document

article

nature genetics • volume 27 • march 2001 263

Dominant-negative mutations of CEBPA,encoding CCAAT/enhancer bindingprotein-α (C/EBPα), in acute myeloidleukemiaThomas Pabst1, Beatrice U. Mueller1, Pu Zhang1, Hanna S. Radomska1, Sailaja Narravula1, SusanneSchnittger2, Gerhard Behre2, Wolfgang Hiddemann2 & Daniel G. Tenen1

The transcription factor C/EBPα (for CCAAT/enhancer binding protein-α; encoded by the gene CEBPA) is crucial for

the differentiation of granulocytes. Conditional expression of C/EBPα triggers neutrophilic differentiation, and no

mature granulocytes are observed in Cebpa-mutant mice. Here we identify heterozygous mutations in CEBPA in

ten patients with acute myeloid leukemia (AML). We found that five mutations in the amino terminus truncate

the full-length protein, but did not affect a 30-kD protein initiated further downstream. The mutant proteins block

wild-type C/EBPα DNA binding and transactivation of granulocyte target genes in a dominant-negative manner,

and fails to induce granulocytic differentiation. Ours is the first report of CEBPA mutations in human neoplasia,

and such mutations are likely to induce the differentiation block found in AML.

1Hematology/Oncology Division, Harvard Institutes of Medicine, Harvard Medical School, Boston, Massachusetts, USA. 2Department of Medicine III, Grosshadern,Ludwig Maximilians University Munich, Munich, Germany. Correspondence should be addressed to D.G.T. (e-mail: dtenen@caregroup.harvard.edu).

IntroductionA number of oncogenes that affect proliferation and cell deathhave been identified in leukemias and other cancers, but rela-tively few differentiation genes have been implicated in themalignant phenotype1–3. In AML the most prominent abnor-mality is a block in differentiation of granulocytic blasts, but thegenetic basis for this differentiation block remains obscure.

The transcription factor C/EBPα is a general inhibitor of cellproliferation and a tumor suppressor4–10. In the hematopoieticsystem, CEBPA is exclusively expressed in myelomonocyticcells11,12. It is specifically upregulated during granulocytic differ-entiation, and conditional expression of CEBPA alone is suffi-cient to trigger neutrophilic differentiation in bipotentialprecursors12. In addition, no mature granulocytes are observedin Cebpa-mutant mice, whereas all the other blood cell types arepresent in normal proportions13. These studies all point to a cru-cial role for CEBPA in neutrophilic lineage development.

The importance of CEBPA for normal granulocytic develop-ment is increasingly understood, but little is known with respectto its possible role in leukemia. Given the phenotype of theCebpa-mutant mouse, we looked for CEBPA mutations in a largecollection of AMLs. Our results demonstrate that CEBPA ismutated in 16% of AML-M2 patients that lack the 8;21 translo-cation. We show that mutations at the N terminus result in a lossof the full-length 42-kD C/EBPα protein, but do not affect a 30-kD form initiated further downstream. This N-terminal muta-tion acts as a dominant-negative inhibitor of full-length CEBPA,in that it affects DNA binding to and transactivation of a directCEBPA target gene, CSF3R (which encodes the colony-stimulat-ing factor-3 receptor, also known as the G-CSF receptor). Ourfindings indicate that CEBPA has a role in both normal myeloiddifferentiation and leukemogenesis.

ResultsHeterozygous mutations of CEBPA in AML patientsTo screen for mutations, the coding region of CEBPA was amplifiedby PCR and sequenced. We identified 10 of 137 AML patients(7.3%) to have at least one mutation of CEBPA (Table 1). Cytoge-netic analysis of 7 of these 10 patients revealed no karyotype abnor-malities. Therefore, mutations in CEBPA represent the onlygenomic alteration so far detected in these particular AML patients.

Wild-type alleles were identified in all DNA samples contain-ing mutations of CEBPA, except in that from patient 22, inwhich each allele carried one of two different mutations. Theratio of mutant to wild-type allele detected varied between 33%(patient 6) and 60% (patient 43). Therefore, we concluded thatmutations in CEBPA in AML patients are heterozygous.Leukemic cells at diagnosis and relapse and remission sampleswere available from one patient (116) with a CEBPA mutation.The mutation was present at diagnosis and at relapse, but not inthe remission sample; thus the mutation was somaticallyacquired. To test whether mutations in CEBPA are a randomevent in humans, we sequenced DNA from peripheral blood of32 healthy volunteers. One volunteer showed an alteration atamino acid 88 (CAG→CAA; both codons encode glutamine).Therefore, we found no evidence that mutations encoding analtered C/EBPα protein occur in normal mature leukocytes.

N-terminal mutations in CEBPA form truncated proteinsand enhance the production of a 30-kD, carboxy-terminal form

We identified five mutations at the N terminus (Table 2). Theframeshift deletions found in patients 10, 22*, 116 and 137 pro-duced a truncated protein of 159 amino acids (Fig. 1). This 20-kDprotein was in vitro translated from expression plasmids of these

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co

m© 2001 Nature Publishing Group http://genetics.nature.com

article

264 nature genetics • volume 27 • march 2001

four mutants (Fig. 2a). It repre-sents a novel finding in malig-nant cells from these AMLpatients. In addition, a 30-kDprotein was seen in all patientscarrying N-terminal mutations.This protein is generated by useof an alternative initiationcodon at amino acid 120 withinthe same reading frame14–16.The truncation of the full-length protein in patients 10,22*, 116 and 137 increases theformation of this 30-kD proteinby 4.2-fold (137) to 8.6-fold(116) compared with theamount of 30-kD protein seenin people without the mutation.To demonstrate these proteinsin vivo, wild-type and mutant expression plasmids were transientlytransfected into CV1 cells that lack endogenous C/EBPα.Immunostaining with an antibody raised against amino acids253–265 of C/EBPα detected the 30-kD protein (Fig. 2b). Stainingof the same blot using an antiserum directed against the first 14amino acids of C/EBPα showed the 20-kD protein in the N-termi-nal mutants, but did not detect the 30-kD protein (Fig. 2c,d).

Finally, to confirm that the relative ratio of 30-kD to 42-kDC/EBPα was also increased in primary leukemic cells, we carriedout western-blot analysis using samples from AML patients withand without N-terminal mutations. In contrast to transfectedCV1 cells, a greater relative abundance of the 30-kD form wasobserved in primary cells of patients with mutations (Fig. 2d).For example, in patient 10, the ratio of 30-kD to 42-kD C/EBPαwas 5.8-fold, whereas equal intensities of the bands were seen inCV1 cells if plasmids carrying wild-type CEBPA and those car-rying the 263–269del mutant are co-transfected at a 1:1 ratio.

Mutated C/EBPα proteins in AML patients showdecreased DNA bindingWe have previously shown that CEBPA is the predominantCEBP form in unstimulated myeloid cells binding to a func-tional region at bp –57 to –38 of the CSF3R promoter17. Herewe used gel-shift and supershift assays to compare the DNA-binding ability of mutant C/EBPα with that of wild-type pro-tein. All N-terminal mutants, as well as mutant1196–1197ins143bp, have a reduced DNA-bindingpotential with the residual binding complex migrat-ing more slowly (Fig. 3a). In addition, the C-terminalmutants 1080–1081insAGA and 640del fail to bind atall. The finding of decreased DNA binding of the N-terminal mutants is unexpected because thesemutants produce the 30-kD protein containing anintact basic zipper region for DNA binding anddimerization. Therefore, we designed constructs toencode either the 20-kD N-terminal protein or the30-kD protein of the 263–269del mutant alone. The20-kD protein alone does not bind to the CEBPA sitein the CSF3R promoter (Fig. 3b). Compared withwild-type protein, the 30-kD protein showed a seven-fold decrease in DNA binding, similar to mutant pro-tein 10, which represents a combination of 30-kD and20-kD proteins. Therefore, we conclude that thehuman 30-kD C/EBPα form alone has lost most of itsability to bind to the CSF3R promoter, whether ornot the 20-kD protein is present.

Deficiency in DNA binding of CEBPA mutants is adominant-negative effectPatients with mutations in CEBPA are genotypically heterozygous.Moreover, Cebpa+/– mice show no phenotypic defect in granu-lopoiesis13. Therefore, if the mutated CEBPA genes block differen-tiation of leukemic blast cells, we predicted that they would act asdominant-negative mutants. When combined at a 1:1 ratio, invitro translated mutant 263–269del and wild-type proteinsresulted in 19% of the DNA binding seen with the wild-type alone(Fig. 3b). The same effect was seen for the 30-kD protein if it wastranslated in the presence of wild-type CEBPA, whereas the 20-kDprotein did not inhibit wild-type DNA-binding function. In addi-tion, this dominant-negative effect was demonstrated for all N-ter-minal mutant proteins if a constant amount of wild-type plasmidwas translated with an increasing amount of mutant plasmid (Fig.3c). Finally, to verify these findings we tested the DNA-bindingability of nuclear extracts of cells from patients with mutations. Asufficient number of malignant cells collected at the time of diag-nosis were available for four patients with N-terminal mutations(Fig. 3d). We compared the binding of mutant extracts with that ofcells prepared from two AML-M2 patients lacking mutations inCEBPA. Binding to CSF3R site was reduced for all four mutantscompared with AML-M2 patients without mutations in CEBPA.These in vivo findings in primary cells support the concept that theN-terminal C/EBPα mutant proteins exert a dominant-negativeeffect on wild-type DNA binding.

Table 1 • 7.3% of AML patients have CEBPA mutations

Karyotype KaryotypeAML subgroup normal Mutation abnormal Mutation

M0 1 1 0 0 0M1 8 3 1 5 1a

M2 62 30 5 19 t(8;21) 013 variousb 2c

M3 22 0 0 22 t(15;17) 0M4 32 9 0 22 inv(16) 0

1 variousd

M5 5 5 0 0 0sec. AMLe 7 7 1f 0 0

total 137 55 7 82 3

The AML subgroups M0 to M5 are according to the FAB classification. aThis patient had a 47,XXY karyotype (43).). bTheabnormalities were one del(9)(q21), one del(9)(q22q34), one t(6;9), one t(10;21)(p11;q22), one del(7)(q22q34), one +8,one +14, and four complex abnormalities. cThese patients had a 46,XY,del(12)(p11.2) karyotype (115) and complexabnormalities (128). dThis patient had a complex karyotype abnormality. eAML in these patients evolved from amyelodysplastic syndrome (6 patients) or fafter Hodgkin disease (subtype unknown).

Table 2 • Mutations in the CEBPA coding region in AML patients

Patient FAB Base pair change Amino acid change Age

10 sec. AML 263–269del P39fsX159 42 y22* M1 255–279del G36fsX159 73 y103 M2 640del R165fsX317 66 y116 M2 395del F82fsX159 56 y137 M2 263–269del P39fsX159 49 y6 M2 1196–1197ins143bp V351fsX366 76 y22” M1 1080–1081insAGA K312–313ins 73 y43 M1 297G>T E50X 67 y128 M2 400A>T H84L 70 y115 M2 719C>T H191H 64 y119 M2 602G>A A152A 53 y

We detected five deletions (del), two insertions (ins) and four point mutations. All deletionscaused a shift into the same alternative reading frame, as the number of missing base pairs is(3n+1). The insertion in patient 6 was a repeat of the previous 143 bp (positions 1054–1196).The insertion in patient 22 introduces into the CAG sequence of aa 312 the 3 bp AGA, whichresults in the sequence CAGAAG, creating an additional lysine at aa 313, whereas aa 312remains unchanged. Sequence numbering is according to ref. 28. The mean age at diagnosis ofthe patients with CEBPA mutations was 66 years.

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co

m© 2001 Nature Publishing Group http://genetics.nature.com

article

nature genetics • volume 27 • march 2001 265

C/EBPα mutant proteins are localized in the nucleusWild-type C/EBPα is a nuclear protein4. We determined whetherabnormal localization of mutant C/EBPα proteins identified inAML patients might explain the dominant-negative effects onDNA binding. C/EBPα immunostaining revealed that all N-ter-minal mutants localized to the nuclei of transfected cells, andtheir staining pattern was indistinguishable from that generatedby intact C/EBPα (Fig. 4). Cells co-transfected with wild-typeand mutant plasmids also exhibited nuclear staining. Therefore,the effects of CEBPA mutants on wild-type function are notmediated by aberrant localization of C/EBPα protein.

Transactivation potential is deficient in CEBPA mutationsAlthough these studies established that the mutant C/EBPα pro-teins act as dominant-negatives for DNA binding, it was possiblethat they would not inhibit transactivation. Therefore, we alsodetermined their effect on CEBPA transactivation through aGCAAT site in the CSF3R promoter17. In CV1 cells, wild-typeCEBPA activated this promoter to a level 10.5-fold greater than thatobtained with the pcDNA3 vector alone (Fig. 5a). The N-terminalmutant proteins lost 79% (255–279del) to 84% (263–269del) oftheir transactivation function. The C-terminal mutant constructs

showed heterogeneous results. The point mutation carried bypatient 128 did not affect the ability of the protein to activate thepromoter, whereas the insertion mutations carried by patients 6and 22” reduced the potential of the resultant proteins to 60% and2%, respectively. The promoter activity for the mutant 640del wasincreased by threefold compared with wild-type CEBPA. Thismutant also increased the activity of the empty luciferase vector(pTK81) ninefold, whereas no activation was observed for the othermutants or the wild type (data not shown). We identified loss of theability to activate a target gene promoter as another functional con-sequence of all but two of the CEBPA mutations in AML patients.

The deficiency in transactivation of the N-terminalmutants is a dominant-negative effect mediated by the30-kD form of CEBPA

The CEBPA mutations in AML patients are genotypically het-erozygous. We determined whether the presence of a mutantC/EBPα protein affects the transactivation ability of the wild-type protein. We transfected a constant amount of wild-typeplasmid with an increasing amount of mutant plasmid (Fig. 5b).We ensured that these experiments were carried out under non-saturating conditions by mixing 10 ng of wild-type plasmid(which activates 6-fold with 10 ng and 10.5-fold with 20 ng com-pared with vector alone) with increasing amounts of mutantplasmid. We found that the presence of each of the five N-termi-

Fig. 1 Diagrammatic representation of proteins encoded by wild-type andmutant CEBPA alleles. (In this and other figures, proteins are referred to by thepatient numbers (see Table 2).) a, Locations of the peptides used to produce N-ter-minal (N’ab) and C-terminal (C’ab) specific antisera, the amino acids correspond-ing to transactivation domains 1 (TAD1) and 2 (TAD2), and the basic zipperdomain4,30–32 (bZip). Shown below the diagram are the in-frame initiation codonsat amino acids 1 and 120 encoding proteins of 42 and 30 kD, whereas the two ATGcodons at amino acids 15 and 218 are not used efficiently. b, Proteins encoded bythe five N-terminal mutants. The mutant peptide contains wild-type CEBPAsequence (white bar) followed by a new stop codon (297G>T, ‘43’), or a shift ofthe reading frame encoding a novel peptide before termination at aa 159, as wellas the 30-kD C-terminal protein. 255–279del (‘22*’) and 1080–1081insAGA (‘22”’)represent the two alleles in patient 22; all other patients have a heterozygousgenotype. c, The four C-terminal mutants. The point mutation 400A>T (‘128’), andthe insertion mutations 1196–1197ins143bp (‘6’) and 1080–1081insAGA (‘22"’)show a protein pattern identical to that of wild-type CEBPA. Regardless of the143-bp insertion in 6, no differences in apparent molecular weight were detected,as a shift of the reading frame results in a stop codon at aa 15 of the insertion,consistent with a net insertion of only 7 aa. The deletion in mutant 640del (‘103’)causes a frameshift downstream of the mutated site with a stop codon at aa 317.

Fig. 2 Identification of proteins encoded by wild-type and mutated CEBPA alle-les in vitro and in vivo. a, Proteins translated in vitro in the presence of 35S-labeled methionine from wild-type (wt) and mutant CEBPA expressionplasmids were electrophoresed and detected by autoradiography. b,c, Westernblots of CV1 cells collected after transient transfection with plasmids express-ing either wild-type or mutated CEBPA. Lysates were stained with either anantiserum directed against the C terminus of C/EBPα (C’ab) (b) or with an anti-body raised against the first 14 aa of C/EBPα (N’ab) (c). The 30-kD protein initi-ated at aa 120 is detectable only with the C’ab, as is an artificial mutantencoding this protein (C’30), whereas only the N’ab detects the 20-kD proteinin the N-terminal mutants. The 42-kD protein is recognized by both antibodies.CV1, untransfected cells; V, pcDNA3 vector alone. d, Left, western blots stainedwith a C/EBPα antiserum (C’ab) of lysates from CV1 cells transiently transfectedwith equal amounts of CEBPA wild-type, mutant 263–269del (“#10”), the 30-kDform (“C’30”), or with mixtures of the plasmids. Middle, western blots fromlysates from three patients with N-terminal mutations (10, 22 and 116) and twoAML-M2 patients with a normal karyoptype (“A”, “B”) stained with the sameCEBPA antibody (C’ab). Right, western blot from lysates of patient 22 stainedwith the N’ab, detecting the 20-kD truncated protein after prolonged expo-sure time.

a

b

c

a

b

c

d

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co

m© 2001 Nature Publishing Group http://genetics.nature.com

Fig. 3 DNA binding of C/EBPα mutant proteins and inhibition of wild-typeC/EBPα binding. a, The ability of in vitro translated C/EBPα mutant proteins tobind to the CEBP site of CSF3R was compared with that of wild-type (wt) pro-tein. Also indicated are competitor oligonucleotides (“self” and “GATA”) usedin 100-fold molar excess and C/EBPα antiserum (“ab”) or normal rat serum(nrs). P, probe alone; u, unprogrammed lysate used for in vitro translation; ss,supershifted band; CEBPA, shifted band; x, band which can not be supershiftedwith C/EBPα antibody17. b, The C-terminal 30-kD protein inhibits C/EBPα DNAbinding. The diagrams at the top show the structure of the proteins encodedby wild type (wt), mutant 263–269del (#10), the 30-kD protein (C’30), and the20-kD N-terminal peptide encoded by the mutant 263–269del allele (N’20). Thewild-type gene encodes mostly the 42 kD form; mutant 263–269del, both the20 and 30 kD forms in approximately 1:1 ratio. The location of the prematurestop codon in mutant 263–269del is indicated (∇ ), as well as that of the peptideused to generate the antiserum (♦ ). Novel sequences in mutant 263–269del areindicated by a thin rectangle, and the bZip domain, by a black rectangle. Wild-type or mutant C/EBPα proteins were in vitro translated either separately or ina 1:1 molar ratio as indicated above each lane. p, probe alone; u, unpro-grammed lysate; ss, supershifted band; CEBPA, shifted band. c, Wild-typeC/EBPα DNA binding is inhibited by C/EBPα mutant protein in a dominant-neg-ative manner. Wild-type CEBPA plasmid was mixed with increasing amounts ofmutant CEBPA plasmid (0, 0.5, 1, 2 and 3 µg) and in vitro translated beforeEMSA analysis. Inhibition of wild-type binding is shown for the N-terminalmutant 263–269del (#10) and for the C-terminal mutant 1196–1197ins143bp(#6). p, probe alone; +self, competition with unlabeled self oligonucleotide in100-fold excess; u, unprogrammed lysate used for in vitro translation. Similarresults were obtained for the other N-terminal mutants (not shown). d, Leukemic cells from AML patients with CEBPA mutations are deficient in DNA binding to CSF3R. DNA binding of nuclear extracts from primary cells of fourAML patients with N-terminal mutations and two AML-M2 patients with no CEBPA alterations (A, B). U937 cells served as a positive control, and K562 cells as anegative control for C/EBPα binding. “Self” indicates competition with 100-fold excess cold self oligonucleotide. “Antibody” refers to supershift with C/EBPαantibody. The free probe was run off the gel to optimize separation of the C/EBPα shift and supershift (“ss”).

article

266 nature genetics • volume 27 • march 2001

nal mutants decreased the promoter activity. A 2:1 ratio ofmutant to wild-type plasmid reduced the promoter activity tolevels seen with mutant plasmid alone. Neither the 30-kD nor the20-kD peptide, nor both (263–269del), showed transactivation.When used at a 1:1 ratio, only the 30-kD protein inhibited wild-type C/EBPα (Fig. 5c). Therefore, the 30-kD peptide, normallymade in low amounts compared with the 42-kD form, can act asa dominant-negative of wild-type transactivation whenexpressed at levels equal to or greater than the 42 kD form, as isthe case in AML patients (Fig. 2d).

Conditional expression of the 263–269del mutant inmyeloid precursor cells fails to induce granulocyticdifferentiationWe previously showed that induced expression of wild-typeC/EBPα protein is sufficient to induce neutrophilic differentia-tion in U937 cells12. Therefore, we determined whether CEBPAmutations identified in AML patients have lost this potential. Weestablished two U937 cell lines that conditionally expressed eitherwild-type C/EBPα protein or the peptides of mutant 263–269delusing the Tet-Off system (Fig. 6a). Induction of either the mutant263–269del or the wild-type protein in these cells changes the 42kD to 30 kD ratio so that it is similar to what is seen in patient cells(Fig. 2d). Expression of exogenous wild-type C/EBPα induced

granulocytic differentiation of U937 cells at day 17 after with-drawal of tetracycline (Fig. 6b–e). This is consistent with our pre-vious findings using the zinc-inducible metallothionein system12.In contrast, conditional expression of mutant 263–269del did notresult in differentiation of the cells, as no morphological changeswere observed after withdrawal of tetracycline. These experimentsdemonstrate that CEBPA mutant 263–269del has lost the poten-tial to trigger granulocytic differentiation.

We also determined whether induction of CEBPA mutant263–269del expression fails to increase the expression of CEBPAtarget genes12. We analyzed the expression of G-CSF receptor, agranulocyte-specific marker, before and two days after withdrawalof tetracycline. No increase in G-CSF receptor expression wasobserved after induction of mutant 263–269del, whereas a signifi-cant upregulation was seen after expression of exogenous C/EBPαwild-type protein (Fig. 6f,g). Finally, we asked whether the mutantC/EBPα protein blocks the ability of the endogenous protein toinduce the expression of CEBPA target genes such as CSF3R. Wetherefore treated the U937 cells two days after withdrawal of tetra-cycline for another two days with 1 µM retinoic acid (ATRA). Themutant 263–269del protein completely blocked upregulation of G-CSF receptor expression following the treatment with ATRA (Fig.6g,h). Therefore, increasing the ratio of 30-kD to 42-kD proteinblocked induction of G-CSF receptor.

a b

c

d

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co

m© 2001 Nature Publishing Group http://genetics.nature.com

article

nature genetics • volume 27 • march 2001 267

DiscussionOurs is the first report to describe mutations of the tumor-suppres-sor gene CEBPA in malignant cells of patients with cancer. Wefound ten AML patients with mutations of CEBPA. Seven of thesepatients had an otherwise normal karyotype as assessed by conven-tional karyotype analysis. Because the total number and the meanfollow-up of the patients with CEBPA mutations are limited, nostatements in terms of the prognostic significance of these muta-tions are possible. We did not find mutations in 19 patients witht(8;21), 22 patients with the PML/RARA translocation, 22 patientswith INV(16) or peripheral blood from healthy volunteers. Ourresults indicate that mutations in CEBPA define a distinct subgroupof AML patients, and that detection of CEBPA mutations may be ofpossible prognostic importance.

We identified CEBPA mutations in two patients of the M1 andseven patients of the M2 subtype, and one patient had a sec-ondary AML. The AML-M1 and M2 subgroups describe imma-ture myeloid cells. These subtypes mirror the myeloblastic cellsseen in Cebpa–/– mice, which lack mature granulocytes but retainall other blood cell types, including monocytes and peritoneal

macrophages13. Moreover, we previously reported that condi-tional expression of CEBPA alone is sufficient to trigger neu-trophilic differentiation in myeloid precursor cells12. Therefore,myeloid blast cells harboring CEBPA mutations appear to lackthe signal crucial for neutrophilic differentiation and conse-quently accumulate at the myeloblastic stage.

We were able to identify mutations in CEBPA in AML, whereasa previous study failed to observe such mutations in the relatedprotein CEBPE (C/EBPε; ref. 18). These results are consistentwith gene-targeting studies showing that disruption of CEBPAfunction results in an early block in granulocyte differentiation,whereas the Cebpe mutants are blocked at a very late stage19.Mutations in CEBPE have been detected in patients with sec-ondary granule deficiency20, in which primary but not secondarygranule protein genes are expressed, which is precisely what isobserved in Cebpe-mutant animals21. Thus, mutations in CEBPAand CEBPE are observed in human diseases with phenotypes

Fig. 4 Wild-type and mutant C/EBPα proteins are localized to the nucleus. CV1cells were transiently transfected with plasmids carrying wild type or mutantCEBPA, and stained with specific antiserum after 48 h. Wild-type C/EBPα (wt) andthe mutant proteins identified in AML patients demonstrated diffuse nuclearstaining, whereas untransfected CV1 cells did not show specific staining.

Fig. 5 Transactivation potential of mutated CEBPA versus wild type. a, CV1 cells were transiently transfected with 20 ng of each mutant expression plasmid, anamount giving maximal transactivation by wild-type C/EBPα of the reporter, a tetramer of the CEBP site of the CSF3R promoter. As mutant 640del activated thepromoter construct 30-fold, its bar graph is not drawn to the same scale as the others. Transactivation results of the luciferase assay are presented compared withthe pcDNA3 expression vector alone (“V”=1.0) and are normalized for transfection efficiency by measuring β-galactosidase activity from the co-transfected CMV-LacZ construct. The bars represent mean values of three repetitions. The error bars denote standard deviation. b, CEBPA N-terminal mutants inhibit the transac-tivation potential of the wild-type protein in a dominant-negative manner. Wild-type and mutant plasmids were co-transfected into CV1 cells as indicated. Wechose to use 10 ng of wild-type and 20 ng of mutant plasmid because these dosages result in relative ratios of 42-kD to 30-kD proteins observed in patients. c, TheC-terminal, 30-kD form (“C’30”), but not the N-terminal, 20-kD (“N’20”) truncated protein, inhibits wild-type C/EBPα transactivation. CV1 cells were transientlytransfected with 10 ng of the pcDNA3 vector (“V”), wild type (“wt”), mutant 263–269del (“#10”), C’30, or N’20 plasmid. Equal transfection efficiencies aredemonstrated in western blots from parts of the lysates as shown in Fig. 2d.

a

b

c

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co

m© 2001 Nature Publishing Group http://genetics.nature.com

similar to or predictable from the phenotypes of the mutantmice. Moreover, we predict that small, cytogenetically unde-tectable mutations in other myeloid transcription factors willhave a role in the pathogenesis of other AMLs. Indeed, a previousstudy reported point mutations in the runt domain of RUNX1(previously AML1) in 8 of 160 leukemia patients22.

We identified five patients with an N-terminal truncation ofthe full-length, 42-kD CEBPA form, whereas a 30-kD form wasdetected at an increased level compared with the amount of thisform seen with the wild-type plasmid. These findings supportthe concept that CEBPA forms detected with monospecific anti-bodies are alternative products translated from several in-frameinitiation codons by a leaky ribosome-scanning mecha-nism14–16,23. These forms exhibit antagonistic activities24; forexample, it was previously shown that the 42-kD protein is apowerful transactivator of target genes during adipocyte differ-entiation and has anti-proliferative activities for preadipocytesand mouse hepatoma cells6,9. In contrast, the 30-kD form has noantimitotic activity25 and lacks most of its transactivation abil-ity15,16. The ratio of 42-kD to 30-kD protein seems to be biologi-cally significant, as similar ratios of 42-kD and 30-kD CEBPAprotein are found in Xenopus laevis, chicken, rat, mouse andhuman hepatoma cell nuclei16. Prevalence of the 42-kD formoccurs in CEBPA-expressing tissues such as liver, lung and smallintestine15, and is also seen for proteins derived from wild-typeplasmids (Fig. 2). Obviously, the ratio between the two forms isgrossly changed in the 5 heterozygous N-terminal mutations inwhich the 42-kD form is deleted in the mutated allele.

We used the ability of CEBPA to bind to a direct target gene,the CSF3R promoter, to test the functional significance of muta-tions identified in AML patients17. We found that the DNA-bind-ing ability was decreased for the five N-terminal mutations as

well as three of four mutations at the C terminus.Two mechanisms for the decrease in DNA bindingwere revealed: (i) a predominant 30-kD form dueto deletion of upstream sequences; and (ii) muta-tions in the DNA-binding domain itself. In view ofthe fact that the mouse 30-kD protein is reportedto bind DNA efficiently in liver14,15,25, the human30-kD form, which is formed together with atruncated 20-kD protein in the N-terminal muta-tions, bound DNA only with 14% compared withthe full-length protein in reticulocyte lysates andAML cells. Thus, in terms of DNA binding, thehuman 30-kD form obviously differs from therodent or chicken equivalent. This decrease was

also observed if wild-type and mutant protein were tested in acompetitive assay. The 20-kD protein neither bound DNA alonenor inhibited wild-type binding, and therefore the 30-kD form isthe inhibitor of wild-type function. We were unable to demon-strate the presence of 42 kD/30 kD heterodimers in this gel-shiftassay. Thus, the mechanisms by which the 30-kD CEBPA proteinaffects wild-type DNA binding and why the other mutants aredysfunctional are not completely understood.

The decrease in DNA binding to the CSF3R promoter as seenin in vitro assays was verified in vivo by studying malignantcells of four patients with N-terminal mutations. Cells of thesepatients showed a marked relative increase in the amount ofthe 30-kD form. Because as little as threefold changes inCEBPA 42-kD protein are sufficient to induce differentiationof myeloid cell lines12, it is likely that the changes we observe invivo are sufficient to explain the block in differentiation inthese patients with AML.

Human CEBPA is located at chromosome 19q13.1, which isnot a site of frequent chromosome translocations in leukemia1,26.The finding of dominant-negative CEBPA forms might explainwhy CEBPA, a gene found to be crucial for myeloid development,has not been described so far as a translocation partner. Thetranslocation process usually truncates a gene and fuses it to(parts of) a partner gene to create a dominant fusion product. InCEBPA the potential to create a new dominant-negative form hasbeen evolutionarily conserved, and uncovered by the five N-ter-minal mutations identified in AML patients.

Conversely, if interruption of CEBPA function is an impor-tant step in induction of myeloid leukemia, then we predictthat, in other AML subtypes, other mutant gene products willadversely affect CEBPA function. Indeed, this has been shownto be the case in those AML subtypes harboring the t(8;21)

Fig. 6 Conditional expression of CEBPA mutant 263–269delfails to induce granulocytic differentiation and expressionof CEBPA target genes in myeloid precursor cells. a, A west-ern blot stained for the C terminus of C/EBPα of U937 cellsfor CEBPA wild type (wt), mutant 10 (mut), and the vectoralone (V). +, cells under continued tetracycline application;–, cells four days after withdrawal of tetracycline. Weinduced either wild-type C/EBPα (b,c) or mutant 263–269delprotein (d,e) in U937 cells. No phenotypic differences weredetectable under continued tetracycline application in thewild-type line (b) compared with the mutant 263–269delline (d). Induction of wild-type CEBPA protein results in neu-trophilic differentiation at day 17 after withdrawal of tetra-cycline (c), whereas induced expression of mutant263–269del protein fails to induce differentiation (e). N, cellwith the appearance of a polymorphonuclear granulocyte.G-CSF receptor expression was measured by FACS undertetracycline (f), two days after withdrawal of tetracycline(g), and after two additional days of treatment with 1 µMATRA (h). Mut, U937 cells with the inducible mutant263–269del protein incubated with biotinylated recombi-nant human (rh) G-CSF; Wt, U937 cells with inducible C/EBPαwild-type protein incubated with biotinylated rh G-CSF.

article

268 nature genetics • volume 27 • march 2001

a

b c

d ef g h

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co

m© 2001 Nature Publishing Group http://genetics.nature.com

article

nature genetics • volume 27 • march 2001 269

(ref. 27) or t(15;17) fusion proteins (T. Lodie et al., manuscriptsubmitted). In t(15;17) cells, a non-mutant C/EBPα protein isexpressed at normal levels, but the PML/RARα fusion proteinabolishes CEBPA DNA binding by altering nuclear localiza-tion. In t(8;21) leukemias, CEBPA is also not mutated, but itsexpression is selectively downregulated by the AML1–ETOtranslocation fusion protein (T.P. et al., manuscript submit-ted). Finally, we anticipate finding alterations in CEBPA inother human neoplasms involving tissues in which C/EBPα isexpressed, including lung, liver, fat and prostate.

MethodsPatient samples. We obtained patient samples from the Department ofMedicine III, Grosshadern. All patients were included in study protocolsconducted by the German AML Study Group between January 1996 andApril 1998. Samples were collected at time of diagnosis before initiation oftreatment and were obtained from bone marrow or peripheral blood. Thepercentage of blasts in the samples was in general greater than 90%. DNAwas available from 137 AML patients and 32 healthy volunteers.

PCR and sequencing. We designed two overlapping primer pairs (PP) toamplify the entire coding region of human CEBPA including 30 bp of the 5´UTR and 94 bp of the 3´ UTR (sequences according to ref. 28): PP1 (550bp), 5´–TCGCCATGCCGGGAGAACTCTAAC–3´ and 5´–CTGGTAAGGGAAGAGGCCGGCCAG–3´; for PP2 (680 bp), 5´–CCGCTGGTGATCAAGCAGGA–3´ and 5´–CACGGTCTGGGCAAGCCTCGAGAT–3´. Fouralternative primer pairs were used in cases of abnormal or ambiguousresults: PP3 (290 bp), 5´–TCGCCATGCCGGGAGAACTCTAAC–3´ and5´–ACGGCCGCCTTGGCCTTCTCCTGCT–3´; PP4 (279 bp), 5´–CTTCAACGACGAGTTCCTGGCCGA–3´ and 5´–AGCTGCTTGGCTTCATCCTCCT–3´; PP5 (371 bp), 5´–CCGCTGGTGATCAAGCAGGA–3´ and5´–CCGGTACTCGTTGCTGTTCT–3´; and PP6 (539 bp), 5´–CCGCACCTGCAGTTCCAGAT–3´ and 5´–CACGGTCTGGGCAAGCCTCGAGAT–3´. PCR reactions were carried out in a final volume of 50 µl containinggenomic DNA (100 ng), KCl (50 mM), Tris-HCl (20 mM, pH 8.4), MgCl2(2.5 mM), 5 vol% DMSO, primers (2 µM of each), nucleotides (0.1 mM ofeach) and Taq DNA polymerase (1.25 U; Gibco BRL). Samples wereprocessed through 35 cycles at 94 °C for 60 s, 62 °C for 40 s, and 72 °C for90 s, with a final step for 10 min at 72 °C. PCR products were elec-trophoresed on agarose gels, purified (Qiagen) and sequenced usingBigDye Terminators and AmpliTaq FS (Perkin Elmer ABI). Abnormalsequencing results were repeated three times in both directions, includingrepetitions of PCR and sequencing with an alternative pair of PCR primers.Abnormal PCR products were subcloned into the pGEM-T vector(Promega), and clones were subsequently sequenced.

Constructs. Wild-type and mutated CEBPA were subcloned between theHindIII and XhoI sites of the pcDNA3 expression vector. The 30 kD C-ter-minal construct (C’30) was a HindIII-AscI deletion of wild-type CEBPA,and the 20-kD N-terminal construct (N’20) was a BstX-XhoI fragmentderived from mutant 263–269del, all in pcDNA3. Wild-type and mutant263–269del CEBPA were subcloned between the EcoRI and BamHI sites ofthe pUHD10-3 vector, under the control of the tetracycline-responsive tTAtransactivator (Tet-Off). In addition, a neomycin resistance gene was sub-cloned into this construct. Using neomycin for selection, we transfectedthese constructs as described12 into the U937 cell line (provided by G.Grosveld), which was stably transfected with the tTA gene.

Immunoblotting. We transfected 5×105 CV1 cells with expression plasmid(1 µg) using Lipofectamine (Gibco), and collected them after 48 h. Cellswere lysed in RIPA buffer as described12. Protein extracts were fractionatedon SDS-12% polyacrylamide gels and transferred to nitrocellulose mem-branes by electroblotting. We detected C/EBPα proteins with either rabbitanti-rat C/EBPα polyclonal serum (1:1,000; Santa Cruz) raised against aa257–270 of the rat C/EBPα protein, or with rabbit polyclonal antiserum(1:2,000; provided by C. Nerlov) raised against the first 14 aa of C/EBPα.An anti-rabbit IgG-horseradish peroxidase (HRP) conjugated secondaryantibody was used (Santa Cruz). A monoclonal anti-mouse β-tubulin anti-body served as a loading control (Boehringer), with an anti-mouse Ig-HRP

conjugated secondary antibody (Amersham).

Electrophoretic mobility shift assay. Wild-type and mutant C/EBPα proteinswere in vitro translated from pcDNA3 constructs with the TnT T7-coupledreticulocyte lysate system (Promega). To compare translation efficiencies, thereaction was also performed in the presence of 35S-labeled methionine, and invitro translated proteins were run on a SDS-12% polyacrylamide gel, driedand placed on X-ray film. Preparation of nuclear extracts and binding reac-tion have been described17. The CSF3R promoter oligonucleotide (bp –57 to–38 with CEBP binding site underlined) had the sequence 5´–AAGGTGTTGCAATCCCCAGC–3´ (ref. 17). Competition with nonself oligonucleotide wasperformed using a 19mer oligonucleotide (GGGCAACTGATAAGGATTC)containing a GATA binding site. For supershift experiments, CEBPA poly-clonal rabbit serum (2 µl; Santa Cruz) was added. Reactions were elec-trophoresed at 10 V/cm on a 4% polyacrylamide gel in 1×TBE (45 mM Tris-borate, 1 mM EDTA) at 4 °C. Quantitation of EMSA bands was performedusing Imagequant software (Molecular Dynamics).

Immunolocalization. We plated 2×104 CV1 cells onto glass coverslips,and transfected them after 24 h using Lipofectamine (Gibco). After 24 h,coverslips with transfected CV1 cells were fixed for 10 min in 250 µl His-tochoice Tissue Fixative (Sigma) per slide, washed twice for 10 min inPBS, and permeabilized with 0.1% Triton X-100 in PBS for 5 min. Slideswere incubated with a 1:100 dilution of the C/EBPα antibody (SantaCruz) for 1 h, washed twice for 10 min, and incubated for 1 h with a1:100 dilution of FITC-conjugated anti-rabbit IgG (Santa Cruz). Slideswere mounted in ProLong Antifade (40 µl; Molecular Probes) andexamined under epifluorescent illumination.

Transient transfections. We seeded 2×104 CV1 cells in 24-well dishesand transfected after 24 h using Lipofectamine (Gibco) with reporterplasmid (200 ng; tetramer of the CEBP site of CSF3R inserted into thepromoterless luciferase vector pTK81-luc), expression vector (20 ng)and CMV-LacZ construct (40 ng). We carried out luciferase assays 24 hpost-transfection as described17,29. Luciferase activities were normalizedfor transfection efficiency with the co-transfected CMV-LacZ construct,using the chemiluminescent reporter gene assay for the detection of β-galactosidase following the manufacturer’s protocol (Tropix). All trans-activation experiments were repeated three times with two differentpreparations of each plasmid. Equal expression levels of the CEBPAderivatives in transfected cells were confirmed by western blot.

FACS analysis. Human recombinant G-CSF (Pharmacia) was biotinylatedusing NHS-LC-biotin (Pierce) following the manufacturer’s procedure. Cellswere incubated in PBS with 2% (w/v) BSA on ice for 1 h with biotinylated G-CSF (50 ng/106 cells). After washing, cells were incubated with PE-conjugatedstreptavidin (1 µg; Pharmacia) in PBS (50 µl) for 30 min on ice, washed andresuspended in PBS with 10% formaldehyde. We analyzed samples on a FAC-Scan flow cytometer (Becton Dickinson) using Cellquest software.

AcknowledgmentsWe thank C. Schoch for assistance with cytogenetic analysis and T. Haferlachfor morphologic analysis of patient samples; members of the Tenenlaboratory, A. Iwama and G. Gilliland for suggestions; L. Clayton for carefulreading of the manuscript; and M. Singleton for assistance with preparationof the manuscript. This work was supported by grants from the SwissNational Science Foundation (81BS-051911 and SSMBS 1011) and the SwissRoche Research Foundation (97-189) (to T.P.), and NIH grants CA72009and HL56745 (to D.G.T.).

Received 5 July; accepted 19 December 2000.

1. Rabbits, T.H. Chromosomal translocations in human cancer. Nature 372, 143–149(1994).

2. Wolff, L. Contribution of oncogenes and tumor suppressor genes to myeloidleukemia. Biochim. Biophys. Acta 1332, F67–104 (1997).

3. Tenen, D.G., Hromas, R., Licht, J.D. & Zhang, D.E. Transcription factors, normalmyeloid development, and leukemia. Blood 90, 489–519 (1997).

4. Landschulz, W.H., Johnson, P.F., Adashi, E.Y., Graves, B.J. & McKnight, S.L. Isolationof a recombinant copy of the gene encoding C/EBP. Genes Dev. 2, 786–800 (1988).

5. Cao, Z., Umek, R.M. & McKnight, S.L. Regulated expression of three C/EBP isoformsduring adipose conversion of 3T3-L1 cells. Genes Dev. 5, 1538–1552 (1991).

6. Lin, F.T. & Lane, M.D. CCAAT/enhancer binding protein α is sufficient to initiate

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co

m© 2001 Nature Publishing Group http://genetics.nature.com

article

270 nature genetics • volume 27 • march 2001

the 3T3-L1 adipocyte differentiation program. Proc. Natl. Acad. Sci. USA 91,8757–8761 (1994).

7. Timchenko, N.A., Wilde, M., Nakanishi, M., Smith, J.R. & Darlington, G.J.CCAAT/enhancer-binding protein α (C/EBPα) inhibits cell proliferation throughthe p21 (WAF-1/CIP-1/SDI-1) protein. Genes Dev. 10, 804–815 (1996).

8. Watkins, P.J., Condreay, J.P., Huber, B.E., Jacobs, S.J. & Adams, D.J. Impairedproliferation and tumorigenicity induced by CCAAT/enhancer-binding protein.Cancer Res. 56, 1063–1067 (1996).

9. Umek, R.M., Friedman, A.D. & McKnight, S.L. CCAAT/enhancer binding protein α:a component of a differentiation switch. Science 251, 288–292 (1991).

10. Hendricks-Taylor, L.R. & Darlington, G.J. Inhibition of cell proliferation by C/EBPαoccurs in many cell types, does not require the presence of p53 or Rb, and is notaffected by large T-antigen. Nucleic Acids Res. 23, 4726–4733 (1995).

11. Scott, L.M., Civin, C.I., Roth, P. & Friedman, A.D. A novel temporal expressionpattern of three C/EBP family members in differentiating myelomonocytic cells.Blood 80, 1725–1735 (1992).

12. Radomska, H.S. et al. CCAAT/enhancer binding protein α is a regulatory switchsufficient for induction of granulocytic development from bipotential myeloidprogenitors. Mol. Cell. Biol. 18, 4301–4314 (1998).

13. Zhang, D.E. et al. Absence of granulocyte colony-stimulating factor signaling andneutrophil development in CCAAT enhancer binding protein α-deficient mice.Proc. Natl. Acad. Sci. USA 94, 569–574 (1997).

14. An, M.R. et al. Evidence for posttranscriptional regulation of C/EBPα and C/EBPβisoform expression during the lipopolysaccharide-mediated acute-phaseresponse. Mol. Cell. Biol. 16, 2295–2306 (1996).

15. Calkhoven, C.F., Bouwman, P.R.J., Snippe, L. & Ab, G. Translation start sitemultiplicity of the CCAAT/enhancer binding protein α mRNA is dictated by a small5´ open reading frame. Nucleic Acids Res. 22, 5540–5547 (1994).

16. Ossipow, V., Descombes, P. & Schibler, U. CCAAT/enhancer-binding protein mRNAis translated into multiple proteins with different transcription activationpotentials. Proc. Natl. Acad. Sci. USA 90, 8219–8223 (1993).

17. Smith, L.T., Hohaus, S., Gonzalez, D.A., Dziennis, S.E. & Tenen, D.G. PU.1 (Spi-1)and C/EBPα regulate the granulocyte colony-stimulating factor receptorpromoter in myeloid cells. Blood 88, 1234–1247 (1996).

18. Koike, M. et al. C/EBP-ε: chromosomal mapping and mutational analysis of thegene in leukemia and preleukemia. Leuk. Res. 21, 833–839 (1997).

19. Yamanaka, R. et al. Impaired granulopoiesis, myelodysplasia, and early lethalityin CCAAT/enhancer binding protein ε-deficient mice. Proc. Natl. Acad. Sci. USA94, 13187–13192 (1997).

20. Lekstrom-Himes, J.A., Dorman, S.E., Kopar, P., Holland, S.M. & Gallin, J.I.

Neutrophil-specific granule deficiency results from a novel mutation with loss offunction of the transcription factor CCAAT/enhancer binding protein ε. J. Exp.Med. 189, 1847–1852 (1999).

21. Lekstrom-Himes, J.A. & Xanthopoulos, K.G. CCAAT/enhancer binding protein ε iscritical for effective neutrophil-mediated response to inflammatory challenge.Blood 93, 3096–3105 (1999).

22. Osato, M. et al. Biallelic and heterozygous point mutations in the Runt domain ofthe AML1/PEBP2αB gene associated with myeloblastic leukemias. Blood 93,1817–1824 (1998).

23. Kozak, M. The scanning model for translation: an update. J. Cell Biol. 108,229–241 (1989).

24. Descombes, P. & Schibler, U. A liver-enriched transcriptional activator protein,LAP, and a transcriptional inhibitory protein, LIP, are translated from the samemRNA. Cell 67, 569–579 (1991).

25. Lin, F.T., MacDougald, O.A., Diehl, A.M. & Lane, M.D. A 30-kD alternativetranslation product of the CCAAT/enhancer binding protein α message:transcriptional activator lacking antimitotic activity. Proc. Natl. Acad. Sci. USA 90,9606–9610 (1993).

26. Hendricks-Taylor, L.R. & Darlington, G.J. The CCAAT/enhancer-binding protein(C/EBP α) gene (CEBPA) maps to human chromosome 19q13.1 and the relatednuclear factor NF-IL6 (C/EBP β) gene (CEBPB) gene maps to human chromosome20q13.1. Genomics 14, 12–17 (1992).

27. Westendorf, J.J. et al. The t(8;21) fusion product, AML-1-ETO, associates withC/EBPα, inhibits C/EBPα-dependent transcription, and blocks granulocyticdifferentiation. Mol. Cell. Biol. 18, 322–333 (1998).

28. Swart, G.W.M., van Groningen, J.J.M., van Ruissen, F., Bergers, M. & Schalkwijk, J.Transcription factor C/EBPα: novel sites of expression and cloning of the humangene. Biol. Chem. 378, 373–379 (1997).

29. Pahl, H.L., Burn, T.C. & Tenen, D.G. Optimization of transient transfection intohuman myeloid cell lines using a luciferase reporter gene. Exp. Hematol. 19,1038–1041 (1991).

30. Nerlov, C. & Ziff, E.B. Three levels of functional interaction determine the activityof CCAAT/enhancer binding protein-α on the serum albumin promoter. GenesDev. 8, 350–362 (1994).

31. Friedman, A.D. & McKnight, S.L. Identification of two polypeptide segments ofCCAAT/enhancer-binding protein required for transcriptional activation of theserum albumin gene. Genes Dev. 4, 1416–1426 (1990).

32. Landschulz, W.H., Johnson, P.F. & McKnight, S.L. The leucine zipper: ahypothetical structure common to a new class of DNA binding proteins. Science240, 1759–1764 (1988).

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://g

enet

ics.

nat

ure

.co

m© 2001 Nature Publishing Group http://genetics.nature.com