Upload
yi-yang
View
213
Download
1
Embed Size (px)
Citation preview
Original Article
a-lipoic acid inhibits high glucose-induced apoptosis inHIT-T15 cells
Yi Yang,1,2† Weiping Wang,1† Yinan Liu,1 Ting Guo,1 Ping Chen,1 Kangtao Ma1 andChunyan Zhou1*1Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Peking University, 38 Xueyuan
Road, Beijing, 100191; and 2Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences,Ningxia Medical University, 1160 Sheng Li South Road, Yinchuan, Ningxia Hui Autonomous Region, 750004, China
High blood glucose plays an important role in the pathogenesis of diabetes. a-lipoic acid (LA) has been used toprevent and treat diabetes, and is thought to act by increasing insulin sensitivity in many tissues. However,whether LA also has a cytoprotective effect on pancreatic islet beta cells remains unclear. In this study, weassessed whether LA could inhibit apoptosis in beta cells exposed to high glucose concentrations. HIT-T15pancreatic beta cells were treated with 30 mmol/L glucose in the presence or absence of 0.5 mmol/L LA for8 days. LA significantly reduced the numbers of apoptotic HIT-T15 cells and inhibited the cell overgrowth nor-mally induced by high glucose treatment. Additionally, LA inhibited insulin expression and secretion in HIT-T15cells induced by high glucose. Further study demonstrated that LA upregulated Pdx1 and Bcl2 gene expres-sion, reduced Bax gene expression, and promoted phosphorylation of Akt in HIT-T15 cells treated with highglucose. Intriguingly, knockdown of Pdx1 expression partially offset the anti-apoptotic effect of LA. However,inhibition of Akt by PI3K/AKT antagonist LY294002 only slightly reversed the anti-apoptosis effect of LA andmildly decreased the gene expression level of Pdx1 (P > 0.05). Moreover, LA only slightly attenuated reactiveoxygen species (ROS) production and augmented mitochondrial membrane potential. Therefore, our data sug-gest that a-lipoic acid can effectively attenuate high glucose-induced HIT-T15 cell apoptosis probably byincreasing Pdx1 expression. These findings provide a new interpretation on the role of LA in the treatment ofdiabetes.
Key words: a-lipoic acid, apoptosis, diabetes, islet beta cells, Pdx1.
Introduction
a-lipoic acid (LA), isolated from bovine liver in 1950, is
a naturally-occurring cofactor found in a number of
multienzyme complexes. It is a powerful antioxidant
and can scavenge reactive oxygen species (ROS) (Bal-
kis et al. 2009). LA has a protective effect on oxidative
stress-induced apoptosis in some cell types. It has
been reported to inhibit high glucose-induced apopto-
sis of human umbilical vein endothelial cells (Menget al. 2008), reduce dopaminergic neuron loss in a rat
model of Parkinson’s disease (Abdin & Sarhan 2011)
and reduce the apoptosis of hepatocytes and bone
marrow stromal cells induced by TNF-a (Byun et al.
2005; Diesel et al. 2007). This cytoprotective potential
is not only due to its antioxidative properties but also
involves the activation of specific cellular signaling
pathways (Salinthone et al. 2010). LA has also been
reported to induce apoptosis in some cancer cells at
higher concentrations (over 1–2 mmol/L). It induces
apoptosis in human hepatoma cells by activating
PTEN and inhibiting Akt (Shi et al. 2008). In lung can-cer cells, LA induces apoptosis through both caspase-
independent and caspase-dependent pathways, which
are mediated by intracellular Ca2+ (Choi et al. 2009).
These data suggest that LA can act as an anti-apop-
totic or a pro-apoptotic agent depending on its con-
centration and the cell type. Recent evidence suggests
that LA has a wide range of benefits in the treatment
of diabetes. It is thought to ameliorate insulin resis-tance in type 2 diabetes mellitus (Lee et al. 2005;
Kamenova 2006; Gupte et al. 2009; Muellenbach
*Author to whom all correspondence should be addressed.Email: [email protected]†These authors contributed equally to this work.Received 20 November 2011; revised 27 March 2012;
accepted 10 April 2012.ª 2012 The AuthorsDevelopment, Growth & Differentiation ª 2012 Japanese
Society of Developmental Biologists
Develop. Growth Differ. (2012) 54, 557–565 doi: 10.1111/j.1440-169X.2012.01356.x
The Japanese Society of Developmental Biologists
et al. 2009; Wang et al. 2010). Another importantpathogenetic mechanism in diabetes is the apoptosis
of beta cells caused by high blood glucose (Wang
et al. 2011a). The purpose of this study was to investi-
gate whether LA confers a cytoprotective effect on
beta cells in the presence of high glucose concentra-
tions, and the possible mechanisms involved in this
effect. Pancreatic duodenal homeobox 1 (Pdx1) has
been reported to play central roles in pancreatic betacell function and survival (Johnson et al. 2003; Li et al.
2005; Fujimoto & Polonsky 2009; Fujimoto et al. 2009;
Gauthier et al. 2009). Phosphatidylinositol 3-kinase
(PI3K) and its effector protein kinase B (PKB/Akt) have
also been implicated as critical mediators of pancreatic
beta cell survival (Artwohl et al. 2007; Wang et al.
2011b). We used hamster insulinoma cells (HIT-T15
cell line) to investigate whether these mechanisms areinvolved in the protection of pancreatic beta cells by
LA. Our data reveal that LA can prevent HIT-T15 cells
from undergoing apoptosis caused by long term cul-
ture in high glucose medium. The anti-apoptotic effect
might be mainly mediated by increasing expression of
Pdx1.
Materials and methods
Cell culture
Hamster pancreatic beta cells, HIT-T15 (ATCC num-
ber: CRL-1777), were cultured in RPMI-1640 medium
containing 11.5 mmol/L glucose with 10% heat-inacti-
vated fetal bovine serum (FBS), 100 U/mL penicillin
and 100 mg/mL streptomycin. Most experiments werecarried out with at least three groups: One group
remained in medium with a normal glucose concentra-
tion (11.5 mmol/L, the NG group); one group was cul-
tured in medium with high glucose concentration
(30 mmol/L, the HG group) and one group was cul-
tured in medium with high glucose concentration
(30 mmol/L) supplemented with 0.5 mmol/L lipoic acid
(the HG + LA group).
Evaluation of apoptosis
Apoptosis of HIT-T15 cells was induced by culturing
the cells in medium supplemented with 30 mmol/L
glucose with or without 0.5 mmol/L LA for up to
8 days (the HG + LA and HG groups, respectively).
Cells were washed twice with phosphate-buffered sal-ine (PBS) and fixed in 1% paraformaldehyde in PBS at
4°C for 30 min followed by 70% ethanol for 30 min.
The effects of LA were evaluated by Annexin-V and PI
staining according to the manufacturer’s protocol (Vig-
orous Biotechnology, Beijing, China). Samples were
analyzed on a Becton Dickinson FACS Calibur (SanJose, CA, USA).
Cell proliferation assay
HIT-T15 cells were seeded at a density of 1 9 103
cells/well in 96-well plates in normal glucose medium
(11.5 mmol/L glucose). After 24 h, cells were cultured
in NG, HG or HG + LA media for a further 4 days. Cellviability was measured using a CCK-8 cell proliferation
kit (Dojindo Laboratories, Kumamoto, Japan) accord-
ing to the manufacturer’s instructions. Briefly, 10 lLCCK-8 solution was added to each well at different
time-points. Plates were incubated at 37°C for 2 h
and the absorbance at 450 nm was measured with a
Microplate Reader (Bio-Rad, La Jolla, CA, USA).
Real-time RT-PCR
RNA extraction was performed using Trizol Reagent
(Invitrogen) based on the manufacturer’s instructions.
For real-time reverse transcription–polymerase chain
reaction (RT–-PCR), ABI Prism 7700 sequence detec-
tor and SYBR® Green Real-Time Master Mix (TOY-
OBO, Tokyo, Japan) were used. Primers are listed inTable 1. All annealing temperatures were 60°C. Tran-scription levels of each gene were normalized to 18S
rRNA level.
Western blotting
Western blot analysis was performed as described
previously (Guo et al. 2011). The antibodies includegoat polyclonal antibody against b-actin; mouse
monoclonal antibody against LaminB; rabbit polyclonal
antibodies against Bcl2, Bax, Pdx1 and caspase-12
(Santa Cruz), Akt and phosphorylated Akt (Cell Signal-
ling). PI3K/Akt antagonist LY294002 was obtained
from Sigma and used at 5 lmol/L for 24 h prior to
protein extraction.
Table 1. The sequences of real-time reverse transcription–poly-
merase chain reaction (RT–PCR)primers
Genes Primer Sequences (5′-3′)
Bcl2 F, ATAGCCCGTGTTTGTAATR, TTCCTGATAGGGTAGGTG
Bax F, AGAGGCAGCGGCAGTGATR, CGATCCTGGATGAAACCCT
Pdx1 F, CGCGTCCAGCTCCCTTTR, TGCCCACTGGCCTTTCC
Insulin F, AGGACCCACAAGTGGAACAACTR, CAACGCCAAGGTCTGAAGGT
ª 2012 The Authors
Development, Growth & Differentiation ª 2012 Japanese Society of Developmental Biologists
558 Y. Yang et al.
RNA interference (RNAi)
HIT-T15 cells were transfected with Pdx1-siRNA (siP-
dx1) or non-silencer siRNA (siNo), respectively. Either
siPdx1 or siNo duplexes were synthesized by Shang-hai GeneChem, China. The sequences of siPdx1 are:
sense, 5′-GAAAGAGGAAGAUAAGAAAtt-3′; antisense,
5′-UUUCUUAUCUUCCUCU UUCtt-3′. The sequences
of non-silencer siRNA are: sense, 5′-UUCUCCGAAC-GUG UCACGUtt-3′; antisense, 5′-ACGUGACACG-UUCGGAGAAtt-3′. HIT-T15 cells were cultured with
HG or HG + LA for 4 days and then siRNA was
transfected into the cells using LipofectamineRNAiMAX (Invitrogen). After 48 h the cells were
harvested for apoptosis assay, real-time RT–PCR and
western blotting analysis.
Analysis of ROS production
HIT-T15 cells (5 9 104/well in six-well plates) were cul-
tured in NG, HG or HG + LA media for 6 days. Cellswere washed with PBS and incubated with 2.5 lg/mL
dihydrorhodamine 123 (DHR123; Sigma). Fluorescence
was excited at 450–490 nm and emission was moni-
tored at 515–565 nm. Fluorescence intensities were
analyzed by recording the Rhodamine 123 relative flu-
orescence unit (RFU) by flow cytometry. The data were
collected using a FACscan fluorescence-activated cell
scanner with the data acquisition program, QCELLQuest (both from Becton Dickinson).
Mitochondrial membrane potential (ΔΨm) analysis
HIT-T15 cells (5 9 104/well in 6-well plates) were cul-
tured in NG, HG or HG + LA media for 6 days.
Freshly harvested HIT-T15 cells were washed with
PBS and incubated with rhodamine 123 (800 ng/mL,Sigma) for 30 min. DΨm was monitored by observing
RFU using a FluoroCount plate reader (Packard
Instruments) at excitation/emission wavelengths of
530/590 nm.
Insulin secretion assay
HIT-T15 cells (5 9 104/well in 6-well plates) were cul-tured in NG, HG or HG + LA media for 6 days. Cells
were washed in glucose-free Krebs-Ringer bicarbon-
ate (KRB) buffer three times and then re-incubated in
NG, HG or HG + LA media, respectively, at 37°C for
60 min. The media were collected after gentle centri-
fugation and stored at �20°C for measurement of
insulin secretion by radio immunoassay (RIA) kit (The
China Atomic Energy Diagnostics) normalized to totalprotein.
Statistical analysis
The data are expressed as mean ± standard deviation
(SD). Comparisons between groups were analyzed
using analysis of variance (ANOVA), and the Student–Newman–Kleuss method was used to estimate the
level of significance. Differences were considered to be
statistically significant at P < 0.05.
Results
LA protects HIT-T15 cells against high
glucose-induced apoptosis
The apoptosis of pancreatic islet beta cells is thought
to play an important role in the pathogenesis of diabe-
tes. Chronic exposure to high glucose levels (17–27 mmol/L for 48–72 h) may induce apoptosis of beta
cells (Wang et al. 2011a). To investigate whether LA
could protect beta cells from high glucose-induced
apoptosis, a hamster pancreatic beta cell line, HIT-T15, was cultured in the presence of 30 mmol/L of
glucose with or without 0.5 mmol/L LA from 0 to
8 days (the HG + LA and HG groups, respectively). LA
significantly reduced the number of apoptotic cells
induced by high glucose at day 4, and became more
evident from day 6 onwards (Fig. 1A). The percentage
of apoptotic cells was 38.7 ± 9% and 48.8 ± 8% in
the HG group, and 7.9 ± 2% and 9.4 ± 2% in theHG + LA group at day 6 and day 8, respectively
(n = 3; P < 0.01). LA could also inhibit the overprolifer-
ation of HIT-T15 cells induced by high glucose culture.
CCK-8 cell proliferation assay showed a time-depen-
dent elevation in cell viability from day 1 to day 4 in
the HG group. In the HG + LA group, cell growth
declined from day 2 to day 4 (n = 3, P < 0.05 com-
pared with the HG group) and was similar to growth inthe normal glucose control group (Fig. 1B). These
results demonstrate that LA can prevent the apoptosis
and overgrowth of HIT-T15 cells cultured in high
glucose medium.
LA protects HIT-T15 cells from apoptosis mainly by
upregulating Pdx1 gene expression
To explore the anti-apoptotic mechanisms of LA, we
examined expression of the Pdx1 gene that has been
reported to play important anti-apoptotic and cytopro-
tective roles in islet beta cells (Fujimoto & Polonsky
2009). RT–PCR and western blot analysis showed that
culture in high glucose media only slightly reduced the
expression of Pdx1, but that addition of LA increased
the expression of Pdx1 at both mRNA (5.12 ± 0.6-fold)and protein levels on day 6 (Fig. 2A,B, P < 0.01,
ª 2012 The Authors
Development, Growth & Differentiation ª 2012 Japanese Society of Developmental Biologists
LA inhibits HIT-T15 cells apoptosis 559
(A) (B)
Fig. 1. Effects of a-lipoic acid (LA) on hamster insulinoma (HIT) -T15 cell apoptosis and proliferation. (A) Cells were cultured in 30 mmol/
L glucose with or without 0.5 mmol/L LA (high glucose [HG] + LA and HG, respectively), for 8 days. The percentage of apoptotic cells
was determined by flow cytometry with Annexin-V and PI double staining. Each sample was in triplicate and the experiments were per-
formed three times. (B) Cells were cultured in 11.5 mmol/L glucose (normal glucose [NG]) or 30 mmol/L glucose with or without
0.5 mmol/L LA (HG + LA and HG, respectively), for 4 days. Cell proliferation rates were determined by CCK-8 cell proliferation assay
(n = 3). Each bar represents mean ± SD. *P < 0.05, **P < 0.01 versus HG.
(A) (B)
(C)
(D)
Fig. 2. Effects of pancreatic duodenal homeobox 1 (Pdx1) on the anti-apoptosis of a-lipoic acid (LA) in hamster insulinoma (HIT)-T15
cells. Cells were cultured in 11.5 mmol/L glucose (normal glucose [NG]) or 30 mmol/L glucose with or without 0.5 mmol/L LA (high
glucose [HG] + LA and HG, respectively), for 6 days. (A) The expression of Pdx1, Bax and Bcl2 were determined by real-time reverse
transcription–polymerase chain reaction (RT–PCR). Each bar represents mean ± SD. (n = 3) *P < 0.05, **P < 0.01. (B) The expression of
Pdx1, Bax, Bcl2 and Caspase12 were determined by western blot analysis. b-actin was used as a loading control. (C) Real-time RT–
PCR (top) and western blotting (bottom) showed the expression of Pdx1 in Pdx1 knockdown (siPdx1) HIT-T15 cells; non-silencer siRNA
(siNo) was used as a siRNA control (**P < 0.01). (D) The level of apoptosis was measured by flow cytometry analysis in Pdx1 knock-
down HIT-T15 cells on day 6. The percentage of apoptotic cells in HG + LA group compared to NG, HG, HG + LA + siPdx1 and
HG + LA + siNo groups. A representative figure is shown on the left and the statistical analysis data are shown on the right. Each bar
represents mean ± SD from three samples (**P < 0.01). The experiments were repeated three times and a representative figure is
shown.
ª 2012 The Authors
Development, Growth & Differentiation ª 2012 Japanese Society of Developmental Biologists
560 Y. Yang et al.
n = 3), suggesting that Pdx1 might be involved in theprotective effect of LA. To further confirm the anti-
apoptotic role of Pdx1, Pdx1-specific siRNA (si-Pdx1)
was transfected into HIT-T15 cells cultured with HG
and LA. The expression of Pdx1 at both mRNA and
protein levels were significantly reduced by Pdx1-siR-
NA (Fig. 2C). Flow cytometry indicated that knock-
down of Pdx1 could increase apoptosis of HIT-T15
cells over threefold (Fig. 2D, P < 0.01, n = 3), sug-gesting that Pdx1 can partially contribute to the anti-
apoptotic effect of LA in these cells.
We also noted expression changes in the anti-apop-
totic gene Bcl2 as well as the pro-apoptotic gene Bax.
The gene expression level of Bax was increased over
fourfold in the HG group compared with the NG con-
trol, while Bcl2 was not affected significantly. However,
LA could partially reverse the expression levels ofthese two genes (Fig. 2A,B). In contrast, the activation
of caspase-12, a representative caspase involved in
response to endoplasmic reticulum stress, was
enhanced by HG culture but not significantly affected
by treatment with LA. These results provide further
evidence that LA could play an anti-apoptosis role in
HIT-T15 cells treated with high glucose.
Since the PI3-K/Akt pathway is known to participatein anti-apoptotic signaling cascades in different cells
(Artwohl et al. 2007; Wang et al. 2011b), and Akt can
regulate Pdx1 function directly or indirectly (Fujimoto &
Polonsky 2009), we also examined whether Akt activa-
tion was involved in the protective effect of LA on high
glucose-induced apoptosis. The phosphorylation at
serine 473 of Akt was increased when HIT-T15 cells
were treated with high glucose, while Akt phosphoryla-tion was further enhanced in the HG + LA group
(Fig. 3A). However, inhibition of Akt by PI3K/AKT
antagonist LY294002 only slightly reversed the anti-
apoptosis effect of LA and mildly decreased the gene
expression level of Pdx1 (Fig. 3A,B). The results sug-
gest that LA could induce the activation of Akt, but the
Akt activation may not be the main mechanism
involved in the preventive effects of LA against highglucose-induced apoptosis in HIT-T15 cells.
LA inhibits insulin secretion of HIT-T15 cells induced
by high glucose
LA acts as an insulin sensitizer in skeletal muscle
(Gupte et al. 2009; Wang et al. 2010). We evaluated
(A) (B)
Fig. 3. Effects of activating Akt on the pancreatic duodenal homeobox 1 (Pdx1) expression and anti-apoptosis of a-lipoic acid (LA) in
hamster insulinoma (HIT)-T15 cells. Cells were cultured in 11.5 mmol/L glucose (normal glucose [NG]) or 30 mmol/L glucose with or
without 0.5 mmol/L LA (high glucose [HG] + LA and HG, respectively) for 6 days. PI3K/Akt antagonist LY294002 (5 lmol/L) was incu-
bated with cells for 24 h prior to protein extraction or apoptosis rate determination in the HG + LA + LY group. (A) Real-time reverse
transcription–polymerase chain reaction (RT–PCR) (top) and western blotting (bottom) showed the expression of Pdx1 and Akt phos-
phorylation in HIT-T15 cells (compared with HG group, **P < 0.01). (B) The level of apoptosis was measured by flow cytometry analysis
in the indicated group (compared with HG group, **P < 0.01). A representative figure is shown on the top and the statistical analysis
data are shown at the bottom.
ª 2012 The Authors
Development, Growth & Differentiation ª 2012 Japanese Society of Developmental Biologists
LA inhibits HIT-T15 cells apoptosis 561
the influence of HG medium and LA on insulin secre-tion in HIT-T15 cells for up to 6 days. Insulin secretion
increased in the first 2 days in the HG group (Fig. 4A,
P < 0.01, n = 3), then became close to the levels of
NG group in days 3–6. LA inhibited insulin secretion
on days 1 and 2 compared to the HG group (Fig. 4A,
P < 0.05, n = 3). The upregulation of insulin gene
expression in the HG group was also inhibited by addi-
tion of LA (Fig. 4B, P < 0.01, n = 3). LA thus inhibitsinsulin over-secretion by HIT-T15 cells induced by high
glucose.
LA influences ROS production and mitochondrial
membrane potential slightly in HIT-T15 cells cultured
with high glucose
Hyperglycaemia has been reported to enhance reac-tive oxygen species (ROS) production through the
mitochondrial electron transport chain, which in turn
activates cellular apoptotic pathways (Piconi et al.
2006). LA is an important cofactor of mitochondrial de-
hydrogenases and has been used in the treatment ofseveral oxidative injury conditions, such as neural
degeneration in diabetes (Varkonyi & Kempler 2008).
However, in our study, ROS production and mitochon-
drial membrane potential (ΔΨm) only showed slight
changes, a 14.3% increase in ROS production and a
marginal decrease of ΔΨm, in the HG group compared
to the NG group after 6 days culture (Fig. 5A,B,
P > 0.05, n = 3). When incubated with LA, ROS levelwas reduced 26% and ΔΨm was increased 17%,
respectively, but there was no significant difference
compared with high glucose culture alone (P > 0.05).
Together, these results suggest that LA can slightly
attenuate ROS production and augment ΔΨm. The
antioxidative effect might not be excluded from LA
anti-apoptosis mechanism.
Discussion
a-lipoic acid, a potent antioxidant, has been success-
fully used as a dietary supplement to prevent and treat
(A) (B)
Fig. 4. Effects of a-lipoic acid (LA) on insulin secretion and expression in hamster insulinoma (HIT)-T15 cells. (A) Cells were cultured in
11.5 mmol/L glucose (normal glucose [NG]) or 30 mmol/L glucose with or without 0.5 mmol/L LA (high glucose [HG] + LA and HG,
respectively) for 6 days and assayed for insulin secretion by radio immunoassay (RIA) (n = 3). (B) The expression of insulin in the cells
cultured for 2 days was determined by real-time reverse transcription–polymerase chain reaction (RT–PCR). Each bar represents
mean ± SD (n = 3). *P < 0.05, **P < 0.01.
(A) (B)
Fig. 5. Effects of a-lipoic acid (LA) on reactive oxygen species (ROS) production and mitochondrial membrane potential level in hamster
insulinoma (HIT)-T15 cells. Cells were cultured in 11.5 mmol/L glucose (normal glucose [NG]) or 30 mmol/L glucose with or without
0.5 mmol/L LA (high glucose [HG] + LA and HG, respectively) for 6 days. (A) Mitochondria ROS and (B) mitochondrial membrane
potential were measured by recording the Rhodamine 123 fluorescence intensities (relative fluorescence unit) by flow cytometry. Each
bar represents mean ± SD, (n = 3).
ª 2012 The Authors
Development, Growth & Differentiation ª 2012 Japanese Society of Developmental Biologists
562 Y. Yang et al.
many diseases, including neurodegeneration, hepaticdisorders and diabetes (Lee et al. 2005; Diesel et al.
2007; Abdin & Sarhan 2011). The evidence suggests
that LA has a wide range of benefits in the treatment
of diabetes. LA could partly ameliorate insulin resis-
tance in type 2 diabetic rats (Lee et al. 2005), and
additional antidiabetic effects have been reported in
earlier rodent and human studies (Kamenova 2006;
Gupte et al. 2009). LA has also been shown toenhance glucose disposal in skeletal muscle, liver and
adipocytes, to suppress hepatic gluconeogenesis (Lee
et al. 2005), and even to be a direct binding activator
of the insulin receptor to prevent hepatocyte apoptosis
(Diesel et al. 2007). Pancreatic beta cell apoptosis is
thought to play an important role in the pathogenesis
of diabetes. However, whether LA could protect beta
cells from apoptosis has not been fully investigated. Inthis study, we demonstrated that LA could protect
HIT-T15 cells from high glucose-induced apoptosis. Its
cytoprotective effects are mainly mediated by upregu-
lating Pdx1 expression.
The protective action of LA is usually explained by its
antioxidative potential (Varkonyi & Kempler 2008; Abdin
& Sarhan 2011). However, in our study, ROS production
and ΔΨm did not seem to be influenced by LA treatmentsignificantly. We should point out that no significant
change of ROS production was observed between the
NG and HG groups in our study. It has been reported
that glucose toxicity could increase the formation of
ROS in a variety of cell lines including HIT-T15 (Tanaka
et al. 2002). One possible reason why we did not
observe such change in our high glucose group could
be that the glucose concentration in the control (NG)group (11.5 mmol/L) is already the super-physiological
concentration (5.6 mmol/L), which might increase the
baseline of ROS (Robertson et al. 1992). It has been
reported that LA is a powerful antioxidant (Balkis et al.
2009) and has a protective effect on oxidative stress-
induced apoptosis in a number of cell types (Lee et al.
2005; Goraca et al. 2011). In the present study, we also
observe that LA slightly attenuates ROS production(26%) and augments ΔΨm (17%), although the
difference is not significant (P > 0.05). Therefore, the
antioxidative effect might not be excluded from LA
anti-apoptosis mechanism. Since 0.5 mmol/L LA could
almost completely prevent apoptosis in our study, other
molecular mechanisms have to be considered.
Pdx1 is a transcription factor that plays a central role
in pancreatic beta cell function and survival (Fujimoto& Polonsky 2009). Pdx1 knockout increased beta cell
apoptosis (Johnson et al. 2003; Gauthier et al. 2009).
Chronic hyperglycaemia can reduce Pdx1 expression
and cause beta cell dysfunction (Fujimoto & Polonsky
2009). We also observed a slightly decreased expres-
sion of Pdx1 in HIT-T15 cells with high glucose culture.However, LA could significantly elevate expression of
Pdx1. Furthermore, knockdown of Pdx1 expression
could partially offset the anti-apoptotic effect of LA.
The expressions of Isl1 and Beta2, which have been
reported as anti-apoptosis effectors in islet cells (Guo
et al. 2011), were not influenced by LA treatment (data
not shown). This suggests that it is Pdx1, not Isl1 or
Beta2, that is involved in the cytoprotective effect ofLA.
PI3-kinase/Akt signal pathway is critical to the con-
trol of beta cell growth and survival (Wang et al.
2011b). It has been reported that the activation of the
Akt pathway could increase Pdx1 expression in beta
cells through direct and indirect pathways (by inactiva-
tion of GSK-3b and Foxo1) (Fujimoto & Polonsky
2009). In this study, we also found that Akt phosphor-ylation was enhanced in HIT-T15 cells cultured in HG
with LA at 0.5 mmol/L. However, inhibition of Akt by
PI3K/AKT antagonist LY294002 only slightly decrease
the gene expression level of Pdx1, mildly reversed the
anti-apoptosis effect of LA. Therefore, it is reasonable
to propose that LA could induce the activation of Akt,
but the Akt activation may not be the main mechanism
involved in the preventive effects of LA against highglucose-induced apoptosis in HIT-T15 cells.
It is well known that PI3K activation/Akt phosphoryla-
tion is also a downstream effect of insulin signaling. In
the present study, LA inhibited HG-induced insulin
secretion, but also increased Akt phosphorylation. This
is not controversial. It has been reported that LA could
activate Akt in certain circumstances (Lee et al. 2011;
Shay & Hagen 2009). Furthermore, the chronic activa-tion of Akt in beta cells could inhibit ERK1/2 activation,
which in turn could have adverse effects on the beta
cell function, such as downregulating insulin gene
expression (Dickson & Rhodes 2004). We propose that
the activation of Akt might be involved in the inhibited
insulin secretion in HIT-T15 cells treated with LA.
The beneficial property of LA as a beta cell anti-
apoptotic agent makes it a potentially useful agent fordiabetes treatment. However, we have shown here
that LA inhibits insulin expression and secretion, as
well HIT-T15 cells proliferation with high glucose cul-
ture. Similar findings are also reported by Targonsky
et al. They found that acute or chronic exposure to LA
can cause a reduction in insulin secretion and inhibit
cells growth in isolated rat islets and MIN6 beta cells
(Targonsky et al. 2006). Therefore, it is a coordinativeeffect of LA to inhibit HIT-T15 cells apoptosis and
insulin secretion to protect and maintain beta cell func-
tion under hyperglycemia.
In our study, we observed apoptosis rate of HIT-T15
cells was increased significantly, meanwhile, we also
ª 2012 The Authors
Development, Growth & Differentiation ª 2012 Japanese Society of Developmental Biologists
LA inhibits HIT-T15 cells apoptosis 563
found cells proliferation rate was increased with highglucose culture. This phenomenon seems to conflict
but could be interpreted as a consequence of islets
cells in response to the hyperglycemia. It has been
reported that in the compensation stage of diabetes,
the numbers of beta cells will be increased and islets
hypertrophy will occur to adapt insulin over-secretion.
However, long-term or chronic elevated glucose con-
centrations will result in beta cell apoptosis, dys-function and ultimately death, a state called
decompensation during the progress of diabetes (Weir
et al. 2001).
In conclusion, our data suggest that a-lipoic acid
can effectively attenuate high glucose-induced HIT-
T15 cell apoptosis mainly by increasing Pdx1 expres-
sion.
Acknowledgments
This work was supported by the National Natural Sci-
ence Foundation of China (30470402, 81071675,
81170713, 81160103), Specialized Research Fund for
the New Teacher in Doctoral Program of Higher
Education (20070001798), Specialized Research Fund
for the Doctoral Program of Higher Education(20060001107), Science Research and International
Cooperation Project of Ningxia Hui Autonomous
Region (NXIC2011010) and the National Natural
Science Foundation of Ningxia (NZ1097). We thank Dr
Jason Wong, University of Cambridge, UK for his kind
help in the preparation of this manuscript.
Author contributions
Yi Yang, Weiping Wang and Chunyan Zhou designed
research; Yi Yang, Weiping Wang, Yinan Liu, Ting Guo
and Ping Chen performed research; Yi Yang, Weiping
Wang and Kangtao Ma analyzed data; Weiping Wang
and Chunyan Zhou wrote the paper.
Competing interests
The funders had no role in study design, data collec-
tion and analysis, decision to publish, or preparation of
the manuscript. The authors declare no conflicts of
interest.
References
Abdin, A. & Sarhan, N. 2011. Intervention of mitochondrial dys-function-oxidative stress-dependent apoptosis as a possibleneuroprotective mechanism of a-lipoic acid against rote-none-induced parkinsonism and L-dopa toxicity. Neurosci.
Res. 71, 387–395.
Artwohl, M., Muth, K., Kosulin, K., de Martin, R., Holzenbein, T.,Rainer, G., Freudenthaler, A., Huttary, N., Schmetterer, L.,Waldhausl, W. K. & Baumgartner-Parzer, S. M. 2007. R-(+)-alpha-lipoic acid inhibits endothelial cell apoptosisand proliferation: involvement of Akt and retinoblastoma pro-tein/E2F-1. Am. J. Physiol. Endocrinol. Metab. 293, E681–E689.
Balkis, B. S., Othman, F., Louis, S. R., Abu, B. M., Radzi, M.,Osman, K., Das, S. & Mohamed, J. 2009. Effect of alpha li-poic acid on oxidative stress and vascular wall of diabeticrats. Rom. J. Morphol. Embryol. 50, 23–30.
Byun, C. H., Koh, J. M., Kim, D. K., Park, S. I., Lee, K. U. &Kim, G. S. 2005. Alpha-lipoic acid inhibits TNF-alpha-induced apoptosis in human bone marrow stromal cells.J. Bone Miner. Res. 20, 1125–1130.
Choi, S. Y., Yu, J. H. & Kim, H. 2009. Mechanism of alpha-lipoicacid-induced apoptosis of lung cancer cells. Ann. N. Y.
Acad. Sci. 1171, 149–155.Dickson, L. M. & Rhodes, C. J. 2004. Pancreatic beta-cell
growth and survival in the onset of type 2 diabetes: a rolefor protein kinase B in the Akt? Am. J. Physiol. Endocrinol.
Metab. 287, E192–E198.Diesel, B., Kulhanek-Heinze, S., Holtje, M., Brandt, B., Holtje, H.
D., Vollmar, A. M. & Kiemer, A. K. 2007. Alpha-lipoic acid asa directly binding activator of the insulin receptor: protectionfrom hepatocyte apoptosis. Biochemistry 46, 2146–2155.
Fujimoto, K. & Polonsky, K. S. 2009. Pdx1 and other factors thatregulate pancreatic beta-cell survival. Diabetes Obes. Metab.
11(Suppl 4), 30–37.Fujimoto, K., Hanson, P. T., Tran, H., Ford, E. L., Han, Z., John-
son, J. D., Schmidt, R. E., Green, K. G., Wice, B. M. &Polonsky, K. S. 2009. Autophagy regulates pancreatic betacell death in response to Pdx1 deficiency and nutrient depri-vation. J. Biol. Chem. 284, 27664–27673.
Gauthier, B. R., Wiederkehr, A., Baquie, M., Dai, C., Powers, A.C., Kerr-Conte, J., Pattou, F., MacDonald, R. J., Ferrer, J. &Wollheim, C. B. 2009. PDX1 deficiency causes mitochondrialdysfunction and defective insulin secretion through TFAMsuppression. Cell Metab. 10, 110–118.
Goraca, A., Huk-Kolega, H., Piechota, A., Kleniewska, P., Ciejka,E. & Skibska, B. 2011. Lipoic acid – biological activity andtherapeutic potential. Pharmacol. Rep. 63, 849–858.
Guo, T., Wang, W. P., Zhang, H., Liu, Y. N., Chen, P., Ma, K. T.& Zhou, C. Y. 2011. ISL1 promotes pancreatic islet cell pro-liferation. PLoS ONE 6, e22387.
Gupte, A. A., Bomhoff, G. L., Morris, J. K., Gorres, B. K. & Gei-ger, P. C. 2009. Lipoic acid increases heat shock proteinexpression and inhibits stress kinase activation to improveinsulin signaling in skeletal muscle from high-fat-fed rats.J. Appl. Physiol. 106, 1425–1434.
Johnson, J. D., Ahmed, N. T., Luciani, D. S., Han, Z., Tran, H.,Fujita, J., Misler, S., Edlund, H. & Polonsky, K. S. 2003.Increased islet apoptosis in Pdx1+/� mice. J. Clin. Invest.
111, 1147–1160.Kamenova, P. 2006. Improvement of insulin sensitivity in patients
with type 2 diabetes mellitus after oral administration ofalpha-lipoic acid. Hormones (Athens) 5, 251–258.
Lee, S. J., Kim, S. H., Kang, J. G., Kim, C. S., Ihm, S. H., Choi,M. G. & Yoo, H. J. 2011. Alpha-lipoic acid inhibits endoplas-mic reticulum stress-induced cell death through PI3K/Aktsignaling pathway in FRTL5 thyroid cells. Horm. Metab. Res.
43, 445–451.Lee, W. J., Song, K. H., Koh, E. H., Won, J. C., Kim, H. S.,
Park, H. S., Kim, M. S., Kim, S. W., Lee, K. U. & Park, J. Y.
ª 2012 The Authors
Development, Growth & Differentiation ª 2012 Japanese Society of Developmental Biologists
564 Y. Yang et al.
2005. Alpha-lipoic acid increases insulin sensitivity by acti-vating AMPK in skeletal muscle. Biochem. Biophys. Res.
Commun. 332, 885–891.Li, Y., Cao, X. Li, X. L., Brubaker, P. L., Edlund, H. & Drucker, D.
J. 2005. beta-Cell Pdx1 expression is essential for the gluc-oregulatory, proliferative, and cytoprotective actions of gluca-gon-like peptide-1. Diabetes 54, 482–491.
Meng, X., Li, Z. M., Zhou, Y. J., Cao, Y. L. & Zhang, J. 2008.Effect of the antioxidant alpha-lipoic acid on apoptosis inhuman umbilical vein endothelial cells induced by high glu-cose. Clin. Exp. Med. 8, 43–49.
Muellenbach, E. M., Diehl, C. J., Teachey, M. K., Lindborg, K.A., Hasselwander, O., Matuschek, M. & Henriksen, E. J.2009. Metabolic interactions of AGE inhibitor pyridoxamineand antioxidant alpha-lipoic acid following 22 weeks of treat-ment in obese Zucker rats. Life Sci. 84, 563–568.
Piconi, L., Quagliaro, L., Assaloni, R., Da, R. R., Maier, A., Zuo-dar, G. & Ceriello, A. 2006. Constant and intermittent highglucose enhances endothelial cell apoptosis through mito-chondrial superoxide overproduction. Diabetes Metab. Res.
Rev. 22, 198–203.Robertson, R., Zhang, H., Pyzdrowski, K. & Walseth, T. 1992.
Preservation of insulin mRNA levels and insulin secretion inHIT cells by avoidance of chronic exposure to high glucoseconcentrations. J. Clin. Invest. 90, 320–325.
Salinthone, S., Yadav, V., Schillace, R. V., Bourdette, D. N. &Carr, D. W. 2010. Lipoic acid attenuates inflammation viacAMP and protein kinase A signaling. PLoS ONE 28, pii:e13058.
Shay, K. P. & Hagen, T. M. 2009. Age-associated impairment ofAkt phosphorylation in primary rat hepatocytes is remediatedby alpha-lipoic acid through PI3 kinase, PTEN, and PP2A.Biogerontology 10, 443–456.
Shi, D. Y., Liu, H. L., Stern, J. S., Yu, P. Z. & Liu, S. L. 2008.Alpha-lipoic acid induces apoptosis in hepatoma cells viathe PTEN/Akt pathway. FEBS Lett. 582, 1667–1671.
Tanaka, Y., Tran, P. O., Harmon, J. & Robertson, R. P. 2002. Arole for glutathione peroxidase in protecting pancreatic betacells against oxidative stress in a model of glucose toxicity.Proc. Natl Acad. Sci. USA 99, 12363–12368.
Targonsky, E., Dai, F., Koshkin, V., Karaman, G., Gyulkhanda-nyan, A., Zhang, Y., Chan, C. & Wheeler, M. 2006. Alpha-lipoic acid regulates AMP-activated protein kinase andinhibits insulin secretion from beta cells. Diabetologia 49,1587–1598.
Varkonyi, T. & Kempler, P. 2008. Diabetic neuropathy: new strat-egies for treatment. Diabetes Obes. Metab. 10, 99–108.
Wang, H. W., Mizuta, M., Saitoh, Y., Noma, K., Ueno, H. & Nak-azato, M. 2011a. Glucagon-like peptide-1 and candesartanadditively improve glucolipotoxicity in pancreatic b-cells.Metabolism 60, 1081–1089.
Wang, X., Liu, Y., Yang, Z., Zhang, Z., Zhou, W., Ye, Z., Zhang,W., Zhang, S., Yang, Z., Feng, X., Chen, F. & Hu, R. 2011b.Glucose metabolism-related protein 1 (GMRP1) regulatespancreatic beta cell proliferation and apoptosis via activationof Akt signalling pathway in rats and mice. Diabetologia 54,852–863.
Wang, Y., Li, X., Guo, Y., Chan, L. & Guan, X. 2010. alpha-Li-poic acid increases energy expenditure by enhancing adeno-sine monophosphate-activated protein kinase-peroxisomeproliferator-activated receptor-gamma coactivator-1alphasignaling in the skeletal muscle of aged mice. Metabolism
59, 967–976.Weir, G. C., Laybutt, D. R., Kaneto, H., Bonner-Weir, S. & Shar-
ma, A. 2001. Beta-cell adaptation and decompensation dur-ing the progression of diabetes. Diabetes 50, S154–S159.
ª 2012 The Authors
Development, Growth & Differentiation ª 2012 Japanese Society of Developmental Biologists
LA inhibits HIT-T15 cells apoptosis 565