dis3745.pdf

Identification, characterization and high-resolution mapping of resistance genes to Phytophthora

infestans in potato

Promotors: Prof. dr. Richard G.F. Visser, Hoogleraar in de Plantenveredeling

Prof. dr. ir. Evert Jacobsen, Hoogleraar in de Plantenveredeling

Promotiecommissie: Prof. dr.ir. P.J.G.M. de Wit, Wageningen Universiteit

Dr. J.H. de Jong, Wageningen Universiteit

Dr. A. Pereira, Plant Research International

Prof. dr. W.J. Stiekema, Plant Research International

Dit onderzoek is uitgevoerd binnen de onderzoekschool Experimental Plant Sciences

Identification, characterization and high-resolution mapping of resistance genes to Phytophthora

infestans in potato

Tae-Ho Park

Proefschrift

ter verkrijging van de graad van doctor

op gezag van de rector magnificus

van Wageningen Universiteit

Prof. dr. ir. L. Speelman

in het openbaar te verdedigen

op woensdag 11 mei 2005

des namiddags te vier uur in de Aula.

3

Identification, characterization and high-resolution mapping of resistance genes to

Phytophthora infestans in potato

Tae-Ho Park

PhD thesis, Wageningen University, The Netherlands, 2005

With references With summaries in English, Dutch and Korean

ISBN 90-8504-189-9

Contents

Chapter 1 General introduction 7

Chapter 2 Dissection of foliage and tuber late blight resistance in mapping populations of potato 19

Chapter 3 High-resolution mapping and analysis of the resistance locus Rpi-abpt against Phytophthora infestans in potato 33

Chapter 4 Characterization and high-resolution mapping of a late blight resistance locus similar to R2 49

Chapter 5 The late blight resistance locus Rpi-blb3 from Solanum bulbocastanum belongs to a major late blight R gene cluster on

chromosome 4 of potato 63

Chapter 6 Genetic positioning of centromeres using half-tetrad analysis in a 4x-2x cross population of potato 81

Chapter 7 General discussion 101

Summary 119

Samenvatting 123

Summary in Korean 127

Acknowledgements 131

Curriculum vitae 134

5

Chapter 1

General introduction

Chapter 1

Potato The cultivated potato Solanum tuberosum L. that originated from the Andean region of South America is one of the most important food crops in the world. Potato was first domesticated and eaten by man in South America particularly in the region of the Andes about 8,000 years ago. It was probably introduced into Europe from South America more than four centuries ago when the Spanish invaded the Inca Empire. The native potato cultivars that were introduced were day-length sensitive, which means that tuber formation was inhibited by a day-length longer than 12 hours. After many generations of natural selection in Western Europe, the potato became adapted to the long days of the western hemisphere (Hawkes, 1978 and 1994; Brown, 1990).

Potato is ranked at the fourth place in the world food production after wheat, corn and rice. Of the root crops, it is on the top of the list, followed by cassava, sweet potato and yams. Potato is very productive and nutritious. Compared with wheat and rice, the potato has an approximately five times higher crop yield per hectare and one and half times more energy production per ha and day (Struik and Wiersema, 1999). Potato is also an important source of starch and contains high quality protein and vitamin C. Moreover, potato can be grown widely under various climatic conditions such as tropical, sub-tropical and temperate environments and in various altitudes because of its high adaptation ability (Doehlonan and Sleper, 1995). Purposes for growing potato are also very diverse such as for fresh potato consumption, starch production, chips and French-fries.

Potato belongs to the Solanaceae family, which includes eggplant (S. melongena), pepper (Capsicum annum), tomato (Lycopersicum esculentum) and tobacco (Nicotiana tabacum). Many alkaloid drug plants also belong to this family such as Atropa, Hyoscyamus, Scopolia and Mandragora and ornamentals in the genera Petunia, Nicotiana and Schizanthus (Hawkes, 1990; Spooner et al., 1993). Potato breeding is performed to improve resistance for diseases, viruses and pests and to improve taste, cooking qualities, skin colour, shape and the yield as the most important criteria according to demands of growers and consumers. There are several ploidy levels from monoploid (2n=x=12) to hexaploid (2n=6x=72) with tetraploid being common in cultivated potatoes. The triploids and the pentaploids are often sterile, however, they can be maintained because of their vegetative propagation (Howard, 1970; Hawkes, 1990). The high degree of ploidy not only makes it genetically diverse, but also makes it difficult to create new cultivars. Phytophthora infestans Phytophthora infestans is the casual agent of late blight, which is the most devastating disease in potato worldwide. It caused the great Irish famine in the 1840s

8


Figure 1. Pictures of infected potatoes in resistance assays performed on different tissues and organs using different methods. A: Plants inoculated by pipetting inoculum on the leaves in vitro (in vitro assay). B: Leaf inoculated by pipetting inoculum on the abaxial side (detached leaf assay). C: Plants inoculated by spraying inoculum in the field (field assay). D: Tuber inoculated by pipetting inoculum on the wound site (wounded tuber assay). E: Tuber after cutting the infected tuber (D) in the wounded tuber assay. F: Tuber kept for three additional days after cutting the infected tuber (D) in the wounded tuber assay. G: Tuber slice inoculated by pipetting inoculum on the upper side. H: Tuber inoculated by spraying with a perfume spray (whole tuber assay). I: Tuber after cutting the infected tuber (H) in the whole tuber assay.

9

Chapter 1

resulting in famine-related diseases, which made over 1 million people die and over 1.5 million people immigrate.

The pathogen belongs taxonomically to the oomycetes, a phylum that was traditionally classified as a fungus due to their filamentous growth habit. However, based on biochemical analyses and phylogenetic analyses, oomycetes are closer to heterokont algae than to fungi belonging to basidiomycete fungi and ascomycete fungi (van de Peer and de Vachter, 1997). Chesnick et al. (1996) also showed that Phytophthora is related to two other stramenopiles (Chrysodidymus and Ochromonas), but not to fungi using the mitochondrial nad4L genes protein sequences. The oomycetes consist of 60 species of the genus Phytophthora, several genera of the biotrophic downy mildew and more than 100 species of the genus Pythium (referred to from http://www.oardc.ohio-state.edu/phytophthora). The host plant range of P. infestans encompasses at least 90 plant species. Most of them are members of the plant family Solanaceae (Erwin and Ribeiro, 1996). Late blight diseased potatoes are shown in Figure 1. P. infestans can infect any tissue and organ of potato. The figure includes pictures of infected tubers and leaves in different resistance assays.

The life of P. infestans has been well-studied (Figure 2). It follows three basic steps, formation of mycelium in the host plant, spatial expansion of the affected area lesion in the host plant and formation and dispersal of spores. P. infestans has a complex life cycle with distinctly different spore forms like zoospores produced by self-reproduction and oospores produced by sexual reproduction. In the 1940s or 1950s, an A2 type, the sexual reproduced type, was discovered in Mexico where the pathogen originated and was spreading through the USA, Europe, Asia and North Africa in the 1970s and 1980s (Fry et al., 1992). Since the appearance of A2 types, the chance of genetic variation of the pathogen is getting higher and it causes the problem that new strains can develop and overcome resistance genes. Late blight resistance Potato late blight causes 10 to 15 percent reduction of the global annual production (CIP, 1995). The economic value of this loss and the costs of crop protection have been estimated at 5 billion US dollar annually (Duncan, 1999). Late blight is mainly controlled by application of enormous amounts of chemicals. In spite of the application of the chemical, late blight is increasingly more difficult to control and in most countries chemical control is being restricted. There is thus an urgent need for durable resistant potato cultivars. Introduction of resistance genes from wild Solanum species into potato cultivars is considered as the most promising and environment-safe approach to achieve late blight resistance.

10


Figure 2. Disease cycle of potato late blight caused by Phytophthora infestans

In early breeding programs, eleven R genes from S. demissum were introduced into cultivated potatoes. Eight R genes, R3 (now known to exist of R3a and R3b), R5, R6, R7, R8, R9, R10 and R11, were found to be located close to each other on the short arm of chromosome 11 (El Kharbotly, 1994 and 1996; Huang et al., 2004; Huang, 2005). Other mapped R genes include R2 on chromosome 4 (Li et al., 1998) and R1 on chromosome 5 (Leonards-Schippers et al., 1992; El-Kharbotly, 1994). Unfortunately all of these genes have already been broken because new pathogens quickly evolve that are virulent to the previously resistant hosts (Umaerus and Umaerus, 1994). Besides S. demissum, other wild Solanum species have been recognized as new sources of the resistance against P. infestans. For instance, Rber from S. berthaultii has been mapped on chromosome 10 (Ewing et al., 2000), RB or Rpi-blb1 and Rpi-blb2 from S. bulbocastanum on chromosome 8 and chromosome 6, respectively (Nasess et al., 2000; van der Vossen et al., 2003 and 2004), Rpi1 from S. pinnatisectum on chromosome 7 (Kuhl et al., 2001) and quantitative trait loci (QTL) involved in resistance from S. microdontum on chromosome 4, 5 and 10 (Sandbrink et al., 2000).

Until now, research for late blight has been focussed mainly on foliage blight resistance. However, since infected seed tubers have been recognised as highly

11

Chapter 1

important in the spread of the disease, more emphasis should be placed on understanding the genetic basis of tuber blight resistance.

Tuber blight resistance is largely dependent on the testing conditions. It can be effective in various different tissues and the character of tuber resistance can be diverse in different plant genotypes (Flier, 2001; wieyski and Zimnoch-Guzowska, 2001). Detailed studies on foliar blight resistance to P. infestans have shown that plant R genes specifically recognize avirulence gene products or elicitors of P. infestans. Strong R genes act qualitatively, but weaker R genes act quantitatively and reveal a partial resistance phenotype (Vleeshouwers et al., 2000). Similarly, R gene-based resistance mechanisms are also thought to operate at tuber level (Hohl and Stssel, 1976; Shimony and Friend, 1976, wieyski and Zimnoch-Guzowska, 2001). However, insight on the correlation between leaf and tuber blight resistance phenotypes is limited, most likely because of the difficulty to separate tissue specific genetic effects from the variation obtained due to testing conditions (wieyski and Zimnoch-Guzowska, 2001). As mentioned above, the expression of tuber resistance is affected by several factors such as testing conditions, storage conditions, tuber tissues, plant genotypes, harvest date, interval between harvest and inoculation, testing location, year etc. Tubers grown in the glasshouse, for instance, gave more consistent phenotypes then tubers grown in the field (Stewart et al., 1996). More reliable disease responses were observed on post-harvest inoculated tubers than field tubers (Platt and Tai, 1998). With regard to the testing location and year, Darsow (1987) presented results of testing varieties for 12 years and he found that Adretta was very resistant and Mariella was very susceptible in 1975 and vice versa in 1979. This is an extreme example. wieyski et al. (2001) reported the consistency of tuber blight resistance, which was assayed in five different countries. They found 25 varieties giving consistency and eight varieties with a discrepancy. Furthermore, the effect of harvest date and the interval between harvest and inoculation for tuber blight resistance was examined by Stewart et al. (1983). They concluded that the optimum date for the test would probably vary with the aggressiveness of P. infestans used and other conditions influencing infection. The rate of suberization of the lenticels and differences in the relative importance of eyes and lenticels as sites of infection are important factors in determining tuber blight resistance.

So far, any resistance genes, which are only active in foliage or tuber, have not been identified. There were the first contemporary reports on mapping QTL for tuber blight resistance (Collins et al., 1999; Oberhagemann et al., 1999). However, it was related to the major QTL for foliage blight resistance, foliage maturity and vigor. That a relation exists between tuber and foliage blight resistance was confirmed by Collins et al. (1999). A strong influence of foliar R1, R2 and R3 genes on tuber blight resistance was verified (Roer et al., 1961; Toxopeus, 1961; Stewart and Bradshaw, 2001).

12


Resistance gene cloning Genes that confer race-specific resistance often control disease resistance in plants. Those resistance genes interact with specific avirulence genes in the pathogen in a gene-for-gene interaction (Flor, 1977). During the last decade, plant disease resistance genes controlling monogenic resistance have been cloned (reviewed in Gebhardt and Vlkonen, 2001). About 40 disease resistance genes have now been isolated from a variety of plant species. Nine of those resistance genes have been cloned from potato (Table 1). Table 1. Potato disease resistance genes cloned.

Gene Pathogen Chr.* Reference Rx1 Potato virus X 12 van der Vossen et al. (2000) Rx2 Potato virus X 5 Bendahmane et al. (2000) Gpa2 Globodera pallida 12 van der Vossen et al. (2000) Gro1 Globodera rostochiensis 7 Paal et al. (2004) R1 Phytophthora infestans 5 Ballvora et al. (2002) R3a Phytophthora infestans 11 Huang et al. (2005) R3b Phytophthora infestans 11 Huang S. (in preparation) Rpi-blb1 or RB Phytophthora infestans 8 van der Vossen et al. (2003); Song et al. (2003)Rpi-blb2 Phytophthora infestans 6 van der Vossen et al. (2004) * Chr. indicates the chromosomal location where the genes belong to.

Importance of the centromere From the viewpoint of plant breeding, the centromere is one of the most important functional elements of eukaryotic chromosomes, because it facilitates proper cell division in meiosis and stable transmission of the genetic material. During meiosis, each chromosome replicates, inducing homologous chromosome and crossover events generate new allelic combinations. In potato, breeding is not easy because the cultivated potato is tetraploid. However, the introgression of new genes from diverse 2x relatives of potato for the improvement of traits, especially disease resistance, is often possible via 4x-2x crosses because 2n gametes can be produced (reviewed by Jansky, 2000; Buso et al., 2003). These 2n gametes lead to various breeding schemes to synthesize highly heterozygous 4x clones. Douches and Maas (1998) investigated the relationship between yield production and heterozygosity transmission in 4x-2x populations. The heterozygosity of genetic traits and marker loci in the 4x-2x cross is dependent on the distance between genetic loci and centromere and the genetic consequences associated with different cytological mechanisms that are related to the functional importance of the centromere. Therefore, the identification of the centromeric position

13

Chapter 1

in potato chromosomes could be of great value in potato breeding (reviewed by Carputo et al., 2000). Objectives and outline of this thesis The aim of this research was to identify foliage and tuber resistance genes against Phytophthora infestans in potato.

In Chapter 2, we investigated the relationship between foliage and tuber blight resistance to identify foliage or tuber specific resistance in four different populations of which indications were obtained that three of them contained both types of resistances and one did not. We found successfully two foliage specific resistance genes, but unfortunately no tuber specific resistance genes. Additionally, we found more resistance genes in one of the populations by comparing resistance specificity with molecular marker data.

In Chapter 3, a new resistance gene was identified in a tetraploid population derived from an ABPT breeding line. The gene was expected to be originated from the wild species S. bulbocastanum. A high-resolution map of the resistance locus was constructed towards resistance gene cloning and the resistance locus was analyzed by using the homology between the sequence of markers and sequences available in databases. In Chapter 4, a resistance locus, which is phenotypically indistinguishable from the S. demissum derived-R2 locus, was identified in a diploid population. A marker-saturated high-resolution map was constructed using bulk segregant analysis combined with AFLP marker technology towards resistance gene cloning and also here additional genes were found in the population. In Chapter 5, another gene derived from the wild species S. bulbocastanum was identified. Four different methods were used to construct a marker-saturated high-resolution map towards resistance gene isolation: PCR-based marker development from published RFLP markers, the RGA candidate gene approach, BAC chromosome walking and bulk segregant analysis combined with AFLP marker technology. Additionally comparative genetics and R gene clusters on potato chromosome 4 were studied. In Chapter 6, we obtained results that are important for potato breeding in general. A population, already described in Chapter 2, was created by a cross between tetraploid female and diploid male parents. In this case, the male parent produces unreduced 2n pollen. The analysis of markers derived from the male parent allowed us to localize the position of centromeres using half-tetrad analysis. Additionally we proved that crossovers occur only once per chromosome arm.

The genes we identified for foliage blight resistance in this research were all located on chromosome 4. They could be very closely related or allelic to each other.

14


To make full use of this fact, resistance gene clusters and comparative genetics for the isolation of these genes are discussed in Chapter 5 and in the general discussion. References Ballvora, A., Ercolano, M.R., Wei, J., Meksem, K., Bormann, C.A., Oberhagemann, P.,

Salamini, F. and Gebhardt, C. 2002. The R1 gene for potato resistance to late blight (Phytophthora infestans) belongs to the leucine zipper/NBS/LRR class of plant resistance genes. Plant J 30: 361-371

Bendahmane, A., Querci, M., Kanyuka, K. and Baulcombe, D.C. 2000. Agrobacterium transient expression system as a tool for the isolation of disease resistance genes: application to the Rx2 locus in potato. Plant J 21: 73-81

Brown, C.R. 1990. Modern Evolution of the Cultivated Potato Gene Pool In: Vayda, M.E. and Park, W.D. The Molecular and Cellular Biology of the Potato. Wallingford. CAB international. Wallingford. pp 1-12.

Buso, J.A., Boiteux, L.S. and Peloquin, S.J. 2003. Tuber yield and quality of 4x-2x (FDR) potato progenies derived from the wild diploid species Solanum berthaultii and Solanum tarijense. Plant Breeding 122: 299-232

Carputo, D., Barone, A. and Frusciante, L. 2000. 2n gametes in the potato: essential ingredients for breeding and germplasm transfer. Theor Appl Genet 101: 805-813

Chesnick, J.M., Tuxbury, K., Coleman, A., Burger, G. and Lang, B.F. 1996. Utility of the mitochondrial nad4L gene for algal and protistan phylogenetic analysis. J Phycol 32: 452-456

CIP. 1995. The International Potato Center Annual Report. Lima. Peru. Collins, A., Milbourne, D., Ramsay, L., Meyer, R., Chatot-Balandras, C., Oberhagemann,

P., De Jong, W., Gebhardt, C., Bonnel, E. and Waugh, R. 1999. QTL for field resistance to late blight in potato are strongly correlated with maturity and vigour. Mol Breeding 5: 387-398

Darsow, U. 1987. Long-term results of a tuber slice test for relative resistance to late blight. Potato Res 30: 9-22

Doehlonan, J.M. and Sleper, D.A. 1995. Breeding Field Crops. Iowa state University Press. Ames. pp 419-433

Douches, D.S. and Maas. D.L. 1998. Comparison of FDR- and SDR-derived tetraploid progeny from 2x-4x crosses using haploids of Solanum tuberosum L. that produce mixed modes of 2n eggs. Theor Appl Genet 97: 1307-1313

Duncan, J.M. 1999. Phytophthora - an abiding threat to our crops. Microbiol Today 26: 114-116

El-Kharbotly, A., Leonards-Schippers, C., Huigen, D.J., Jacobsen, E., Pereira, A., Stiekema, W.J., Salamini, F. and Gebhardt, C. 1994. Segregation analysis and RFLP mapping of the R1 and R3 alleles conferring race-specific resistance to Phytophthora infestans in progeny of dihaploid potato parents. Mol Gen Genet 242: 749-754

El-Kharbotly, A., Palomino-Snchez, C., Salamini, F., Jacobsen, E. and Gebhardt, C. 1996. R6 and R7 alleles of potato conferring race-specific resistance to Phytophthora infestans (Mont.) de Bary identified genetic loci clustering with the R3 locus on chromosome XI. Theor Appl Genet 92: 880-884

15

Chapter 1

Erwin, D.C. and Ribeiro, O.K. 1996. Phytophthora diseases worldwide. American Phytopathological Society (APS press). St. Paul. Minnesota. p 562

Ewing, E.E., Simko, I., Smart, C.D., Bonierbale, M.W., Mizubuti, E.S.G., May, G.D. and Fry, W.E. 2000. Genetic mapping from field of qualitative and quantitative resistance to Phytophthora infestans in a population derived from Solanum tuberosum and Solanum berthaultii. Mol Breeding 6: 25-36

Flier, W.G., Turkensteen, L.J., van den Bosch, G.B.M., Vereijken, P.F.G. and Mulder, A. 2001. Differential interaction of Phytophthora infestans of potato cultivars with different levels of blight resistance. Plant Pathol 50: 292-301

Flor, H.H. 1971. Current status of the gene-for-gene concept. Annu Rev Phytopathol 9: 275-296

Fry W.E., Goodwin S.B., Matuszak J.M., Spielman L.J., Milgroom M.G. and Drenth A. 1992. Population genetics and intercontinental migrations of Phytophthora infestans. Annu Rev of Phytopathol 30: 107-130.

Gebhardt, C. and Valkonen. J.P.T. 2001. Organization of genes controlling disease resistance in the potato genome. Annu Rev Phytopathol 39: 79-102

Hawkes, J.G. 1978. History of the potato In: Harris, P.M. The potato crop: the scientific basis for improvement. Ed. P. M. harris. Chapman and Hall. London. pp 1-69

Hawkes, J.G. 1990. The potato: Evolution, biodiversity and genetic resources. Belhaven Press. London

Hawkes, J.G. 1994. Origins of cultivated potatoes and species relationships In: Bradshaw, J.E. and Mackay, G.R. Potato genetics. University Press. Cambridge. pp 3-42

Hohl, H.R. and Stssel, P. 1976. Host-parasite interfaces in a resistant and a susceptible cultivar of Solanum tuberosum inoculated with Phytophthora infestans: tuber tissue. Can J Bot 54: 900-912

Howard, H.W. 1970. Genetics of the potato (Solanum tuberosum). Logos Press Limited. London

Huang, S., Vleeshouwers, V.G.A.A, Werij, J.S., Hutten, R.C.B., van Eck, H.J., Visser, R.G.F. and Jacobsen, E. 2004. The R3 resistance to Phytophthora infestans in potato is conferred by two closely linked R genes with distinct specificities. Mol Plant Microb Interact 17: 428-435

Huang, S. 2005. The discovery and characterization of the major late blight resistance complex in potato: genomic structure, functional diversity and implications. PhD thesis, Wageningen University. Wageningen

Huang, S., van der Vossen, E., Kuang, H., Vleeshouwers, V.G.A.A., Zhang, N., Born, T.J.A., van Eck, H.J., Baker, B., Jacobsen, E. and Visser, R.G.F. 2005. Comparative genomics enabled the isolation of the R3a late blight resistance gene in potato. Plant J. in press

Jansky, S. 2000. Breeding for disease resistance in potato. Plant Breeding Rev 19: 69-155 Kuhl, J.C., Hanneman Jr., R.E. and Havey, M.J. 2001. Characterization and mapping of

Rpi1, a late-blight resistance locus from diploid (1EBN) Mexican Solanum pinnatisectum. Mol Genet Genomics 265: 977-985

Leonards-Schippers, C., Gieffers, W., Salamini, F. and Gebhardt, C. 1992. The R1 gene conferring race-specific resistance to Phytophthora infestans in potato is located on potato chromosome V. Mol Gen Genet 233: 278-283

16


Li, X., van Eck, H.J., Rouppe van der Voort, J.N.A.M., Huigen, D.J., Stam, P. and Jacobsen, E. 1998. Autotetraploids and genetic mapping using common AFLP markers: the R2 allele conferring resistance to Phytophthora infestans mapped on potato chromosome 4. Theor Appl Genet 96: 1121-1128

Naess, S.K., Bradeen, J.M., Wielgus, S.M., Haberlach, G.T., McGrath, J.M. and Helgeson, J.P. 2000. Resistance to late blight in Solanum bulbocastanum is mapped to chromosome 8. Theor Appl Genet 101: 697-704

Oberhagemann, P., Chatot-Balandras, C., Schfer-Pregl, R., Wegener, D., Palomino, C., Salamini, F., Bonnel, E. and Gebhardt, C. 1999. A genetic analysis of quantitative resistance to late blight in potato: towards marker-assisted selection. Mol Breeding 5: 399-415

Paal, J., Henselewski, H., Muth, J., Meksem, K., Menendez, C.M., Salamini, F., Ballvora, A. and Gebhardt, C. 2004. Molecular cloning of the potato Gro1-4 gene conferring resistance to pathotype Ro1 of the root cyst nematode Globodera rostochiensis, based on a candidate gene approach. Plant J 38: 285-297

Platt, H.W. and Tai, G. 1998. Relationship between resistance to late blight in potato foliage and tubers of cultivars and breeding selections with different resistance levels. Amer J Potato Res 75: 173-178

Roer, L. and Toxopeus, H.J. 1961. The effect of R-genes for hypersensitivity in potato-leaves on tuber resistance to Phytophthora infestans. Euphytica 10: 35-42

Sandbrink, J.M., Colon, L.T., Wolters, P.J.C.C. and Stiekema, W.J. 2000. Two related genotypes of Solanum microdontum carry different segregating alleles for field resistance to Phytophthora infestans. Mol Breeding 6: 215-225

Shimony, C. and Friend, J. 1976. Ultrastructure of the interaction between Phytophthora infestans and tuber slices of resistant and susceptible cultivars of potato (Solanum tuberosum L.) Orion and Majestic. Isr J Bot 25: 174-183

Song, J., Bradeen, J.M., Naess, S.K., Raasch, J.A., Wielgus, S.M., Haberlach, G.T., Liu, J., Kuang, H., Austin-Phillips, S., Buell, C.R., Helgeson, J.P. and Jiang, J. 2003. Gene RB cloned from Solanum bulbocastanum confers broad spectrum resistance to potato late blight. Proc Natl Acad Sci USA100:9128-9133

Spooner, D.M., Anderson, G.J. and Jansen, R.K. 1993. Chloroplast DNA evidence for the interrelationships of tomatoes, potatoes, and pepinos (Solanaceae). Am J Bot 80: 676-688

Stewart, H.E. and Bradshaw, J.E. 2001. Assessment of the field resistance of potato genotypes with major gene resistance to late blight (Phytophthora infestans (Mont.) de Bary) using inoculum comprised of two complementary races of the fungus. Potato Res 44: 41-52

Stewart, H.E., McCalmont, D.C. and Wastie, R.L. 1983. The effect of harvest date and the interval between harvest and inoculation on the assessment of the resistance of potato tubers to late blight. Potato Res 26: 101-107

Stewart, H.E., Wastie, R.L. and Bradshaw, J.E. 1996. Susceptibility to Phytophthora infestans of field- and glasshouse-grown potato tubers. Potato Res 39: 283-288

Struik, P.C. and Wiersema, S.G. 1999. Seed potato technology. Wageningen Pers. Wageningen. pp 19-30

17

Chapter 1

wieyski, K.M., Chrzanowska, M., Domaski, L. and Zimnoch-Guzowska, E. 2001. Comparison of resistance evaluation in potato variety assessment. Potato Res 44: 25-31

wieyski, K.M. and Zimnoch-Guzowska, E. 2001. Breeding potato cultivars with tuber resistant to Phytophthora infestans. Potato Res 44: 97-117

Toxopeus, H.J. 1961. On the inheritance of tuber resistance of Solanum tubersosum to Phytophthora infestans in the field. Euphytica 10: 307-314

Umaerus, V. and Umaerus, M. 1994. Inheritance of resistance to late blight. In: Bradshaw, J.E. and Mackay, G.R. Potato genetics. CAB International. Wallingford. UK. pp 365-401

van de Peer, Y. and de Wachter, R. 1997. Evolutionary relationships among crown taxa taken into account site-to-site rate variation in 185 rRNA. J Mol Evol 45: 619-630

van der Vossen, E.A.G., Rouppe van der Voort, J.N.A.M., Kanyuka, K., Bendahmane, A., Sandbrink, H., Baulcombe, D.C., Bakker, J., Stiekema, W.J. and Klein-Lankhorst, R.M. 2000. Homologues of a single resistance-gene cluster in potato confer resistance to distinct pathogens: a virus and a nematode. Plant J 23: 567-576

van der Vossen, E., Sikkema, A., Hekkert, B.L., Gros, J., Stevens, P., Muskens, M., Wouters, D., Pereira, A., Stiekema, W. and Allefs, S. 2003. An ancient R gene from the wild potato species Solanum bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato and tomato. Plant J 36: 867-882

van der Vossen, E.A., Muskens, M., Sikkema, A., Gros, J., Wouters, D., Wolters, P., Pereira, A. and Allefs, S. 2004. The Rpi-blb2 gene from Solanum bulbocastanum is allelic to the Mi-1 gene from tomato and confers broad spectrum resistance to Phytophthora infestans both in cultivated potato and tomato. 1st Solanaceae Genome Workshop 2004, September 19-21, 2004, Wageningen, The Netherlands. p 121

Vleeshouwers, V.G.A.A., van Dooijeweert, W., Govers, F., Kamoun, S. and Colon, L.T. 2000. The hypersensitive response is associated with host and nonhost resistance to Phytophthora infestans. Planta 210: 853-864

18

Chapter 2

Dissection of foliage and tuber late blight resistance

in mapping populations of potato

Tae-Ho Park, Vivianne G.A.A. Vleeshouwers, Jong-Bo Kim,

Ronald C.B. Hutten and Richard G.F. Visser

Accepted by Euphytica

Chapter 2

Abstract The devastating late blight pathogen Phytophthora infestans infects foliage as well as tubers of potato. To date, resistance breeding has often focused on foliage blight resistance, but tuber blight resistance is becoming more and more important in cultivated potatoes. In this study, a reliable tuber assay for resistance assessment was developed and foliage and tuber blight resistance (R) was compared in four mapping populations. In the RH4X-103 population, tuber blight resistance inherited independently from foliage blight resistance. Three specific R genes against P. infestans were segregating. The Rpi-abpt and R3a genes function as foliage-specific R genes, whereas the R1 gene acts on both foliage and tuber. In the segregating populations SHRH and RH94-076, tuber and foliage blight resistance correlated significantly, which suggests that resistance in foliage and tuber is conferred by the same gene (could be R3b) and QTL, respectively. In the CE population neither tuber nor foliage resistance was observed. Introduction Late blight caused by the oomycete Phytophthora infestans is a devastating disease in potato (Solanum tuberosum L.). The economic value of the crop protection and losses by the disease has reached several billion US dollars annually (Kamoun, 2001). Although numerous chemicals are applied to control late blight, introduction of resistance (R) genes from wild Solanum species into potato cultivars is considered the most promising and environmentally safe approach to achieve late blight resistance. For late blight resistance in foliage, eleven R genes from S. demissum have been introduced into cultivated potatoes. Five genes, R1, R2, R3, R6 and R7 were mapped and shown to confer race-specific resistance (Leonards-Schippers et al., 1992; Li et al., 1998; El-Kharbotly, 1994 and 1996). Also in other wild species such as S. microdontum, S. berthaultii, S. pinnatisectum and S. bulbocastanum, R genes and quantitative trait loci (QTL) have been localized as new sources for foliage resistance against P. infestans (Sandbrink et al., 2000; Ewing et al., 2000; Kuhl et al., 2001; Naess et al., 2000; van der Vossen et al., 2003 and 2004). The genetics of tuber blight resistance has not extensively been studied. The inheritance of tuber blight resistance was proven by three different testcrosses in potato: resistant x resistant, resistant x susceptible and susceptible x susceptible (Toxopeus, 1961; Wastie et al., 1987), as the mean percentage of susceptible tubers was significantly different among the three testcrosses. The inheritance of tuber blight

20

Tuber blight resistance

resistance was then explored using combining ability analysis by Stewart et al. (1992). In 1999, there were the first contemporary reports on mapping QTL for tuber blight resistance. Oberhagemann et al. (1999) analyzed five populations derived from crosses between heterozygous potato clones devoid of any known major R genes in foliage. One major QTL for tuber blight resistance was observed near marker GP179 on chromosome 5 in three populations. This QTL was closely linked to foliage blight resistance, foliage maturity and vigour. In general, cultivars with a good level of foliage blight resistance show a good level of tuber blight resistance (Collins et al., 1999), but this is depending on the plant genotypes (wieyski and Zimnoch-Guzowska, 2001). To date, no R genes against late blight were identified to specifically act in tuber or foliage.

Tuber resistance against P. infestans is an agriculturally important trait. For instance, when cut potato seeds are planted, one or two cycles of late blight transmission may occur between cutting and emergence (Lambert et al., 1998). A higher degree of resistance in seed tubers is expected to lower the infection pressure in the field (Toxopeus, 1958; Wastie, 1991). Toxopeus (1958 and 1961) reported that important barriers to prevent the pathogen from penetrating the tuber are the tuber skin and the cambial layer just below the tuber skin. Also the periderm, the cortex and the medulla are thought to be involved in tuber blight resistance (Flier et al., 2001). Therefore the expression of tuber blight resistance is largely dependent on inoculated tissues (wieyski and Zimnoch-Guzowska, 2001). In this study, four mapping populations bearing various R genes and QTL from different sources were used to investigate the inheritance of, and the relation between tuber and foliage blight resistance. Most R genes and QTL appeared to be active in both foliage and tuber. In one mapping population, foliage specific R genes were identified, including a novel R gene derived from S. bulbocastanum. Materials and methods Plant material The parents and progeny of four mapping populations, SHRH, RH4X-103, RH94-076 and CE were used in this study (Table 1). The diploid SHRH population is widely used in potato genetic mapping at the Laboratory of Plant Breeding and Nematology, Wageningen University, The Netherlands and used for an ultra high density (UHD) map with more than 10,000 AFLP (Amplified Fragment Length Polymorphism) markers (Rouppe van der Voort et al., 1997a, 1997b and 1999; Huang et al., 2004; van Os et al., submitted). The UHD map is available in the web (http://www.dpw.wageningen-ur.nl/uhd/). For this population, 14 resistant and 16 susceptible genotypes were chosen based on the results of inoculation with isolate IPO-0 in foliage (Huang et al., 2004). The tetraploid RH4X-103 population is derived

21

Chapter 2

from a cross between 707TG11-1 and RH89-039-16. 707TG11-1 was obtained from ABPT material, which was produced via bridge crosses as quadruple hybrids with four Solanum species: S. acaule, S. bulbocastanum, S. phureja and S. tuberosum (Hermsen and Ramanna, 1973). For this population, 15 resistant and 15 susceptible genotypes were chosen based on the results of inoculation with P. infestans isolate 90128 in foliage (Chapter 3). The diploid RH94-076 population is derived from a cross between RH90-038-21, an interspecific hybrid between S. microdontum and S. tuberosum and RH88-025-50, an interspecific hybrid between S. phureja and S. tuberosum. For this population, 15 genotypes with the highest and 15 genotypes with the lowest AUDPC (Area Under Disease Progress Curve) value, which were evaluated with a complex P. infestans isolate IPO-82001 in a field experiment (Celis et al., unpublished), were selected. The diploid CE population is derived from a cross between C (USW5337.3) and E (77.2102.37). Clone C is an interspecific hybrid between S. phureja and S. tuberosum. Clone E was obtained from a cross between the clone C and S. vernei S. tuberosum backcross clone (Jacobs et al., 1995). Thirty genotypes were randomly selected. Potato cultivars Nicola and Bintje were used as resistant and susceptible controls, respectively, in all experiments.

Table 1. Mapping populations used in this study. Parents with known R genes or QTL in foliage, wild

Solanum species origin of resistance and genetic location of the R gene or QTL are presented.

Population Maternal clone (R gene)

Paternal clone Resistance source R gene / QTLs and location

Reference

SHRH SH83-92-488 (R3)

RH89-039-16 S. demissum R3 on chromosom 11

Huang et al. (2004)

RH4x103 707TG11-1 (Rpi-abpt)

RH89-039-16 S. bulbocastanum Rpi-abpt on chromosome 4

Chapter 3

RH94-076 RH90-038-21 (QTL)

RH88-025-50 S. microdontum QTLs on chromosome 4

Celis et al. (unpublished)

CE USW5337.3 77.2102.37 None None Jacobs et al. (1995)

Table 2. Isolates of Phytophthora infestans and virulence factors.

Isolate Race Source IPO-0 0 W. Flier, Plant Research International, The Netherlands 90128 1.3.4.7.8.11 F. Govers, Wageningen University, The Netherlands 99018 1.4 F. Govers, Wageningen University, The Netherlands H30P04 3.7 F. Govers, Wageningen University, The Netherlands Isolates of P. infestans and preparation of inoculum The P. infestans isolates used in this study are presented in Table 2. The isolates were cultured on rye sucrose agar medium in the dark at 15oC for 1-2 weeks (Caten and Jinks, 1968). Sporulating mycelium was flooded with cold water and the sporangiaspore suspension was incubated at 4 oC for three hours. After the release of

22


the zoospores, the inoculum was adjusted to a concentration of 5 x 105 zoospores/ml (Vleeshouwers et al., 1999). Resistance assays The wounded tuber assay was developed based on the method described by Roer and Toxopeus (1961). Intact tubers of similar size were taken from cold storage. They were washed in tab water, sterilized in 5 % sodium hypochlorite for 5 minutes and rinsed in tap water twice. Holes of 5 mm depth were made on the surface of the tubers and a 10 droplet of inoculum was applied in the wound. The tubers were incubated in a closed tray with 100 % relative humidity in the dark at 15 oC and resistance was evaluated at 5-14 days after inoculation. After the evaluation, the tubers were cut and kept in the same condition for three additional days.

Two types of tuber slice methods were performed, i.e. the medulla slice assay and the cortex slice assay as described by Dorrance & Inglis (1998). Tuber slices of about 7 mm thickness were taken from the medulla and the cortex, i.e. the central and the outer part of tubers, respectively. The slices were placed individually in 9 cm petri-dishes and spot-inoculated with a 10 l droplet of inoculum on the middle upper side of the slices. They were incubated in the dark at 15 oC and evaluated at 3-7 days after inoculation.

Foliage blight resistance was determined by a detached leaf assay. Fully expanded and healthy leaves collected from greenhouse plants were placed randomly on wet paper in trays with high relative humidity. The leaflets were inoculated by pipetting 10 l droplet of inoculum on the abaxial side and incubated in the climate chamber at 15 oC. The symptoms were evaluated at 3-14 days after inoculation. DNA isolation and molecular marker analysis DNA isolation was performed with fresh leaf tissue using the Retsch machine (Retsch Inc., Haan, Germany) in which DNA of 96 samples can be isolated simultaneously. The fresh leaf tissue was grinded in the presence of a 2 % CTAB buffer composed of Tris (pH 7.5), 5 M NaCl and 0.5 M EDTA (pH 8.0).

Markers linked to the resistance locus were identified by a bulked segregant analysis (BSA) as described by Michelmore et al. (1991) using the AFLP method (Vos et al., 1995). AFLP bands were separated on a 6 % polyacryl amide gel in a Li-cor sequencer (Li-cor, Lincoln, NB, U.S.A.). From pre-amplified products, the bulks for resistant and susceptible genotypes were composed according to the phenotypic data obtained from the resistance assay. Each bulk consisted of pre-amplified products of eight genotypes. In the BSA analysis, the resistant parent, the susceptible parent, the resistant bulk and the susceptible bulk were screened with 256 primer combinations. Candidate markers, which seemed to be linked to the resistance gene, were selected

23

Chapter 2

on the basis of absence/presence of bands. Candidate markers were tested for confirmation of linkage on 16 individual genotypes used for resistant and susceptible bulk composition.

For linkage analysis and characterization of resistances in the RH4X-103 population, PCR-based markers were used to detect different known R genes (Chapter 3; Ballvora et al., 2002; Meksum et al., 1999; Huang et al., 2005). The markers are listed in Table 3.

Table 3. List of primers of PCR based-markers used in this study.

Marker PCR primer (5`-3`)* Tm Enz. Reference GP179 GGTTTTAGTGATTGTGCTGC

AATTTCAGACGAGTAGGCACT 55 BssKI Meksem et al. (1995)

Th2 ATTCATCGTCATCGCCTTTA CCTTTGTATCATTCGCAGTT

56 a.s. Chapter 3

76_2S CACTCGTGACATATCCTCACTA CAACCCTGGCATGCCACG

50-55 a.s. Ballvora et al. (2002)

SH23_2 ATCGTTGTCATGCTATGAGATTGTT CTTCAAGGTAGTGGGCAGTATGCTT

64-50 a.s. Huang et al. (2005)

* Nucleotide sequence of primers. Both forward and reverse primers are shown. Annealing temperature. For 76_2S, the annealing temperature was 50 oC for the first 7 cycles and 55 oC for the last 30 cycles. For SH23_2, a touch-down program was applied. For the first 12 cycles, the annealing temperature was gradually decreasing from 64 oC to 50 oC and it was kept at 50 oC for the last 20 cycles. Restriction enzyme that reveals polymorphism between resistant and susceptible linked alleles of the marker. a.s. means allele specific marker showing polymorphism without digestion.

Results Tuber blight assessment To optimize the method for tuber blight resistance assessment and to compare late blight resistance between foliage and tuber, the parents of four mapping populations (Table 1) were inoculated with the P. infestans isolates IPO-0, H30P04 and 90128 (Table 2) on tuber medulla slices, cortex slices and wounded tubers. No difference in resistance outcome was found between the different methods. However, the wounded tuber assay was selected for further experiments, because it showed systematically clear phenotypes and more reliable patterns. At five days after inoculation, resistant genotypes did not show any disease symptom (Figure 1A), but massive mycelium was visible at the inoculation site on the wound of susceptible genotypes (Figure 1B). The difference between resistant and susceptible became clearer when the tubers were cut. Resistant genotypes showed a sharp border, which looked like a hypersensitive response (HR; Figure 1A), whereas in susceptible genotypes the tissue was browning that expanded from the inoculation site (Figure 1B). After re-incubation at high humidity for three additional days, resistant genotypes remained devoid of any disease symptoms (Figure 1C), whereas abundant

24


sporulating mycelium was visible on the cut tuber surface in the susceptible genotypes (Figure 1D). Occasionally, an intermediate phenotype was noted. In such case, the HR-like border was less clear, but no sporulation could be noted on the cut tubers. This phenotype was designated moderately resistant.

Figure 1. The wounded tuber assay with P. infestansisolate IPO-0. Tubers of 707TG11-1 (A, C) and RH89-039-16 (B, D) were cut 5 days after inoculation (A, B) and re-incubated for 3 additional days (C, D).

Table 4. Tuber late blight resistance data of the parents of the mapping populations (Table 1) to the P.

infestans isolates IPO-0, H30P04 and 90128.

IPO-0 H30P04 90128 SH83-92-488 R* M S RH89-039-16 S S S RH90-038-21 M S S RH88-025-50 S S S 707TG11-1 R M M USW5537.3 S 77.2102.37 S * Tuber blight resistance is classified into three diff resistant respectively.

The resistances found in t

resistances in foliages (Table 1)77.2102.37 were susceptible to all tfoliage to identical or different isolasusceptible to isolate 90128 excetermed Rpi-abpt (Chapter 3). R3SH83-92-488 that also exists in folin resistance to different isolates wtubers were moderately resistant tcontains a major QTL for foliage blapparently strong enough to confer

S S S S

erent classes. R, S and M indicate resistant, susceptible and moderatelyubers of parents (Table 4) were similar to the . RH89-039-16, RH88-025-50, USW5537.3 and hree P. infestans isolates in tubers as they were in tes (Table 1, data not shown). All genotypes were pt 707TG11-1, which contains a novel R gene race-specific resistance was found in tubers of iage (Huang et al., 2004). Quantitative differences

ere also noted. SH83-92-488 and RH90-038-21 o H30P04 and IPO-0, respectively. RH90-038-21 ight resistance (Celis et al., unpublished), which is tuber resistance to P. infestans isolate IPO-0, but

25

Chapter 2

too weak for the more complex isolates H30P04 and 90128. 707TG11-1 was fully resistant to IPO-0, but moderately resistant to H30P04 and 90128. Inheritance of foliage and tuber blight resistance In the resistance assay with seven parental genotypes, we found that tuber blight resistance coincided with foliage blight resistance. To investigate the inheritance of tuber blight resistance in comparison with foliage blight resistance, 30 genotypes were selected for each mapping population and inoculated with isolate IPO-0 using the wounded tuber assay. All 30 genotypes of the CE population were susceptible in tubers, indicating the absence of any late blight R gene. Tuber blight resistance to isolate IPO-0 segregated in the other three mapping populations. In SHRH and RH94-076, the resistance in tubers correlated with the resistance in foliage. This indicates that R3 in the SHRH population (Huang et al., 2004) and the QTL in the RH94-076 population (Celis et al., unpublished) are expressed in foliage as well as in tuber. It also would suggest that the QTL of RH94-076 is effective against isolate IPO-0 (race 0) as well as isolate IPO-82001 (race 1.2.4.5.10.11). In RH4X-103, tuber and foliage blight resistance were not correlated. Eleven and seven genotypes were resistant and susceptible for both tuber and foliage resistance, respectively, but conflicting results were found in the other 12 genotypes (Table 5). Table 5. Comparison between foliage and tuber blight resistance in 30 genotypes of the RH4X-103

mapping population. Correlation between foliage and tuber resistance was determined by 2 test (2 =

1.29; P < 0.5).

Foliage\Tuber Resistant Susceptible Total Resistant 11 4 15 Susceptible 8 7 15 Total 19 11 30 Localization of tuber resistance in RH4X-103 To further investigate the tuber blight resistance in RH4X-103, the population was expanded to 233 offspring. The resistance of these genotypes was examined by inoculation with the isolates 90128 and IPO-0 using the wounded tuber assay method. All genotypes were susceptible to the isolate 90128. Race-specific resistance was noted to isolate IPO-0, as 79 and 104 genotypes were clearly resistant and clearly susceptible, respectively. The remaining 50 genotypes showing unclear hypersensitive response were excluded from analysis. The resistance data indicates a 1:1 segregation (2=3.48, 0.9


707TG11-1, RH89-039-16, the resistance bulk and the susceptible bulk were screened for BSA (Michelmore et al., 1991), and ten AFLP markers were identified to be linked to the locus for tuber blight resistance (data not shown). Blasting of the sequence of the AFLP markers via the website (http://www.ncbi.nlm.nih.gov/BLAST) showed that EATC/MCGA_332 was identical to the sequence of S. tuberosum strain P6/210 clone BAC BA87d17, S. tuberosum strain P6/210 clone BAC BA213c14 and S. demissum chromosome 5 clone PGEC472P22. A part of the AFLP marker sequence (63 nucleotides) was 82 % similar to the sequence of Lycopersicon pimpinellifolium Rio Grande 76R Pto locus (Chang et al., 2002), which is located on tomato chromosome 5. These data suggest that the resistance gene that is active in tuber is located on chromosome 5.

The tentative location of the R gene was further examined with known PCR markers (Table 3). The RFLP marker-derived locus GP179 (Meksem et al., 1995), which is located on chromosome 5, was mapped in the population of 233 genotypes and found to be linked to the tuber blight R locus at 8.1 cM genetic distance. Also the race-specific R1 gene is located near GP179 (Leonards-Schippers et al., 1992). Based on the sequence of R1, an R1 specific marker 76_2s was developed (Table 3; Ballvora et al., 2002) and applied to the 233 genotypes. The 76_2s marker was fully co-segregating with tuber blight resistance locus. In combination with the race-specific resistance data to isolates IPO-0 and 90128, these data indicate that the R1 or an R1-like gene is present in RH4X-103 and active in tubers.

Figure 2. Graphical genotyping and phenotyping of the parents 707TG11-1 (TG) and RH89-039-16 (RH) and 52 offspring and of RH4X-103. Segregation for resistance to each P. infestans isolate and molecular marker is shown. A: The phenotypic results with isolate IPO-0 in tuber. B: The phenotypic results with P. infestans isolates IPO-0, 90128, 99018 and H30P04 in foliage. C: The genotypic results detected by the Rpi-abpt-specific Th2, the R1-specific 76_2S and the R3-specific SH23_2 markers (Table 3). D: Classes determined by phenotypic and genotypic data. The number of genotypes within each group is indicated. R, S, nd, ab and aa indicate resistant, susceptible, not determined, presence and absence of the markers, respectively.

27

Chapter 2

Characterization of the foliage resistance genes in RH4X-103 To identify foliage blight resistance genes in the population RH4X-103, a subset of 52 genotypes and both parents were subjected to detached leaf assays with the P. infestans isolates IPO-0 and 90128. A smaller subset of 28 progeny plants was inoculated with the isolates 99018 and H30P04 (Table 2). All isolates showed different segregation patterns in the population, which suggests that at least three R genes for foliage resistance are segregating in the population (Figure 2B). The results for resistance to isolate 90128 were adopted from the results of Chapter 3. In addition, the population of 52 genotypes was analyzed with molecular markers (Table 3). The 76_2s marker (Ballvora et al., 2002) segregated 1:1 (Figure 2C), and exactly matched to the R1 specific resistance in tuber (Figure 2A). Also the SH23_2 marker for R3a race-specific resistance (Huang et al., 2005) appeared to segregate in RH4x103 (Figure 2C). An additional marker Th2 was developed (Table 3, Chapter 3), which appeared to be 1:1. By combining genotypic and phenotypic data, the 52 genotypes were assigned to eight different groups (Figure 2D). Genotypes that contain any of the three R gene-linked markers, i.e. group I-VII, were resistant to isolate IPO-0 in foliage. All genotypes that carry the Th2 marker, i.e. group I-IV, were resistant to all isolates, which is explained by the broad-spectrum resistance of Rpi-abpt (Chapter 3). The genotypes containing only 76_2s or SH23_2, i.e. group VI or VII, show race-specific resistance to isolates 99018, H30P04 and IPO-0, as expected based on virulence data to R1 and R3a. In summary, in the RH4X-103 population, the three R genes Rpi-abpt, R1 and R3a segregate for foliage resistance, from which only R1 is functional in tuber.

Discussion Tuber resistance to P. infestans is one of the most important traits in cultivated potatoes. Although it is considered as an essential component for potato breeding, comparatively less efforts are made in breeding for resistance in tuber than in foliage (wieyski and Zimnoch-Guzowska, 2001). There is rather limited knowledge on inheritance of tuber blight resistance, but also occurrence of tissue-specific expression of resistance and the difficulty of evaluation complicate the breeding research. To develop a reliable method for tuber blight resistance, seven parental genotypes of four mapping populations of which foliage blight resistances were previously identified were tested using different inoculation methods. The different tuber blight assay methods gave identical results in this genetic material. The relationship between tuber and foliage blight resistance is not clear and often contradicting. Platt and Tai (1998) and Stewart et al. (1994) found a correlation between tuber and foliage blight resistances, whereas Stewart et al. (1992) and Kirk

28


et al. (2001) did not. R1, R2 and R3 and some QTL could confer both foliage and tuber blight resistance (Toxopeus, 1961; Roer and Toxopeus, 1961; Stewart and Bradshaw, 2001; Collins et al., 1999; Oberhagemann et al., 1999). However, other genes may be differentially expressed in different tiss ues or organs. In this study, therefore, we examined the inheritance of tuber blight resistance in four mapping populations and compared the results with foliage blight resistance. The proportion of resistant and susceptible tubers were accepted as a 1:1 ratio in the SHRH, RH94-076 and RH4X-103 populations indicating that the resistance was transmitted as a monogenic trait from the parents to their progenies. Tuber blight resistance inherited independently of the foliage resistance in the RH4X-103 population (Table 5). Tuber blight resistance was conferred by one major gene, which was localized on chromosome 5. This resistance co-segregated with the R1-specific marker 76_2s, suggesting that tuber blight resistance in this population was caused by R1 or R1-like as one cultivar containing S. demissum-derived fragment was present in the pedigree of the population. In foliage, however, two additional R genes were identified to cause foliage-specific resistance. R3a (Huang et al., 2005) and Rpi-abpt (Chapter 3) were segregating in the population and specifically acting in foliage. However, 707TG11-1 was moderately resistant to isolate 90128 which could be due to the presence of several unknown minor QTL, which do not have detectable effects on resistance in the progeny after segregation. The moderate resistance to isolate H30P04 could be explained by its high aggressiveness (Table 4). In the SHRH and the RH94-076 populations, tuber blight resistance correlated with the presence of R3 and a major QTL for foliage blight resistance, respectively.

The R3 locus in the SHRH population consists of two functionally distinct R genes R3a and R3b that are only 0.4 cM separated from each other (Huang et al., 2004). R3-specific resistance occurred in both tuber and foliage in the SHRH population, but the R3a gene alone was foliage-specific in the RH4x103 population. It remains to be determined whether the R3 specific resistance for tuber blight in the SHRH population is caused by R3b or another R3-like gene or differences in expression patterns.

In conclusion, we found that the expression of resistance for tuber or foliage late blight depends on the R genes. In the RH4X-103 population, Rpi-abpt and R3a are foliage-specific whereas R1 or R1-like and the QTL from RH94-076 act both in tuber and foliage. Reference Ballvora, A., Ercolano, M.R., Wei, J., Meksem, K., Bormann, C.A., Oberhagemann, P.,

Salamini, F. and Gebhardt, C. 2002. The R1 gene for potato resistance to late blight

29

Chapter 2

(Phytophthora infestans) belongs to the leucine zipper/NBS/LRR class of plant resistance genes. Plant J 30: 361-371

Caten, C.E. and Jinks, J.L. 1968. Spontaneous variability of single isolates of Phytophthora infestans I. Cultural variation. Can J Bot 46: 329-347

Chang, J.H., Tai, Y.S., Bernal, A.J., Lavelle, D.T., Staskawicz, B.J. and Michelmore, R.W. 2002. Functional analysis of the Pto resistance gene family in tomato and the identification of a minor resistance determinant in a susceptible haplotype. Mol Plant Microb Interact 15: 281-291

Collins, A., Milbourne, D., Ramsay, L., Meyer, R., Chatot-Balandras, C., Oberhagemann, P., De Jong, W., Gebhardt, C., Bonnel, E. and Waugh, R. 1999. QTL for field resistance to late blight in potato are strongly correlated with maturity and vigour. Mol Breeding 5: 387-398

Dorrance, A.E. and Inglis, D.A. 1998. Assesment of laboratory methods for evaluating potato tubers for resistance to late blight. Plant Dis 82: 442-446

El-Kharbotly, A., Leonards-Schippers, C., Huigen, D.J., Jacobsen, E., Pereira, A., Stiekema, W.J., Salamini, F. and Gebhardt, C. 1994. Segregation analysis and RFLP mapping of the R1 and R3 alleles conferring race-specific resistance to Phytophthora infestans in progeny of dihaploid potato parents. Mol Gen Genet 242: 749-754

El-Kharbotly, A., Palomino-Snchez, C., Salamini, F., Jacobsen, E. and Gebhardt, C. 1996. R6 and R7 alleles of potato conferring race-specific resistance to Phytophthora infestans (Mont.) de Bary identified genetic loci clustering with the R3 locus on chromosome XI. Theor Appl Genet 92: 880-884

Ewing, E.E., Simko, I., Smart, C.D., Bonierbale, M.W., Mizubuti, E.S.G., May, G.D. and Fry, W.E. 2000. Genetic mapping from field of qualitative and quantitative resistance to Phytophthora infestans in a population derived from Solanum tuberosum and Solanum berthaultii. Mol Breeding 6: 25-36

Flier, W.G., Turkensteen, L.J., van den Bosch, G.B.M., Vereijken, P.F.G. and Mulder, A. 2001. Differential interaction of Phytophthora infestans of potato cultivars with different levels of blight resistance. Plant Pathol 50: 292-301

Hermsen, J.G.T.H. and Ramanna, M.S. 1973. Double-bridge hybrids of Solanum bulbocastanum and cultivars of Solanum tuberosum. Euphytica 22: 457-466

Huang, S., Vleeshouwers, V.G.A.A, Werij, J.S., Hutten, R.C.B., van Eck, H.J., Visser, R.G.F. and Jacobsen, E. 2004. The R3 resistance to Phytophthora infestans in potato is conferred by two closely linked R genes with distinct specificities. Mol Plant Microb Interact 17: 428-435

Huang, S., van der Vossen, E., Kuang, H., Vleeshouwers, V., Zhang, N., Borm, T.J.A., van Eck, H.J., Baker, B., Jacobsen, E. and Visser, R.G.F. 2005. Comparative genomics enabled the isolation of the R3a late blight resistance gene in potato. Plant J. in press

Jacobs, J.M.E., van Eck, H.J., Bastiaanssen, H., El-Kharbotly, A., Hertog-Vant Oever, A.T., Arens, P., Verkerk-Bakker, B., Te Lintel Hekkert, B., Pereira, A., Jacobsen, E. and Stiekema, W.J. 1995. A molecular map of potato from non-inbred parents including isozyme and morphological trait loci. Theor Appl Genet 91: 289-300

Kamoun, S. 2001. Nonhost resistance to Phytophthora: novel prospect for a classical problem. Curr Opin Plant Biol 4: 295-300

30


Kirk, W.W., Felcher, K.J., Douches, D.S., Niemira, B.A. and Hammerschmidt, R. 2001. Susceptibility of potato (Solanum tuberosum L.) foliage and tubers to the US8 genotype of Phytophthora infestrans. Amer J Potato Res 78: 319-322

Kuhl, J.C., Hanneman Jr., R.E. and Havey, M.J. 2001. Characterization and mapping of Rpi1, a late-blight resistance locus from diploid (1EBN) Mexican Solanum pinnatisectum. Mol Genet Genomics 265: 977-985

Lambert, D.H., Currier, A.I. and Olanya, M.O. 1998. Transmission of Phythphthora infestans in Cut Potato Seed. Amer J Potato Res 75: 257-263

Leonards-Schippers, C., Gieffers, W., Salamini, F. and Gebhardt, C. 1992. The R1 gene conferring race-specific resistance to Phytophthora infestans in potato is located on potato chromosome V. Mol Gen Genet 233: 278-283

Li, X., van Eck, H.J., Rouppe van der Voort, J.N.A.M., Huigen, D.J., Stam, P. and Jacobsen, E. 1998. Autotetraploids and genetic mapping using common AFLP markers: the R2 allele conferring resistance to Phytophthora infestans mapped on potato chromosome 4. Theor Appl Genet 96: 1121-1128

Meksem, K. Leister, D., Peleman, J., Zabeau, M., Salamini, F. and Gebhardt, C. 1995. A high-resolution map of the vicinity of the R1 locus on chromosome V of potato based on RFLP and AFLP markers. Mol Gen Genet 249:74-81

Michelmore, R.W., Paran, I. and Kesseli, R.V. 1991. Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proc Natl Acad Sci USA 88: 9828-9832

Naess, S.K., Bradeen, J.M., Wielgus, S.M., Haberlach, G.T., McGrath, J.M. and Helgeson, J.P. 2000. Resistance to late blight in Solanum bulbocastanum is mapped to chromosome 8. Theor Appl Genet 101: 697-704

Oberhagemann, P., Chatot-Balandras, C., Schfer-Pregl, R., Wegener, D., Palomino, C., Salamini, F., Bonnel, E. and Gebhardt, C. 1999. A genetic analysis of quantitative resistance to late blight in potato: towards marker-assisted selection. Mol Breeding 5: 399-415

Platt, H.W. and Tai, G. 1998. Relationship between resistance to late blight in potato foliage and tubers of cultivars and breeding selections with different resistance levels. Amer J Potato Res 75: 173-178

Roer, L. and Toxopeus, H.J. 1961. The effect of R-genes for hypersensitivity in potato-leaves on tuber resistance to Phytophthora infestans. Euphytica 10: 35-42

Rouppe van der Voort, J., van Zandvoort, P., van Eck, H.J., Folkertsma, R.T., Hutten, R.C.B., Draaistra, J., Gommers, F.J., Jacobsen, E., Helder, J. and Bakker, J. 1997a. Use of allele specificity of comigrating AFLP markers to align genetic maps from different potato genotypes. Mol Gen Genet 255: 438-447

Rouppe van der Voort, J., Wolters, P., Folkertsma, R., Hutten, R., van Zandvoort, P., Vinke, H., Kanyuke, K., Bendahmane, A., Jacobsen, E., Janssen, R. and Bakker, J. 1997b. Mapping of the cyst nematode resistance locus Gpa2 in potato using a strategy based on comigrating AFLP markers. Theor Appl Genet 95: 874-880

Rouppe van der Voort, J., Kanyuka, K., van der Vossen, E., Bendahmane, A., Klein-Lankhorst, R., Stiekema, W., Baulcombe, D. and Bakker, J. 1999. Tight physical linkage of the nematode resistance gene Gpa2 and the virus resistance gene Rx on a

31

Chapter 2

single introgression segment from the wild potato species Solanum tuberosum ssp. andigena CPC 1673. Mol Plant Microb Interact 12:197-206

Sandbrink, J.M., Colon, L.T., Wolters, P.J.C.C. and Stiekema, W.J. 2000. Two related genotypes of Solanum microdontum carry different segregating alleles for field resistance to Phytophthora infestans. Mol Breeding 6: 215-225

Stewart, H.E. and Bradshaw, J.E. 2001. Assessment of the field resistance of potato genotypes with major gene resistance to late blight (Phytophthora infestans (Mont.) de Bary) using inoculum comprised of two complementary races of the fungus. Potato Res 44: 41-52

Stewart, H.E., Bradshaw, J.E. and Wastie, R.L. 1994. Correlation between resistance to late blight in foliage and tubers in potato clones from parents of contrasting resistance. Potato Res 37: 429-434

Stewart, H.E., Wastie, R.L., Bradshaw, J.E. and Brown, J. 1992. Inheritance of resistance to late blight in foliage and tubers of progenies from parents differing in resistance. Potato Res 35: 313-319

wieyski, K.M. and Zimnoch-Guzowska, E. 2001. Breeding potato cultivars with tuber resistant to Phytophthora infestans. Potato Res 44: 97-117

Toxopeus, H.J. 1958. Some notes of the relations between field resistance to Phytophthora infestans in leaves and tubers and ripening time in Solanum tuberosum subsp. tuberosum. Euphytica 7: 123-130

Toxopeus, H.J. 1961. On the inheritance of tuber resistance of Solanum tubersosum to Phytophthora infestans in the field. Euphytica 10: 307-314

van der Vossen, E., Sikkema, A., Hekkert, B.L., Gros, J., Stevens, P., Muskens, M., Wouters, D., Pereira, A., Stiekema, W. and Allefs, S. 2003. An ancient R gene from the wild potato species Solanum bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato and tomato. Plant J 36: 867-882

van der Vossen, E.A., Muskens, M., Sikkema, A., Gros, J., Wouters, D., Wolters, P., Pereira, A. and Allefs, S. 2004. The Rpi-blb2 gene from Solanum bulbocastanum is allelic to the Mi-1 gene from tomato and confers broad spectrum resistance to Phytophthora infestans both in cultivated potato and tomato. 1st Solanaceae Genome Workshop 2004, September 19-21, 2004, Wageningen, The Netherlands. p 121

Vleeshouwers, V.G.A.A., van Dooijweert, W., Paul Keizer, L.C., Sijpkes, L., Govers, F., Colon, L.T. 1999. A laboratory assay for Phytophthora infestans resistance in various Solanum species reflects the field situation. Eur J Plant Pathol 105: 241-250

Vos, P., Hogers, R., Bleeker, M, Reijans, M, van de Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M. and Zabeau, M. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23: 4407-4414

Wastie, R.L. 1991. Breeding for resistance. In: Ingram, D.S. and Williams, P.H. eds. Advances in plant pathology. Vol. 7. London. UK. Academic press. pp 193-224

Wastie, R.L., Caligari, P.D.S., Stewart, H. and Mackay, G.R. 1987. A glasshouse progeny test for resistance to tuber blight (Phytophthora infestans). Potato Res 30: 533-538

32

Chapter 3

High-resolution mapping and analysis of the resistance

locus Rpi-abpt against Phytophthora infestans

in potato

Tae-Ho Park, Vivianne G.A.A. Vleeshouwers, Ronald C.B. Hutten,

Herman J. van Eck, Edwin van der Vossen,

Evert Jacobsen and Richard G.F. Visser

Accepted by Molecular Breeding

Chapter 3

Abstract Introduction of more durable resistance against Phytophthora infestans causing late blight into the cultivated potato is of importance for sustainable agriculture. We identified a new monogenically inherited resistance locus that is localized on chromosome 4. The resistance is derived from an ABPT clone, which is originally a complex quadruple hybrid in which Solanum acaule, S. bulbocastanum, S. phureja and S. tuberosum were involved. Resistance data of the original resistant accessions of the wild species and analysis of mobility of AFLP markers linked to the resistance locus suggest that the resistance locus is originating from S. bulbocastanum. A population of 1383 genotypes was screened with two AFLP markers flanking the Rpi-abpt locus and 98 recombinants were identified. An accurate high-resolution map was constructed and the Rpi-abpt locus was localized in a 0.5 cM interval. One AFLP marker was co-segregating with the Rpi-abpt locus. Its DNA sequence was highly similar with sequences found on a tomato BAC containing several resistance gene analogues of chromosome 4 and its translated protein sequence appeared to be homologous to several disease resistance related proteins. The results indicated that it is clear that the Rpi-abpt gene is a member of an R gene cluster. Introduction Late blight caused by Phytophthora infestans is one of the most serious threats to potato cultivation. Controlling late blight usually involves the application of a lot of chemicals. Nevertheless, restrictions of chemical control, environmental safety and the spread of more virulent forms of the pathogen to these chemicals indicate that the most promising approach to achieve late blight resistance is the introduction of resistance genes from wild Solanum species into potato cultivars (Kato et al., 1997).

In the last century, 11 resistance genes against Phytophthora infestans were introgressed from the wild Solanum species S. demissum into potato (Black et al., 1953; Malcolmson and Black, 1966). However, these resistance genes confer race-specific resistance controlled by single resistance factors and these genes are not durable (Mastenbroek, 1953; Malcolmson and Black, 1966). In the meantime, not only asexual but also sexual forms (A1 and A2) of P. infestans have been introduced into Europe, enabling more flexibility of the pathogen both against chemicals and resistance genes. Therefore, new sources are required for the creation of durable and race-non-specific resistance. Instead of the genes from S. demissum, resistance loci and QTLs originating from wild species like S. berthaultii, S. pinnatisectum and S. microdontum have been localized on the chromosomes 10, 7 and 4, respectively, as

34

High-resolution mapping of Rpi-abpt

new sources of resistance (Ewing et al., 2000; Kuhl et al., 2001; Sandbrink et al., 2000). S. bulbocastanum has also been considered as another new source of resistance to P. infestans (Niederhausen and Mills, 1953). S. bulbocastanum is a self-incompatible diploid wild species from Mexico which could not directly be crossed to the common potato S. tuberosum (Hermsen and De Boer, 1971). Recently two resistance genes Rpi-blb1/RB and Rpi-blb2 derived from S. bulbocastanum were cloned (van der Vossen et al., 2003; Song et al., 2003; van der Vossen et al., 2004). The RB gene was localized on chromosome 8 (Naess et al., 2000). Because of the impossibility of direct sexual crosses between S. tuberosum and S. bulbocastanum, BC2 populations derived from somatic hybrids were used (Helgeson et al., 1998). Due to the same reason, the Rpi-blb1 gene was cloned using an intraspecific hybrid between resistant and susceptible S. bulbocastanum genotypes (van der Vossen et al., 2003). To clone Rpi-blb2, which is located on chromosome 6, both an intraspecific hybrid and a complex interspecific hybrid, which was designated ABPT, were used (van der Vossen et al., 2004). ABPT is a quadruple species hybrid created through bridge crosses using S. acaule (A), S. bulbocastanum (B), S. phureja (P) and S. tuberosum (T) (Figure 1a; Hermsen and Ramanna, 1973). Map-based cloning is one of the most challenging methods for gene cloning in plant species with a relatively large genome (Lukowitz et al., 2000). In addition to Rpi-blb1/RB and Rpi-blb2, the S. demissum derived R1 (Ballvora et al, 2002) and R3a (Huang, 2005) have also been isolated using the map-based cloning approach. The first essential step for map-based gene cloning is to determine the accurate position of the target gene.

In this paper, we identify another new resistance gene named Rpi-abpt in ABPT material, which differs from that used by van der Vossen et al. (2004). We construct a high-resolution map of the Rpi-abpt locus and analyze this region by investigating the sequence of closely linked markers. We also unraveled the predicted wild species origin of the resistance gene. Materials and methods Plant materials The pedigree of the mapping population RH4X-103 is shown in Figure 1b. The tetraploid resistant female parent 707TG11-1 was derived from a quadruple hybrid ABPT clone (Hermsen and Ramanna, 1973). The diploid susceptible male parent RH89-039-16, producing unreduced 2n pollen, is one of the advanced clones widely used for mapping research at the Laboratory of Plant Breeding and the Laboratory of Nematology, Wageningen University (Rouppe van der Voort et al., 1997a, 1997b, 1998, 1999; Huang et al., 2004; van Os et al., submitted).

35

Chapter 3

Seeds of RH4X-103 progeny were sterilized in three different steps: 70 % alcohol for 1 minute, 1.5 % sodium hypochlorite for 5 minutes and three times rinsing with sterilized water. Plants were generated from seeds sown in vitro. When the size of the in vitro plants was approximately five centimeters, they were multiplied for DNA isolation, resistance assay and genotype maintenance. Recombinants were maintained in vitro and transferred to the greenhouse for generation of leaf material for the detached leaf assays.

Figure 1. Plant materials used for creation of the tetraploid mapping population RH4X-103. A: Pedigree of the tetraploid ABPT breeding clone. A, B, P and T indicate S. acaule, S. bulbocastanum, S. phureja and S. tuberosum, respectively. B: Pedigree of RH4X-103 derived from two quadruple hybrid ABPTs. The genotypes carrying resistance against P. infestans are indicated in bold.

Accession of S. acaule CGN17843 and CGN20620, S. bulbocastanum CGN21306 and CGN17693, S. phureja CGN17667 and CGN18301, S. demissum CGN17810 were obtained from the Center of Genetic Resources in The Netherlands (CGN) and maintained in vitro. Potato clone Ceb44-158-4, which has S. demissum in its pedigree and S. tuberosum cultivars Titana, Alcmaria, Van Gogh, Agria, Bintje and Nicola were planted in the greenhouse, and leaves were collected for DNA isolation. Resistance assay The mapping population of 233 genotypes was subjected to a detached leaf assay in four replications using leaf material from the maintenance field. Fully expanded and healthy leaflets were collected and incubated in moist trays. Each leaflet was inoculated with a 10 l droplet of inoculum (Vleeshouwers et al, 1999). Leaves of plants were evaluated three and five days after inoculation.

P. infestans isolates 90128 (race 1.3.4.7.8.11), which was kindly provided by Drs. F. Govers of Wageningen University, Wageningen, the Netherlands, USA618 (race 1.2.3.6.7.11) by W. Fry of Cornell University, Ithaca, USA and IPO-82001 (race 1.2.4.5.10.11) by W. Flier of Plant Research International, Wagenigen, The Netherlands were used to determine the resistance. The isolates were cultured on rye

36


sucrose agar medium (Caten and Jinks, 1968) in the dark at 15 for two weeks. When mycelium was growing on the medium, it was rinsed with 5 ml ice-cold water for the release of the zoospores from sporangia. After incubating the suspension at 4 for three hours, it was re-suspended to make an inoculum concentration of 5 x 105 zoospores/ml. DNA isolation and AFLP analysis DNA isolation was performed using a Retch protocol. Fresh leaf tissue was ground with two steel balls, nuclear lysis buffer (0.2 M Tris-HCl, 0.05 M EDTA, 2 M NaCl, 2 % CTAB, with an end pH of 7.5), DNA extraction buffer (100 mM Tris-HCl, 5 mM EDTA, 0.35 M Sorbitol, 20 mM NaBisulfite, with an end pH of 7.5) and 5 % sarcosyl in 96 wells Costar plates (Corning Inc., Corning, NY, U.S.A.) using a Retch machine (Retsch Inc., Haan, Germany). The ground leaf tissue was incubated at 65 C for an hour followed by adding ice-cold chloroform isoamyl alcohol (24:1). After centrifugation, the supernatant was transferred to new tubes. Adding isopropanol and another centrifugation allowed the precipitated DNA to be extracted. After the DNA pellet was dried, the DNA was dissolved in T0.1E-buffer (+ 0.5 g RNAse). AFLP analysis was performed as described by Vos et al. (1995). Primary template DNA of 233 genotypes was prepared using the restriction enzymes EcoRI/MseI and PstI/MseI combinations, ligated with adaptors fitting to the EcoRI, MseI and PstI sites, and 10 times diluted prior to the selective pre-amplification with single nucleotide extended primers. For the selective amplification, 11 E+3/M+3 primer combinations were selected based on their appearance in the Ultra High Density (UHD) Map (http://www.dpw.wau.nl/uhd/). Extra primer combinations were selected according to the results of a bulked segregant analysis (BSA) with 204 primer combinations as described by Michelmore et al. (1991) and six primer combinations from the R2 map (Li et al., 1998). In addition to this, AFLP marker analysis was performed to detect the wild species origin of the resistance in five different Solanum species as described by Li et al. (1998). The mobility of the AFLP markers, which are linked to the resistance locus, was compared among them. Map construction The AFLP markers inherited from the female parent were scored. Band intensity was discarded to use AFLP markers as dominant markers and only simplex-inherited markers [single-dose restriction fragments, (SDRFs); Wu et al., 1992] with a simplex trait allele for the detection of linkage in the coupling phase were included in the data analysis. The linkage group containing the resistance locus was determined by JoinMap 2.0 (Stam, 1993) and marker order by Record (van Os et al., 2000). The

37

Chapter 3

map distance was calculated based on the frequency of the recombination between AFLP markers. AFLP marker and BAC clone analysis Blasting of the sequences was performed on the web site http://www.ncbi.nlm.nih. gov/BLAST/. Genescan (http://bioweb.pasteur.fr/seqanal/interfaces/genscan.html; Burge and Karlin, 1997) and Genemark (http://www.ebi.ac.uk/genemark/; Lukashin and Borodovsky, 1998) were used to analyze the sequences of some BAC clones. ClustalX (Jeanmougin et al., 1998) was used to align sequences. For physical alignment of the resistance gene, the BAC library constructed of the wild species S. bulbocastanum, BGRC8005-8 (van der Vossen et al., 2003) was used and BAC-end sequences were performed at Greenomics (Wageningen, The Netherlands). Marker nomenclature AFLP markers were named with acronyms of enzyme combinations EcoRI/MseI and PstI/MseI, which were used to prepare the template DNA, followed by three selective nucleotides and the size of each marker as described in reference autoradiograms created by Keygene NV, Wageningen, The Netherlands. Developed PCR markers, which were based on the sequence of a tomato BAC clone, were named with the original accession number followed by a defined part of the sequence, for instance right (R), left (L) and resistance gene analogue (RGA). Markers from potato BAC-end sequences were named with the plate, row and column number of the BAC library. Results Localization of the resistance locus ABPT-derived clones were routinely inoculated with P. infestans during the breeding process and resistance was specifically noted in ABPT-30, ABPT-33, (ABPT30x33)-3, ABNA1-2, RH87-707-1 and 707TG11-1 (Figure 1). A tetraploid mapping population of 233 tetraploid genotypes, which was generated by a cross between 707TG11-1 and RH89-039-16, was assessed for resistance to P. infestans isolate 90128. 707TG11-1 was assigned as resistant, RH89-039-16 as susceptible (Figure 2) and 83 and 90 offspring were unambiguously classified as resistant and susceptible, respectively. This 1:1 segregation ratio indicates a simplex inheritance of the resistance gene. The remaining 60 genotypes were tentatively classified, but excluded from the analysis for localization of the resistance locus because of less accurate observations and insufficient humidity during the incubation period. To localize the resistance locus on the genetic linkage map of potato, 11 primer combinations were selected from the UHD map. In total 1187 AFLP bands were observed in 707TG11-1 ranging between 79 and 164 per primer combination.

38


243 bands (20.5 %) of these showed a polymorphism that was scorable with accuracy in the offspring. A subset of 191 marker loci showed a 1:1 segregation (simplex inherited markers) with the 2-test (P < 0.05). Those markers should be considered as SDRFs. In the first round of the JoinMap analysis, two of the 191 markers, i.e. EAAC/MCAG_101 and PAC/MAAT_498 were grouped with the Rpi-abpt locus.

Figure 2. Detached leaf assay on resistant and susceptible parents of RH4X-103, five days after inoculation with P. infestansisolate 90128. A: The resistant parent 707TG11-1 shows the hypersensitivity response. B: The susceptible parent RH89-039-16 is heavily sporulating.

To obtain additional AFLP markers with linkage to the Rpi-abpt locus, BSA was applied with 128 Eco/Mse and 76 Pst/Mse primer combinations using four samples: resistant parent (Pr), susceptible parent (Ps), resistant bulk (Br) and susceptible bulk (Bs). The bulks were composed of equal amounts of pre-amplified templates of eight resistant and eight susceptible genotypes as determined by the resistance assay. AFLP markers that were present in Pr and Br and absent in Ps and Bs were selected as candidate markers with putative linkage to the Rpi-abpt locus. Three and five markers from Eco/Mse and Pst/Mse primer combinations, respectively, were confirmed progressively to have more definite linkage to the Rpi-abpt locus by analyzing the 16 genotypes of Br and Bs individuals. An example is shown in Figure 3. This analysis resulted in an efficiency of determining one marker with linkage to the resistance locus per 25 AFLP primer combinat analysis, two AFLP markers from 11 primer c from the BSA were grouped with the Rpi-abpt lo

Figure 3. Part of an AFLP fingerprint showing a bulk-specPCG/MAGA primer combination. Pr, Ps, Br and Bs indiresistant bulk and susceptible bulk, respectively. R and Sgenotypes of Br and Bs.

ions. In the second round of JoinMapombinations and eight AFLP markerscus.

ific band associated with resistance using the cate the resistant parent, susceptible parent, represent resistant and susceptible individual

39

Chapter 3

One of the AFLP markers, PAT/MAGA_307, was converted into a CAPS marker Th2 (Foward: AGGATTTCAGTATGTCTCG and Reverse: TCCATTGTTGATT GCCCCT) to determine the chromosomal location of the Rpi-abpt locus. In the UHD mapping population, Th2 was localized on chromosome 4. R2, one of the S. demissum-derived R genes against P. infestans, was also mapped on chromosome 4 (Li et al., 1998). To confirm the chromosome number, six primer combinations selected from the R2 map were tested on our mapping population of 233 genotypes and four R2-linked markers were grouped with the Rpi-abpt locus in the third round of JoinMap analysis. The marker order was determined by Record software (van Os et al., 2000) and genetic map distances were determined by the recombination frequencies between flanking markers. The linkage map containing 15 loci, i.e. 14 markers and the Rpi-abpt locus was constructed. Subsequently the map was merged with the high-resolution map in Figure 4.

Figure 4. High-resolution map of Rpi-abpt on chromosome 4. The constructed map was based on 98 recombinants selected from the extended population of 1383 genotypes between the markers EAGT/MCTT_247 and EAGA/MCAC_202. The rest was based on the original map with 233 genotypes. The AFLP markers, which are also present in the map of R2, are indicated in italic. In the population of 86 genotypes, R2 was co-segregating with EACT/MCAC_189 and was located 1 cM below EATC/MCGA_186 (Li et al., 1998). Genetic distance and the number of recombinants between markers are shown on the left side of the map.

Construction of a high-resolution map From the genetic linkage map of Rpi-abpt, two flanking AFLP markers were selected for a large-scale recombinant analysis. The first one is EAGT/MCTT_247 mapping 3.4 cM telomeric from the Rpi-abpt locus and the other one is EAGA/MCAC_202 mapping 1.3 cM centromeric from the Rpi-abpt locus in the population with 233 genotypes. An additional 1383 offspring of the population was screened with the two AFLP markers, and 98 recombinants were selected. This resulted in 7.1 cM genetic

40


distance between the two AFLP markers. The 98 recombinants were screened with the AFLP markers located on and between EAGT/MCTT_247 and EAGA/MCAC_202 and tested for resistance to P. infestans isolate 90128. The high-resolution map containing the resistance locus and six AFLP markers was constructed (Figure 4). The closest markers on both sides of the Rpi-abpt locus, EATC/MCGA_186 and EATG/MCAG_215, are separated with one recombinant in 0.1 cM and six recombinants in 0.4 cM, respectively. One AFLP marker PAT/MAGA_307 was co-segregating with the Rpi-abpt locus.

Figure 5. A physical alignment of the resistance gene Rpi-abpt and its homologues. A: Graphical illustration of sequence homology among the ABPT-derived AFLP marker PAT/MAGA_307, tomato derived NBS-LRR sequences of gene4, gene5 and gene7 and Solanum bulbocastanum derived BAC-end sequences. GENESCAN predicted NBS-LRR genes in the tomato BAC clone with high homology to the Rpi-abpt candidate tagged by PAT/MAGA_307 marker. B: Sequence alignment among the sequences of resistance gene analogues and PAT/MAGA_307 created by using CLUSTAL-X software. Analysis of the Rpi-abpt locus AFLP marker PAT/MAGA_307 co-segregating with the Rpi-abpt locus was sequenced. A blast search revealed that the protein sequence of the marker showed a high degree of similarity to several well-known plant resistance proteins that belong to the NBS-LRR class. In addition, the DNA sequence of the marker showed high similarity with sequences of Lycopersicon esculentum BAC clone 127E11 (Gene back number: AF411807) derived from the tomato cultivar Heinz 1709 (van der Hoeven et al., 2002). This BAC has been localized between CT229A and TG370 at the short arm of the tomato chromosome 4 with a total length of 95,845 bp. By using Genescan and Genemark, 19 resistance gene analogues (RGA) were predicted in this clone.

41

Chapter 3

Three RGAs, i.e. Gene4, 5 and 7 out of the 19 RGAs are homologous to disease resistance protein RPP13 against Peronospora parasitica (Downy Mildew) in Arabidopsis (Bittner-Eddy et al., 1999). Marker PAT/MAGA_307 is highly similar to the 5 end of these three RGAs of the tomato BAC clone (Figure 5B). The markers AF411807L and AF411807R of the tomato BAC clone were localized at 1.2 cM and 0.8 cM distance from the Rpi-abpt locus, respectively. Based on the consensus sequence of the three RGAs of the tomato BAC clone, a RGA marker was designed (Forward: CCTTTGTATCATTTGCAGTT and Reverse: ACATCCTCCATTCTTTCTT). Analysis of the RGA marker in the mapping population revealed that the RGA marker was also co-segregating with the Rpi-abpt locus and PAT/MAGA_307 (Figure 5A). For physical alignment of resistance gene homologues, we screened the BAC library from S. bulbocastanum (van der Vossen et al., 2003) with PAT/MAGA_307 and the RGA marker. Several BACs contained these two markers. BAC clones 139K15 and 54I8 were selected to form a small contig (Figure 5A). The BAC-end sequence marker from 139K15L is also coding for a resistance gene homologue. Identification of the wild species origin of the resistance The wild Solanum accessions CGN17843, CGN20620, CGN21306, CGN17693, CGN17667 and CGN18301 that were involved in the pedigree of RH4X-103 were inoculated with P. infestans isolate 90128, using an in vitro inoculation assay (Huang, 2005). All genotypes from S. acaule and S. phureja were heavily sporulating whereas all genotypes from S. bulbocastanum showed a hypersensitive response. These results suggest that S. bulbocastanum is the most likely the donor species of the Rpi-abpt resistance.

To identify the wild species origin of the resistance gene Rpi-abpt at the molecular l

dis3745.pdf

Documents

Pdf...Pdf ... 6

strategia2014.pdf pdf

book1487.pdf pdf

book1631.pdf pdf

Pdf ed176 pdf

PDF in Theorie und Praxis - qucosa.de · Inhalt Quellen Was ist PDF? PDF-Struktur PDF erstellen PDF analysieren PDF bearbeiten PDF drucken und Troubleshooting Rechtliches Spezialthemen

Foral1.pdf · PDF file

275. erkel2_02.pdf /08600/08689/pdf/erkel2_02.pdf

book1632.pdf pdf

Pdf ed165 pdf

Pdf ed163 pdf

Pdf ed177 pdf

Pdf ed171 pdf

Pdf ed167 pdf

Pdf ed166 pdf

Pdf ed172 pdf

Biodecodificaciòn pdf..pdf

Pdf ed173 pdf

VAIO - OoCities...DSC-P9.pdf DSC-P92.pdf DSC-S30.PDF DSC-S40.pdf DSC-S50.PDF DSC-S60.pdf DSC-S70.pdf DSC-S75.pdf DSC-S80.pdf DSC-S85.pdf DSC-S90.pdf DSC-T1.pdf DSC-T3.pdf DSC-T33.pdf

wegiel_75_2_2011.pdf pdf