β-Aminobutyric Acid Primed Expression of WRKY and Defence Genes in Brassica carinata Against Alternaria Blight

SHORT COMMUNICATION

b-Aminobutyric Acid Primed Expression of WRKY and DefenceGenes in Brassica carinata Against Alternaria BlightVinodkumar Chavan and Avinash Kamble

Department of Botany, University of Pune, Pune, Maharashtra, 411007, India

Keywords

Alternaria brassicae, Brassica carinata,

induced resistance, PR-1, priming, WRKY

Correspondence

A. Kamble, Department of Botany, University

of Pune, Pune 411007, Maharashtra, India.

E-mail: [email protected]

Received: February 7, 2013; accepted: May 8,

2013.

doi: 10.1111/jph.12132

Abstract

Foliar spray with BABA led to a significant reduction of lesion develop-

ment in Brassica carinata caused by Alternaria brassicae. To get better insight

into molecular mechanisms underlying priming of defence responses by

BABA, expression pattern of BcWRKY genes and marker genes for the SA

and JA pathway namely PR-1 and PDF 1.2 was examined. Q-RT-PCR anal-

ysis revealed priming of BcWRKY70, BcWRKY11 and BcWRKY53 gene

expression in BABA-pretreated Brassica plants challenged with pathogen.

However, the expression of BcWRKY72 and BcWRKY18 remained

unchanged. Furthermore, BcWRKY7 gene was found to be upregulated in

water-treated plants in response to pathogen indicating its role in suscep-

tibility. In addition, BABA application potentiated expression of defence

genes PR-1, PDF1.2 and PAL in response to the pathogen. In conclusion,

BABA-primed expression of BcWRKY70, BcWRKY11 and BcWRKY53 genes

is strongly correlated with enhanced expression of PR-1, PDF1.2 and PAL

hence suggesting their role in BABA-induced resistance.

Introduction

Alternaria blight caused by Alternaria brassicae (Berk.)

Sacc. is a major disease of oilseed Brassicas resulting

in severe yield losses. In the absence of natural resis-

tant genes in available Brassica gene pool, alternative

strategy like chemically induced resistance seems

to be promising method for disease control. BABA

(ß-aminobutyric acid) is known to induce resistance

in many crop plants against several pathogens (Cohen

2002). Research on the mechanisms of the BABA-

induced resistance (BABA-IR) has shown that this

form of induced resistance like SAR is mostly based

on priming for different pathogen-inducible defence

mechanisms (Van Hulten et al. 2006); however, the

exact mode of action is still unclear.

Primed plant responds faster and stronger after

pathogen attack resulting in timely expression of

resistance. It has been hypothesized that transcription

factors (TFs) play an important role in induction

of priming by regulating the defence genes at early

stages of infection (Conrath et al. 2006; Ent

et al. 2009). Therefore, an important step towards

unravelling the molecular mechanism of BABA-

induced resistance would be to identify the regulatory

components and to establish their regulatory role in

defence signalling cascades. It has been reported that

several kinds of TF such as DREB, ERF, ZFP, QM and

WRKY regulate the transcription of defence genes in

response to various environmental stress such as bio-

tic and abiotic (Eulgem et al. 2000; Agarwal et al.

2011). It has been also demonstrated that promoters

of a large number of plant defence-related genes

including PR genes and NPR-1 contain W-box

sequences (T)(T)TGAC(C/T) that are recognized by

WRKY proteins and are necessary for the inducible

expression of these defence genes (Yu et al. 2001).

Different members of WRKY factors have been shown

to confer resistance towards bacteria and fungi

(Deslandes et al. 2002; Mzid et al. 2007; Cai et al.

2008). Few others are known to act as negative regu-

lator of the resistance (Journot-Catalino et al. 2006).

We have studied the expression patterns of

BcWRKY70, BcWRKY18, BcWRKY72, BcWRKY7, BcWR-

KY53, BcWRKY11 and defence genes PR-1, PDF1.2 and

PAL in Brassica carinata against Alternaria blight using

J Phytopathol 161 (2013) 859–865 � 2013 Blackwell Verlag GmbH 859

J Phytopathol

quantitative real-time PCR (Q-RT-PCR). Our results

demonstrated that BcWRKY 72 and BcWRKY 18

expressed constitutively in all the treatments, whereas

BcWRKY53, BcWRKY7 and BcWRKY11 were expressed

differentially. In addition, BABA treatment potenti-

ated the expression of defence genes PR-1, PDF1.2 and

PAL in Brassica against A. brassicae.

Materials and Methods

Plant material and fungal cultures

Three weeks old B. carinata cultivar car6 seedlings

(susceptible to A. brassicae) grown in 15 9 15 9 10 cm

pots were transferred from natural field condition to a

growth chamber set at 20°C and photoperiod of 12 h

with 70 lE/m2/s light intensity. These plants were

allowed to acclimatize for three days before pathogen

inoculation. Fungal cultures of A. brassicae were

maintained on potato dextrose agar (PDA) plates and

stored in a refrigerator. Spore suspension was

prepared by addition of a small volume of water in

the culture plate, and the culture was gently scraped.

The spore density was adjusted to 5 9 103 spores per

ml using a haemocytometer.

Plant treatment and inoculation

The efficiency of the BABA concentrations to reduce

disease severity and its phytotoxic level was initially

confirmed (results not shown) based on previous

report on B. juncea- A. brassicae system (Kamble and

Bhargava 2007). 5 mM aqueous solution of BABA

(Sigma-Aldrich, USA) was sprayed till run-off point

on the adaxial surface of the Brassica leaves, 24 h

before pathogen inoculation. A single 10 ll droplet ofthe A. brassicae spore suspension (5 9 103/ml) was

applied on either side of the midrib on the lamina

portion of the second and third leaf from the shoot

apex. The droplets were allowed to dry for 4 h, and

then, the plants were sprayed with water till run-off,

covered with plastic bags and incubated in a growth

chamber at 20°C with a light intensity of 70 lE/m2/s

and 12 h photoperiod. Control plants were pretreated

with water and mock-inoculated with 10 ll droplet ofwater.

RNA extraction and cDNA synthesis

Leaf samples were collected at 3 and 5 days after

pathogen inoculation, and 2 cm2 leaf area including

the lesion was taken for RNA isolation. Total RNA was

isolated using TRI-REAGENT (Molecular Research

Centre, St Louis, MO, USA) according to the manu-

facturer’s protocols. RNA samples were treated with

DNase I, RNase-free (Fermentas, Pittsburgh, PA, USA)

as per manufacturer’s direction to remove DNA

contamination. One microgram of total RNA was

reverse-transcribed in a 20 ll reaction volume with

SuperScriptTM III First-Strand Synthesis System for

RT-PCR (Invitrogen, Carlsbad, CA, USA) kit according

to the manufacturer’s directions.

Quantification of transcripts using Q-RT-PCR

WRKY genes sequences of B. napus available at NCBI

site (http://www.ncbi.nlm.nih.gov/) were used for

primer designing by Gene Runner software

(Table 1). GAPDH (Glyceraldehyde-3-phosphate

dehydrogenase) gene of B. napus was used as inter-

Table 1 Sequences of oligonucleotides used for Q-RT-PCR analysis

BnWRKY70 (FJ384113.1) F = 5′ -AGTTTGACGACCACGATGA -3′ 58.4 109

R = 5′ - ACCACAACCATAAATAGCCT -3′ 58.4

BnWRKY7 (FJ384112.1) F = 5′ - TCTCGGTGCTCTTCATCATC - 3′ 61.7 108

R = 5′ - CTGCCTGCTGCTCATCATTAG - 3′ 61.7

BnWRKY11 (FJ384101.1) F = 5′ -ATCACCGACTTCACCGTT -3′ 58.4 73

R = 5′ - GGAGGAGATGAGGAAGTTGA - 3′ 58.4

BnWRKY53 (FJ384111.1) F = 5′ - TAGTGAAGCATCGTCGCC - 3′ 61.7 126

R = 5′ -CTACAGCAACAGTCGCCG -3′ 61.7

BnPR-1 (U70666.1) F = 5′ - TCAACGCTCACAACCAAG -3′ 61 149

R = 5′ - CCAAGTTCTCTCCGTAAGG - 3′ 61

BnPDF1.2 (U59459.1) F = 5′ - CGCCACGAGAACAGTAAA -3′ 61 170

R = 5′ - CAGGCGTTATTGTTTCCA - 3′ 61

BnPAL (DQ341308.1) F = 5′ - TCAAGGAGTGTAGGTCGTATC - 3′ 61 113

R = 5′ -CTTCCCTTCACAAATCGC -3′ 61

BnGAPDH (AF536826) F = 5′ - CCGCTTCCTTCAACATCA - 3′ 58.4 152

R = 5′ - CTTTCTCGTGTCTAACCGTGA - 3′ 58.4

J Phytopathol 161 (2013) 859–865 � 2013 Blackwell Verlag GmbH860

b-aminobutyric acid primed expression of WRKY and defence genes V. Chavan and A. Kamble

nal control. Q-RT-PCR was performed using master-

cycler ep realplex system (Eppendorf, Hamburg,

Germany). 10 ll volume of reaction mixture consist

of 0.5 ll of cDNA (1 : 20 diluted), 5 ll of iQTM SYBR

Green Supermix (Bio-Rad) and 0 .5 ll (1 pm/ll)each of the forward and reverse primers, 3.5 ll of

RNase-free MiliQ water. Initial denaturation at 95°Cfor 5 min, annealing was carried out for 40 cycles of

95°C for 45 s, 58.4–61.7°C for 1 min, 68°C for 1 min

and final extension at 72°C for 3 min. PCR product

specificity was confirmed by melting curve analysis.

The generated threshold cycle (CT) was used to cal-

culate the transcript abundance relative to the refer-

ence gene BnGAPDH (GenBank accession AF536826)

according to the 2�DDCt method (Livak and Schmitt-

gen 2001) using three replicates. Experiments were

carried out twice. All the data were statistically anal-

ysed by analysis of variance (ANOVA) test, and the dif-

ference of P < 0.05 being considered at statistically

significant.

Results and Discussion

Disease severity was evaluated after 7 days of spore

application on leaves. Reduction in lesion size on

Brassica leaves was observed in BABA (5 mM) pre-

treated plants as compared to water pretreatment

(Fig. 1).

Q-RT-PCR analysis revealed the expression profile

of BcWRKY70, BcWRKY18, BcWRKY72, BcWRKY7,

BcWRKY53, BcWRKY11, defence-related genes PR-1,

PDF1.2 and PAL. Expression of BcWRKY72 and

BcWRKY18 genes remained unchanged in Brassica

plants pretreated either with water or BABA at both 3

and 5 dpi (Fig. 2) Recently, it was demonstrated that

Fig. 1 Size of lesion formed in leaves of

B. carinata plants, 7 days after inoculation of

A. brassicae spores. Where, W + P – water-

pretreated and pathogen-inoculated, B + P –

BABA-pretreated & pathogen-inoculated.

(a)

(b)

Fig. 2 Constitutive expression pattern of (a) BcWRKY72 and (b)

BcWRKY18 genes shown by quantitative real-time PCR analyses at differ-

ent time points in B. carinata cv. car6. W + M – water-pretreated and

mock-inoculated, W + P – water-pretreated and pathogen-inoculated,

B + M – BABA-pretreated and mock-inoculated, B + P – BABA-pretreat-

ed and pathogen-inoculated.


V. Chavan and A. Kamble b-aminobutyric acid primed expression of WRKY and defence genes

WRKY72-type TF contributes to basal immunity

against root-knot nematodes (RKN) and oomycetes

Hyaloperonospora arabidopsidis in Arabidopsis (Bhattarai

et al. 2010). Hence, constitutive expression of

BcWRKY72 could be involved in basal defence against

A. brassicae. Changes in transcript level of BnWRKY18

in Brassica napuswere observed in response to Sclerotinia

sclerotiorum and A. brassicae; however, these changes

were not statistically significant (Yang et al. 2009).

Unchanged expression of these two WRKY genes sug-

gests that they might be involved in basal defence or in

biological processes other than plant defence responses.

In BABA-treated plants, a 2-fold increase in expres-

sion of BcWRKY70 was observed 3 dpi which further

increased to 5-fold at 5 dpi as compared to all other

treatments (Fig. 3a). In Arabidopsis, gain and loss of

AtWRKY70 function resulted in enhanced resistance

and susceptibility to biotrophic pathogen Erysiphe chi-

choracearum, respectively. In contrast, overexpression

of AtWRKY70 led to enhanced susceptibility to necro-

trophic pathogen Alternaria brassicicola (Li et al. 2006).

AtWRKY70 has also been implicated in basal defence

and RPP-4 mediated resistance in Arabidopsis against

Hyaloperonospora parasitica (Knoth et al. 2007).

AtWRKY70 has been demonstrated to be an activator

of SA-inducible pathogenesis-related genes and a

repressor of JA-inducible gene PDF1.2 thus playing a

role of regulator of SA-JA crosstalk (Li et al. 2006; Li

et al. 2004). Interestingly, in our study, BABA-

pretreated plants showed significantly enhanced

expression of SA marker PR-1 gene and JA marker

PDF1.2 gene at 3 dpi where transcript level of PDF1.2

was seen 20-fold higher than PR-1. This result sug-

gests that BABA-primed expression of both PR-1 and

PDF1.2 through activation of multiple BcWRKY genes

or through NPR-1, a key regulator of SA and JA path-

way. Previously, Kamble and Bhargava (2007) have

shown that in B. juncea, BABA-induced resistance is

mediated through an enhanced expression of patho-

genesis-related protein genes (PR-1 and PDF1.2), inde-

pendent of SA and JA accumulation. During 5 dpi,

50-fold increase in PR-1 transcript was observed in

BABA-pretreated and pathogen-inoculated plants,

whereas PDF1.2 expression was not detected in any of

the treatments. This results suggest that during late

stage of infection, enhanced expression of BcWRKY70

contributes to SA-controlled suppression of JA-medi-

ated PDF1.2 expression.

BcWRKY11 gene expression also increased signifi-

cantly during early as well as late infection stages in

BABA-treated plants as compared to water-treated and

pathogen-inoculated plants (Fig. 3b). Rapid and tran-

sient induction of Arabidopsis AtWRKY11 transcripts

observed in response to Pseudomonas syringae negatively

(a) (b)

(c) (d)

Fig. 3 Expression patterns of (a) BcWRKY70,

(b) BcWRKY11, (c) BcWRKY53 and (d) BcWRKY7

transcription factor genes shown by quantita-

tive real-time PCR analyses at different time

points in B. carinata cv. car6. Treatments are

as described in Fig. 2.



regulated the basal defence (Journot-Catalino et al.

2006). WRKY11 is known to positively regulate JA

pathway, and in our study, we could correlate induc-

tion in expression of WRKY11 and PDF1.2, a JA-regu-

lated defence gene in BABA-treated plants after

pathogen inoculation.

The expression of BcWRKY53 was upregulated 3 dpi

in BABA-treated plants as compared to all other treat-

ments; however, this expression level declined signifi-

cantly at 5 dpi (Fig. 3c). In Arabidopsis, WRKY53 is

known to be induced by H2O2 involved in a complex TF

signalling network regulating early stage of leaf senes-

cence (Miao et al. 2004; Ulker et al. 2007). In present

study, induction of BcWRKY53might be as a response to

transient but significant increase in the level of H2O2 in

BABA-treated plants (results not shown).

BcWRKY7 expression was significantly increased in

water-treated plants at both 3 and 5 dpi as compared

to BABA-treated plants (Fig. 3d) suggesting its role

in susceptibility and hence a negative regulator

of BABA-induced resistance. Overexpression of

AtWRKY7 in Arabidopsis plants supported more growth

of P. syringae and developed more severe disease

symptoms than wild-type plants (Kim et al. 2006),

and thus, WRKY7 is likely to be function as a DNA-

binding transcriptional repressor.

In a recent study, it was demonstrated that in

B. napus, thirteen WRKY genes showed differential

expression in response to two fungal pathogens

namely S. sclerotiorum and A. brassicae as well as in

response to hormones like ABA, SA, JA and ET (Yang

et al. 2009).

In BABA-treated plants, a 10-fold increase in expres-

sion of PR-1was observed at 3 dpi in response to patho-

gen application which further increased to 50-fold at

5 dpi as compared to all other treatments (Fig. 4a).

Similar results were demonstrated in B. juncea against

A. brassicae during BABA-induced resistance (Kamble

and Bhargava 2007). BABA is also known to prime

expression of PR-1 in B. napus against Verticillium longi-

sporum (Kamble et al. 2012), Arabidopsis against P. sy-

ringae pv. Tomato DC3000 (Tsai et al. 2011) and Botrytis

cinerea (Zimmerli et al. 2001) and in Nicotiana tabacum

against TMV (He et al. 2007). In Arabidopsis, a group of

26 genes including PR-1was identified containing bind-

ing site for WRKY proteins (W-box, TTGAC) suggesting

there regulation by WRKY proteins (Maleck et al.

2000). In our study, WRKY70 and WRKY11 might be

coregulating expression of defence genes like PR-1 and

PDF1.2, respectively.

Expression of PDF1.2 increased significantly to

30-fold 3 dpi; however, induction of PDF1.2 transcript

level was found to be transient and their expression

level decreased significantly in BABA-treated plants

5 dpi (Fig. 4b). BABA priming of PDF1.2 gene expres-

sion is also reported in B. juncea against A. brassicae

(Kamble and Bhargava 2007). Hence, it is evident that

(a)

(b)

(c)

Fig. 4 Expression pattern of (a) PR-1, (b) PDF 1.2 and (c) PAL genes

shown by quantitative real-time PCR analyses at different time points in

B. carinata cv. car6. Treatments are as described in Fig. 2.



BABA is able to prime expression of both PR-1 and

PDF1.2 genes which must be contributing to expres-

sion of resistance.

PAL gene expression increased significantly to

30-fold during 3 dpi and further to 50-fold at 5 dpi in

BABA-treated plants as compared to water-treated

and pathogen-inoculated plants (Fig. 4c). Recently, it

was demonstrated that foliar application of BABA

enhanced the activities of PAL enzyme in B. napus

against V. longisporum (Kamble et al. 2013).

In conclusion, BABA primes an independent induc-

tion of both PR-1, PDF1.2 and also PAL genes in

response to pathogen through early activation of

BcWRKY70, BcWRKY53, BcWRKY7 and BcWRKY11

which ensures an equilibrated defence response.

Acknowledgements

This work was made possible through grants from

Department Research Development Program, BCUD,

University of Pune, Pune, India and UGC (New Delhi)

fellowship awarded to VC.

References

Agarwal P, Reddy M, Chikara J. (2011) WRKY: its struc-

ture, evolutionary relationship, DNA-binding selectivity,

role in stress tolerance and development of plants. Mol

Biol Rep 38:3883–3896.

Bhattarai K, Atamian H, Kaloshian I, Eulgem T. (2010)

WRKY72-type transcription factors contribute to basal

immunity in tomato and Arabidopsis as well as gene-

for-gene resistance mediated by the tomato R gene

Mi-1. Plant J 63:229–240.

CaiM, Qiu D, Yuan T, Ding X, Li H, Duan L, Xu C, Li X,

Wang S. (2008) Identification of novel

pathogen-responsive cis-elements and their binding

proteins in the promoter of OsWRKY13, a gene regulating

rice disease resistance. Plant, Cell Environ 31:86–96.

Cohen Y. (2002) b – aminobutyric acid- induced resistance

against plant pathogen. Plant Dis 86:448–457.

Conrath U, Beckers G, Flors V et al. (2006) Priming:

getting ready for battle. MPMI 19:1062–1071.

Deslandes L, Olivier J, Theulieres T, Hirsch J, Feng D,

Bittner-Eddy P, Beynon J, Marco Y. (2002) Resistance

to Ralstonia solanacearum in Arabidopsis thaliana is

conferred by the recessive RRS1-R gene, a member

of a novel family of resistance genes. PNAS

99:2404–2409.

Ent S, Hulten M, Pozo M, Czechowski T, Udvardi M,

Pieterse C, Ton J. (2009) Priming of plant innate immu-

nity by rhizobacteria and b-aminobutyric acid: differ-

ences and similarities in regulation. New Phytol

183:419–431.

Eulgem T, Rushton PJ, Robatzek S, Somssich IE. (2000)

The WRKY superfamily of plant transcription factors.

Trends Plant Sci 5:199–206.

He Y, Ding X, Cong L, Guo G, Chen S, Zhang J. (2007)

Induction of PR protein and inhibition of TMV in

tobacco by b-amino-butyric acid. Acta physiologica

Sinica 37:1–3.

Journot-Catalino N, Somssich I, Roby D, Kroj T. (2006)

The transcription factors WRKY11 and WRKY17 act as

negative regulators of basal resistance in Arabidopsis

thaliana. Plant Cell 18:3289–3302.

Kamble A, Bhargava S. (2007) b-Aminobutyric acid-

induced resistance in Brassica juncea against the necro-

trophic pathogen Alternaria brassicae. J Phytopathol

155:152–158.

Kamble A, Koopmann B, von Tiedemann A. (2013)

Induced resistance to Verticillium longisporum in Bras-

sica napus by b–aminobutyric acid. Plant Pathol.

62:552–561.

Kim K, Fan B, Chen Z. (2006) Pathogen-induced Arabidop-

sis WRKY7 is a transcriptional repressor and enhances

plant susceptibility to Pseudomonas syringae. Plant Physiol

142:1180–1192.

Knoth C, Ringler J, Dangl J, Eulgem T. (2007) Arabidopsis

WRKY70 is required for full RPP4-mediated disease resis-

tance and basal defense against Hyaloperonospora parasiti-

ca. Mol Plant Microbe Interact 20:120–128.

Li J, Brader G, Palva E. (2004) The WRKY70 transcription

factor: a node of convergence for jasmonate- mediated

and salicylate- mediated signals in plant defense. Plant

Cell 16:319–331.

Li J, Brader G, Kariola T, Palva ET. (2006) WRKY70

modulates the selection of signaling pathways in plant

defense. Plant J 46:477–491.

Livak K, Schmittgen T. (2001) Analysis of relative gene

expression data using real-time quantitative PCR

and the 2-[Delta][Delta]CT method. Methods 25:

402–408.

Maleck K, Levine A, Eulgem T, Morgan A, Schmid J,

Lawton K, Dangl J, Dietrich R. (2000) The transcriptome

of Arabidopsis thaliana during systemic acquired resis-

tance. Nat Genet 26:1002–1004.

Miao Y, Laun T, Zimmermann P, Zentgraf U. (2004)

Targets of the WRKY53 transcription factor and its role

during leaf senescence in Arabidopsis. Plant Mol Biol

55:853–867.

Mzid R, Marchive C, Blancard D, Deluc L, Barrieu F,

Corio-Costet M, Drira N, Hamdi S, Lauvergeat V. (2007)

Overexpression of VvWRKY2 in tobacco enhances broad

resistance to necrotrophic fungal pathogens. Physiol

Plant 131:434–447.

Tsai C, Singh P, Chen C, Thomas J, Weber J, Mauch-Mani

B, Zimmerli L. (2011) Priming for enhanced defence

responses by specific inhibition of the Arabidopsis

response to coronatine. Plant J 65:469–479.



Ulker B, Mukhtar M, Somssich I. (2007) The WRKY70

transcription factor of Arabidopsis in Xuences both the

plant senescence and defense signaling pathways. Planta

226:125–137.

Van Hulten M, Pelser M, van Loon L, Pieterse C, Ton J.

(2006) Costs and benefits of priming for defense in

Arabidopsis. PNAS 103:5602–5607.

Yang B, Jiang Y, Rahman M, Deyholes M, Kav N. (2009)

Identification and expression analysis of WRKY tran-

scription factor genes in canola (Brassica napus L.) in

response to fungal pathogens and hormone treatments.

BMC Plant Biol 9:68.

Yu D, Chen C, Chen Z. (2001) Evidence for an impor-

tant role of WRKY DNA binding proteins in the regu-

lation of NPR1 gene expression. Plant Cell 13:1527–

1539.

Zimmerli L, Metraux J, Mauch-Mani B. (2001) b-amin-

obutyric acid induced protection of Arabidopsis against

the necrotrophic fungus Botrytis cinerea. Plant Physiol

126:517–523.



Documents

β-Aminobutyric Acid Primed Expression of WRKY and Defence Genes in Brassica carinata Against Alternaria Blight