i

به همسر نازنینم...مهسا

To my dearest… Mahsa

ii

Promotor: Prof. Dr. ir. Monica Höfte Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium

Dean: Prof. Dr. ir. Guido Van Huylenbroeck

Rector: Prof. Dr. Paul Van Cauwenberge

iii

Hamed Soren Seifi

Key roles of glutamate metabolism and cuticle permeability in the

multifaceted defense response of the abscisic acid deficient sitiens

tomato mutant against Botrytis cinerea

Thesis submitted in partial fulfilment of the requirements for the degree of

Doctor (PhD) in Applied Biological Sciences

iv

Dutch translation of the title:

De sleutelrol van het glutamaat metabolisme en de permeabiliteit van de cuticula in de

veelzijdige afweerrespons van de abscisinezuur-deficiënte tomaat mutant sitiens tegen Botrytis

cinerea

Cover illustration:

The painting’s name is “Christ carrying the cross” created by the Flemish Renaissance artist

Pieter Bruegel (1525–1569). The painting is now kept at Kunsthistorisches Museum in Vienna,

Austria. The event of “Christ carrying the cross” had been a very popular subject for many

Renaissance painters around the world; legendary artists like Michelangelo, Raphael and Della

Francesca. Commonly, in their paintings of this subject, a rather large-sized figure of Jesus has

been painted in the center of the canvas, forming the most important focus and often the only

important figure of the drawing. However, what Pieter Bruegel has exceptionally created,

depicts a totally different vision towards the world. As it can be seen in this miniature version of

Bruegel's massive painting, Jesus (in the center) is barely visible. There is not only one main

focus in this work, but there are villagers, peasants, soldiers, housewives etc, having been

painted (and seen) as large as Jesus. That's part of Bruegel's message. In fact, the true genius

Pieter Bruegel has delineated a multi-central world, in which many different important parts

exist and interact with each other. I found this amazing artistic masterpiece, somehow, relevant

to my research story: A multi-central world of different defense mechanisms, synergistically

interacting with each other to ultimately shape a multifaceted resistance response in the sitiens

mutant.

ISBN-number: 978-90-5989-623-9

The author and the promoter give the authorization to consult and to copy parts of this work

for personal use only. Every other use is subject to the copyright laws. Permission to reproduce

any material contained in this work should be obtained from the author.

v

Acknowledgements

فردوسی -اندرخورد گفتن جایگه بدین خرد وصف خردمند ای کنون

Speak now sage! The praise of wisdom and rejoice – Ferdowsi, Persian poet, 940-1020

It was such a great opportunity for me to join the Phytopathology lab. A truly international lab

with a vibrant atmosphere of research, filled with the warmth of friendship. First of all, I would

like to express my sincere gratitude to my promoter Prof. Monica Höfte for accepting me to be

part of her lab. Monica, without your constant supports and invaluable encouragements during

all these years, reaching this stage would have not been possible for me. I learned many

valuable lessons from you, not only about how to become “a good scientist“ (as you always

phrased), but beyond that, about decency, commitment and sincerity.

I am also deeply indebted to Ana and Peter Bossier, for their warm-hearted support and

unwavering trust. Dear Ana and Peter, I still clearly remember those very days in Urmiah, when

I met you for the first time. That brief visit actually opened a new horizon for me, not only

academically, but as well as personally. Thanks for everything you’ve done to support me

during all these years.

I am very grateful to Katrien Curvers. Dear Katrien, since the moment that I came to Belgium,

you have kindly helped me, not only in my very first lab experiments (and very last ones of

course!), but in many other things. Katrien, you are a precious friend for me and Mahsa, and I

never forget all your valuable supports and encouragements during different stages of my

research. Dear Valeri, I feel so close to you man and you’re just like my brother. Mahsa and I

shall never forget your generosity, support, warmth and kindness. Dear Soraya, you’re a very

nice lady. I think your beautiful Persian name suits well your beautiful personality. You are

caring and kind, and it’s been a great pleasure for me to meet you. Dear David, the Lionel

Messi of our research team! I really admire your generosity in sharing your rich scientific

vi

knowledge with others. Your brilliant scientific work and ambitious ideas have actually raised

the level of research at our lab. I learned a lot from you man, and I really appreciate your

support throughout my PhD. I also heartily hope that Barca would come back soon to its

sensational wining days! Dear Ilse, Nathalie and Jing, my great friends/officemates! We have

had awesome time together during these years. Thanks for your wonderful friendship and

support; and thanks for sharing all those nice moments with me. I always believed (and still

believe) that our office is the best office that could possibly exist on Earth!

I am also very thankful to all my (former) colleagues and staff of the Phytopathology lab for

their friendship and support: Jolien, Jasper, Sarah, Joke, Orelvis, Zabih, Yaquelyn, Katrien DM,

Saman, Eveline, Jonas, lieselotte, Lien B, Lien T, and …

And to my family and Iranian friends:

از مادرم، پدرم و خواهرم گلنوش با تمام وجودم سپاسگزاری می کنم برای عشق بی انتها و حمایت های بی دریغشان .

بوده. جای شما در جشن پایان تحصیلم خیلی خالی خواهد بود. برای من دوری از شما تلخ ترین رویداد این چند سال

عاشقانه دوستتون دارم و آرزو میکنم که روزی بیاد که باز هممون کنار هم باشیم. کاش که ایران عزیز ما دوباره "سبز"

ر هرگز مجبور نباشن بشه و جایی بشه که همه ایرانیها بتونن اونجا شاد و شرافتمندانه زندگی کنن؛ تا بچه های ایران دیگ

که در جستجوی "زندگی"، خانواده و سرزمینشون رو ترک کنن. به امید آنروز...

جای هما جان، محمود خان، احسان و آرزوی عزیز در جشن پایان تحصیلم بسیار خالی خواهد بود. هیچ گاه گرمای محبت

قلب من جا دارین. و مهربانی های شما رو فراموش نخواهم کرد. شما همیشه و همیشه در

درود بر دوستان نازینینم در گنت که در این چند سال دوری از ایران، جای خالی خانواده هامون رو برای من و مهسا پر

کردید. روزهای به یاد موندنی بسیاری رو با هم سپری کردیم. از تک تک شما برای مهربانیتون سپاسگزارم. پونه و

مروارید، مریم و نیما، فرشته و منصور، فرزانه و بهروز، شیدا و محمد، آزاده و سریه سامان، زینب و سپهر، سارا و

و... همچنین دوست دارم که یادی بکنم از دوستان قدیمی که از پیش ما رفتند: لیال، مریم و عادل عزیز که جاشون خیلی

های علمی و کمک های فکری ارزشمندی خالیه. یک سپاسگزاری ویژه هم از آقا منصور و پونه عزیز دارم، برای مشورت

!که هر گاه الزم داشتم دریغ نکردند. دوستی ها پایدار

گرمترین واژه های سپاسگزاری ام و این پایان نامه رو به همسر نازنینم مهسا پیشکش می کنم. مهسا...تا اینجای زندگی

و من هرگز و هرگز توان ادامه این راه رو نداشتم. مشترکمون راه پر نشیب و فرازی رو با هم اومدیم. می دونم که بدون ت

برای همه چیز ازت ممنونم. مهسای نازم... دوستت دارم.

vii

viii

List of abbreviations

ABA abscisic acid

AS asparagine synthetase

Avr avirulence

BHN broad host-range necrotroph

cDNA complementary DNA

COS chitosan

DAB 3,3’-diaminobenzidine

DP degree of polymerization

dpi days post inoculation

EBM egg-box molecule

GABA γ-amino butyric acid

GABA-T GABA-transaminase

GAD glutamate decarboxylase

GDH glutamate dehydrogenase

GM glutamate metabolism

GS1 cytosolic glutamine synthetase

GS2 chloroplastic glutamine synthetase

GSH glutathione

GS/GOGAT glutamine synthetase/glutamate oxoglutarate aminotransferase

H2O2 hydrogen peroxide

hpi hours post inoculation

HR hypersensitive response

HSN host-specific necrotroph

Hrp hypersensitive response and pathogenicity

i

ix

IR induced resistance

JA jasmonic acid

mETC mitochondrial electron transfer chain

NO nitric oxide

PA polyamine

PAL phenylalanine ammonia lyase

OGA oligogalacturonide

PAMPs pathogen-associated molecular patterns

PCD Programmed cell death

PDS phytoene desaturase

PG polygalacturonase

PR pathogenesis-related

R-gene resistance gene

ROS reactive oxygen species

SA salicylic acid

SAG senescence-associated gene

SAR systemic acquired resistance

Sit sitiens

SSA succinate semialdehyde

SSADH SSA dehydrogenase

TCA tricarboxylic acid

TRV tobacco rattle virus

WT wild type

ii

x

xi

Table of contents

List of abbreviations

i

Chapter 1 Problem statement and thesis outline 1

Chapter 2 Glutamate metabolism in plant disease and defense: friend of foe? 9

Chapter 3 Concurrent over-activation of the cytosolic glutamine synthetase and the GABA-shunt in the abscisic acid-deficient sitiens mutant of tomato leads to resistance against Botrytis cinerea

37

Chapter 4 The role of asparagine synthetase in B. cinerea-tomato interaction 75

Chapter 5

Characterization of ammonium nitrate induced-resistance against Botrytis cinerea in tomato

83

Chapter 6 Abscisic acid deficiency causes changes in cuticle permeability and pectin composition that influence tomato resistance to Botrytis cinerea

97

Chapter 7 Further characterization of potential signaling components involved in sitiens defense response to B. cinerea

127

Chapter 8 General conclusions and perspectives 143

Summary 155

Samenvatting 159

References 165

Curriculum Vitae

189

xii

1

Chapter

1

Problem statement and thesis outline

lants are frequently challenged by a wide variety of microbial pathogens. Plant pathogens

are often categorized into three major groups based on their lifestyles, namely biotrophs,

necrotrophs and hemibiotrophs. Biotrophic pathogens need living host tissue to establish their

life cycle, whereas necrotrophs kill host cells first, and then feed on the dead tissue. A third

group, hemibiotrophs, exhibit an early biotrophic phase followed by a necrotrophic lifestyle in

later stages of infection. Therefore, it can be presumed that an efficient defense response

against pathogens with different lifestyles, may demand distinct mechanisms.

Complete resistance to biotrophic pathogens normally follows the ‘gene-for-gene’ hypothesis,

discovered and coined by Harold Henry Flor (Flor 1956). According to this hypothesis,

interaction between the product of a certain avirulence gene (Avr-gene) of the pathogen and

the corresponding recognition protein in the plant, encoded by the resistance gene (R-gene),

results in rapid activation of defense responses. These R-gene-mediated resistance responses

typically entail rapid production of reactive oxygen species (ROS), called ‘oxidative burst’,

resulting in an active form of programmed cell death (PCD), named hypersensitive response

(HR) in the challenged tissue. In synergy to the HR cell death, de novo synthesis of various

antimicrobial proteins (PR proteins) and secondary metabolites (phytoalexines) can ultimately

impede pathogen colonization. In contrast, there is no R-gene model of resistance (monogenic

P

2

resistance, vertical resistance) known to be effective against necrotrophic pathogens.

Moreover, since most of necrotrophs benefit from host cell death, they may not be limited by

ROS-mediated, HR-dependent defense responses. Necrotrophs are further categorized into two

main groups: 1. host-specific necrotrophs (HSNs), infecting through secretion of host-specific

toxins essential for their pathogenicity, and 2. broad host-range necrotrophs (BHNs), possessing

various forms of virulence factors. Although resistance mechanisms against host specific

necrotrophs such as Cochliobolus carbonum, have been fairly well explained, resistance to

broad host-range necrotrophs, such as Botrytis cinerea, seems to be more complex (Mengiste

2012).

Botrytis cinerea (teleomorph: Botryotinia fucheliana) is the causal agent of the gray mold

disease (or Botrytis blight) with a broad host range, attacking over 200 species worldwide (Van

Kan, 2006), with very few reports of host resistance (Williamson et al., 2007). Recently, B.

cinerea was announced to be the most scientifically/economically important necrotrophic

fungal plant pathogen (Dean et al., 2012). Although there are some chemical controls available

for Botrytis blight, many classes of fungicides have failed due to the genetic plasticity of this

ascomycete (Williamson et al., 2007). Commonly, more severe Botrytis infections occur during

cool (15-18 °C) rainy seasons in places having a dimmer light. Presence of small wounds or

necrotized plant tissue may also increase the chance of Botrytis infection. B. cinerea is

characterized by abundant conidia (asexual spores), borne on tree-like conidiophores that are

branched from the vegetative mycelia of the fungus. B. cinerea overwinters in dead plant debris

forming compact and hard masses of mycelia, termed as sclerotia. In the next spring, sclerotia

germinate, developing fresh sporulating mycelia. New conidia can be then wind-borne or

water-splashed to cause new infections, completing the life cycle of the fungus (Fig 1-1).

3

Figure 1-1. The life cycle

of B. cinerea, (Figure

adapted from

http://www.nicks.com.au/

index.aspx).

Our lab has previously shown that abscisic acid (ABA) deficiency in the sitiens mutant of

tomato, blocked in aldehyde oxidase, the last step in the ABA biosynthetic pathway (Fig. 1-2),

results in a strong resistance response to the necrotrophic fungal pathogen B. cinerea

(Audenaert et al., 2002). It has been also demonstrated that the defense mechanism

underpinning this resistance response involves a rapid epidermal production of hydrogen

peroxide (H2O2) followed by a highly localized HR and cell wall fortifications, which ultimately

impede further spreading of the pathogen (Asselbergh et al., 2007). However, application of

exogenous ABA during the development of the mutant restores the disease susceptibility to

wild type levels (Asselbergh et al., 2007). Moreover, Tom1 tomato arrays were used to compare

wild type and sitiens plants at 0 and 8 hours post inoculation (hpi) with B. cinerea. After

extensive statistical analysis 240 genes appeared to be significant differentially induced in

response to the pathogen infection. Microarray analysis revealed that in addition to groups of

genes coding for pathogenesis related (PR) proteins and enzymes related to cell-wall structure

being upregulated, expression of a cluster of genes involved in primary amino acid metabolism

4

significantly increased in the resistant mutant at 8 hours post inoculation (hpi) (Asselberg et al.,

2007). However, the cause and the presumable role of these primary metabolism-associated

transcriptional alterations in the resistance mechanism of sitiens against B. cinerea remained

unclear.

Figure 1-2. ABA biosynthesis pathway in the plant cell. The mutation in the sitiens mutant of tomato has occurred in the aldehyde oxidase gene, catalyzing the last step of ABA biosynthesis. IPDP: isopentenyl diphosphate (the main precursor for ABA biosynthesis); AO: aldehyde oxidase.

The primary objective of the current study was to further characterize the sitiens-B. cinerea

interaction, as a model pathosystem in which a strong resistance response against a true

necrotrophic pathogen has been observed. Our results may provide further insights into better

understanding of the complex defense mechanisms against broad host-range necrotrophs. In

this work, we mainly sought to deal with three essential questions:

1. Do the observed alterations in the genes involved in primary amino acid metabolism in

sitiens play an influential role in the defense response against B. cinerea?

5

2. Is there a link between the rapid epidermal defense response, reported previously

(Asselbergh et al., 2007), and the observed alterations in primary amino acid

metabolism in the sitiens mutant.

3. How can the seemingly, fast and timely perception of the pathogen, resulting in the

rapid epidermal defense reaction of sitiens in response to B. cinerea, be mechanistically

explained?

This dissertation possesses two main parts, devoted to deal with the aforementioned essential

questions. In the first part (Chapters 2, 3 and 4), the main focus has been laid on the role of

primary metabolism during plant-pathogen interactions, particularly the incompatible sitiens-B.

cinerea model pathosystem. Chapter 2 is dedicated to a comprehensive overview of the current

knowledge on the role of primary amino acid metabolism (glutamate metabolism) in plant

defense responses against phytopathogens. Further evaluation and synthesis of the

information collected in the review led us to a conceptual model describing how

reconfigurations in the host glutamate metabolism may affect the ultimate outcome of the

defense response against different pathogenic lifestyles.

In Chapter 3, we explore the possible interconnection between alterations in primary amino

acid metabolism and the resistance response of sitiens against B. cinerea. Using transcriptional,

enzymatic and metabolic analyses, we found that over-activation of both GABA metabolism and

the glutamine synthetase/glutamate synthase (GS/GOGAT) cycle, are critically involved in the

sitiens defense response against B. cinerea, leading to a secondary anti cell-death defense

mechanism in the mesophyll that suppresses the pathogen-induced senescence in later stages

of the interaction. This may suggest an important role for plant central C/N metabolism in

shaping an effective resistance response against necrotrophic pathogens. Additionally, in this

chapter, a possible link between the primary epidermal ROS-mediated defense response

(Asselbergh et al., 2007), and the secondary GABA-GS/GOGAT-dependent reaction has been

proposed. In Chapter 4, which is an addendum to the previous chapter, the possible role of the

senescence-associated gene, asparagine synthetase in the B. cinerea-tomato interaction has

been explored.

6

Chapter 5 presents a study on the role of nitrogen supplementation on the tomato-B.cinerea

interaction. We brought up evidence showing that root-supplementation of ammonium nitrate

(AN) to the commonly susceptible wild-type tomato, results in increased resistance against the

gray mold disease. Further characterization of the observed resistance in the wild-type plant

revealed no sign for a rapid ROS-mediated defense mechanism, similar to the early epidermal

reaction in the sitiens mutant. Instead, a late mesophyllic restriction of B. cinerea growth,

mimicking the secondary phase of the sitiens defense response (described in Chapter 3), was

observed in this type of AN-induced resistance.

In the second part of the dissertation (chapters 6 and 7), we assess early signaling events during

the sitiens-B. cinerea interaction. In Chapter 6, the main focus of the dissertation is shifted to

the signaling and elicitation aspects of the sitiens resistance response. We present evidence

that ABA deficiency has resulted in marked changes in the cell-wall and cuticle structures in the

sitiens mutant. It is shown that the cuticle of sitiens leaves is more permeable than that of wild-

type plants; and more importantly, cuticle permeability and resistance to B. cinerea are

positively correlated in the mutant, while such link cannot be seen in the wild type. In the end,

a schematic model is proposed, explaining how these structural differences may lead to a

successful resistance response in the sitiens mutant. Chapter 7 is a continuation of the previous

study (Chapter 6). In this chapter, the possible nature of elicitation-associated components of

the sitiens-B. cinerea interaction has been further investigated.

Finally, in Chapter 8, we try to derive some important overall conclusions form our study, and

provide final answers to the essential questions posed in this chapter. Furthermore, we

propose some fertile targets for future research.

7

8

9

Chapter

2

Glutamate metabolism in plant disease and defense: friend or foe?

Hamed Soren Seifi, Jonas Van Bockhaven, Geert Angenon and Monica Höfte

Published in Molecular Plant-Microbe Interactions 2013, 26 (5):475-485

he plant glutamate metabolism (GM) plays a pivotal role in amino acid metabolism and

orchestrates crucial metabolic functions with key roles in plant defense against pathogens.

These functions concern three major areas: nitrogen transportation via the GS/GOGAT cycle,

cellular redox regulation, and TCA cycle-dependent energy reprogramming. During interactions

with pathogens the host GM is markedly altered leading to either a metabolic state, termed as

‘endurance’, in which cell viability is maintained; or to an opposite metabolic state, termed as

‘evasion’, in which the process of cell death is facilitated. It seems that endurance-natured

modulations result in resistance to necrotrophic pathogens and susceptibility to biotrophs,

whereas evasion-related reconfigurations lead to resistance to biotrophic pathogens, but

stimulate the infection by necrotrophs. Pathogens, however, have evolved strategies, such as

toxin secretion, hemibiotrophy and selective amino acid utilization, to exploit the plant GM to

their own benefit. Collectively, it seems that alterations in the host GM in response to different

pathogenic scenarios function in two opposing ways, either backing the ongoing defense

strategy to ultimately shape an efficient resistance response, or being exploited by the

pathogen to promote and facilitate infection.

T

10

Introduction

The dynamic co-evolutionary conflict between phytopathogens and plants over the host

nutritional resources has shaped distinct invasion strategies. Pathogens with biotrophic lifestyle

need living cells to ensure supplies for their growth and reproduction, while necrotrophs prefer

dying tissues. Plants, on the other hand, have devised sophisticated mechanisms to deprive

pathogens of nutrients. Upon timely perception of the presence of pathogenic micro-

organisms, a resistant plant is capable of deploying assorted types of defense strategies to halt

pathogen progress. These strategies range from constructing physical barriers (e.g., reactive

oxygen species (ROS)-dependent cross-linking of structural proteins in the cell wall), to de novo

synthesis of various anti-microbial compounds (e.g., PR proteins or phytoalexins). The

regulation of genes controlling these well-established defense strategies has been extensively

studied through transcriptional profiling studies, particularly on incompatible plant-pathogen

interactions. Commonly, these gene expression analyses also report marked alterations in

transcriptional levels of genes encoding pathways related to primary metabolism, suggesting

some roles for host central carbon/nitrogen metabolism in relation with defense mechanisms.

There are dozens of research studies corroborating the link between primary metabolism and

plant-pathogen interactions (reviewed by Berger et al. 2007). The indispensable role of host

primary metabolism in plant defense machinery has been recently reviewed (Bolton 2009).

However, molecular knowledge on the role of central carbon/nitrogen metabolism in plant

defense mechanisms against different pathogenic behaviors is still scarce (Liu et al. 2010).

Nitrogen (N) is an essential element for plant growth and development. The assimilation of N

onto carbon (C) skeletons is the entry point for the newly-uptaken nitrogen (NO3- and NH4

+)

into the plant central metabolism (Lam et al. 1996). In higher plants, this physiologically crucial

assimilation is carried out by the enzyme glutamine synthetase (GS), via the GS/glutamate

synthase (GOGAT) cycle (Forde and Lea 2007; Cren and Hirel 1999). Being at the interface of

central C and N metabolism, the GS/GOGAT cycle constitutes a metabolic node with a pivotal

position in plant amino acid metabolism via which the amino acid glutamate is continuously

metabolized (Lam et al. 1996). Glutamate metabolism (GM) is known to play a central role in

11

plant amino acid metabolism, orchestrating crucial metabolic functions including:

assimilation/dissimilation of ammonia, amino acid transamination and providing both the

carbon skeleton and α-amino group for biosynthesis of amino acids with key roles in plant

defense such as γ-aminobutyric acid (GABA), arginine and proline (Galili et al. 2001; Forde and

Lea 2007). Thus, it seems that proper investigation of the interaction between plant central C/N

metabolism and defense mechanisms needs specific focus on the alterations in the host

glutamate-mediated central metabolism during challenge with pathogens.

In this review we categorize GM-related pathways that are altered in response to pathogen

invasion in three major areas: 1. N remobilization/reutilization, 2. Host cell death/viability and

3. Tricarboxylic acid (TCA) cycle exhaustion/replenishment. We hypothesize that these

alterations can ultimately result in two opposite metabolic states, namely ‘endurance’ and

‘evasion’. We define ‘endurance’ as a state in which cell viability is maintained via N

reutilization through the GS/GOGAT cycle, ROS scavenging, or by replenishment of the TCA

cycle. In contrast ‘evasion’ is defined as a state that facilitates the process of cell death via N

remobilization away from the GS/GOGAT cycle, ROS generation, or by exhausting the TCA cycle

(Fig. 2-1). How these GM modulations in response to pathogens with different lifestyles will

lead to resistance or susceptibility will be further discussed.

12

Figure 2-1. Three major conflicts between the host glutamate metabolism and different pathogen virulence strategies. An integrated model of GM-dependent metabolic pathways, reported to be influential on plant defense responses. Green arrows indicate pathways associated with ‘endurance’, and red arrows indicate pathways facilitating ‘evasion’. The central role of glutamate in supplying different defense-associated pathways can be seen in this model, as suggested previously (Galili et al. 2001; Brauc et al. 2011). ARGAH: arginase; AS: Asn synthetase; AST: Asp transaminase; GAD: Glu decarboxylase; γ-GC: gamma glutamylcysteine; GDC: glycine decarboxylase; GDH: Glu dehydrogenase; GOGAT: Gln-oxoglutarate aminotransferase; GOX: glycolate oxidase; GS: Gln synthetase; GSH: glutathione; GSHS: GSH synthetase; NOS: nitric oxide synthase; OCT: Orn carbamoyl-transferase; OG: oxoglutarate; PAO: polyamine oxidase; P5C: ∆1-pyrroline -5-carboxylate.

I. Nitrogen remobilization/reutilization

Amino acids as nutritional sources for pathogens. The premise that plant pathogens actively

vie for a reliable N source in planta seems to be widely accepted (Pieterse et al. 1993; van den

Ackerveken et al. 1994; Pérez-Garcia et al. 2001; Bolton & Thomma 2008). It is also known that

all N needed for fungal pathogen growth is derived from plant sources, including nitrate,

ammonia and amino acids (Solomon et al. 2003). In addition, for some fungal pathogens

13

utilization of amino acids seems to be generally preferred over inorganic N uptake (Walters and

Bingham 2007). For instance, to supply the demand for organic nitrogen, the biotrophic fungal

pathogen Ustilago maydis, has been reported to modulate the allocation flow of amino acids in

its host maize, to be mainly transported to the infection tumors (Horst et al. 2010). Likewise, in

the compatible interaction between tomato and the biotrophic ascomycete Cladosporium

fulvum, increased apoplastic levels of GABA in infected tissues have been suggested to be

associated with the pathogen acquisition of a N source (Solomon and Oliver 2001 and 2002).

Some bacterial pathogens have also nutritionally evolved to utilize amino acids that are present

in their hosts as both C and N sources. For example, while non-pathogenic strains of the genus

Pseudomonas show potent nutritional versatility in the assimilation of various amino acids, the

pathogenic P. syringae pv. tomato has been demonstrated to be nutritionally specialized to

catabolize the abundant amino acids in the tomato apoplast, such as GABA, aspartate,

glutamate and glutamine (Rico and Preston 2008).

N transportation ‘away’ from the challenged cell (remobilization). The inter-dependency

between the pathogen C and N needs and the plant central C/N metabolism makes the basic

substrate for a metabolic battle in which host GM plays a central role. In angiosperms, there are

two distinct GS isoforms, cytosolic (GS1) and chloroplastic (GS2), which possess two different

physiological roles in plant metabolism. GS1 is commonly believed to be involved in ammonium

re-assimilation during natural and stress-induced senescence, as the GS1 transcript is known as

a putative senescence-associated gene (SAG)/marker. GS2, though, plays a crucial role in

amino acid anabolism via assimilation of ammonium obtained from nitrate reduction and

photorespiration (Perez-Garcia et al. 1998; Bernard and Habash 2009). Early upregulation of

several plant SAGs, such as GS1 and asparagine synthetase (AS), in response to pathogenic

infections has been repeatedly reported (Abuqamar et al. 2006; Pageau et al. 2006). Both

asparagine and glutamine are key intermediates in N metabolism with a prominent role in

nitrogen transport in higher plants (Lam et al. 1996). However, asparagine is known as a more

efficient N-transport compound due to its higher N:C ratio (2:4) compared with glutamine (2:5)

(Kim et al. 1999). In some (hemi)biotrophic interactions, a rapid and strong invasion-triggered

senescence is considered as an effective defense strategy, termed as ‘slash-and-burn’ defense

14

strategy (Tavernier et al. 2007). This defense strategy consists of a timely and efficient

remobilization of ammonium, in the form of asparagine and/or glutamine, away from the

invaded area to the phloem. The rapid N export out of the challenged tissue may either protect

the host N content or deprive the N-starving pathogen of its nutritional target. Pageau et al.

(2006) reported a marked and early (2 hours post inoculation (hpi)) induction of GS1 during an

incompatible interaction between tobacco and the hemibiotrophic P. syringae, which was

independent of HR induction. Accordingly, rapid accumulation of GS1 mRNA, paralleled with

the defense-related genes chalcone synthase (CHS) and phenylalanine ammonia lyase (PAL),

were observed in an incompatible interaction between common bean and the hemibiotrophic

pathogen Colletotrichum lindemuthianum (strain R255) (Tavernier et al. 2007). In tomato leaves

infected by P. syringae, the expression of GS1 coupled with AS1 was postulated to be

responsible for forming a metabolic draining route, from the cytosol of challenged cells into the

phloem. Through this route, the host transfers high levels of asparagine, carrying the free

ammonia released by amino acid catabolism, out of the invaded area (Olea et al. 2004). A rapid

(5 hpi) and strong induction of AS1 in pepper was shown to be essential for resistance against

the hemibiotrophic bacterial pathogen Xanthomonas campestris pv. vesicatoria, whereas later

(15-20 hpi) induction of the enzyme was associated with susceptibility (Hwang et al. 2011).

These results highlight again the importance of ‘timeliness’ in the ‘slash and burn’ defense

strategy. The same defensive phenomenon was also observed in transgenic Arabidopsis plants

overexpressing pepper AS1, against P. syringae and the biotrophic oomycete Hyaloperonospora

arabidopsidis (Hwang et al. 2011). Interestingly, P. syringae pv. tabaci seems to be able to

neutralize this defensive N-translocation via secretion of a dipeptide toxin, named tabtoxin,

which irreversibly inhibits GS activity resulting in an excess accumulation of free ammonia in

the host tissue (Turner 1981; Thomas et al. 1983). In the same vein, drastic depletion of the GS2

isoform in infected leaves of tomato has been shown to be associated with the pathogenicity of

P. syringae pv. tomato (Perez-Garcia et al. 1995).

N transportation ‘towards’ the challenged cell (reutilization). The efficacy of above-mentioned

senescence-natured, slash-and-burn defense responses seems to be dependent on the

pathogen’s lifestyle. In fact, for some necrotrophic pathogens, like the ascomycete Botrytis

15

cinerea, induction of senescence in the host tissue is known as a mode of pathogenicity

(Swartzberg et al. 2008). Therefore, it could be hypothesized that an opposite defense strategy,

i.e. translocation of N towards the invaded area in order to supply central metabolism of the

challenged cells, could be effective for a resisting host. For instance, drastic depletion in

glutamate storage in distal non-invaded regions of sunflower was postulated as a defensive

reaction against B. cinerea. Through this mechanism, infected sunflower plants were presumed

to provide N supply to be reutilized in the challenged area, eventually delaying the necrotroph-

induced senescence (Dulermo et al. 2009). In the same vein, overexpression of glutamate

receptors (transporters) increased ammonium transportation within the challenged cells in

transgenic Arabidopsis plants, resulting in delayed senescence and increased levels of

resistance against B. cinerea (Kang et al. 2006). This may also explain observed levels of

resistance against B. cinerea in Arabidopsis lines over-expressing arginase, an urea generating

enzyme which eventually supplies the GS/GOGAT cycle with ammonium (Brauc et al. 2012).

Interestingly, the necrotrophic pathogen Cochliobolus victoriae seems to be able to induce

senescence in oat by interrupting the GS/GOGAT-mediated N-reutilization, as an effective

counter strategy. Secreting a host-selective toxin, victorin, the fungus targets glycine

decarboxylase (GDC) the mitochondrial enzyme converting glycine to serine, which also feeds

the photorespiration-derived ammonium into the GS/GOGAT cycle (Navarre and Wolpert

1999). Through the inhibition of the GS/GOGAT-supplying GDC enzyme, the pathogen may

neutralize this anti-senescence defense strategy in its host.

II. Host cell death/viability

The life span of a cell is controlled by many processes, but one of the determining factors is the

cellular redox balance (De Gara et al. 2003). In general, a more reductive balance lengthens the

cell life span while oxidative stress leads to senescence and cell death. In plants, metabolic

redox-dependent regulation of cell longevity plays a prominent role in shaping the overall

response to different environmental stimuli including biotic stresses (Foyer and Noctor 2005).

16

On the other hand, pathogens can find ways to exploit these mechanisms in order to induce

susceptibility in plants.

Programmed cell death (PCD)

PCD is mainly controlled by perturbation in cellular redox balances through generation of

different ROS such as hydrogen peroxide (H2O2) (De Gara et al. 2003; Van Doorn et al. 2011).

One of the best-studied type of PCD reactions in plant cells is the host hypersensitive cell death

(HR), a pervasive feature seen in incompatible plant-pathogen interactions (Dangl and Jones

2001). In this context, glutamate metabolism, embodying complex ROS generating/scavenging

machinery, could also be considered as a spatiotemporally important determinant of the host

redox status during pathogen infection. It is noteworthy to underline that ROS-triggered HR

may be particularly effective against pathogens with biotrophic (or often hemibiotrophic)

lifestyles, due to the necessity of viable nutrition sources for these type of parasites. However,

some necrotrophic pathogens may favor, or even induce, ROS-mediated cell death in their host

tissue for a successful invasion (Van Baarlen et al. 2004; Govrin et al. 2000).

Photorespiratory ROS generation. Photorespiration is known as one of the main secondary

sources of ammonium generation in the plant cell (Lea and Azevedo 2007), connecting the

Calvin cycle to the GS/GOGAT cycle (Fig. 2-1). The key ROS-generating component of plant

amino acid metabolism is the photorespiratory enzyme glycolate oxidase (GOX). The

peroxisomal GOX enzyme also converts glycolate into glyoxylate, the main substrate for several

key aminotransferases involved in amino acid metabolism (Fahnenstich et al. 2008).

Although the plasma membrane-bound NADPH oxidases are commonly known as the main

sources of ROS production during HR, the ROS generated by intracellular organelles

(mitochondria, chloroplasts and peroxisomes) have been also shown to play an important role

in initiating and shaping a HR reaction (Zurbriggen et al. 2010). The HR-dependent resistance in

the melon genotype PI to the biotrophic oomycete pathogen Pseudoperonospora cubensis was

shown to be controlled by three photorespiratory enzymes: glycolate oxidase (GOX), serine

glyoxylate aminotransferase (SGAT) and glutamate:glyoxylate aminotransferase (GGAT)

17

(Kenigsbuch and Cohen 1992; Taler et al. 2004). It was revealed that the HR, responsible for the

arrest of the pathogen in the resistant genotype, was linked to the higher expression of SGAT

and GGAT genes, presumably via the over-activation of the ROS generating enzyme (GOX)

(Taler et al. 2004). GOX is also known to play a role in H2O2-fueled nonhost resistance in

tobacco and Arabidopsis against nonhost strains of P. syringae (Rojas et al. 2012). The latter

work showed that alleviated H2O2 production in GOX-silenced plants is independent of the

oxidative burst mediated by NADPH oxidase, suggesting GOX as an alternative source for ROS

production during HR-dependent defense responses.

Proline oxidation. An interesting illustration of metabolic regulation of plant cell redox

homeostasis during pathogen infection is the proline (Pro)/pyrroline-5-carboxylate (P5C) cycle

(Fig.2-2). The Pro-P5C cycle comprises of the cytosolic P5C reductase (P5CR) and mitochondrial

proline dehydrogenase (ProDH) (Phang et al. 2008; Cecchini et al. 2011, Servet et al. 2012,

Natarajan 2012). In higher plants, proline is known to accumulate in response to different

environmental stresses (Reviewed by Szabados and Savouré 2010). The main precursor of

proline biosynthesis is glutamate and P5CR catalyzes the last step of the biosynthetic pathway,

whereas ProDH consumes the cytosolic pool of proline to produce P5C in the mitochondrion

(Hare and Cress 1997). ProDH activity is known to be highly sensitive to many environmental

stresses, therefore stimulating cytosolic proline accumulation in cells undergoing different type

of stresses including defense-associated oxidative stress (Verbruggen and Hermans 2008). On

the other hand, it has been shown that under certain circumstances, over-activation of ProDH

results in an incomplete oxidation of Pro, which in turn transfers an overflow of electrons to the

mitochondrial electron transfer chain (mETC), inducing mitochondrial redox imbalances (Miller

et al. 2009). In a recent study in Arabidopsis, ProDH was suggested to function as a defense

gene, contributing to timely HR induction against P. syringae (Cecchini et al. 2011). Therein,

ProDH-silenced plants were also shown to be compromised in a rapid HR development,

displaying reduced cell death levels and enhanced susceptibility to an avirulent strain of the

bacterial pathogen. A similar role was reported for ProDH and the other main P5C generating

enzyme ornithine delta-aminotransferase (δOAT) in the induction of the HR-mediated non-host

18

resistance in Arabidopsis and Nicotiana benthamiana against different strains of P. syringae

(Senthil-Kumar and Mysore 2012).

Figure 2-2. proline/pyrroline-5-carboxylate (P5C) cycle. Over-activation of proline dehydrogenase (ProDH) results in an incomplete oxidation of Pro and transfers an overflow of electrons to the mitochondrial electron transfer chain (mETC), inducing programmed cell death (PCD) (Miller et al. 2009).

Arginine-dependent NO generation. In synergy to ROS, reactive nitrogen species (RNS), such as

nitric oxide (NO) also act as important signaling molecules in the plant immune system,

orchestrating different defense responses ranging from transcriptional and hormonal

regulations to HR development (reviewed by Mur et al. 2006; Moreau et al. 2010). Despite the

large body of evidence supporting the importance of nitrate and nitrite in NO biosynthesis,

existence of an arginine-dependent NO biosynthetic route has been also reported in many

plants (Moreau et al. 2010). The NADPH-dependent enzyme nitric oxide synthase (NOS)

catalyzes the two-step oxidation of L-arginine to NO and citrulline (Crawford 2006).

Interestingly, preharvest L-arginine treatment on tomato fruits has been shown to be sufficient

to induce postharvest resistance against B. cinerea through its effect on increased NO

biosynthesis, and consequently, over-activation of defensive enzymes such as PAL, chitinase

and glucanase (Zheng et al. 2011).

Polyamine oxidation. Arginine is also known as the main precursor for polyamine (PA)

biosynthesis. In higher plants, arginine decarboxylase (indirectly) and ornithine decarboxylase

(directly) form putrescine, the main precursor of other PAs (Kuznetsov et al. 2006). PAs not only

19

play a signaling role in plant defense, but their oxidation also imposes oxidative stress leading

to cell death after infection (reviewed by Walters 2003). During the incompatible interaction

between barley and the powdery mildew fungus Blumeria graminis f. sp. hordei, increased

levels of PA and PA-oxidase were shown to be associated with cell death (Cowley and Walters

2002). This might explain why interference in arginine biosynthesis is a foremost invasion

strategy for some pathogens. For instance, the non-host specific antimetabolite toxins,

phaseolotoxin and mangotoxin, produced by virulent strains of P. syringae have been shown to

inhibit different steps in the arginine biosynthetic pathway, facilitating bacterial colonization

(Tourte et al. 1995; Arrebola et al. 2003). Similar mechanism can be considered for a report on

P. syringae pv. phaseolicola and vetch interaction, where downregulation in arginine

biosynthesis was associated with the inhibitory effect of phaseolotoxin resulting in

susceptibility (Patil et al., 1972). Likewise, an uncharacterized toxic activity of some strains of P.

syringae pv. tomato seems to have a similar mode of action (Arrebola et al. 2003).

Since there is an indirect connection between GM and HR-mediated defense responses via NO

biosynthesis and PA oxidation, further focus on defense-associated NO/PA alterations stays out

of the intended scope of this review paper.

Host cell viability

The redox regulating capacities of GM also lie in the ability to scavenge oxidative stress. The

ROS-scavenging function of some GS/GOGAT-dependent metabolic pathways creates a

reducing environment that guards host cell viability. Here, quite contrary to PCD, an increase in

cell longevity is presumed as an effective defense strategy against necrotrophic pathogens that

benefit from an early cell death, while it can potentially promote biotrophic interactions.

Redox regulatory role of the GS/GOGAT cycle. A redox-balancing role was suggested for the

functionality of the GS/GOGAT cycle, negatively modulating HR-mediated defense responses

(Liu et al. 2010). The authors demonstrated that in Arabidopsis leaf cells, inhibition of the

GS/GOGAT-supplying glutamine transportation from the apoplast into the cytosol leads to

resistance against the hemibiotrophic anthracnose fungus Colletotrichum higgisianum and the

20

biotrophic powdery mildew pathogen Erysiphe cichoracearum. Accordingly, loss of function of

the Arabidopsis isocitrate dehydrogenase enzyme, generating 2-oxoglutarate as the main

carbon skeleton required for normal functionality of GS/GOGAT cycle, was shown to induce

redox perturbations and cell death. Consequently, this confers resistance against the virulent

DC3000 strain of P. syringae pv. tomato (Mhamdi et al. 2010). However, continuation of

GS/GOGAT cycle operation, through the over-activation of the cytosolic GS1, was a feature seen

in early stages of a compatible interaction between P. syringae and tomato (Pérez-Garcia, et al.

1998). Collectively, it seems that GS/GOGAT cycle functionality could be considered as a

molecular ON/OFF switch of cell viability, negatively controlling the overall resistance response

against biotrophic-natured virulence strategies (including hemibiotrophic interactions). By

contrast, it could be expected that the impact of this master switch on necrotrophic invasions

might work in the opposite way. Interestingly, it has been recently observed in our lab that the

resistance seen in sitiens, an abscisic acid deficient tomato mutant, against B. cinerea

(Asselbergh et al. 2007; Curvers et al. 2010), correlates with the ability of the mutant to retard

the necrotrophic pathogen-induced cell death by maintaining the GS/GOGAT cycle activity (Seifi

and Höfte, unpublished data).

Glutathione-mediated ROS scavenging. Being involved in the biosynthesis of a highly

important antioxidant metabolite, the tripeptide γ-glutamylcysteinylglycine or glutathione

(GSH), GM may modulate redox alterations occurring during pathogenic infections. GSH is

known to play several roles in plant physiology and development (reviewed by Noctor et al.

2012), as well as in plant defense responses (De Gara et al. 2003). Increased levels of GSH

accumulation in tobacco and barley have been shown to occur during HR-mediated defense

responses against biotrophic pathogens, as a protective mechanism in the cells surrounding the

HR-undergoing areas, mitigating further oxidative damage to the rest of the tissue (ElZahaby et

al. 1995; Fodor et al. 1997). Likewise, peroxisomal accumulation of GSH was shown to be part

of an antioxidative defense reaction to counteract P.syringae-induced cell death in Arabidopsis

(Grosskinsky et al., 2012). On the other hand, GSH content could also be exploited by some

pathogens to establish their infectious colonization. For instance, lower levels of GSH have been

observed in tomato leaves infected with the ROS-favoring pathogen B. cinerea (Kuzniak and

21

Sklodowska 1999) as well as in Avena sativa leaves during the necrotrophic interaction with

Drechslera spp. (Vongonner and Schlösser 1993). According to the latter reports, attenuating

the antioxidant capacity of the host tissue is crucial for a successful necrotrophic virulence

strategy.

Proline accumulation. Proline accumulation was particularly observed in leaf areas surrounding

HR lesions in a gene-for-gene mediated incompatible interaction between Arabidopsis Co1-0

plants and P. syringae (Fabro et al. 2004). The authors then hypothesized that proline might

play a protective role, as a free radical scavenger, to ameliorate the burden of oxidative

damage to the photosynthetic tissues around the challenged area.

Taken all together, it seems that plant GM plays a dual role both as an inducer and as a

scavenger of oxidative stress in the challenged site, leading to either programmed cell death or

increased cell viability. This redox-regulating potential, on one hand, is important in the defense

against pathogens with different lifestyles; while on the other hand, pathogens may also exploit

these very mechanisms to induce susceptibility.

III. TCA cycle replenishment/exhaustion

TCA cycle Replenishment. All levels of inducible resistance reactions are known as highly

energy-demanding processes in plants (Heil and Bostock 2002; Berger et al. 2007), heavily

draining TCA cycle-generated energy and intermediates (Kinnersley and Turano 2000; Bolton

2009). The TCA cycle plays a crucial anabolic role in supporting the costly defense-related

metabolic pathways, such as stress-induced phenylpropanoid metabolism, which is known to

consume up to 20% of the total photosynthetic carbon in the plant (Dennis and Blakeley 1995).

This huge demand highlights the significance of anaplerotic reactions (i.e ‘filling-up reactions’;

Kornberg 1965), such as the GABA shunt, to replenish the cycle and ensure its constant

functionality during such circumstances.

22

The GABA shunt is a cytosolic-mitochondrial pathway that connects the GS/GOGAT cycle to the

TCA cycle consisting of three key enzymes: glutamate decarboxylase (GAD), GABA transaminase

(GABA-T) and succinic-semialdehyde dehydrogenase (SSADH) (Fait et al. 2008). Specifically

using glutamate as the main precursor for GABA biosynthesis, GAD activity catalyzes the first

step of the GABA-shunt in the cytosol, while the other two steps of the shunt, GABA-T and

SSADH, have been shown to locate in mitochondria (Shelp et al. 2012). Therefore, it could be

postulated that the TCA-replenishing role of the GABA-shunt during stresses requires

maintaining a constant level of cytosolic glutamate generation through the GS/GOGAT cycle,

again highlighting the central role of GM in orchestrating several defense-related pathways in

host amino acid metabolism.

The physiological link between the GABA shunt and primary carbon metabolism via the TCA

cycle has recently attracted some attention (Studart-Guimaraes et al. 2007; Fait et al. 2008;

Arujo et al. 2008). The latter authors have demonstrated that in potato, inhibition of 2-

oxoglutarate dehydrogenase (the second enzyme of the TCA cycle bypassed by the GABA shunt)

induces a clear upregulation in the GABA-shunt-comprising genes. Likewise, GABA

transportation into the mitochondria under carbon limitation was shown to be essential for

proper carbon metabolism in Arabidopsis (Michaeli et al. 2011).

Although there are a number of studies suggesting roles for GABA-shunt in response to abiotic

stresses (Kinnersley and Turano 2000; Bouché et al. 2003; Ludewig et al. 2008), information on

the molecular mechanism underpinning metabolic roles of GABA-shunt in plant defense

mechanism against pathogens is still scarce. A TCA-replenishing role for the GABA-shunt was

proposed when a novel GABA-T gene was found to be induced in rice leaves during challenge

with different abiotic and biotic stresses, including ultraviolet radiation, mechanical wounding

and infection with the hemibiotrophic blast fungus Magnaporthe oryzae (Wu et al. 2006).

Accordingly, the race non-specific Lr34-mediated resistance response against the wheat leaf

rust pathogen Puccinia triticina has been shown to be considerably energy-intensive, entailing

concurrent upregulation of the TCA cycle and the GABA shunt (Bolton et al. 2008). It was also

shown that over-expression of cytosolic aspartate transaminase in Arabidopsis increases

23

susceptibility to B. cinerea, presumably through over-consumption of the cytosolic glutamate

pool, resulting in depletion of some important defensive metabolites such as GABA (Brauc et al.

2011).

TCA cycle Exhaustion. The senescence-associated gene, glutamate dehydrogenase (GDH) is

another linking route between the TCA and the GS/GOGAT cycles, where the aminating activity

of GDH adds an amino group to the TCA-intermediate metabolite 2-oxoglutarate, to generate

glutamate (Masclaux-Daubresse et al. 2002). This TCA-draining function of the enzyme has

been reported to occur in response to bacterial as well as viral invasions (Pageau et al. 2006).

The latter authors have observed GDH enzymatic over-activation in tobacco leaves during

infections with P. syringae and Potato virus Y, presumably facilitating the cell death process in

the host tissue. Likewise, recent transcriptional analysis suggests that draining of the TCA cycle

due to an increased expression of GDH might facilitate the progression of the necrotrophic

fungus Cochliobolus miyabeanus in susceptible rice plants, while the opposite was observed in

more resistant plants. The GDH-mediated export of glutamate from the mitochondria and

subsequent draining of the TCA cycle might be a strategy of the fungus to induce senescence

and susceptibility (Van Bockhaven and Höfte, unpublished data). A similar hypothesis can

explain why over-expression of aspartate transaminase, which reversibly converts 2-

oxoglutarate into glutamate, increases susceptibility to B. cinerea in Arabidopsis (Brauc et al.

2011). Likewise, the necrotrophic fungus Alternaria citri, via secretion of the ACR-toxin, induces

leakage of NAD+ from the TCA cycle causing cell death in rough lemon (Tsuge et al. 2012).

Collectively, it seems that exhausting the host crucial anabolic apparatus, the TCA cycle, can be

considered as an effective virulence strategy for some necrotrophic pathogens.

To endure or to evade, that is the question

The modulation of disease resistance via alterations in host GM seems to be a complex

phenomenon. Table 1 summarizes all the previously-discussed reconfigurations of the GM of

different host plants in response to biotrophic, necrotrophic and hemibiotrophic pathogens,

24

clearly showing that the ultimate outcome of the overall defense response is largely dependent

on the lifestyle of the invading pathogen. For instance, while ‘evasion’-related strategies such as

the over-activation of the cell death-facilitating aminating activity of GDH in the challenged

tissue could be effective in shaping a successful HR-dependent defense mechanism against a

biotrophic pathogen (Pageau et al. 2006), the same reaction would be greatly favorable for a

necrotroph (Dulermo et al. 2009). This dual pathogenesis-dependent role of GM might also

explain the observed contradicting effect of N supply in tomato against different pathogens

(Hoffland et al. 2000). According to this study, increased N concentrations in tomato

hydroponic cultivation could reduce susceptibility against B. cinerea, whereas it significantly

increased susceptibility against the biotrophic powdery mildew fungus Oidium lycopersicum.

Similarly, Lecompte et al. (2010) demonstrated that a high N nutrition lowers the susceptibility

of tomato to B. cinerea stem infections. It could be hypothesized that N nutrition replenishes

the GS/GOGAT cycle, boosting the ‘endurance’ state in infected tissues. This enables the plant

to retard the necrotrophic pathogen-induced cell death, leading to increased resistance.

However, during the true biotrophic interaction with Oidium lycopersicum, the N-induced

endurance state sustains the host cell viability, which is extremely beneficial for the pathogen.

Taken all together, a simplified juxtaposition model is proposed, describing how the two main

functionalities of host GM (i.e. evasion and endurance) in response to different infection

scenarios (i.e. biotrophic, hemibiotrophic and necrotrophic) can modulate the overall defense

reaction (Fig. 2-3). It seems that reconfiguration of the host GM during pathogenic challenge

functions as a ‘double-edged sword’, either backing the ongoing defensive strategy, or being

exploited by the pathogen, thus facilitating infection. According to this model, the state of

‘resistance’ depends on the concurrence of certain metabolic events in the host that oppose

the metabolic demands of the pathogen. Yet, how mechanistically a resistant plant tailors and

fine-tunes these metabolic rearrangements according to the lifestyle of the invading pathogen

merits further elucidation.

25

Figure 2-3. Pathogen virulence strategy versus host glutamate metabolism. A hypothetical model showing how plant GM, in response to pathogens with different virulence strategies, may modulate the outcome of defense response. AS: Asn synthetase; AST: Asp transaminase; GDH (AM/DAM): Glu dehydrogenase (aminating/deaminating); GOGAT: Gln-oxoglutarate aminotransferase; GOX: glycolate oxidase; GS: Gln synthetase; GSH: glutathione; PAO: polyamine oxidation (PA-oxidase); P5C: pyrroline-5-carboxylate.

26

Table 1. Roles of host glutamate metabolism in plant-pathogen interactions. GDMP: glutamate-dependent metabolic pathway, ND: not determined; ↗: up-regulation, ↘: down-regulation.

Enzyme abbreviations: AS: Asn synthetase; AGT: Ala glyoxylate aminotransferase; ARGAH: arginase; AST Asp transaminase; GABA-T: GABA transaminase; GAD: Glu decarboxylase; GDC: glycine decarboxylase; GDH: Glu dehydrogenase; GOGAT: Gln-oxoglutarate aminotransferase; GOX: glycolate oxidase; GS: Gln synthetase; GSH: glutathione ; GSHS: GSH synthetase; NOS: nitric oxide synthase; OCT: Orn carbamoyl-transferase; P5CR: ∆1-pyrroline -5-carboxylate reductase; P5CS: ∆1-pyrroline -5-carboxylate synthase; PAO: polyamine oxidase; ProDH: Pro dehydrogenase; SGT: Ser glyoxylate aminotransferase.

Host plant Pathogen GDMP

involved

GDMP

mode of action

Effect on

overall

resistance

response

Reference

Barley Erysiphe

graminis f.sp.

hordei

↗GSHS Cell viability: Restricting

the extent of HR,

protecting non-invaded

areas

+ ElZahaby et al.

1995

Tobacco Tobacco Mosaic

Virus

↗GSHS Cell viability: Restricting

the extent of HR,

protecting non-invaded

areas

+ Fodor et al. 1997

Melon Pseudo-

peronospora

cubensis

↗SGT, AGT,

GOX

Cell death: Generation

of ROS, HR-mediated

defense

+ Taler et al. 2004

Wheat Puccinia

triticina

↗GABA shunt TCA replenishment:

Replenishing the TCA

cycle, providing energy

for the Lr34-mediated

resistance

+ Bolton et al. 2008

Tomato Cladosporium

fulvum

↗GABA

biosynthesis

Apoplastic GABA

accumulation, providing

N source for the

pathogen

_ Solomon and

Oliver 2002

Arabidopsis Erysiphe

cichoracearum

↘GS/GOGAT

(via the Gln

transporter,

LHT1)

Cell death: Induction of

redox imbalance,

resulting in a HR-

mediated defense

+ Liu et al. 2010

Biotrophic interactions

27

Arabidopsis

Hyaloperonosp

ora

arabidopsidis

↗AS N remobilization:

Facilitating cell death

+ Hwang et al. 2011

Arabidopsis Botrytis cinerea ↗Glu

transporters

N reutilization: Increase

in NH4 reutilization,

delaying senescence

+ Kang et al. 2006

Arabidopsis Botrytis cinerea ↗ARGAH N reutilization: Increase

in NH4 reutilization,

delaying senescence

+ Brauc et al. 2011

Tomato Botrytis cinerea ↗Arg-

dependent

NO

biosynthesis

NO-induced PR protein

accumulation

+ Zheng et al. 2011

Tomato Botrytis cinerea ND N reutilization:

Induction of resistance in

N supplemented plants

+ Lecompte et al.

2010

Arabidopsis Botrytis cinerea ↗AST TCA exhaustion: Over-

consumption of cytosolic

Glu pool, resulting in

depletion of GABA

_ Brauc et al. 2011

Oat Drechslera spp. ↘GSHS Cell death: Facilitating

cell death

_ Gonnen and

Schlöser, 1993

Oat Cochliobolus

victoriae

↘GDC Inhibiting N reutilization _ Navarre and

Wolpert, 1999

Sunflower Botrytis cinerea ↗GDH TCA exhaustion:

Facilitating cell death

_ Dulermo et al.

2009

Tomato Botrytis cinerea ↘GSHS Cell death: Facilitating

cell death

_ Kuzniak and

Sklodowska, 1999

Arabidopsis Colletotrichum

higginsianum

↘GS/GOGAT

(via the Gln

transporter,

LHT1)

Cell death: Induction of

redox imbalance,

resulting in a HR-

mediated defense

+ Liu et al. 2010

Arabidopsis Pseudomonas

syringae pv.

tomato

↗AS N remobilization:

Facilitating cell death

+ Hwang et al. 2011

Hemibiotrophic interactions

Necrotrophic interactions

28

Arabidopsis Pseudomonas

syringae pv.

tomato

↗P5CS (Pro

biosynthesis)

Cell viability: Restriction

of the extent of HR,

protecting non-invaded

areas

+ Fabro et al. 2004

Arabidopsis Pseudomonas

syringae pv.

tomato

↗ProDH/P5C

R

Cell death: Induction of

electron overflow in

mETC, resulting in a HR-

mediated defense

+ Cecchini et al.

2011

Arabidopsis Pseudomonas

syringae pv.

syringae and

tabaci

↗GOX Cell death: Induction of

ROS-dependent nonhost

resistance

+ Rojas et al. 2012

Common

bean

Colletotrichum

lindemuthianu

m

↗GS1-GDH N remobilization:

Depriving the pathogen

of nutrients (slash and

burn defense strategy)

+ Tavernier et al.

2007

Tobacco Pseudomonas

syringae pv.

tabaci and

tomato

↗GS1, GDH N remobilization:

Facilitating cell death

+ Pageau et al. 2006

Tobacco Pseudomonas

syringae pv.

tomato

↗GOX Cell death: Induction of

ROS-dependent nonhost

resistance

+ Rojas et al. 2012

Tomato Pseudomonas

syringae pv.

tomato

↗GS1-AS N remobilization:

Transfer of free

ammonia out of the

invaded area

+ Olea et al. 2004

Tomato Pseudomonas

syringae pv.

tomato

↘GS/GOGAT

(via ICDH

enzyme)

Cell death: Induction of

redox imbalance,

resulting in a HR-

mediated defense

+ Mhamdi et al.

2010

Rice Magnaporte

oryzae

↗GABA-T TCA replenishment:

Restricting the levels of

host cell death

+ Wu et al. 2006

Pepper Xanthomonas

campestris pv.

vesicatoria

↗AS N remobilization:

Facilitating cell death

+ Hwang et al. 2011

Arabidopsis Pseudomonas

syringae pv.

tomato

↗AtGAT1

(GABA

transporter)

Apoplastic GABA

accumulation, providing

N source for the

pathogen

_ Ward et al. 2010

Mango Pseudomonas

syringae pv.

syringae

↘Arg

biosynthesis

ND _ Arrebola et al.

2003

29

Tobacco Pseudomonas

syringae pv.

tabaci

↘GS/GOGAT

(via

irreversible

inhibition of

GS)

Inhibition of N

remobilization:

Induction of the

accumulation of free

ammonia

_ Turner 1981

Vetch Pseudomonas

syringae pv.

phaseolicola

↘Arg

biosynthesis

ND _ Patil et al. 1972

Pathogen exploitation of the host glutamate metabolism

Although the main scope of the current review was to focus on the role of host GM

reconfigurations in plant-pathogen interactions, it is also important to understand how

pathogens may exploit plant GM to their own benefit.

Secretion of various effectors/toxins is broadly known as a potent virulence mechanism that

enables pathogens to subvert host cell metabolic functions (Block et al. 2008; Duke and Dayan

2011). For instance, P. syringae, via secreting a constellation of type III effectors (TTEs) and/or

various toxins into the target cell, is able to manipulate the host central metabolism, including

amino acid metabolism, to its own benefit (Rico et al. 2011). Despite the currently scarce

information on TTEs that specifically target host central C/N metabolism, there are some

available data about pathogen-derived toxins with this particular mode of action, termed as

‘antimetabolite’ toxins (Arrebola et al. 2011). Some of the most notable examples of these

toxins were briefly illustrated in this review in their relevant contexts and are summarized in

Table 2. However, in addition to these toxin-mediated virulence mechanisms, pathogens may

deploy other strategies to cope with defense-associated host GM reconfigurations. Here, we

only provide a preliminary insight on this fertile area, which definitely warrants further

exploration.

30

Table 2. Pathogen-secreted toxins that target host central C/N metabolism. Enzyme abbreviations: GS: glutamine synthetase; RuBisCO: ribolose 1,5-bisphosphate carboxylase; OAT: Ornithine N-acetyl-transferase; OCT: Ornithine cabamoyl-transferase; GDC: glycine decarboxylase.

Timely switching of pathogenicity modes. Some pathogens, mostly hemibiotrophs, are able to

neutralize plant GM-mediated defenses by responsively adapting their lifestyle to these

metabolic reconfigurations. For instance, Leptosphaeria maculans was observed to switch from

an early biotrophic phase into a necrotrophic invasion strategy, when its host, Brassica napus,

tries to evade the initial biotrophic invasion by remobilizing N away from the challenged tissue

(Rossato et al. 2001). Another interesting example has been depicted in a study by Tavernier et

al. (2007), on the interaction between Colletotrichum lindemuthianum and Phaseolus vulgaris.

In this compatible pathosystem, upon the pathogen ingress, a rather late GS1-mediated

‘evasion’ of the first biotrophic challenge occurs in the host, resulting in glutamine

accumulation in the phloem around the infection site. Concomitantly, C. lindemuthianum shifts

Toxin Pathogen Host Mode of action on host central C/N

metabolism

Reference

Tabtoxin Pseudomonas

syringae pv.

tabaci

Tobacco,

Pea

Irreversible inhibition of GS, disruption

of the GS/GOGAT cycle

Turner 1981;

Thomas et al.

1983

Mangotoxin Pseudomonas

syringae pv.

syringae

Mango Inhibition of OAT, downregulation of

Orn biosynthesis

Arrebola et al.

2003

Phaseolotoxin Pseudomonas

syringae pv.

phaseolicola

Vetch Inhibition of OCT, downregulation of Arg

biosynthesis

Patil et al. 1972

Unknown Pseudomonas

syringae pv.

tomato

Tomato downregulation of Orn biosynthesis Arrebola et al.

2003

ACR-toxin Alternaria citri Lemon Induction of NAD+ leakage from the TCA

cycle

Tsuge et al.

2012

Victorin Cochliobolus

victoriae

Oat Inhibition of GDC, accumulation of free

ammonium in the cytosol

Navarre and

Wolpert 1999

31

into a necrotrophic invasion style, presumably because the increased vascular glutamine

concentration is perceived as a signal of the host escape. This timely transition in virulence

strategy enables the anthracnose pathogen to trap high levels of glutamine in the phloem,

before the host can efficiently translocate its N reservoir out of the challenged area. In spite of

the competence of this adaptable infection strategy, an early and strong ‘evasion’-based

defense reaction in the host has been shown to be sufficient to stop the development of some

potent hemibiotrophic pathogens, such as Colletotrichum higgisianum (Liu et al. 2010), and

Phytophthora infestans (Shibata et al. 2010) while they are still in their biotrophic phase.

Selective amino-acid utilization. Deciphering why some pathogens metabolize or neglect

particular amino acids during the infection course may provide an intriguing insight into the

metabolic interface between plants and pathogens.

It has been shown that P. syringae pv. tomato is well-adapted to metabolize the six most

abundant amino acids in the tomato apoplast as both nitrogen and carbon sources. Most low-

abundant amino acids are used very poorly or not at all, except for asparagine, arginine, proline

and histidine (Rico and Preston 2008). Utilization of histidine has been attributed to the energy-

intensive anabolism of the amino acid by the pathogen itself; however, it is not clear why the

three other amino acids are utilized. Nutritional value is probably not the only evolutionary

cause that has made these particular amino acids so important, since the highly abundant N-

rich amino acids, like aspartate, glutamate and glutamine, should be sufficient to supply the N

need of the pathogen. By selective utilization of asparagine, P. syringae may affect AS

expression in its host. However, as previously discussed, early and strong induction of AS in the

host seems to be linked with a ‘slash and burn’-natured defense strategy (Hwang et al. 2011).

Therefore, a late induction of AS, as observed in the compatible interaction of P. syringae-

tomato at 2 dpi peaking at 4 dpi (Olea et al. 2004), might be beneficial for the hemibiotrophic

pathogen, facilitating the cell death associated with the necrotrophic phase of the infection.

Confirmingly, no significant alterations were observed in asparagine levels of Arabidopsis leaves

during early stages (8 and 12 hpi) of P. syringae infection (Ward et al. 2010).

32

Likewise, regarding the roles of arginine and proline in the host GM-mediated defenses (Fig. 2-

1), it can be hypothesized that the ability to utilize these amino acids might help the pathogen

to seize two important defense-related precursors, repressing the following HR-inducing

modules.

Another example of a utilization-dependent virulence strategy can be seen in a recent study on

the role of GABA in the P. syringae pv. tomato-Arabidopsis interaction (Park et al. 2010). The

authors have demonstrated several important findings: firstly, that GABA is a suitable nutrient

source for the pathogen in in vitro cultures; secondly, that higher levels of GABA are induced in

the host in response to the infection; thirdly, that Arabidopsis pop2-1 mutants, accumulating

higher levels of GABA, exhibit reduced susceptibility to the pathogen; and finally and most

importantly, deficiency in the GABA catabolic pathway in the pathogen also results in reduced

susceptibility in the host. These results give support to the hypothesis that active utilization of

a particular amino acid by P. syringae is not always just a nutritional preference; but beyond

that, it may function as a ‘virulence strategy’ via which the pathogen interferes with an

effective defense component of its host.

Conversely, by neglecting a particular amino acid or intermediate metabolite, the pathogen

may prevent activation of the associated biosynthetic pathway. This may explain why P.

syringae lacks the glycerate pathway, which is necessary for glyoxylate utilization (Rico et al.

and Preston 2008). Since glyoxylate is not used as a carbon source, further stimulation of the

H2O2-generating GOX enzyme (Fig. 2-1) is avoided, leading to attenuation of the HR response

in the host.

33

Targets for future research

In this review we tried to explain how alterations in host GM can lead to either susceptibility or

resistance, depending on the lifestyle of the pathogen. We hope that the endurance/evasion

model may inspire further research in this fascinating, but underexplored area.

To further substantiate the concepts of this review, glutamate (and possibly other key

metabolites) could be labeled with stable isotopes such as 13C and 15N to study its metabolic

flux in the GM-dependent metabolic pathways depicted in Figure 2-1 upon pathogen challenge.

The observed alterations in host GM are clearly the result of a dynamic interplay between the

host, trying to defend itself, and the pathogen, manipulating the host metabolism for its own

benefit. We need a better understanding of the virulence factors of the pathogen such as toxins

and effector proteins that modify the host GM. Moreover, the hypothesis that pathogens utilize

certain amino acids to interfere with plant defense should be tested via mutants impaired in

the uptake or metabolization of these compounds. To fully understand the metabolic events

that rule plant-pathogen interactions, metabolic changes need to be studied both in the host

and the pathogen, which is clearly exemplified by the GABA work of Park et al. (2010) discussed

above. Analytical techniques that can help to achieve this are summarized in Rico et al. (2011)

and Allwood et al. (2008). Novel approaches such as “dual metabolomics” described by Allwood

et al. (2010) will be very helpful in this respect. In this method, plant cell cultures and

pathogens are co-cultured for a certain amount of time, separated by filtration and

subsequently, Fourier transform infrared spectroscopy is used to study the intracellular

metabolomes of pathogen and plant cells (metabolic fingerprints) and the metabolites

extruded in the supernatant (metabolic footprints).

The role of plant hormones such as abscisic acid in host GM alterations is unclear and needs to

be further explored. And finally, it will be interesting to see how environmental factors such as

light and nitrogen nutrition, which are known to have profound effects on amino acid levels in

the plant leaf (Urbanczyk-Wochniak and Fernie 2005; Jankanpaa et al. 2012) interfere with the

34

host GM and disease susceptibility. We believe that a better understanding of the role of plant

GM in disease resistance can lead to new insights and strategies to control plant diseases.

Acknowledgements

This work was supported by grants from the Fund for Scientific Research Flanders (FWO grants

3G052607 and 3G000210) and by a specialization fellowship of the Flemish Institute for the

stimulation of Scientific-Technological Research in Industry (IWT, Belgium) given to Jonas Van

Bockhaven. The first author is grateful to Dr. David De Vleesschauwer for his encouraging

remarks and his suggestion on the title.

Author contributions

H. Seifi devised the main concept of the review paper and wrote the original draft of the

manuscript. J. Van Bockhaven proofread and contributed to drafting some additional parts to

the original manuscript. The manuscript was critically reviewed and revised by G. Angenon and

M. Höfte; while M. Höfte supervised the entire process of writing the paper.

35

36

37

Chapter

3

Concurrent over-activation of the cytosolic glutamine synthetase and

the GABA-shunt in the abscisic acid-deficient sitiens mutant of tomato

leads to resistance against Botrytis cinerea

Hamed Soren Seifi, Katrien Curvers, David De Vleesschauwer, Ilse Delaere, Aziz Aziz, Monica

Höfte

Accepted for publication in New Phytologist

eficiency of abscisic acid in the sitiens mutant of tomato culminates in increased

resistance to Botrytis cinerea through a rapid epidermal hypersensitive response (HR) and

associated phenylpropanoid-pathway-derived cell wall fortifications. This study focused on

understanding the role of primary carbon/nitrogen (C/N) metabolism in the resistance response

of sitiens to B. cinerea. how alterations in C/N metabolism are linked with the HR-mediated

epidermal arrest of the pathogen, has been also investigated. Our results on the sitiens-B.

cinerea interaction favor a model in which cell viability in the cells surrounding the invaded

tissue is maintained by a constant replenishment of the TCA cycle through overactivation of the

GS/GOGAT cycle and the GABA shunt, resulting in resistance via both tightly controlling the

defense-associated HR and slowing down the pathogen-induced senescence. Collectively, this

study shows that maintaining cell viability via alterations in host C/N metabolism plays a vital

role in the resistance response against necrotrophic pathogens.

D

38

Introduction

Plants have evolved a plethora of defense strategies to persist in a hostile environment that is

abound with pathogens. Besides constitutive structural and biochemical defenses, plants

possess sophisticated defense machinery, induced against those few pathogens that succeed in

overcoming the preformed barriers. The plant possesses an arsenal of these inducible defenses,

including the reactive oxygen species (ROS) burst, hypersensitive (HR) cell death, cell wall

fortifications and de novo synthesis of various anti-microbial compounds which ultimately

deprive a (hemi)biotrophic pathogen of the plant’s nutritional resources (Pieterse et al., 2009).

However, the efficacy of such ROS/HR-mediated defense strategies against necrotrophic

pathogens, which favor host cell death, remains questionable (Robert-Seilaniantz et al., 2007).

Botrytis cinerea has been recently nominated as the most scientifically/economically important

necrotrophic fungal plant pathogen (Dean et al., 2012). As a true necrotroph, induction of cell

death in the host tissue is known as a crucial mode of pathogenicity (Van Baarlen et al., 2004;

Govrin et al., 2006). To accomplish this, B. cinerea is armed with an array of virulence factors

such as phytotoxic metabolites, oxidative burst-evoking enzymes and oxalic acid (Govrin &

Levine, 2000; Van Kan, 2006). On the other hand, resistance to necrotrophic pathogens like B.

cinerea depends, to some extent, on the ability of the host to control the balance between cell

death and survival (Mengiste 2012). It has been shown that expression of a senescence-

associated gene of Arabidopsis (SAG12) is induced by B. cinerea infection, while transgenic non-

senescing tomatoes exhibit some levels of resistance to the pathogen (Swartzberg et al., 2008).

A model has been proposed for Arabidopsis non-host resistance to B. cinerea, according to

which presence of a cellular zone around the primary infection site with a slower rate of cell

death can restrict pathogen colonization (Van Baarlen et al., 2007).

We have previously demonstrated that abscisic acid (ABA) deficiency in the sitiens mutant of

tomato results in a strong resistance response to B. cinerea (Audenaert et al., 2002).

Additionally it was recently shown that cuticle permeability and specific cell wall structure in

the mutant leads to rapid defensive responses, including an early and localized production of

hydrogen peroxide (H2O2) and HR followed by cell wall fortifications in the epidermis, which

39

ultimately impede further spreading of the pathogen (Asselberg et al., 2007; Curvers et al.,

2010). Microarray analysis revealed that in addition to groups of genes coding for pathogenesis

related (PR) proteins and enzymes related to cell-wall structure being upregulated, expression

of a cluster of genes involved in primary amino acid metabolism significantly increased in the

resistant mutant at 8 hours post inoculation (hpi) (Asselberg et al., 2007). The most notable of

the latter group of genes were peroxisomal/glyoxysomal aspartate transaminase (AAT), the

lysine catabolic gene ketoglutarate reductase/saccharopin dehydrogenase (LKR/SDH) and the γ-

aminobutyric acid (GABA) biosynthetic gene glutamate decarboxylase (GAD). However, the

cause and the putative role of these amino acid-associated transcriptional alterations in the

resistance mechanism of sitiens against B. cinerea remained unclear.

Although there are dozens of studies corroborating the link between primary metabolism and

plant defense responses (Reviewed by Bolton 2009), molecular knowledge on the role of

primary amino acid metabolism in plant resistance mechanisms against pathogens is still

fragmentary. We have recently reviewed the role of glutamate metabolism in plant-pathogen

interactions, highlighting the importance of infection-triggered alterations in central amino acid

metabolism in molding a resistance/susceptibility response in the host (Seifi et al., 2013). A

causal link has been proposed between the disruption in glutamate/glutamine homeostasis and

induction of cellular redox imbalances in leaf cells of Arabidopsis, leading to ROS-mediated cell

death and resistance against the biotrophic fungus Erysiphe cichoracearum and the

hemibiotrophic fungus Colletotrichum higginsianum (Liu et al., 2010). Conversely, drastic

depletion in glutamate storage in distal, non-invaded regions of sunflower was postulated as a

defensive strategy against B. cinerea. It was hypothesized that through this mechanism,

glutamate-derived N-rich amino acids are supplied to the infected area, delaying the

necrotroph-induced senescence (Dulermo et al., 2009). In Arabidopsis, LKR/SDH is significantly

upregulated by abiotic stresses, but also by B. cinerea infection (Genevestigator, Zimmermann

et al., 2005). It is suggested that stress-induced lysine catabolism serves as a generator of

glutamate, the key precursor for important stress-related metabolites such as arginine, proline

and GABA (Galili et al., 2001). Similarly, the observed increased susceptibility to B. cinerea in

cytosolic aspartate transaminase (AAT1) over-expressing lines of Arabidopsis was suggested to

40

be caused through the repression of glutamate consuming pathways to maintain normal

glutamate levels. In this way, less glutamate would be converted to key defense related

metabolites such as proline or GABA (Brauc et al., 2011).

GABA is known to accumulate in plant tissues in response to various abiotic and biotic stresses,

suggesting assorted functions for the molecule ranging from involvement in central

carbon/nitrogen (C/N) metabolism to functioning as a signaling molecule during plant-microbe

interactions (Kinnersley & Turano, 2000; Roberts, 2007; Fait et al., 2008). Making up a

considerable fraction of total free amino acid content in some plants (Roberts, 2007), GABA

might be an attractive nutritional target, particularly for intercellularly growing pathogens. For

instance, infection of tomato by the biotrophic fungus Cladosporium fulvum was shown to

induce high levels of GABA in the apoplast, providing the pathogen with a rich nitrogen source

(Solomon & Oliver, 2002). GABA also appears to be a nutrient source for Pseudomonas syringae

pv. tomato in Arabidopsis. However, conditions promoting high levels of GABA can increase

plant resistance by repressing the expression of the hrp genes in the bacterium (Park et al.,

2010). The involvement of GABA in plant-stress interactions have been also attributed to the

metabolic functions of the GABA shunt, a cytosolic-mitochondrial pathway with an important

role in the plant central C/N metabolism, connecting amino acid metabolism to the tricarboxylic

acid (TCA) cycle (Fait et al., 2008). The GABA shunt consists of three key enzymes: GAD, GABA

transaminase (GABAT) and succinic-semialdehyde dehydrogenase (SSADH). Specifically using

glutamate as the main precursor for GABA biosynthesis, GAD activity catalyzes the first step of

the GABA shunt in the cytosol, while the other two steps of the shunt, GABAT and SSADH, occur

in mitochondria (Shelp et al. 2012). Although there are a number of studies demonstrating

involvement of the GABA shunt in response to abiotic stresses (Bouché et al., 2003; Ludewig et

al., 2008), information on the molecular mechanism underpinning the role of this pathway in

plant defense mechanisms against pathogens is still scarce (Wu et al., 2006).

This study aimed at unraveling the role of the GABA shunt in the resistance response of the

sitiens mutant to B. cinerea. In addition, we investigated how alterations in GABA metabolism

may be linked with the HR-mediated epidermal arrest of the pathogen seen in the mutant. The

41

efficacy of the ROS-fueled defense of sitiens against a ROS-favoring pathogen, such as B.

cinerea, appears to be vitally dependent on a secondary anti cell-death defense mechanism,

activated in the area surrounding the invaded cells via concurrent over-activation of the GABA

shunt and the cytosolic glutamine synthetase. Our sitiens model has revealed that maintaining

cell viability via alterations in central C/N metabolisms is crucial in the resistance response

against a necrotrophic pathogen.

Results

The GABA-shunt is involved in resistance of sitiens against Botrytis cinerea

Previous microarray analysis has shown an upregulation of the GABA anabolic gene, glutamate

decarboxylase 1 (GAD1), in inoculated sitiens (Asselbergh et al., 2007; Brauc et al. 2011).

Additionally, a presumable link between AAT1 and LKR/SDH upregulations by B. cinerea

infection and GABA metabolism, was previously proposed (Brauc et al., 2011). These

observations prompted us to investigate whether GABA metabolism might play a role in the

defense machinery of sitiens against B. cinerea. Quantitative reverse transcription (qRT)-PCR

analyses revealed that all the key genes comprising the GABA-shunt, i.e GAD (GAD1 and GAD2),

mitochondrial GABAT (GABAT1) and SSADH, were induced during early stages of the sitiens - B.

cinerea interaction, whereas these alterations could not be seen in the wild type (Fig. 3-1a). A

SSADH enzymatic assay confirmed the rapid increase in the activity of the last step of the GABA-

shunt upon inoculation of the mutant (Fig. 3-1b).

In order to further evaluate whether the GABA shunt plays a role in the resistance of tomato

against B. cinerea, GABAT1 (the transcript which showed the highest upregulation in response

to B. cinerea) was functionally tested using the tobacco rattle virus (TRV)-based virus-induced

gene silencing (VIGS) technique (Liu et al., 2002a; Liu et al., 2002b; Anand et al., 2007). The

GABAT1 gene was cloned and a TRV construct was developed for VIGS in 10 day-old wild-type

and sitiens seedlings. Three weeks after agroinfiltration, plants were assayed for resistance

against B. cinerea. As a control, a TRV construct harboring the GUS gene sequence (with no

42

homology with plant DNA) was used. Furthermore, the Phytoene desaturase (PDS) gene was

used to visually detect the proper time for pathogen inoculation (Supplemental Fig. S3). VIGS of

GABAT1 increased susceptibility to B. cinerea in sitiens but not in the wild-type (Fig. 3-1c).

However, silencing of GABAT1 imposed severe physiological disturbances in the mutant,

causing death of some sitiens seedlings (~30%) and a hampered growth phenotype in the

remaining plantlets, whereas such negative effect was not observed in GABAT1-silenced wild-

type plants (Fig. 3-1d).

43

Figure 3-1. Involvement of the GABA-shunt during sitiens-B. cinerea interaction. (a), Relative transcript accumulation of genes involved in the GABA shunt in sitiens (Sit) and the wild-type (WT) tomato in response to B. cinerea infection. GAD: glutamate decarboxylase; GABAT: GABA transaminase; SSADH: succinate semialdehyde dehyrogenase. One leaflet from each spray-inoculated leaf, taken from at least nine different 5-week-old plants, was excised, pooled (three leaflets per replicate), and flash-frozen at different time points after inoculation. Data presented here are relative gene expression in infected plants to the expression level in mock-inoculated control plants at each time point ± SE of three biological replicates. Experiments were repeated two times with similar results. (b), SSADH enzymatic activity, the enzyme functioning as the last step of the shunt, in sitiens mock-inoculated (SitM) and infected (SitI), and wild type mock-inoculated (WTM) and infected (WTI); during the infection course. The sampling procedure and data expression were performed as described above. For relative activity (infected/mock) of the enzyme, see Supplemental Fig. S2. (c), Disease severity in GABAT-silenced sitiens and wild type plants (Sit-GABAT1 , WT-GABAT1) and control plants (Sit/Sit-TRV2, WT/WT-TRV2) infected with B. cinerea. The downregulation of GABAT1 gene expression in silenced plants was confirmed using qRT-PCR (Supplemental Table S4). Disease index calculation and inoculation were performed as described in “Material and Methods”. Data represent means ± SE of at least six different plants (leaves), with 4 leaf disks per leaf, from a representative experiment. Different letters indicate statistically significant difference (Duncan’s test; α=0.05), analyzed using SPSS Software (Version 15; SPSS, Inc.). (d), Physiological effect of GABAT1 silencing on sitiens and wild-type plants. (e), The effect of HBA (1mM) on disease severity in Sit and WT. Symptoms were evaluated 5dpi. The downregulation of SSDH enzymatic activity in inhibitor-treated plants was confirmed (Supplemental Table S5). Data represent means ± SE of four different plants (leaves), with 6 leaf disks per leaf, from a representative experiment. Different letters indicate statistically significant difference (Duncan’s test; α=0.05). Significant differences between gene expression levels in WT and Sit (panel a), and enzyme activity levels in infected and mock-inoculated plants (panel b) are indicated by an asterisk (t-student test, p < 0.05).

To avoid the severe physiological effect of GABAT1 silencing, we tried to pharmacologically

inhibit the shunt in sitiens plants. Application of a potent GABA-shunt inhibitor, 4-

hydroxybenzaldehyde (HBA) (Tao et al., 2006), resulted in enhanced susceptibility in the mutant

(Fig. 3-1e). Both silencing of GABAT1 and HBA treatment ultimately subdued the mutant’s

capability to contain the pathogen, while the early epidermal HR-like symptoms and cell wall

fortifications appeared intact resulting in an uncommon susceptible phenotype. The symptoms

observed were quite similar to the resistance responses in the control plants until 2-3 days

post-inoculation (dpi), while spreading mycelial tissue colonization outside of the inoculation

site occurred afterwards (Fig. 3-2a-HBA/TRV2:GABAT1, 3-2c; the phenotype of the HBA-treated

wild-type is shown in supplemental figure S8). Conversely, resistant control plants could

effectively arrest pathogen growth within the inoculation site by forming a mesophyllic HR-like

ring, differing from the epidermal HR, which appeared after 3 dpi as a ring encircling the

inoculation area (Fig. 3-2a-Ctrl, 3-2b).

44

Figure 3-2. Macroscopic and microscopic analyses of the primary (12 h, 16 h and 72 h) and the secondary (7 dpi) defense responses in infected, water-treated sitiens (Ctrl), in comparison with GABA-shunt-inhibited (HBA)/GABAT1-silenced (TRV2:GABAT1), and glutamine synthetase-inhibited (MSO)/GS1- silenced (TRV2:GS1) plants. (a), The early epidermal cell-wall fortifications could be seen in all samples: auto-fluorescence of phenolic compounds, deposited in the epidermis of sitiens inoculated with GFP-expressing B. cinerea at 12 hpi, and epidermal cell-wall modifications stained with safranine-O at 16hpi. At 72 h, GABAT1 silencing/GABA-shunt inhibition and GS1 silencing/GS inhibition did not affect the primary HR-like symptoms beneath the inoculation droplet, whereas slightly-spreading lesions could be seen sporadically in leaf disks. At 7 dpi, the infection site was encircled by a secondary HR-like ring in Ctrl (the red arrow), suppressing pathogen growth; while in other treated/silenced samples, the ring was not pronounced and the pathogen could successfully colonize the tissue out of the boundary of the primarily challenged area. (b), Micrograph of the primary epidermal (the white arrow) and the secondary mesophyllic (the red arrow) HR in Sit-Ctrl. (c), The deterrent effect of HBA on pathogen arrest in sitiens. Similar phenomena were observed in MSO-treated, TRV2:GS1 and TRV2:GABAT1 samples. Scale bars = 50µm.

45

Exogenous application of GABA decreases susceptibility to Botrytis cinerea in wild-type

tomato

To further ascertain whether GABA metabolism plays a role in the resistance mechanism

against B. cinerea, the effect of exogenous GABA application on the defense responses of both

sitiens and wild-type tomato plants was analyzed. Interestingly, wild-type leaf disks incubated

overnight in solutions of 1, 5 and 10 mM GABA showed partial resistance to B. cinerea, while no

significant change could be seen in GABA-treated sitiens compared to the untreated sitiens

plants. However, simultaneous application of GABA and the GABA-shunt inhibitor HBA (1mM)

led to increased disease severity in the wild type as well as in the mutant (Fig 3-3a; only data of

5mM GABA treatment are shown). Further microscopic analysis on the GABA-induced

resistance in wild-type leaves revealed that pathogen growth was suppressed in the cell layer

beneath the epidermis forming a mesophyllic HR-like ring that surrounded the slightly-

spreading primary lesion (Fig. 3-3b), quite similar to what was observed in sitiens during later

stages of the infection (Fig. 3-2b). To examine a direct effect of GABA on growth of B. cinerea,

the fungus was grown on salt base medium with either sucrose (as carbon source) or GABA (as

potential carbon and nitrogen source) or sucrose + GABA. The fungus grew and sporulated on

the sucrose + GABA medium, indicating that GABA could serve as sole nitrogen source and had

no direct negative impact on fungal growth (Fig. 3-3c).

Metabolic analysis of GABA level fluctuations during the Botrytis cinerea-tomato interaction

To investigate how GABA metabolism is modulated upon pathogen invasion in tomato,

alterations in the levels of GABA were measured at different time points after inoculation using

a specific ‘ultra performance liquid chromatography’ (UPLC) method. As shown in Fig. 3-3d,

GABA levels showed a sharp rise at 8 hpi in the B. cinerea-inoculated sitiens (SI), which was

totally consumed after 16 hpi, followed by a gradual increase until 48 hpi in both mock-

inoculated (SC) and SI. Conversely, GABA levels showed a marginal increase until 16 hpi in both

B. cinerea-infected (WI) and mock-inoculated (WC) samples. A marginal increase in WI at 24 hpi

occurred which was followed by a sudden drop at 48 hpi. Absolute GABA levels, however, were

higher in wild-type than in sitiens plants (Fig. 3-3d; Supplemental Table S3).

46

Figure 3-3. (a), The effect of exogenous GABA (5mM) application on disease severity in sitiens (Sit) and wild-type (WT) plants. Symptoms were evaluated 5dpi. Data represent means ±SE of four different plants (leaves), with 6 leaf disks per leaf, from a representative experiment. Different letters indicate statistically significant difference (Duncan’s test; α=0.05). (b), Macroscopic and microscopic appearance of the infected water-treated wild-type (Ctrl) and GABA-treated wild type (GABA), infected with B. cinerea. On right-hand side: the mesophyllic HR ring restricting the lesion in GABA-treated WT. Fungal mycelia were stained with ‘trypan blue’ as described in “Material and Methods”. Scale bar = 500µm. (c), In vitro effect of GABA (5mM) on the growth and sporulation of B. cinerea grown on Gamborg B5 salt base medium (B5SB: with no carbon and nitrogen sources). The black circles indicate the place of the inoculation plaque. (d), Measurements of GABA levels in Sit and WT inoculated with B. cinerea. Error bars represent ± SE of three biological replicates.

47

Glutamine synthetase contributes to the defense mechanism against Botrytis cinerea in sitiens

The glutamine synthetase/glutamate synthase (GS/GOGAT) cycle constitutes an important

metabolic node with a central position in plant amino acid metabolism via which the amino acid

glutamate, the main precursor for GABA biosynthesis, is continuously metabolized (Lam et al.

1996). Therefore, we next focused on glutamine synthetase (GS), the key enzyme of the

GS/GOGAT cycle that carries out ammonium re-assimilation (Cren & Hirel, 1999), and

potentially contributes to plant defense (Tavernier et al. 2007). Total GS enzymatic activity in

sitiens started to increase from 8 hpi onwards and peaked at 24 hpi at approximately 6 times

the levels found in non-inoculated controls (Fig. 3-4a). Application of methionine sulfoximine

(MSO), a selective inhibitor of GS (Takeba, 1984), increased susceptibility in sitiens (Fig. 3-4b)

resulting in promoted cell death, measured by the amount of electrolyte leaked from the

inoculated tissue (Kawasaki et al., 2005) (supplemental Fig. S5).

Interestingly, the rapid increase in the expression of the GABA-shunt comprising genes in sitiens

(Fig 3-1a), was paralleled by an early upregulation of cytosolic glutamine synthetase (GS1). After

an 8 h delay, GS1 expression in wild-type mirrored the profile observed for sitiens, while

expression of the chloroplastic isoform (GS2) rapidly decreased in both sitiens and the wild-type

(Fig. 3-4c). To determine whether GS1 was involved in the sitiens defense response against B.

cinerea, GS1-silenced sitiens plants were infected and found to exhibit severe susceptibility to

B. cinerea. (Fig. 3-4d). Both silencing of GS1 and MSO treatment impaired the ability of the

mutant to arrest the pathogen, with symptoms quite identical to those resulting from GABAT1

silencing and GABA-shunt inhibition (Fig. 3-2a-MSO/TRV2:GS1).

48

Figure 3-4. Involvement of glutamine synthetase in sitiens (Sit) and wild-type (WT) defense responses against B. cinerea. (a), GS enzymatic activity in sitiens and the wild type in response to B. cinerea. For relative activity (infected/mock) of the enzyme, see Supplemental Fig. S4. Error bars represent ± SE of three biological replicates. (b), GS inhibition by MSO led to increased susceptibility in sitiens. The downregulation of GS enzymatic activity in inhibitor-treated plants was confirmed (Supplemental Table 5). Data represent means ±SE of four different plants (leaves), with 4 leaf disks per leaf, from a representative experiment. (c), Relative transcript accumulation of GS1 and GS2 in Sit and WT in response to B. cinerea infection. (d), Disease severity in GS1-silenced sitiens and wild type plants (Sit-GS1 , WT-GS1) and control plants (Sit/Sit-TRV2, WT/WT-TRV2) infected with B. cinerea. The downregulation of GS1 gene expression in silenced plants was confirmed using qRT-PCR (Supplemental Table S4). Data represent means ±SE of at least six different plants (leaves), with 4 leaf disks per leaf, from a representative experiment. Different letters indicate statistically significant difference (Duncan’s test; α=0.05). Significant differences between enzyme activity levels in infected and mock-inoculated plants (panel a), and gene expression levels in WT and Sit (panel c), are indicated by an asterisk (t-student test, p < 0.05).

49

Sitiens does not undergo Botrytis cinerea-induced senescence

Next, the expression pattern of the mitochondrial glutamate dehydrogenase (GDH1), which

links the GS/GOGAT and the TCA cycle and is known as a molecular marker for stress-induced

senescence (Masclaux et al., 2002; Pageau et al., 2006), was monitored. Despite an

upregulation in sitiens at 8 hpi, the relative gene expression level did not alter significantly at

later time points (16 and 24 hpi); whereas a tremendous rise in GDH transcriptional level was

observed in infected wild-type (Fig. 3-5a). To further study the difference in the process of

senescence in the two genotypes, protein degradation during the course of the infection was

monitored as well. In sitiens, no clear change was detected in total protein content of infected

leaves compared with the control until 3 dpi. However, total protein content of the wild type

markedly decreased (Fig. 3-5b). Furthermore, sitiens plants did not exhibit any visually-

detectable symptom of senescence until 7 dpi (Fig. 3-5c). From this time onward, symptoms of

chlorophyll degradation (pale yellowish color) were uniformly seen around the infection site,

while the inoculation site (leaf area underneath the inoculation droplet) surrounded by the

aforementioned HR ring remained green. The green area resembled a phenomenon typically

associated with biotrophic interactions, the so-called “green bionissia” (Walters et al., 2008)

(Fig. 3-5d). The ongoing photosynthesis in the green region at 21 dpi was confirmed by live-cell

imaging when gas bubbles were observed being released through the stomata after light-

stimulation (Supplemental Video). Interestingly, the pathogen contained within the boundaries,

was still viable as it was successfully re-cultured from beneath the inoculation droplet at 21 dpi.

50

Figure 3-5. Responses of sitiens (Sit) and the wild-type (WT) tomato to the pathogen-induced senescence. (a), Relative transcript accumulation of the senescence-associated gene GDH1, in Sit and WT at the indicated time points post inoculation. (b), Changes in total protein content in Sit and WT in response to B. cinerea infection. Total protein content was determined using a Bradford assay (Bradford, 1976). Data presented here are ratio of the measured total protein level in infected plants to the total protein level measured in mock-inoculated plants at each indicated time point. Error bars represent ± SE of three biological replicates. (c), Monitoring the senescence process in Sit and WT in response to B. cinerea infection. Sit’s ability to resist the infection-associated senescence could be seen until 7dpi in the whole leaf disk, while the inoculated area within the HR-ring, remained green and viable until 21 dpi. 24 leaf disks from three different Sit and WT plants were inoculated, and incubated for 3 weeks under continuous dark condition at 22 °C. (d), The so-called “green bionissia” phenomenon. Significant differences between gene expression, and protein degradation levels in WT and Sit are indicated by an asterisk (t-student test, p < 0.05).

51

The phenylpropanoid pathway plays a pivotal role in the resistance response of sitiens

against Botrytis cinerea

We have previously shown a strong induction of phenylalanine ammonia-lyase (PAL) activity in

sitiens (at 16 hpi) in response to B. cinerea (Audenaert et al., 2002). However, the importance

of the phenyl propanoid pathway in the resistance response observed in the mutant remained

unclear. The function of phenylpropanoid metabolism in plant resistance mechanisms is

diverse, including strengthening cell walls through deposition of phenolic compounds (Hartley

& Ford, 1989; Dixon et al., 2002). PAL activity is also known as a major secondary source of

ammonium production in plant cells, entailing an influx of ammonium into the cytosol as the

inevitable byproduct of the enzyme activity (Bernard & Habash, 2009). This premise led us to

hypothesize that the ammonium generated by the strong over-activation of PAL might be

reassimilated by the GS enzyme, linking the rapid epidermal cell wall fortification studied

previously (Asselbergh et al., 2007) with the observed alterations in GS/GOGAT-GABA-shunt in

the mutant. Therefore, the involvement of the phenylpropanoid pathway in the sitiens-B.

cinerea interaction was further analyzed.

The relative expression of tomato PAL5 (accession No.: M90692), the main isoform reported to

be induced in response to biotic stresses in tomato (Chang et al. 2008), was next monitored in

both sitiens and wild type plants. The relative expression level of PAL5 was higher in B. cinerea-

infected sitiens plants (3.3 at 16hpi and 4.8 at 24hpi), compared with infected wild-type plants

(0.73 at 16hpi and 2.14 at 24hpi) (Fig. 3-6a). Blast analyses (tblastn, blastx and blastn) revealed

a GenBank tomato cDNA entry (accession No.: AK320988) showing the highest identity to

Petunia axillaris PAL1 (85%), Nicotiana tabacum PAL4 (78%) and Nicotiana attenuatae PAL1

(77%). However, it exhibited no significant sequence similarity to three known tomato PAL1,

PAL5 and PAL6 genes available in GenBank (accession No.: M83314, M90692 and GO653208) or

to available sequences for other tomato PAL genes (PAL2, PAL3, PAL4) retrieved from The

Institute for Genomic Research (TIGR) database (Gayoso et al., 2010). Translation of the

sequence by BLASTX program, revealed 81% and 80% identity (E value = 0) with tomato PAL1

(accession No.: P26600) and PAL5 (accession No.: P35511) proteins, respectively (Supplemental

52

Fig. S1), suggesting that it may encode a new tomato PAL isoform (hereafter referred to as

PAL7, see supplemental Fig. S6 for more information). In comparison with PAL5, the

presumable PAL7 is expressed faster and more strongly in the inoculated mutant. Interestingly,

PAL7 showed a clear parallel expression pattern with GS1 and the GABA-shunt genes (Fig. 3-6a).

Furthermore, silencing of PAL7 in sitiens increased susceptibility to B. cinerea (Fig. 3-6b).

However, the actual existence and functionality of PAL7 protein during the sitiens-B. cinerea

interaction remains to be proved.

Further enzymatic analysis of PAL activity in sitiens demonstrated a pronounced increase in the

overall activity of the enzyme at 8 hpi that was still present at 16 and 24 hpi (Fig. 3-6c). In wild-

type plants, PAL activity increased during infection to only a fraction of the levels in sitiens

confirming the importance of the phenylpropanoid pathway in regulating resistance of tomato

to B. cinerea-sitiens. Accordingly, epi-fluorescence (EF) microscopy revealed either epidermal

(12 hpi) or mesophyllic deposition of phenolic compounds in the mutant (24 hpi) (Fig. 3-6d).

Furthermore, independent application of two different PAL inhibitors, α-aminooxyacetic acid

(AOA) and α-aminooxy-β-phenylpropanoic acid (AOPP) (Amrhein & Gödeke, 1977), gave similar

results and led to extreme susceptibility both in sitiens and WT (Fig. 3-7a –only AOPP data are

shown). EF-microscopy confirmed the attenuating effect of PAL inhibition on the deposition of

phenolic compounds in epidermal cell walls of the mutant (Fig. 3-7b). However, using 3,3’-

diaminobenzidine (DAB) to visualize H2O2 production at the inoculation site revealed that PAL

inhibition did not affect the early epidermal accumulation of H2O2 typically seen in Botrytis-

infected sitiens (Asselbergh et al., 2007), suggesting an upstream role for ROS spiking in the

sitiens-Botrytis interaction (Fig. 3-7c).

53

Figure 3-6. Over-activation of the phenylpropanoid pathway during sitiens-B. cinerea interaction. (a), Relative transcript accumulation of PAL5 and the presumable PAL7 in sitiens (Sit) and the wild-type (WT). (b), Disease severity in PAL7-silenced sitiens and wild type plants (Sit-PAL7 , WT-PAL7) and control plants (Sit/Sit-TRV2, WT/WT-TRV2) infected with B. cinerea. The downregulation of PAL7 gene expression in silenced plants was confirmed using qRT-PCR (Supplemental Table S4). Data represent means ±SE of at least six different plants (leaves), with 4 leaf disks per leaf, from a representative experiment. Different letters indicate statistically significant difference (Duncan’s test; α=0.05). (c), PAL enzymatic activity in sitiens and the wild type in response to B. cinerea infection. For relative activity (infected/mock) of the enzyme, see Supplemental Fig. S7. Error bars represent ± SE of three biological replicates. (d), Left: autofluorescence of phenolic compounds deposited in the mesophyll (red arrows) of sitiens (Sit) leaf inoculated with GFP-expressing B. cinerea (24 hpi); the white arrow indicates epidermal accumulation of phenolics. c: conidium; gt: germ-tube. Right: Epi-fluorescence micrograph of wild-type (WT) leaf inoculated with GFP-expressing B. cinerea (24 hpi). Scale bar = 50 µm. Significant differences between gene expression levels in WT and Sit (panel a), and enzyme activity levels in infected and mock-inoculated plants (panel c), are indicated by an asterisk (t-student test, p < 0.05).

54

Figure 3-7. Effect of PAL inhibition on sitiens (Sit) and wild-type (WT) defense responses against B. cinerea. (a), The effect of different concentrations of AOPP on disease severity in sitiens and the wild type. The downregulation of PAL enzymatic activity in inhibitor-treated plants was confirmed (Supplemental Table S5). Data represent means ±SE of three different plants (leaves), with 4 leaf disks per leaf, from a representative experiment. Different letters indicate statistically significant difference (Duncan’s test; α=0.05). (b), Epi-fluorescence microscopy showing attenuating effect of AOPP treatment on the accumulation of epidermal cell wall-bound phenolics in sitiens, inoculated with GFP-expressing B. cinerea. (c), Effect of AOPP on the epidermal H2O2 accumulation, visualized by DAB staining, in sitiens leaf disks infected with a 10 µl droplet of B. cinerea conidial suspension at different time points. One representative leaf disk out of three replicates is shown for each time point. The red arrow shows B. cinerea mycelia covering sitiens leaf disk, treated with AOPP, representing severe susceptibility. Scale bars = 50 µm.

55

Discussion

In this study, the sitiens-B.cinerea pathosystem was used as a model to understand the

mechanisms needed to effectively resist a necrotrophic pathogen. The focus was mainly

directed toward the role of GABA metabolism in the sitiens defense response, inspired by

previous studies (Asselbergh et al., 2007; Brauc et al., 2011). The results indicate that a timely

over-activation of the GS/GOGAT cycle and the GABA shunt maintains cell viability, slowing

down senescence in the site of primary invasion. Induction of such a cell-death alleviating

mechanism in the cells surrounding the epidermal sites penetrated by B. cinerea, may also

explain how the HR-mediated defense response observed in sitiens (Asselbergh et al., 2007)

can effectively suppress a necrotrophic pathogen.

In angiosperms, there are two distinct GS isoforms, cytosolic (GS1) and chloroplastic (GS2),

which feed ammonium in the GS/GOGAT cycle. GS1 is commonly believed to be involved in

ammonium re-assimilation during natural and stress-induced senescence, as the GS1 transcript

is known as a putative senescence-associated gene (SAG)/marker (Pageau et al., 2006). The

chloroplastic isoform (GS2), though, plays a crucial role in the assimilation of ammonium

obtained from nitrate reduction and photorespiration (Perez-Garcia et al., 1998; Bernard &

Habash 2009). Co-induction of SAGs and defense-related genes has been previously observed in

many cases, highlighting the necessity for an efficient protection against opportunistic

pathogens during the critical process of senescence (Quirino et al., 2000). For instance,

overlapping expression of GS1 and PAL has been reported in a number of studies on plant

tissues undergoing some form of senescence, such as lignin depositing sclerenchyma cells in

naturally-maturing leaf blades of rice (Sakurai et al., 2001), and senescing leaves of Phaseolus

vulgaris in response to Colletotrichum lindemuthianum (Tavernier et al., 2007). Accordingly, the

concurrent high levels of GS1/PAL7 expressions and GS/PAL activities observed in inoculated

sitiens suggest a metabolic link between the phenylpropanoid pathway and the GS-GOGAT

cycle, presumably through reassimilation of PAL-derived ammonium. However, according to

the results presented here, the rapid upregulation of GS1 in sitiens seems not to be associated

with senescence, since senescence is delayed in the mutant, particularly during early stages of

56

the interaction. Under the pathogen challenge, and considering the downregulation of GS2, the

cytosolic isoform might play a compensatory role to ensure the critical functionality of the GS-

GOGAT cycle. Therefore, it could be hypothesized that over-activation of GS-GOGAT cycle is not

merely involved in scavenging the unwanted byproduct of a defensive pathway, but more

importantly, it might be an influential part of an activated anti-cell death mechanism in sitiens.

This was further confirmed when either VIGS of GS1 or inhibition of GS by MSO promoted cell

death and abolished the capacity of sitiens to contain the pathogen during the later stages of

the interaction (Fig. 3-2a). However, a late upregulation of GS1 was observed in wild-type

plants, which may be linked to the putative senescence-related role of the gene in agreement

with the strong senescence occurring in these plants (Fig. 3-5c).

Besides functioning as the basic step in forming different amino acids, glutamate generation via

GS-GOGAT cycle serves as a key source for various compounds with possible roles in plant-

pathogen interaction, such as GABA (Galili et al., 2001; Brauc et al., 2011). Cytosolic

decarboxylation of glutamate by GAD is the main route for GABA biosynthesis (Baum et al.

1996), as well as a controlling point in the GABA-shunt (Busch & Fromm, 1999). It is also known

that this route has a regulatory role in central C/N metabolism by providing a major link

between amino acid metabolism and the TCA cycle (Fait et al., 2008). The genes encoding GABA

shunt enzymes exhibited in sitiens an early upregulation in response to the pathogen,

concomitant to the PAL7 and GS1 expression pattern, suggesting a concerted interplay between

defense response and primary metabolism in the mutant. Further evidence for this interplay is

provided by the UPLC analysis showing an increase in GABA levels in the resistant sitiens

mutant at 8 hpi, followed by a considerable consumption of the amino acid. Since absolute

GABA levels are higher in wild-type plants than in the sitiens mutant, it seems that, rather than

the level of GABA per se, temporal activation of the GABA shunt is important in defense. It is

also known that GABA accumulated in plants in response to different environmental stresses

(Kinnersley & Turano, 2000; Roberts, 2007; Fait et al., 2008), including dark incubation and

mechanical leaf detachment (Wallace et al., 1984). This might explain the gradual increasing

levels of GABA in dark-incubated, detached leaves of sitiens and the wild-type plants (Fig. 3D).

Furthermore, the big difference in GABA levels between B. cinerea-infected wild-type (WI) and

57

mock-inoculated wild-type (WC) at 48 hpi could be related to the spread of the pathogen

infection in the leaf tissue, catabolizing GABA as a perfect N source (Fig. 3C).

Under oxidative stress conditions, the TCA enzymes aconitase, succinyl-CoA ligase and the

NADH-generating α-ketoglutarate dehydrogenase are deactivated, resulting in accelerated cell

death in the stress-undergoing tissue (Sweetlove et al., 2002). Although involvement of the

GABA-shunt in maintaining redox equilibrium during plant responses to abiotic stresses or

natural senescence has gained some attention (Ansari et al., 2005; Fait et al., 2005; Shelp et al.,

2012), the literature relating to the cell death-alleviating role of the GABA-shunt in plant

responses towards pathogen-induced oxidative stress is scarce. According to data presented

here, over-activation of the GABA-shunt in sitiens plays a vital role in resistance to B. cinerea.

Likewise, exogenous application of GABA to the wild type could effectively restrict the

pathogen progress by forming a HR-like ring around the spreading lesion (Fig 3-3b), mimicking

the mesophyllic ring observed as the secondary wave of defense in sitiens (Fig. 3-2a). Taken

together, it could be hypothesized that in sitiens timely activation of the GABA-shunt might

restrict the extent of cell death caused by the H2O2-mediated defense response against B.

cinerea, particularly in cells in the vicinity of the pathogen penetration sites. The redox

regulating effect of the GABA shunt may be explained by generation of NADH via SSADH and/or

by ensuring the functionality of the TCA cycle, under oxidative stress, through bypassing the

ROS sensitive enzymes of the cycle. This hypothesis is in agreement with the report of Wu et al.

(2006), suggesting that the GABA shunt may play a role in restricting cell death in both the

incompatible and compatible interaction of rice with the blast fungus Magnaporte oryzae.

Likewise, we have recently proposed a model describing how over-activation of metabolic

pathways that can maintain the functionality of the GS/GOGAT and TCA cycle in invaded cells

may function as anti-cell death defense strategy, termed as ‘endurance’, resulting in resistance

against necrotrophic pathogens (Seifi, et al., 2013).

Defense responses in plants are known to be highly energy-demanding processes (Heil &

Bostock, 2002; Berger et al., 2007), heavily draining the TCA cycle-generated energy and

intermediates (Kinnersley & Turano, 2000; Bolton, 2009). The TCA cycle plays a crucial anabolic

58

role in supporting the costly defense-related metabolic pathways, such as stress-induced

phenylpropanoid metabolism, which may consume up to 20% of the total photosynthetic

carbon in the plant (Dennis & Blakeley, 1995). This huge demand highlights the necessity of

anaplerotic reactions (‘filling-up reactions’; Kornberg, 1965) to replenish the cycle and ensure

its constant functionality during such circumstances (Kinnersley & Turano, 2000). Under

pathogen invasion pressure, the GABA-shunt might also operate as an important anaplerotic

route to the TCA cycle, providing carbon skeleton in the form of succinate (Michaeli et al.,

2011). Accordingly, the race non-specific Lr34-mediated resistance response against the wheat

leaf rust pathogen Puccinia triticina has been shown to be considerably energy-intensive,

entailing concurrent upregulation of the TCA cycle and the GABA shunt (Bolton et al., 2008).

The results presented here may also support this hypothesis, suggesting concurrent over-

activation of the energy-intensive phenylpropanoid pathway and the GABA-shunt during the

early stages of the sitiens-B. cinerea interaction. In this context, and regarding the observed

delayed senescence in the mutant, the early and moderate transcriptional upregulation of

sitiens GDH1 in sitiens might be associated with the PAL-GS1 pattern and the deaminating

activity of the enzyme, forming 2-oxoglutarate from glutamate, functioning as another

anaplerotic entry point into the TCA cycle. However, the late and substantial increase in GDH in

the wild-type is seemingly associated with the aminating activity of the enzyme, exhausting the

TCA cycle and facilitating cell death as suggested previously (Pageau et al., 2006).

It seems that the lower levels of ABA in sitiens lead to a metabolic state in which the process of

senescence is slowed down (Fig. 3-5c, Sit-Mock). Accordingly, ABA was shown to play a major

role in the regulation of leaf senescence in Lilium leaves (Arrom & Munne-Bosch., 2012).

Interestingly, in the inoculated sitiens, cell viability and photosynthesis are retained within the

pathogen-infested area (beneath the inoculation droplet) until at least 21 dpi, while still

containing viable B. cinerea mycelia. The term “green bionissia” was first defined by Walters et

al. (2008) as a “localized green area of host tissue, in which both host and pathogen cells are

alive, surrounded by yellow, senescent host tissue”. This is typically seen in plants invaded by

obligate biotrophs, such as rusts and mildews, benefitting the pathogen by prolonging

availability of a living nutrient source. Here, however, we report that ABA deficiency in the

59

sitiens mutant of tomato results in a rare type of green bionissia, encircled within a mesophyllic

HR-like ring, functioning as a resistance mechanism to retard the necrotrophic pathogen-

induced senescence in the invaded area. In wild-type tomato plants none of the anti-

senescence defense mechanisms discussed above were observed at early time points,

suggesting that they are suppressed by basal ABA levels in the susceptible interaction. It should

be noted that exogenous application of ABA suppresses all defense responses in sitiens

(Asselbergh et al., 2007; Curvers et al., 2010). However, how exactly ABA may negatively

control such defense mechanisms still remains unanswered.

In summary, through our model sitiens- B. cinerea pathosystem, molecular features of a

biphasic resistance mechanism in response to a true necrotrophic invasion strategy was

eventually unraveled. We propose that, in addition to the epidermal HR-mediated defense

response (Asselbergh et al., 2007), timely reconfiguration of the host central C/N metabolism

plays a vital role in shaping a secondary line of defense response in the resistant mutant (Fig. 3-

8). Initially, the ‘fast pathogen arrest’ phase, consisting of a rapid epidermal ROS accumulation

followed by cell wall fortifications, in which the phenylpropanoid pathway plays a vital role,

arrests the penetrating pathogen in the epidermis. Concurrently, a ‘maintenance’ phase of

basic metabolism begins presumably in the mesophyll cells surrounding the infection site,

tightly controlling the extent of the epidermal HR-mediated defense response, and slowing

down the infection-induced senescence. The ammonium produced by PAL activity is re-

assimilated by the cytosolic GS, reutilizing the byproduct of the primary phase to reduce the

damage to the GS/GOGAT cycle in the absence of the chloroplastic isoform. Subsequently, the

GS-GOGAT-generated carbon skeleton is supplied into the TCA cycle via the over-activated

GABA-shunt, replenishing the redox-regulating and anabolically critical Krebs cycle under the

constant pressure of infectious mycelia of B. cinerea. Ultimately, activation of such a survival

mechanism in the vicinity of the penetration site, culminates in forming a rarely-seen anti-

necrotrophic type of ‘green bionissia’ in sitiens, enabling a HR-mediated defense strategy to be

ultimately effective against a HR-favoring necrotrophic pathogen.

60

Figure 3-8. The multifaceted resistance mechanism in sitiens against B. cinerea. The model depicts the interplay between two spatially and functionally different defensive phases, working synergistically to suppress the pathogen progress: the epidermal HR-mediated response (fast pathogen arrest phase, red asterisks), and the mesophyllic GS1/GABA-shunt-mediated anti cell death mechanism (maintenance phase, green asterisks). The immunologically stained micrograph of an infected sitiens leaf section has been adopted from our previous study (Curvers et al. (2010)), showing two HR-undergone epidermal cells in response to the pathogen penetration (red asterisks). Enzymes are indicated in gray rectangles. PAL, phenylalanine ammonia lyase; GS1, cytosolic glutamine synthetase; GAD, glutamate decarboxylase; GABA, γ-aminobutyric acid; GABA-T, GABA-transaminase; SSA, succinate semialdehyde; SSADH, SSA dehydrogenase; GDH, glutamate dehydrogenase.

61

Materials and Methods

Plant and pathogen materials and growth conditions

The ABA-deficient sitiens mutant of tomato (Taylor et al., 1988, 2000), and the corresponding

wild type ‘Moneymaker’ were grown in potting compost soil in a growth chamber at

temperature ranging from 20°C to 25°C during a 16 h light/8 h dark regime, with 75% relative

humidity. Conidia of Botrytis cinerea strain R16 (Faretra & Pollastro, 1991) and codon-optimized

GFP-expressing Botrytis cinerea strain B05.10 (Leroch et al., 2011) were maintained as

previously described (Audenaert et al., 2002; Asselbergh et al., 2007).

Inoculation method and disease index evaluation

The inoculation conidial suspension was prepared according to Curvers et al. (2010), containing

5 × 105 spores mL-1 in 0.01 M KH2PO4 and 6.67 mM glucose, while for mock inoculation conidia

were omitted from the suspension. For infection trials, leaf disks were inoculated according to

Asselbergh et al. (2007) by putting 10-µL droplets of the inoculation suspension on the adaxial

surface of leaf disks punched from fifth or sixth leaves of 5-week-old plants. Inoculated leaf

disks were placed in enclosed 24-well plates and incubated at 22°C under darkness. Disease

index was evaluated 5 dpi as described before (Curvers et al., 2010), using a disease scoring

scale containing four infection severity categories (supplemental Fig. S1). Spray inoculation was

used for enzymatic assays and transcriptional analyses. The fifth or sixth leaves of 5-week-old

plants were excised and placed in a plastic tray on four layers of absorbent paper, moistured

with 400-500 mL of demineralized water. Leaves were sprayed with the inoculation suspension

using an atomizer until a homogenous coverage of 1-2 µL droplets of the leaf was reached.

Visualization of defense responses

H2O2 accumulation was visualized using DAB staining according to the protocol of Thordal-

Christensen et al. (1997). Samples were floated on aqueous solution of DAB-HCL (1 mg mL-1, pH

4) for three hours and then cleared and fixed in 100% ethanol at the desired time point as

previously described (Azami-Sardooei et al., 2010). To visualize cell wall modifications, safranin-

O staining was performed according to Lucena et al. (2003). Leaf disks were incubated in 0.01%

62

safranin-O in 50% ethanol for 3 min. Fungal structures were stained using a slightly modified

trypan blue staining technique (Asselbergh et al. 2007), with 0.1% trypan blue in 10% acetic acid

for 15 seconds. All the staining protocols were followed by extensive rinsing steps in

demineralized water and finally samples were mounted in 50% glycerol before microscopic

observation. Accumulation of autofluorescing phenolic compounds was detected using an

Olympus BX51 epifluorescence microscope (U-MWB2 GPF filter set, excitation filter 450-480

nm, dichroic beam splitter 500 nm, barrier filter BA515) according to De Vleesschauwer et al.

(2010). Live cell imaging was done using U-MWG2 filter cube (excitation filter 510-550 nm,

dichroic beam splitter DM 570, barrier filter BA590). Images were digitally acquired using

‘Olympus Color View II’ camera, and further processed with the ‘Olympus analysis ‘cell^F’

software.

Enzymatic activity assays and total protein content measurement

Soluble proteins were extracted by resuspending the crushed tissue (150 mg fresh weight) in

0.8 mL of potassium phosphate buffer 0.1 M, pH 8, containing 2% (W/V) polyvinylpyrrolidone,

0.1% (V/V) Triton X-100, 1mM dithiothreitol (DTT) and 1mM phenylmethylsulfonyl fluoride

(PMSF). The extracts were then vortexed for 1 min and centrifuged at 14,000 rpm, 4°C for 10

min. The Bradford method (Bradford, 1976), was used for the measurement of protein levels in

extracts used in enzymatic assays.

PAL enzyme activity was assayed according to Sreelakshmia and Sharma (2008), in a reaction

mixture containing an aliquot of the protein extract (100 µL) in 0.9 mL of 0.1 M borate buffer,

pH 8.8, and 10 mM L-phenylalanine (total volume of 1 mL). The reaction was carried out for 60

min at 37°C and the increase in absorbance at 290 nm was recorded at every 10 min interval.

The enzyme activity was determined kinetically based on the rate of formation of trans-

cinnamic acid by calculating the slope of the linear part of the plot as ‘ΔAbs290 per min per mg

of protein’.

GS enzyme activity was measured by the synthetase reaction (glutamate + ammonia + ATP

glutamine + ADP), according to Machado et al. (2001) with minor modifications. The assay

mixture was composed of 500 mM glutamate, 100 mM hydroxylamine, 200 mM MgSO4, 80 mM

63

ATP and 50 mM imidazole buffer, pH 7.4. The reaction was started by adding an aliquot of the

protein extract (0.2 ml) to a final volume of 2 mL. One mL of the mixture was immediately

removed (at 0 min) and added to 1 mL of Ferguson and Sims (FS, 1971) reagent, consisting of

0.67 N HCl, 0.20 M TCA and 0.37 M FeCl3. Another 1 mL of the assay was incubated at 32°C for

15 min when the reaction was stopped by the addition of 1 mL of the FS reagent. The resulting

precipitate in both tubes (0 and 15 min) was removed by centrifugation at 1500 x g for 3 min

and the absorbance of the supernatant was recorded at 535 nm. The enzyme activity was

calculated as ‘ΔAbs535 per 15 min per mg of protein’.

SSADH enzyme activity was assayed as described by Busch and Fromm (1999). The reaction

mixture contained 900 µl of 0.1 M sodium phosphate buffer, pH 9.0, 1 mM DTT, 0.1 mM SSA,

0.5 mM NAD+ and 100 µL of SSADH-containing protein extract. Enzyme activities were

monitored for 5 min, and the increase in absorbance at 340 nm was recorded at every 0.5 min

interval at 24°C. The enzyme activity was determined by calculating the slope of the linear part

of the absorbance plot as ‘ΔAbs340 per min per mg of protein’.

Pharmacological experiments

The leaf disk/24-well plate method, described by Asselbergh et al. (2007) was used for all

inhibitor treatments. Prior to inoculation and microscopic observations, leaf disks of sitiens and

wild type were floated for 12 h on aqueous solutions of the respective inhibitors at the

indicated concentrations, while control leaf disks were placed on sterile demineralized water.

RNA extraction, cDNA synthesis, and quantitative RT-PCR analysis

RNA extraction, cDNA synthesis, and quantitative RT-PCR analysis were performed following

the procedure described by De Vleesschauwer et al. (2010). Briefly, total RNA was isolated from

frozen leaf tissue using the Spectrum Plant Total RNA kit (Sigma). First-strand cDNA synthesis

was done using the High Capacity cDNA Reverse Transcription kit and random primers (Applied

Bioscience), according to the manufacturer’s instructions. Nucleotide sequences of all primers

used in this study are listed in Supplemental Table S1. Maxima Sybr Green qPCR master mix

(Fermentas) and the Mx3005P real-time PCR detection system (Stratagene) were used for

64

quantitative PCR amplifications. A dissociation curve analysis was included to verify the target

specificity of the primers used. Two different reference genes actin (accession No.: AB199316.1)

and elongation factor 1α (accession No.: X14449.1) (Lovdal & Lillo, 2009), were used as internal

controls to normalize the amount of plant RNA in each sample. Samples collected from mock-

inoculated plants at 0 hpi were selected as a calibrator and the generated data were analyzed

with the Mx3005P software (Stratagene).

Virus-Induced gene silencing

Virus-induced gene silencing was carried out on tomato seedlings according to Velásquez et al.

(2009). Briefly, fragments of the tomato (herein called) PAL7 (AK320988.1), GS1 (AF200360.1)

and GABAT1 (NM_001247407.1) were amplified by PCR from a tomato cDNA library with gene-

specific primers (Supplemental Table S2). Adaptor-PCR was used to attach the GATEWAY

recombinatorial cloning (Invitrogen) attB1 (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3’) and

attB2 (5’-GGGGACCACTTTGTACAAGAAAGCTGGGT-3’) sites to the fragments. The resulting

fragments were cloned into the pTRV2-GW vector (Liu et al., 2002a). Constructed plasmids and

the helper plasmid pTRV1 were isolated and transferred into Agrobacterium tumefaciens strain

GV3101 by electroporation. A mixture of A.tumefaciens containing the pTRV1 and the

pTRV2:GUS (or the pTRV2 containing the genes of interest) in a 1 to 1 ratio was used for agro-

inoculation. Three to four weeks after inoculation, fully expanded leaves of both silenced plants

and vector control plants were used for infection with B. cinerea.

GABA level measurement

GABA was extracted from 50 mg of freeze-dried tissue powder with 400 µL of methanol, 200 µL

of chloroform and 400 µL of water at room temperature. Aliquots of 200 µL of the upper phase

were dried under vacuum and residues were resuspended in 50 µL of ultra-pure water. GABA

was derivatized using the AccQTM Tag Ultra derivitization kit (Waters Corporation, Milford, USA)

according to the manufacturer’s instructions. Derivatized GABA was analyzed using an

AcquityTM UPLC system (Waters Corporation, Milford, USA) as described by Jubault et al. (2008).

For each sample, GABA was reliably identified by comparison of sample chromatograms with

65

standard, and then quantified after normalization against internal standards and plant material

fresh weight.

Acknowledgements

This work was supported by grants from the Fund for Scientific Research Flanders (FWO grants

3G052607 and 3G000210) and by a postdoctoral fellowship of the Research Foundation–

Flanders (to D.D.V.). We are very grateful to Sandra Villaume for technical assistance, and to Dr.

Mansour Karimi and Pooneh Kalhorzadeh for their support and invaluable remarks during

different stages of the research. We also thank Prof. Matthias Hahn and Dr. Michaela Leroch for

providing GFP-expressing B. cinerea. Our heartfelt appreciation also goes out to Gareth Hill for

proofreading of the manuscript.

Author contribution

H. Seifi designed the concept, performed experiments, analyzed data and wrote the original

draft of the manuscript. K. Curvers technically supervised gene silencing-related experiments,

and proofread the manuscript. D. De Vleesschauwer critically reviewed the manuscript, and

particularly gave some critical remarks on the final model. I. Delaere provided technical

assistance. A. Aziz was involved in amino acid measurements; while M. Höfte supervised the

entire process of devising the paper.

66

Supplementary material

Supplemental Figure S1. Illustration of the severity scale used for disease index evaluation. A disease index was calculated as described previously (Curvers et al., 2010), with four different scores (0, resistant; 1, slightly spreading lesion; 2, moderately spreading lesion; 3, severely spreading lesion) using the following formula: [(0 × a) + (1 × b) + (2 × c) + (3 × d)/(a + b + c + d)] × 100/3 where a, b, c, and d are the number of discs examined with scores 0, 1, 2, and 3, respectively.

Supplemental Figure S2. Relative values (inoculated/mock) of SSADH enzymatic activity in sitiens (Sit) and wild-type (WT) tomato plants at different time points post inoculation.

0

1

2

3

4

5

0 8 16 24

Re

lati

ve e

xpre

ssio

n (

Inf.

/Mo

ck)

Hours post inoculation

Sit-SSADH

WT-SSADH

67

0

1

2

3

4

5

6

7

8

0 8 16 24

GS

rela

tive

act

ivit

y (I

nf.

/Mo

ck)

Sit

WT

Supplemental Figure S3. A fully expanded 5th

leaf (left) and a 4 week-old PDS-silenced sitiens plant (right). The frequency of gene silencing in PDS-silenced plants were almost 100% (i.e. percentage of plants showing silencing phenotype (bleaching or yellowing) among total infiltrated plants).

Supplemental Figure S4. Relative values (inoculated/mock) of GS enzymatic activity in sitiens (Sit) and wild-type (WT) tomato plants at different time points post inoculation.

68

Supplemental Figure S5. The effect of glutamine synthetase inhibition by MSO on electrolyte leakage in sitiens (Sit) and the wild type (WT) inoculated with B. cinerea. MSO treatment, B. cinerea inoculation and electrolyte leakage measurement were performed as described in “Material and Methods”. Cell death electrolyte leakage was measured as described by Dhawan et al. (2009). Briefly, upon the inhibitor treatment and at the indicated time points, leaf disks were collected, washed with Milli-Q water and placed in a tube containing 15 mL of Milli-Q water, after which the conductivity was measured using a conductivity meter (Model AG 644, Conductometer, Metrohm). Vertical bars indicate standard errors.

0

20

40

60

80

100

120

140

160

180

24 48 72 96 120

Co

nd

uct

ivit

y (µ

S/m

m)

Hours post inoculation

WT-Mock

WT-Inf.

Sit-H2O-Mock

Sit-H2O-Inf.

Sit-MSO-Mock

Sit-MSO-Inf.

69

Supplemental Figure S6. Sequence alignment (BlastX) of the novel tomato PAL (PAL 7) and existing tomato PAL1 (accession No.: P26600) and PAL5 (accession No.: P35511) isoforms. Translation of the sequence gave 81% and 80% identity (E value = 0) with tomato PAL1 and PAL5 proteins, respectively. More information regarding the cDNA entry AK320988: The sequence showed the highest identity to other species’ PALs, such as Petunia axillaris PAL1 (85%), Nicotiana tabacum PAL4 (78%) and Nicotiana attenuatae PAL1 (77%). However, it exhibited no significant sequence similarity to three known tomato PAL1, PAL5 and PAL6 genes available in GenBank (accession No.: M83314, M90692 and GO653208) or to available sequences for other tomato PAL genes (PAL2, PAL3, PAL4) retrieved from The Institute for Genomic Research (TIGR) database (Gayoso et al., 2010).

70

0

2

4

6

8

10

12

14

0 8 16 24

PA

L re

lati

ve a

ctiv

ity

(In

f./M

ock

)

Hours post inoculation

Sit WT

Supplemental Figure S7. Relative values (inoculated/mock) of PAL enzymatic activity in sitiens (Sit) and wild-type (WT) tomato plants at different time points post inoculation.

Supplemental Figure S8. The phenotype of the HBA-treated wild-type leaf disks.

71

Genes Genbank

accession number Forward (5’-3’) Reverse (5’-3’)

Act AB199316.1 TCGGAATGGGACAGAAGGATGCG TGCCTCAGTCAGGAGAACAGGG EF1-α X14449.1 ATGCACCACGAAGCTCTCCAGG ATGACCTGGGCAGTGAAGCTGG PAL7 AK320988.1 GCTATCAACGCGTTCCAACAGGC ACCATTGAGGCCAAGCCAGAGC PAL5 M90692.1 TCGTGGGACGATCACTGCATCG ACAGCCTTGGAGTTAGGCCTGC GS1 AF200360.1 ATTGGCGGTTTTCCTGGCCC ACTGTCCCGGCATGACTTCACC GS2 U15059.1 CGCCCAGCTTCAAACATGGACC AGCTTCAGCCTCAAGGGTTGGC GAD2 AB359914 CGTCGTTGTACCACCACTACGC ACGCGAAAGTCGAGTGAACGG DAO AJ871578.1 ACCGTTCGATTATCCAGCGTGGC ATACCAACCAGCAGCGACGG GABA-TA NM_001247407.1 AGGAGTTCTCCACCAGGTTGGC AGGCACAGATGACCTCATCCGC SSDH AB359921.1 TCTCCGCTGAGGAGGGTAAACG ACAAGCAAGAGCAGGGCCAACC GDH U48695.1 AGCACGACAATGCACGAGGG ATATTGGCGACCGCTGTCTTCC

Supplemental Table S1. Gene-specific primers used in quantitative real-time PCR

Supplemental Table S2. Gene-specific primers used in virus-induced gene silencing

72

Supplemental Table S3. Concentrations of GABA in sitiens (Sit) and wild-type (WT) tomato at different time points post inoculation. Abbreviations: SC/WC: Mock-inoculated (control) Sit/WT; SI/WI: B. cinerea-inoculated (infected) Sit/WT. Data represent values ±SE of three biological replicates.

Supplemental Table S4. Levels of silencing of (VIGS) target genes

Supplemental Table S5. Levels of inhibition of target enzymes

73

74

75

Chapter

4

Addendum to Chapter 3 (Concurrent over-activation of the cytosolic glutamine synthetase

and the GABA-shunt in the abscisic acid-deficient sitiens mutant of tomato leads to resistance

against Botrytis cinerea)

Hamed Soren Seifi, Aziz Aziz, Monica Höfte

The role of asparagine synthetase in B. cinerea-tomato interaction

he fungal plant pathogen Botrytis cinerea is the causal agent of gray mold disease on a

broad range of hosts. As a true necrotroph, B. cinerea possesses several virulence factors

for inducing cell death in its host. Therefore, progress of B. cinerea colonization is commonly

associated with induction of senescence in the host tissue, even in non-invaded regions. In the

previous chapter (Chapter 3), we showed that abscisic acid deficiency in the sitiens tomato

mutant culminates in an anti-senescence defense mechanism which efficiently contributes to

the restriction of B. cinerea growth in the host leaf tissue. However, a strong induction of

senescence could be observed in the susceptible wild-type tomato upon B. cinerea infection.

Such pronounced infection-induced senescence in the wild-type plant was confirmed by higher

levels of total protein degradation and upregulation of two key senescence associated genes

(SAGs), namely glutamate dehydrogenase (GDH) and cytosolic glutamine synthetase (GS1). In

this chapter, the possible involvement of another key SAG, asparagine synthetase (as) in the B.

cinerea-tomato interaction has been explored.

T

76

The amino acid asparagine is one of the major metabolic products in senescing leaves in plants

(Begona et al., 2006). Asparagine has a N:C ratio of 2:4, which makes it an efficient metabolite

for nitrogen transport, particularly during the process of senescence (Kim et al., 1999; Lea et al.,

2007). The major route of asparagine synthesis in the plant cell is the ATP-dependent transfer

of the amino group of glutamine to a molecule of aspartate to form glutamate and asparagine

(Glutamine+Aspartate+ATP Glutamate+Asparagine+AMP+PPi), catalyzed by the enzyme

asparagine synthetase (Lea et al., 2007). AS is also known as a senescence associated gene and

marker (Gaufichon et al., 2010), with possible roles in plant-pathogen interactions (Abuqamar

et al. 2006; Pageau et al. 2006). According to our previously proposed model, over activation of

AS functions as an ‘evasion’-natured metabolic modulation that, depending on the pathogen

lifestyle, affects the overall defense response in two opposite ways. It seems that evasion-

natured metabolic alterations are normally associated with resistance to biotrophic invasions,

whereas they may facilitate necrotrophic infections (Seifi et al., 2013; Chapter 2). For instance,

an early (5 hpi) induction of AS1 in pepper was shown to be involved in resistance against the

hemibiotrophic bacterial pathogen Xanthomonas campestris pv. vesicatoria, while later (15-20

hpi) induction of the enzyme (during the necrotrophic phase of the pathogen infection) was

associated with susceptibility (Hwang et al. 2011). Similarly, a late induction (2 dpi peaking at 4

dpi) of AS in the compatible interaction of the hemibiotrophic pathogen Pseudomonas syringae

and tomato (Olea et al. 2004), was hypothesized to facilitate the cell death associated with the

necrotrophic phase of the infection.

In the previous chapter (Chapter 3), It was shown that ABA deficiency in the sitiens mutant of

tomato results in the over-activation of a GABA-shunt/GS1 mediated, anti-senescence defense

mechanism in response to B. cinerea infection which crucially contributes to the resistance

response in the mutant. However, in Chapter 3, how mechanistically B. cinerea may induce the

observed strong senescence in the susceptible wild-type plant (Chapter 3, Fig. 3-5c), remained

largely unexplained.

In addition to the data already presented in Chapter 2, we also performed other transcriptional,

metabolic and in vitro assays to further study the process of infection-induced senescence in

77

the necrotrophic tomato-B. cinerea interaction. Besides monitoring the expression pattern of

two well-established key SAGs, GS1 and GDH, in sitiens and wild-type plants upon B. cinerea

infection (Chapter 3, Fig. 3-4c and 3-5a), transcriptional alterations of the tomato AS1 gene

(GeneBank accession No. AY240926.1) were also monitored. The AS gene showed a

tremendous upregulation in response to B. cinerea in the wild-type tomato, whereas such

strong induction was not seen in the case of the sitiens mutant (Fig. 4-1).

Figure 4-1. Expression level of the asparagine synthesized gene in mock (M) and B. cinerea-inoculated (I), wild type (WT) and sitiens (Sit) plants. The AS1-specific primer pair used in qRT-PCR analysis: Forward:

TCCCCTTTGGTGTTCTGCTCTCG, Reverse:

TGCTCCCCATTGCTTAGCAGC.

Furthermore, the levels of different amino acids were measured in mock-inoculated and B.

cinerea-infected plants (both genotypes) following the protocol described before (Chapter 3,

“Material and Methods”). The levels of the amino acid asparagine increased in the mock-

treated plants, showing the effect of dark incubation on the accumulation of asparagine, as

suggested previously (Oliveira et al., 2001). Interestingly, the amino acid asparagine was

78

tremendously depleted in the wild-type tomato after 48 hpi, while in sitiens none of the amino

acids showed such a strong depletion ratio (Fig. 4-2, 4-3).

Figure 4-2. Depletion ratio (level in mock/level in infected), 48 hours after B. cinerea infection, of different amino acids in the wild-type and the sitiens mutant tomatoes in response to B. cinerea infection.

79

Figure 4-3. Alterations in asparagine levels in sitiens (Sit) and wild-type (WT), mock (M) and infected (I) plants, at different time points post inoculation.

Additionally, an in vitro assay, using Gamborg B5 salt base medium following the protocol

described previously (Chapter 3, “Material and Methods”), showed that the amino acid

asparagine is a perfect nitrogen source for B. cinerea, resulting in a normal mycelial growth and

a dense sporulation (Fig. 4-3).

Figure 4-3. In vitro effect of asparagine (Asn, 5mM) on the growth and sporulation of B. cinerea grown on Gamborg B5 salt base medium (B5 base: with no carbon and nitrogen sources). “S” stands for sucrose, used as the carbon source in the assay. The black circles indicate the place of the inoculation plaque.

80

As it was previously discussed in this chapter, induction of senescence in the host is a well-

studied pathogenicity mode for the necrotrophic pathogen B. cinerea (Swartzberg et al., 2008).

Accordingly, it seems that in the wild-type tomato plant, susceptibility to B. cinerea is

correlated with a strong induction of the AS gene. AS has been also shown to be an ABA-

responsive gene being upregulated in response to different abiotic stresses (Wang et al., 2005;

Genevestigator, Zimmermann et al., 2005). This might explain why in the ABA-deficient sitiens

mutant, compared with the wild-type plant, the AS gene is only slightly induced by B. cinerea

infection. Furthermore, it has been shown that depletion in sugar levels in tomato plants

submitted to prolonged darkness conditions, results in a strong induction of the AS gene

(Devaux et al., 2003). Accordingly, the strong induction of AS in the B. cinerea-infected wild-

type tomato (Fig. 4-1), might be mediated through both catabolization of the host apoplastic

sugar content by the pathogen, and incubation of tomato leaves in a continuous dark condition.

Interestingly, B. cinerea-induced upregulation of AS in the wild-type plant seems to be followed

by strong depletion of the amino acid asparagine in the infected leaves, suggesting a causal link

between the two transcriptional and metabolic phenomena. Having the highest N content

among all amino acids, asparagine can be a rich N source for B. cinerea in vitro (Fig. 4-3), and

possibly in planta. Therefore, it could be hypothesized that strong induction of AS in the

susceptible wild-type tomato might play a dual role in the pathogenicity of B. cinerea, i.e., both

facilitating virulence-associated senescence in the host tissue, as well as, providing a rich N

source for the progressive in planta growth of the pathogen.

81

82

83

Chapter

5

Characterization of ammonium nitrate induced-resistance against Botrytis

cinerea in tomato

Hamed Soren Seifi, Aziz Aziz, Monica Höfte

n this study, the effect of ammonium nitrate (AN) supplementation on the defense reaction

of tomato against B. cinerea has been studied. Our results indicate that AN fertilization (5

mM supplemented to the soil) can reduce susceptibility to B. cinerea in the wild-type tomato

plant. Furthermore, we present evidence that the unknown mechanism mediating this type of

induced resistance in the wild-type tomato clearly differs from the epidermal HR-mediated

resistance response, previously characterized in the sitiens mutant. However, there seems to be

some symptomatic resemblance to the secondary mesophyllic defense reaction in the sitiens

mutant, described previously in Chapter 3, proposing a possible role for the host central C/N

metabolism in the observed AN-induced resistance against B. cinerea in the wild-type plant.

I

84

Introduction

A renewed attention has been paid to the interplay between plant primary metabolism and

defense mechanisms against pathogens (Berger et al., 2007). It is being increasingly reported

that primary metabolism is an indispensable component of the defense machinery of plants

(Bolton, 2009; Seifi et al., 2013). However, molecular knowledge on the role of central

metabolism in plant defense mechanisms against different pathogenic strategies is still scarce

(Liu et al., 2010).

Nitrogen (N) is an essential element for plant growth and development. However, in response

to pathogen infection, the effect of plant N content on defense seems to be very complicated.

It is believed that N deficiency facilitates disease development, presumably due to the

hampered defense reaction caused by nutritional stress (Bolton, 2009). Similarly, in Arabidopsis

both the constitutive and induced levels of defense-associated proteins have been reported to

be higher at high N conditions (Dietrich et al., 2004). On the other hand, over-fertilization of N

can also promote disease by providing extra nutrients, such as free amino acids, for the

developing pathogen (Solomon et al., 2003). In the same vein, it is believed that some defensive

compounds functioning as structural barriers against pathogens may considerably decline at a

low C⁄N ratio, which are the consequence of a high N nutrition (Talukder et al., 2005).

There is also a recent body of evidence suggesting that the level of N, per se, is not the main

determinant of defense outcome, but the pathogen lifestyle may also play an influential role in

this context (Walters and Bingham, 2007; Seifi et al., 2013). This pathogenesis-dependent effect

of N on the host defense can be seen in a number of research studies. For instance, examining

the effect of N fertilization (in the form of nitrate) on tomato defense response to different

pathogens, Hoffland et al. (2000) reported that increased N concentrations in tomato

hydroponic cultivation could reduce susceptibility to B. cinerea, whereas it significantly

increased susceptibility to the biotrophic powdery mildew fungus Oidium lycopersicum.

Accordingly, it was recently demonstrated that nitrogen supplementation (in the form of

nitrate) alleviates the disease severity of B. cinerea infection on leaf-pruning wounds of tomato

stems (Lecompte et al., 2010). However, both medium and high levels of N supplementation in

85

the biotrophic wheat-Puccinia recondita (leaf rust pathogen) interaction increase spore

production and lesion size, compared with low N conditions (Robert et al., 2004). Very recently,

different types of N supplementations, i.e. NO3 and NH4+, have been shown to induce different

effects on the defense response of tobacco against Pseudomonas syringae pv. phaseolicola

(Gupta et al., 2012). The authors have demonstrated that NO3 treatment culminates in an

enhanced nitric oxide (NO), salicylic acid (SA)-mediated HR reaction; while NH4+ treatment does

not stimulate such defense response, and only results in increased levels of free amino acids in

the host tissue. Nevertheless, experimental information on possible mechanisms through which

N-supplementation might alter defense responses against different pathogenic lifestyles is still

fragmentary.

It is known that N-fertilization increases antioxidant capacity, chlorophyll content and

photosynthetic performance, consequently delaying senescence in the plant leaf (Zhang et al.,

2010). Furthermore, according to our previous results (presented in Chapter 3 and 4), it seems

that induction of senescence in tomato leaf tissue functions as an effective virulence

mechanism for B. cinerea to establish its colonization. In the light of these findings, we

examined the effect of N-fertilization on the defense response of the wild-type tomato against

B. cinerea to further explore the role of senescence in tomato-B. cinerea interaction.

Results

Ammonium nitrate (AN) fertilization decreases susceptibility in the wild-type tomato plant

Wild-type tomato plants were grown in greenhouse conditions (16/8 hours light/dark regime,

at 25/20°C temperature). Plants were supplemented with AN (5mM and 1mM) for three weeks

prior to infection trials, while control plants were irrigated with tap water. After five weeks

(post seed germination), tomato leaves were detached for inoculation with B. cinerea. At this

stage the 5mM AN-supplemented plants were clearly greener with thicker and larger leaves

compared with the control and 1 mM AN-supplemented plants (Fig. 5-1A). Detached leaves of

5-week old tomato plants were inoculated with B. cinerea conidial suspension using droplet

86

inoculation method (Chapter 3); while results of the infection trial were scored 3 days post

inoculation. Interestingly, fertilization with 5 mM AN could significantly reduce susceptibility to

B. cinerea in wild-type plants, while 1 mM AN did not show any significant effect (Fig. 5-1B).

Figure 5-1. A, The effect of AN supplementation (1 and 5 mM) for the period of 3 weeks on the growth and phenotypic characteristics of 5-week-old wild-type tomato plants. B, The effect of AN supplementation on the defense response of wild-type tomato against B. cinerea. Different letters indicate statistical significance (Duncan’s test; α=0.05).

AN-induced resistance in the wild-type tomato is not mediated by an early ROS accumulation

To assess whether the AN-induced resistance response to B. cinerea in wild type holds similar

characteristics to the already studied resistance response observed in the sitiens mutant, the

DAB staining method (Asselbergh et al., 2007), was used to visualize the pattern of H2O2

accumulation and localization during the course of infection. Interestingly, no sign of an early

H2O2 accumulation was seen in AN wild-type leaf disks. However, at later stages (24 hpi)

87

sporadic necrotic brownish spots were observed leading to a restricted DAB-stained pattern,

within the border of the inoculation droplet, at later stages (48 hpi) (Fig. 5-2).

Figure 5-2. Visualization of the accumulation of H2O2 at different time points post inoculation in AN-treated (WT-AN) and control (WT-Ctrl) wild-type tomato plants using DAB staining technique. Sitiens (Sit-Ctrl) leaf disks have been used as another control, showing an early accumulation of H2O2 in response to B. cinerea.

Microscopic analysis of AN-induced resistance reaction in wild-type leaves

Additionally, bright-field microscopic analysis of the defense response in AN-treated wild-type

leaves further confirmed that the AN-induced resistance in the wild-type tomato is not

associated with the epidermal HR-mediated defense response, previously observed in the

sitiens mutant, referred to as the primary ‘fast pathogen arrest’ phase (Chapter 3). However, at

later stages of B. cinerea infection (3 dpi), a mesophyllic HR-like ring around the inoculation

site, restricting the pathogen growth, was revealed in the AN-wild-type leaf (Fig. 5-4). This

phenomenon strongly resembled the mesophyllic HR-like ring previously observed in the sitiens

mutant during the secondary phase of resistance against B. cinerea, termed as the

‘maintenance’ phase (Chapter 3, Fig. 3-2 a).

88

Figure 5-4. Macroscopic and microscopic analysis of the defense response of AN-supplemented wild-type leaves (WT-AN) at 3 dpi, compared with the defense response of sitiens leaves (Sit). In WT-AN a mesophyllic HR-like symptom can be seen, while in Sit the HR reaction mainly occurs in the epidermis.

AN-supplementation does not change the cuticle permeability in the wild-type tomato

It has been previously shown that the sitiens mutant of tomato possesses a high level of cuticle

permeability which positively correlates with resistance to B. cinerea (Curvers et al., 2010).

Therein, it was hypothesized that a more permeable cuticle in sitiens may facilitate a more

efficient permeation of potential defense-eliciting signaling molecules that results in a timely

perception of B. cinerea attack, consequently leading to a fast and effective defense response in

the mutant. In the light of this hypothesis, we tested the possible effect of AN-supplementation

on the cuticle permeability of wild-type tomato leaves. To do this, leaf disks derived from AN-

treated wild-type plants were compared with leaf disks of water-treated wild-type plants,

naturally possessing a very low level of cuticle permeability (as the negative control), and sitiens

leaves exhibiting a high level of cuticle permeability (as the positive control). However, the

results indicated that AN-supplementation did not alter the leaf cuticle permeability in wild-

type leaves (Fig. 5-3).

89

Figure 5-3. The effect of AN supplementation on the cuticle permeability of the wild-type (WT) tomato leaves. Water-treated wild-type (WT-Ctrl) and sitiens (Sit) leaf disks were used as controls. All leaf disks

were floated upside-down on the toluidine-blue dye solution overnight. The more permeable cuticle allows more efficient penetration of the dye through the leaf tissue. The cuticle permeability was visually qualified based on the surface of the leaf disk which has been either stained or remained unstained. In this image, sitiens leaf disks are totally stained with the dye, showing a high level of cuticle permeability; whereas the AN-treated wild-type leaf disks (WT-AN), like the water-treated controls (WT-Ctrl), remained unstained.

Amino acid profiling of AN-treated wild-type plants during the course of infection

We also monitored the changes in free amino-acid concentrations during the course of

infection in AN-treated and control plants. However, due to an unexpected problem in the

heating/cooling system of the growth chamber used in this experiment (causing inconsistent

temperature (12-22°C) and relative humidity (50-80 %) changes during the 5th week of the

growth period), the experiment needs to be repeated in more consistent growth conditions.

Nevertheless, since the phenomenon of AN-induced resistance was still detectable in AN-

treated plants, the collected data might be worthy of consideration, providing some clues about

the interaction of host amino acid metabolism and B. cinerea infection in AN-treated tomato

plants. According to this set of data, the most striking changes were seen in glycine, serine,

glutamate, glutamine, aspartate, asparagine, arginine and GABA amino acids (Fig. 5-6).

90

Figure 5-6. Changes in the concentration (nmol/g fresh weight) of free amino acids in AN-treated control (AN), and AN-treated, B. cinerea-inoculated (ANI) tomato leaves.

91

The activity of the photorespiratory glycolate oxidase (GOX) enzyme increases in AN-

supplemented wild-type plants

The photorespiration pathway is the main route of the biosynthesis of glycine and serine in

plants (Lea and Azevedo, 2007). The observed accumulation of serine and glycine in AN-

supplemented plants in response to B. cinerea infection may hint at the involvement of the

photorespiration pathway in the resistance response in AN-supplemented wild-type plants. To

further assess this hypothesis, the activity of the photorespiratory enzyme, glycolate oxidase

(GOX, Chapter 2, Fig. 2-1) was measured in AN-treated and control plants at 8 hpi. Interestingly,

results showed that AN-fertilization increased GOX enzyme activity in both mock and B.

cinerea-inoculated wild-type tomato leaves (Fig. 5-5), confirming the over-activation of

photorespiration in AN-supplemented wild-type leaves. Moreover, in response to B. cinerea

infection, the GOX enzyme showed even higher activity in AN-wild-type, suggesting a role for

the photorespiration pathway in the observed resistance response (Fig. 5-5).

Figure 5-5. Activity assay of the GOX enzyme in mock (M) and inoculated (I) wild-type control (WT-C) and AN-treated (WT-AN) plants. Vertical bars indicate ±SE of three biological replicates. Different letters indicate statistically significant difference (Duncan’s test; α=0.05).

92

Discussion

A well-known hypothesis on the role of N availability in plant defense mechanisms is known as

the “carbon/nutrient balance” (CNB) hypothesis (Bryant et al., 1983). According to this

hypothesis, alterations in the host C/N ratio play a key role in the biosynthesis of the type of

defense-related compounds (i.e. containing more N or C), consequently affecting the outcome

of defense. For instance, in low N conditions, when the C/N ratio increases, plant growth

declines and fewer precursors are allocated for the generation of N-based defense-related

secondary metabolites, such as alkaloids. Although the CNB hypothesis provides a mechanistic

explanation for the involvement on plant N content in defense mechanisms, it cannot explain

the observed cases of increased susceptibility in N-fertilized plants against biotrophic

pathogens (such as Hoffland et al., 2000). Moreover, in another study on tomato-B. cinerea, a

positive correlation was found between the C/N ratio and the levels of the key N-rich

antimicrobial secondary metabolite α-tomatine (Hoffland et al., 1999). These authors therefore

proposed that instead of lower N-allocation for N-rich secondary metabolites, higher levels of

soluble sugars, providing a rich C source for the pathogen, might induce susceptibility to fungal

pathogens in low N conditions.

The present study also provides some insights into the role of N availability in plant-pathogen

interactions. Our results may present further evidence for our previously proposed hypothesis

on the role of glutamate metabolism in the induction of resistance against B. cinera. The

mechanism controlling the observed AN-induced resistance seems to be quite distinct from the

rapid epidermal defense reaction previously seen in the sitiens mutant (Asselbergh et al., 2007;

Curvers et al., 2010). However, the symptoms of the AN-induced resistance in wild-type leaves

are almost identical to the secondary mesophyllic reaction of the sitiens mutant, termed as the

‘maintenance’ mechanism (Chapter 3), proposing a similar mechanism to be involved in this

type of induced resistance response. According to our previously depicted model on the

biphasic defense mechanism of sitiens against B. cinerea (Chapter 3, Fig. 8), the secondary

‘maintenance’ defense reaction comprises of a timely reconfiguration of central C/N

metabolism in the cells surrounding the penetration sites. This type of metabolic modulation,

93

also termed as ‘endurance’ (Chapter 2), may protect cell viability in the invaded tissue, slowing

down the necrotrophic pathogen-induced senescence. ‘Endurance’-associated modulations

occur through over-activation of those metabolic pathways that supply the critical components

of basic metabolism (such as the TCA and GS/GOGAT cycles) in the challenged area, like the

GABA-shunt and the photorespiration pathway (Chapter 2; Fig. 2-1). This was further

highlighted by the GOX enzyme activity measurements, indicating an over-activation of the

photorespiratory enzyme prior to and after B. cinerea infection in AN-treated plants. In the

same vein, higher levels of glycine and serine in the resistant AN-treated plant might also be

linked to the over-activation of the photorespiration pathway in response to B. cinerea

infection. However, occurrence of some inconsistent growth conditions during the last week of

the growth period, may have affected the amino acid metabolism in our plants. Nevertheless,

considering the levels of different amino acids in both the control and treated samples, we are

still able to see the sole effect of B. cinerea infection and N-supplementation on the amino acid

profile of these tomato plants. In other words, although inconsistent temperature conditions in

the last week of the growth period may have modified the levels of some amino acids in all the

samples, the presented data may still provide some useful clues.

Interestingly, it has been shown that the direct product of the GOX enzyme, glyoxylate, is also a

major substrate for the GABA-shunt key enzyme, GABA transaminase in Arabidopsis thaliana

(Clark et al., 2009). This suggests a causal link between photorespiration and the GABA shunt,

which might be also involved in AN-induced resistance against B. cinerea in tomato. Moreover,

a clear pattern of depletion of all nitrogen-rich amino acids can be seen in AN-wild type leaves

in response to B. cinerea attack (Fig. 5-6). This reaction might be also related to the allocation of

the host nitrogen reservoir on the defensive pathways related to central C/N metabolism, such

as the photorespiration pathway and the GABA shunt, in the challenged tissue. However, in this

study, such metabolic interaction between the two pathways and their possible roles in the

observed AN-dependent defense response remain unexplored. Collectively, the data presented

here, seem to be in general agreement with our previously proposed ‘endurance’ resistance

model against necrotrophic pathogens (Seifi et al., 2013; Chapter 2). It could be therefore

hypothesized that the boosted ‘endurance’ state in the invaded tissue, caused by

94

supplemented central C/N metabolism, restricts the extent of the cell death, induced by the

necrotrophic pathogen. Accordingly, some results hint at the photorespiration pathway to be

involved in this (seemingly) central C/N metabolism-dependent resistance mechanism against

B. cinerea. However, still more empirical data are necessary to be able to come up with a solid

explanation on the observed AN-induced resistance response against B. cinerea.

Material and methods

Plant growth conditions and inoculation method

Wild-type tomato plants were cultured in normal potting soil under 16/8 hours light and 25/20

C° temperature regimes. All plants were watered with tap water for two weeks after

germination, while N-supplementation was applied into the soil using ammonium nitrate (AN)

solutions (1 and 5 mM), for the period of three weeks afterwards. Control plants were irrigated

with tap water for the whole period of five weeks. At 5-week old stage, plants were used for

the inoculation trial. The inoculation conidial suspension contained 5 × 105 spores mL-1 in 0.01

M KH2PO4 and 6.67 mM glucose, while for mock inoculation conidia were omitted from the

suspension. The fifth or sixth leaves of 5-week-old plants were excised and placed on four

layers of absorbent paper, moistured with 400-500 mL of demineralized water, in a plastic tray.

Disease index was evaluated 3 days post inoculation (dpi) as described before (Chapter 3).

GOX enzymatic assay

Total protein extraction and measurement were done as described previously (Chapter 3). The

GOX enzyme activity was measured by an enzyme-coupled assay following the protocol

described by Macheroux et al. (1991). Briefly, the H2O2 generated by GOX during the oxidation

of glycolate is scavenged by horseradish peroxidase and o-dianisidine. Formation of the O-

dianisidine radical cation, which reflects the catalytic activity of GO, can be measured

spectrophotometrically at 440 nm and 25°C.

95

Amino acid measurements

Samples were ground in liquid nitrogen and freeze-dried. Amino acid extraction was made on

50 mg fresh weight of the resulting dry powder using the following procedure: the powder was

suspended in 400 µL of a methanolic solution containing 100 µM DL-3-aminobutyric acid (i.e. β-

aminobutyric acid) solution in methanol, followed by 15 min of agitation at room temperature.

200 µL of chloroform was then added, followed by a 5-min agitation step. Finally, 400 µL of

water was added, and samples were then vortexed vigorously to induce phase separation and

centrifuged at 13,000g for 5 min. 200 µL aliquots of the upper phase, which contains amino

acids, was transferred to clean vials and dried under vacuum. Dry residues were resuspended in

50 µL of ultra-pure water and 10 µL was used for the derivatization using the AccQ-Tag Ultra

derivitization kit (Waters) according to Jubault et al. (2008). Derivatized amino acids were

analyzed using an Acquity UPLC system (Waters). Two microliters of the reaction mixture was

injected onto an Acquity UPLC BEH C18 1.7-mm 2.1- 3 100-mm column heated at 55°C. Amino

acids were eluted with a mixture of 20-fold diluted AccQ-Tag Ultra-eluent A (Waters) and pure

acetonitrile at a flow rate of 0.7 mL min-1 according to the following gradient: initial, 99.9% A;

0.54 min, 99.9% A; 6.50 min, 90.9% A; 8.50 min, 78.8% A; 8.90 min, 40.4% A; 9.50 min, 40.4% A;

9.60 min, 99.9% A; and 10.10 min, 99.9% A. Derivatized amino acids were detected at λex 260

nm and λem 473 nm using a fluorimeter detector. Amino acids were characterized by co-

chromatography of individual standards and quantified by comparison of individual external

calibration curves.

Author contribution

H. Seifi designed and performed experiments. A. Aziz was involved in amino acid

measurements. M. Höfte supervised the entire process of data generation and writing the

chapter.

96

97

Chapter

6

Abscisic acid deficiency causes changes in cuticle permeability and

pectin composition that influence tomato resistance to Botrytis

cinerea

Katrien Curvers, Hamed Seifi, Grégory Mouille², Riet de Rycke, Annelies Van Hecke, Dieter

Vanderschaegen, Herman Höfte, Nico Callewaert, Frank Van Breusegem and Monica Höfte

Published in Plant Physiology, 154 (2): 847-860

mutant of tomato (Solanum lycopersicum) with reduced abscisic acid (ABA) production

(sitiens) exhibits increased resistance to the necrotrophic fungus Botrytis cinerea. This

resistance is correlated with a rapid and strong hydrogen peroxide-driven cell wall fortification

response in epidermis cells that is absent in tomato with normal ABA production. Moreover,

basal expression of defense genes is higher in the mutant compared with the wild-type tomato.

Given the importance of this fast response in sitiens resistance, we investigated cell wall and

cuticle properties of the mutant at the chemical, histological, and ultrastructural levels. We

demonstrate that ABA deficiency in the mutant leads to increased cuticle permeability, which is

positively correlated with disease resistance. Furthermore, perturbation of ABA levels affects

pectin composition. sitiens plants have a relatively higher degree of pectin methylesterification

and release different oligosaccharides upon inoculation with B. cinerea. These results show that

endogenous plant ABA levels affect the composition of the tomato cuticle and cell wall and

demonstrate the importance of cuticle and cell wall chemistry in shaping the outcome of this

plant-fungus interaction.

A

98

Introduction

Plant defense against pathogens often involves the induction of mechanisms after pathogen

recognition, including defense signaling, cell wall strengthening, and localized cell death, but

plants also have preformed chemical and structural defense barriers. Fungal pathogens that

penetrate the plant tissue directly through the outer surface, rather than via natural plant

openings or wounds, must pass through the plant cuticle and epidermal cell wall. Penetration of

the host surface happens either by physical means (i.e. by a highly localized pressure in the

appressorium) or by chemical means (i.e. by the release of hydrolyzing enzymes). Necrotrophic

plant pathogens like Botrytis cinerea typically use the latter strategy. During penetration, they

produce cutinases and pectinolytic enzymes such as pectin methylesterases,

endopolygalacturonases, and exopolygalacturonases (van Kan, 2006).

The cuticle is a hydrophobic barrier that covers the aerial surfaces of the plant. It is mainly

composed of cutin, a polyester matrix, and soluble waxes, a complex mixture of hydrophobic

material containing very-long-chain fatty acids and their derivatives, embedded into and

deposited onto the cutin matrix. It plays an important role in organ development and

protection against water loss (Yephremov et al., 1999; Sieber et al., 2000; Kurata et al., 2003;

Jung et al., 2006). The cuticle is generally considered as a mere passive physical barrier against

pathogen invasion, but it has also been recognized as a potential source of signaling and elicitor

molecules (Jenks et al., 1994; Reina-Pinto and Yephremov, 2009). Plant cutin monomers trigger

cutinase secretion in pathogenic fungi (Woloshuk and Kolattukudy, 1986), and cutin and wax

components initiate appressorium formation and penetration in appressorium-forming

pathogens (Kolattukudy et al., 1995; Francis et al., 1996; Gilbert et al., 1996; Fauth et al., 1998;

Dickman et al., 2003). In plants, cutin monomers induce pathogenesis-related gene expression

and elicit hydrogen peroxide (H2O2) synthesis (Fauth et al., 1998; Kim et al., 2008; Park et al.,

2008). Transgenic tomato (Solanum lycopersicum) plants expressing the yeast Δ-9 desaturase

gene had high levels of cutin monomers that inhibited powdery mildew (Erysiphe polygoni)

spore germination, leading to enhanced resistance (Wang et al., 2000). Arabidopsis

(Arabidopsis thaliana) plants expressing a fungal cutinase or mutants with a defective cuticle,

99

such as long-chain acyl-CoA synthetase2 and bodyguard, are generally more susceptible to

bacteria and equally susceptible to biotrophic fungi but are surprisingly resistant to B. cinerea

(Bessire et al., 2007; Chassot et al., 2007; Tang et al., 2007). It has been postulated that a

defective or thin cuticle encourages these plants to constitutively express defense-related

mechanisms and to secrete antifungal compounds to the plant surface, thereby inhibiting B.

cinerea growth (Bessire et al., 2007; Chassot et al., 2007). In addition, cuticle metabolic

pathways might directly modulate plant-pathogen interactions by interacting with hormonally

regulated defense pathways (Fiebig et al., 2000; Garbay et al., 2007; Mang et al., 2009) or with

complex lipid signaling pathways leading to hypersensitive cell death (Raffaele et al., 2008).

Once plant pathogens have penetrated the cuticle, they secrete hydrolases that target the plant

cell wall (ten Have et al., 1998; Oeser et al., 2002; Vogel et al., 2002; Jakob et al., 2007) that is

mainly composed of cellulose, hemicellulose, and pectin (35% of total dry weight). Pectin

consists mainly of the polysaccharides homogalacturonan and rhamnogalacturonan I and II.

Homogalacturonans are linear chains of α-(1–4)-linked d-GalA residues that can be

methylesterified at C-6. Rhamnogalacturonan I and II are more complex, branched

polysaccharides. B. cinerea is typically regarded as a pectinolytic pathogen because it possesses

an efficient pectinolytic machinery, including a variety of polygalacturonases and pectin

methylesterases (PMEs), some of which are important virulence factors (ten Have et al., 1998,

2001; Valette-Collet et al., 2003; Kars et al., 2005). Pectins are a rich source of

oligogalacturonides (OGAs), biologically active signaling molecules that can activate plant

defense mechanisms (Hahn et al., 1981; Côté and Hahn, 1994; Messiaen and Van Cutsem, 1994;

Ridley et al., 2001). The eliciting capacity of the OGAs was shown to depend on their size, which

in turn is influenced by the methylesterification pattern of the homogalacturonan fraction

(Mathieu et al., 1991; Messiaen and Van Cutsem, 1994). To counteract the activity of fungal

pectinases, many plants express polygalacturonase-inhibiting proteins and PME inhibitors,

which are localized in the cell wall. The role of these proteins in plant defense against B. cinerea

has been extensively demonstrated (Powell et al., 2000; Ferrari et al., 2003; Sicilia et al., 2005;

Joubert et al., 2006, 2007; Lionetti et al., 2007). The interaction with the inhibitors not only

limits the destructive potential of polygalacturonases but also leads to the accumulation of

100

elicitor-active OGAs (De Lorenzo and Ferrari, 2002). How OGAs are perceived by the plant is still

unclear, but in view of the diversity of biological activities and structure requirements, they are

thought to be recognized through different proteins, including receptor-like kinases, wall-

associated kinases, arabinogalactan proteins, and Pro-rich proteins (Côté and Hahn, 1994;

Showalter, 2001; Humphrey et al., 2007).

Over the past years, the role of abscisic acid (ABA) in plant-pathogen interactions has gained

increased attention. ABA is mostly negatively correlated with resistance against

phytopathogens through down-regulation of defense responses orchestrated by salicylic acid,

jasmonic acid, and ethylene (Mohr and Cahill, 2001; Audenaert et al., 2002; Mauch-Mani and

Mauch, 2005; Asselbergh et al., 2008). In tomato, the ABA-deficient mutant sitiens has an

enhanced resistance to B. cinerea (Audenaert et al., 2002) that depends on a timely, localized

oxidative burst leading to rapid epidermal cell wall fortification and a faster and higher

induction of defense-related gene expression upon infection compared with the wild type

(Asselbergh et al., 2007). Moreover, basal defense gene expression is higher in this mutant than

in the wild type. As this early response is of vital importance for the resistant reaction of

tomato against B. cinerea, we investigated whether alterations in cuticle and/or cell wall, which

form the first barrier to the invading pathogen, affect resistance. We demonstrate that the

sitiens cuticle is more permeable and that permeability is positively correlated with resistance

to B. cinerea. Furthermore, differences in pectin composition and rate of methylesterification

occur. Together, these data hint at an unanticipated role for extracellular matrix components in

the resistance of tomato against B. cinerea and thus shed new light on the largely unexplored

interrelationship between the extracellular matrix and plant-pathogen interactions.

101

RESULTS

Different localization of pathogen growth in the wild type and sitiens

We previously showed that resistance in sitiens is based on H2O2 accumulation in the epidermal

cells starting at 4 h post inoculation (hpi) followed by cell wall fortification starting at 8 hpi,

restricting fungal colonization of the underlying tissue (Asselbergh et al., 2007). We here used

immunological detection of pectic cell wall components in transverse sections to visualize pectin

breakdown upon B. cinerea inoculation (Knox et al., 1990). Using the JIM7 antibody, which binds

to methylesterified pectin epitopes, we found that in the wild type, B. cinerea causes degradation

of the pectin matrix in all leaf cell layers at 32 hpi, while in sitiens, degradation is restricted to the

outer anticlinal and periclinal cell wall of epidermal cells (Fig. 6-1). The staining pattern of JIM5,

which recognizes low to non methylesterified epitopes, was similar to that of JIM7 (Supplemental

Fig. S1). Based on these immunological stainings, we could not distinguish quantitative

differences in pectin methylesterification between wild-type and sitiens tomato. However, these

data confirm the importance of epidermal anticlinal cell wall fortification in obstructing B. cinerea

growth and infection, as shown previously (Asselbergh et al., 2007). Moreover, they indicate that

in sitiens, defense reactions and cell wall degradation are restricted to the epidermal cell layer,

hinting at the epidermis as a source of defense signaling molecules. As the cuticle and cell wall are

among the first plant barriers to pathogen ingress, we further investigated whether the fast

defense response and resistance in sitiens are caused by changes in cuticle and/or cell wall

composition.

102

Figure 6-1. Pectin degradation during B. cinerea infection in sitiens and wild-type tomato. Degradation of pectin at 32 h after B. cinerea inoculation (A) or mock inoculation (B) was detected with monoclonal antibody JIM7 and secondary labeling with fluorescein isothiocyanate. Some sites with cell wall degradation are indicated with arrows. Bars = 50 μm. At least 10 samples from different plants were examined for the wild type and sitiens, and representative images are shown.

Ultrastructural differences in cell wall and cuticle of sitiens

Transverse sections of fifth leaves of the wild type and sitiens were examined by transmission

electron microscopy (Fig. 6-2). The cuticle was visible as a dark (electron-dense) layer on top of

the cell wall. Abnormalities in the sitiens cuticle were visible as thicker and irregular electron-

dense layers, which besides structural differences might indicate a different lipid content in the

cuticle of the mutant (Fig. 6-2, B and D). A distinction could also be made between the cell wall

architecture of the wild type and sitiens. In the wild type, the epidermal periclinal cell wall is

regular in shape, whereas that of sitiens was generally thicker and less dense. Furthermore,

irregular depositions of cell wall material were found in the mutant, giving rise to structural

distortions in the epidermal cell walls (Fig. 6-2E). Complementation of sitiens plants with

103

exogenous ABA restored the wild-type phenotype in the mutant, whereas the control treatment

did not (Fig. 6-2, C and D).

Figure 6-2. Transmission electron micrographs of wild-type and sitiens transverse leaf sections. Micrographs show leaf epidermal cell walls of the wild type (A), sitiens (B), sitiens + 100 μm ABA in 0.05% ethanol (C), and sitiens + 0.05% ethanol (D). The cuticle (cu) is visible as the dark (electron-dense) apposition on the cell wall (cw). E, Examples of cell wall abnormalities found in cell wall and cuticle of sitiens leaf. Similar observations were made in sections of three different wild-type and sitiens plants. The experiment was repeated with similar results.

ABA deficiency leads to a decrease in surface hydrophobicity and leaf trichome number

Cuticular permeability to watery solutions and hydrophilic compounds is known to be correlated

with wax amounts and composition (Hauke and Schreiber, 1998; Popp et al., 2005). Furthermore,

wax amounts and the relative composition of the hydrocarbon, alcohol, and aldehyde fractions of

104

the cuticular wax determine the hydrophobicity of the leaf surface (Bringe et al., 2006; Koch and

Ensikat, 2007). Therefore, hydrophobicity of wild-type and sitiens leaves was analyzed by the

contact angle method, in which contact angles of a droplet of distilled water with the surface are

measured (Kasahara et al., 1993). The contact angles for sitiens were smaller than those for the

wild-type leaves, indicating a more hydrophilic surface and thus a difference in wax amount or

composition (Fig. 6-3, A and B). Cuticle composition has been shown to also affect trichome

development in several Arabidopsis mutants (Yephremov et al., 1999; Wellesen et al., 2001).

Moreover, ABA deficiency in plants leads to pleiotropic effects and might thus affect trichome

density. As trichome density could influence droplet formation on the tomato leaf surface, we

counted the trichomes on wild-type and sitiens leaf discs of 4 mm diameter. Clearly, ABA

deficiency in the sitiens tomato mutant leads to a decrease in leaf trichome number (Fig. 6-3, C

and D).

Figure 6-3. Leaf surface hydrophobicity and trichome density. A, Images of droplets on wild-type and sitiens leaf surfaces illustrating the differences in surface tension. B,

Hydrophobicity determined by measuring the contact angle of a 10-μL droplet of distilled water on the leaf surface by the sessile drop method. Mean contact angles were averages of at least 10 measurements.

Fourth leaves of 5-week-old plants (seventh leaf stage) were used. Error bars indicate se. A Student’s t test indicated that differences between the wild type and sitiens were statistically significant, indicated by the star (P < 0.001). C, Number of trichomes per 10 mm2. Error bars indicate se. A Mann-Whitney test revealed a significant difference between the wild type and sitiens, indicated by the star (P < 0.001). D, Representative photographs of leaf sections illustrating differences in trichome density between the wild type (top) and sitiens (bottom).

105

ABA deficiency leads to increased surface permeability

As a measure for surface permeability, we monitored the chlorophyll efflux rates (Chen et al.,

2004). Total chlorophyll was extracted at room temperature with 80% ethanol and sampled at

different time points during a 4-h period from equal amounts of intact leaves of wild-type, sitiens,

and ABA-complemented sitiens plants. Clearly, the chlorophyll efflux was faster in sitiens (Fig. 6-

4A), and complementation with ABA restored permeability of the sitiens cuticle to the wild-type

level (Fig. 6-4B). However, since the sitiens mutant is known to have a higher stomatal density,

which might influence chlorophyll efflux rate (Nagel et al., 1994), we additionally monitored leaf

surface permeability to aqueous staining solutions to assess the permeability of the cuticle of

sitiens and wild-type plants. We used three histological stains that bind different cell wall

epitopes: the pectic carboxyl group-binding dyes ruthenium red and alcian blue and the

polychromatic cell wall dye toluidine blue. Based on dye accumulation in leaf discs floating on

staining solutions, increased permeability of the sitiens cuticle was demonstrated (Fig. 6-4C; data

shown for toluidine blue, with all dyes giving similar results). Dye accumulation was not linked

with stomatal distribution (Fig. 6-4C; data not shown). Complementation with ABA reduced the

permeability to toluidine blue of the sitiens cuticle back to that of the wild type (Fig. 6-4C).

Figure 6-4. Cuticle and cell wall permeability of sitiens and the wild type. A, Extraction of chlorophyll from equal amounts of wild-type and sitiens intact leaves for 0.5 to 4 h in 80% ethanol at room temperature. B, Total chlorophyll extracted from leaves of the wild type, sitiens, and sitiens complemented with ABA by spraying 100 μm ABA in 0.05% ethanol until runoff twice per week during their development at different time intervals with SD. C, Leaf discs excised from the fourth

106

leaf of 5-week-old wild-type and sitiens plants floating on their adaxial side on a 0.05% toluidine blue solution in water for 1 h. sitiens plants were complemented with ABA by spraying 100 μm ABA in 0.05% ethanol until runoff twice per week during development. As a control, a mock solution containing 0.05% ethanol was used. Biological replicates of the experiments produced similar results.

Cuticle permeability is directly linked with resistance against B. cinerea

Increased resistance to B. cinerea in Arabidopsis mutants with an aberrant cuticle has been

shown to be, at least in part, the consequence of the diffusion of antimicrobial compounds from

the epidermal cells to the leaf surface, thereby inhibiting the hyphal growth (Bessire et al., 2007;

Chassot et al., 2007). To determine whether a similar phenomenon is responsible for the resistant

phenotype in sitiens plants, we measured the germination rate of B. cinerea spores in quarter-

strength potato dextrose broth that had been incubated for 18 h on wild-type and sitiens leaf

surfaces so that any antifungal substances could have diffused into them. Quantification of the

spore germination for 5 h revealed no significant difference in the presence of the wild-type or

sitiens exudates (Supplemental Fig. S2A). Additionally, microscopic monitoring of hyphal growth

on the leaf surface revealed no differences between sitiens and the wild type (Supplemental Fig.

S2B). To test whether the cuticular permeability correlates directly with disease resistance against

B. cinerea, we tested all leaves of 5-week-old wild-type and sitiens plants for permeability and

disease susceptibility (Fig. 6-5). Disease and permeability indices were calculated for leaf discs of

the same leaf, and their correlation was statistically analyzed. The permeability of the leaves was

variable at different developmental stages, and a significant negative correlation was observed

between permeability and susceptibility in sitiens, as indicated by the Spearman’s rank

correlation coefficient (ρ = −0.770, P < 0.01), but not for the wild type (ρ = −0.330), due to the

very high susceptibility of all leaves (Fig. 6-5B).

107

Figure 6-5. Correlation between leaf surface permeability and resistance against B. cinerea. A, Schematic representation of a 5-week-old tomato plant (seventh leaf stage) with leaf numbers indicated. B, Permeability index and disease index calculated on four leaf discs of each leaf of 5-week-old (seventh leaf stage) wild-type and sitiens plants. Disease index was evaluated using four scoring categories (0, resistant; 1, slightly spreading lesion; 2, moderately spreading lesion; 3, severely spreading lesion), and permeability index was calculated based on the surface area stained with toluidine blue using four categories (0, 0%–25%; 1, 25%–50%; 2, 50%–75%; 3, 75%–100%). Data represent means ± se of three different plants with four discs per leaf and per plant (n = 12). A significant correlation was observed between permeability and resistance in sitiens, as indicated by the Spearman’s rank correlation coefficient (ρ = −0.770, P < 0.01), but not for the wild type (ρ = −0.330).

Increased methylesterification rate of sitiens homogalacturonan

As B. cinerea produces pectinolytic enzymes during infection, we tested whether the wild type

and sitiens are differentially sensitive to pectinase treatment. Pectinase or polygalacturonase

catalyzes the random hydrolysis of 1,4-α-d-galactosiduronic linkages in pectin and other

galacturonans. Methylesterified pectin is not degradable by polygalacturonases and requires the

action of PMEs. Wild-type leaf discs floating on pectinase solutions of different concentrations

were more susceptible to polygalacturonase degradation after 3 d than sitiens leaf discs,

suggesting a lower degree of methylesterification (Fig. 6-6). Treatment with cellulase at different

concentrations resulted in similar degradation patterns in the wild type and sitiens, indicating that

both genotypes were equally prone to degradation by cellulase (Supplemental Fig. S3). A more

detailed chemical analysis of cell wall sugars was performed on sitiens and wild-type total leaf

108

crude cell wall preparations. Figure 6-7 presents the monosaccharide composition of the sitiens

and wild-type cell walls. A Student’s t test was used to find differences between wild-type and

sitiens monosaccharide composition (P < 0.05). The neutral sugar levels, expressed as a

percentage of cell wall dry weight, did not differ significantly between mutant and control plants,

except for Fuc. Total Gal and GalA contents were significantly lower in sitiens than in the wild

type. Further analysis revealed that the decrease is mainly due to a reduction in Gal and

unmethylesterified GalA (Fig. 6-7). In conclusion, sitiens has a relatively higher degree of

methylesterification of homogalacturonic residues compared with the wild type.

Figure 6-6. Pectinase treatments of wild-type and sitiens leaf discs. A, Leaf discs excised from fifth leaves of wild-type and sitiens plants floating at room temperature on 1 mL of pectinase (Pectinex Ultra SPL; Sigma-Aldrich) solutions at different enzyme concentrations (units mL−1). Photographs were taken after 3 d. B, Quantification of the leaf disc surface area with the image-analysis software APS Assess 2.0. Two biological replicates gave similar results. WT, Wild type.

109

Figure 6-7. Cell wall composition of wild-type (WT) and sitiens plants. Monosaccharide composition of the cell walls of fifth leaves of 5-week-old wild-type and sitiens plants. Results are expressed as a percentage of cell wall dry weight. Bars indicate SE (n = 4; n = 2 for Gal [gal], GalA [galA], and methylesterified GalA [galAmet]).

Differences in oligosaccharides released from sitiens and wild-type epidermal cell walls

The OGAs released from the cell wall during pathogen infection are known to play a role in

disease signaling and pathogen-induced gene expression (Norman et al., 1999). OGAs with a

degree of polymerization between 9 and 15 are potent inducers of plant defense responses

(Mathieu et al., 1991; Bellincampi et al., 1993; Côté and Hahn 1994), although smaller pectin

fragments have some bioactivity (Boudart et al., 1995; Simpson et al., 1998; Moerschbacher et

al., 1999). As the degree of methylesterification in epidermal cell walls of sitiens apparently differs

from that in the wild type, we hypothesized that different OGAs might be released. We analyzed

the carbohydrates released from the wild-type and sitiens leaf surfaces into an infection droplet

at 0, 6, 12, and 48 hpi using capillary electrophoresis (Williams et al., 2003; Ström and Williams,

2004; Goubet et al., 2006). As a control, a B. cinerea inoculation solution was incubated for the

same periods. Derivatization of the carbohydrates with 8-amino-1,3,6-pyrenetrisulfonic acid, a

fluorescent label that readily reacts with the reducing end of oligosaccharides and

polysaccharides, allowed detection of the labeled oligosaccharides. Electropherograms of the

110

different samples are presented (Fig. 6-8). At 0 hpi, no differences can be observed between wild-

type, sitiens, and control samples. Peaks observed around scans 1,850, 2,000, 2,500, 2,630, 3,000,

and 3,250 are thus originating from the Glc-containing B. cinerea inoculation solution. At 6 hpi, no

differences can be observed between wild-type and control samples. However, in sitiens, new

peaks with strong fluorescence around scans 1,750 and 2,250 appear, indicating modifications in

the saccharide composition in the inoculation droplet at that moment. A similar pattern is

observed at 12 hpi. At 48 hpi in the wild type, electrophoretic mobilities drastically shift

compared with previous time points, and more peaks are distinguishable. This indicates that the

oligosaccharide composition in the wild-type droplet drastically differs from that of the previous

time points, which might correlate with total digestion of the plant cell wall upon infection by B.

cinerea. Around 48 hpi, B. cinerea infection causes visible symptoms on wild-type leaves that

generally appear as macerated lesions (Asselbergh et al., 2007). In sitiens, differences in the

electropherogram occur mainly in signal intensities. Infection symptoms in sitiens plants at this

time point are restricted to localized necrotizing cells beneath the infection droplet, but without

tissue maceration.

Figure 6-8. Electropherograms obtained from capillary electrophoresis of wild-type and sitiens oligosaccharides released into B. cinerea inoculation droplets. Oligosaccharides released into B. cinerea inoculation droplets on fifth leaves of 5-week-old plants were sampled at 0, 6, 12, and 48 hpi and labeled with 8-amino-1,3,6-pyrenetrisulfonic acid. Signal intensity as relative fluorescence units is given in the ordinate, and scan numbers are given in the abscissa. For each sample, three biological replicates were analyzed, of which one is represented here.

111

DISCUSSION

The ABA-deficient sitiens tomato mutant has previously been shown to be more resistant to the

necrotrophic fungus B. cinerea (Audenaert et al., 2002). A timely induction of defense reactions,

including H2O2 production and cell wall fortification in epidermal cells, was shown to be

important for the increased resistance in this mutant (Asselbergh et al., 2007). Additionally,

basal defense gene expression is higher in the sitiens mutant compared with the wild type

(Asselbergh et al., 2007). In this study, we show that ABA deficiency in tomato leads to

alterations in leaf surface structure and composition, which might shed some new light on the

resistance mechanism of this mutant to B. cinerea.

Using immunological staining of leaf sections with antibodies that bind to pectin epitopes, we

showed that pectin breakdown in wild-type tomato 32 h after B. cinerea inoculation occurs in

epidermal cells as well as in the mesophyll. In sitiens, pectin breakdown was restricted to the

outer periclinal and anticlinal cell walls at 32 hpi. This is in accordance with previous findings

that rapid induction of H2O2-fueled cell wall fortification prevents spreading of the fungus in the

mutant. Together, these data suggest that the outer surface layer plays a vital role in the

resistance mechanism against B. cinerea.

Ultrastructural analysis of leaf sections using transmission electron microscopy revealed

deformation of epidermal cell walls and irregular deposition of electron-opaque material, which

represents cutin, in the sitiens mutant. As the cuticle is a modification of the epidermal cell

wall, with the cutin matrix linked to the cell wall constituents, it is likely that changes in the

epidermal cell wall metabolism may affect the cuticle and vice versa. A difference in cuticle

composition was also suggested by the lower leaf surface hydrophobicity observed in sitiens as

measured by the contact angle method. Differences in contact angle, however, might have

been influenced by the lower trichome density in sitiens. Intriguingly, Arabidopsis fiddlehead-1

and lacerata mutants, which have altered cuticle composition, also have dramatically lowered

trichome numbers (Yephremov et al., 1999; Wellesen et al., 2001). Overexpression of SHN,

encoding an AP2/EREBP transcription factor involved in regulating the metabolism of lipid

112

and/or cell wall components, resulted in altered wax composition and a decrease in leaf

trichome number in Arabidopsis (Aharoni et al., 2004). Similarly, several eceriferum (cer)

mutants of barley (Hordeum vulgare) and Arabidopsis originally isolated as wax deficient exhibit

increases in stomata number (Zeiger and Stebbins, 1972; Gray et al., 2000). It has been

suggested that the cuticle composition affects epidermal cell differentiation (Bird and Gray,

2003). As indicated by our data on trichome numbers and the higher stomatal density in the

sitiens mutant (Nagel et al., 1994), a similar connection between cuticle composition and

epidermal cell differentiation might exist in tomato, although mere pleiotropic effects of ABA

deficiency cannot be ruled out at this point.

Structural and/or compositional differences in the sitiens cuticle were associated with higher

cuticular permeability, which was shown to be positively correlated with higher resistance to B.

cinerea. Similar observations have been made in Arabidopsis cuticle mutants (Bessire et al.,

2007; Chassot et al., 2007; Tang et al., 2007). Several scenarios have been proposed to explain

the increased resistance to B. cinerea. In some studies, resistance (partially) depended on

enhanced export of antifungal compounds to the leaf surface (Bessire et al., 2007; Chassot et

al., 2007). As germination of B. cinerea spores was not different in leaf exudates from sitiens or

wild-type plants and no differences in germination and penetration on wild-type or sitiens

surfaces have been observed (Asselbergh et al., 2007; this study), this mechanism probably

does not (significantly) contribute to the resistance observed in sitiens. Additionally, it rules out

an effect of leaf surface structure or composition in the early infection stages of B. cinerea.

Another scenario considers the increased permeability of the cuticle to elicitors from B. cinerea,

allowing a faster induction of defense mechanisms (Chassot et al., 2007). Furthermore, it has

been speculated that cutin monomers, which are released onto the surface of Arabidopsis

cuticle mutants, or the action of cutinase/hydrolase might be relevant for the resistance to B.

cinerea (Xiao et al., 2004; Chassot and Métraux, 2005; Chassot et al., 2007). Monomers

released from the cuticular layer are able to induce plant defense reactions (Schweizer et al.,

1996a, 1996b; Chassot and Métraux, 2005; Kim et al., 2008). In etiolated hypocotyls of

cucumber (Cucumis sativus), cutin monomers from hydrolysates of cucumber, apple (Malus

113

domesticus), and tomato elicited H2O2 production (Fauth et al., 1998), further supporting the

notion that plants have the potential to recognize breakdown products of the cuticle and

activate defense-related mechanisms.

We suggest that plant defense elicitors released by B. cinerea, or hydrolytic enzymes producing

cell wall-derived elicitors, may diffuse faster through the more permeable sitiens cuticle.

Alternatively, monomers released from a defective cuticle might induce signaling events leading

to the activation of plant defense mechanisms. In favor of this hypothesis, pathogenesis-related

gene expression is higher in sitiens plants under noninfected conditions than that of the wild

type (Asselbergh et al., 2007). Although no sensor for cuticle integrity was known until now, a

mechanism involving a sensor in the extracellular matrix has been described. The Arabidopsis

plasma membrane-bound receptor-like kinase THESEUS1 has been found to act as a cell wall-

integrity sensor that positively regulates the expression of genes related to defense, oxidative

stress, and cell wall metabolism (Hématy et al., 2007).

It is interesting that, in contrast to the link between cuticle permeability and B. cinerea

resistance in Arabidopsis and tomato leaves, in tomato fruits a less permeable cuticle leads to

B. cinerea resistance. Fruits of the tomato mutant delayed fruit deterioration have a denser

cutin matrix and higher wax and cutin contents than the wild-type cv Ailsa Craig and are highly

resistant to B. cinerea, unless the cuticle is damaged (Saladié et al., 2007). This indicates that

there is a different defense mechanism against B. cinerea operating in tomato leaves as

compared with fruits, which have a 10-fold thicker cuticle.

As ABA plays an important role in drought stress regulation and the cuticle protects plants

against drought, it is likely that ABA might regulate the biosynthesis of this waxy layer, although

strong evidence for direct involvement of basal endogenous ABA in the cuticle biosynthesis

process is scarce. Some genes involved in cuticle biosynthesis (AtMYB41, AtCER6, AtWBC11,

and LpLTP1-3) are induced by exogenously applied or stress-induced ABA, and the CER6 gene

involved in long-chain fatty acid biosynthesis contains a cis-ABA-responsive element in its

promoter (Treviño and O’Connell, 1998; Hooker et al., 2002; Luo et al., 2007; Cominelli et al.,

114

2008). More recently, it has been shown that water deficiency and ABA treatment induce an

increase in cuticular wax load in Arabidopsis, and water deficit increases total cutin monomer

amount and alters the proportional amounts of cutin monomers (Kosma et al., 2009). Our

results clearly indicate a role for ABA in the regulation of cuticle biosynthesis. Accordingly,

transcript levels of a lipid transfer protein are low in sitiens compared with the wild type

(Asselbergh et al., 2007). Besides their role in plant defense, lipid transfer proteins are involved

in the transport of lipids through the extracellular matrix to form cuticular wax (Cameron et al.,

2006).

We also observed an effect of ABA deficiency on the rate of homogalacturonan

methylesterification, which is controlled by PMEs (Wolf et al., 2009). Contradictory roles for

ABA in PME regulation have been reported (Micheli, 2001). PME activity is inhibited by ABA

during yellow cedar (Chamaecyparis nootkatensis) and Medicago truncatula seed germination

(Ren and Kermode, 2000; Gimeno-Gilles et al., 2009). In tomato seed germination, ABA

enhances PME activity (Downie et al., 1998). In drought-stressed Arabidopsis, PME genes are

down-regulated (Bray, 2004), but in ripening banana (Musa acuminata) fruit, ABA increases

PME activity (Lohani et al., 2004). Although immunological staining was not sensitive enough to

reveal putative differences in pectin methylesterification rate between the wild type and sitiens

(Fig. 6-1; Supplemental Fig. S1), pectinase treatment and gas chromatography-mass

spectrometry (GC-MS) data indicated a higher degree of methylesterification in the sitiens

mutant. Our data show a correlation between low endogenous ABA content and higher pectin

methylesterification in tomato leaves, indicating that ABA plays a role in the regulation of PMEs

that are expressed in the leaves.

One explanation for the high resistance of sitiens might be that the pectin layer is less

degradable by hydrolase activities that are secreted by B. cinerea, due to the higher degree of

methylesterification. However, sitiens is more resistant to several other (biotrophic) pathogens

that do not secrete pectinases for penetration and/or tissue colonization (Thaler and Bostock,

2004; Achuo et al., 2006). Moreover, B. cinerea secretes PMEs during leaf penetration, and it is

not clear whether PME activity is required for the virulence of the pathogen (Valette-Collet et

115

al., 2003; Kars et al., 2005). Rather, we hypothesize that in sitiens, the methylesterification

pattern and degree account for the release of more active elicitors. OGAs with a polymerization

degree between 9 and 15 are known to be most bioactive (Mathieu et al., 1991; Messiaen and

Van Cutsem, 1993). Additionally, methylesterification rate was shown to have an effect on

elicitation capacity of OGAs against B. cinerea in strawberry (Fragaria vesca; Osorio et al., 2008).

Our hypothesis is strengthened by the observation that different carbohydrates accumulated in

infection droplets incubated on sitiens leaves than on those of the wild type. Thus, our results

indicate that the higher degree of pectin methylesterification in sitiens might result in the

release of different and more bioactive OGAs upon pectin breakdown by B. cinerea. The

identity of the carbohydrates as well as their potential in vivo elicitor activity are the subjects of

further investigation.

A synergistic effect of the alterations in sitiens cuticle and pectin is conceivable. A model of this

hypothesis is presented (Fig. 6-9). Dimers of homogalacturonide chains bridged by Ca2+ ions

form an egg-box conformation that is necessary for OGAs to be biologically most active

(Decreux and Messiaen, 2005). This egg-box conformation induced a significant increase in the

binding of OGAs to the transmembrane receptor-like wall-associated kinase WAK1 (Cabrera et

al., 2008). Moreover, when fungi invade plant tissue, chitin oligosaccharides and de-N-

acetylated chitosan oligosaccharides are produced, which elicit defense responses in various

plants (Hahn, 1996). Chitosan oligomers were recently shown to stabilize the OGA egg boxes,

leading to enhanced elicitor capacity in vitro (Cabrera et al., 2010). Previous results showed that

in sitiens, a chitinase is highly expressed prior to infection (Asselbergh et al., 2007). A high

activity of this enzyme in the extracellular space could induce the release of chitin and chitosan

oligomers from B. cinerea and subsequently associate with OGAs released from the cell wall of

epidermal cells. As stabilization of the elicitor-active egg-box conformation is time dependent

(Cabrera et al., 2008), one could speculate that the higher permeability of the sitiens cuticle

permits faster elicitor maturation, resulting in faster induction of defense reactions. Our

observation of a clear correlation between leaf surface permeability and resistance is in favor of

this hypothesis.

116

Figure 6-9. Schematic representation of the putative oligosaccharide signaling in the wild type and sitiens. In sitiens, the perception by the plant of a defective cuticle might lead to the constitutive expression of chitinases and glucan endo-1,3-β-glucosidases (1), releasing elicitor-active molecules from the fungal cell wall (2). The higher degree of methylesterification in the sitiens cell wall delivers more active host elicitors. Both types of elicitors can have a synergistic effect or even interact with each other to form even more elicitor-active complexes (3). Together with the higher permeability of the sitiens cuticle, the signaling would be faster and more effective with defense gene expression and the resistant phenotype that typifies the mutant as a consequence. In the wild type, basal expression of chitinases and glucan endo-1,3-β-glucosidases is not high enough to release elicitors from the germinating B. cinerea, and expression is induced only upon infection. The cuticle is not permeable, which delays the diffusion of signaling molecules/complexes into the cytosol of epidermal cells. Because of the absence of early signaling reactions, defense is delayed, resulting in cell wall breakdown, cell death, and fungal spreading. co, Conidium; cu, cuticle; ep, epidermal cell layer; me, mesophyll cell layer; pe, point of penetration.

There has been a long-standing controversy over whether or not hydrolase activity enhances

fungal infection (Schäfer, 1993; Valette-Collet et al., 2003; Kars et al., 2005). Our results indicate

117

that the composition of the epidermal leaf surface itself has an influence on the end products

of hydrolase activity and may influence the role of these enzymes as a virulence factor.

In conclusion, we have shown that endogenous ABA levels play a decisive role in (the regulation

of) cuticle and cell wall biosynthesis in tomato leaves and consequently determine the structure

and composition of the outer surface layers. ABA deficiency resulted in a more permeable

cuticle and a higher degree of pectin methylesterifcation. We furthermore demonstrated that

the more permeable cuticle of the ABA-deficient sitiens mutant is directly correlated with

enhanced resistance to B. cinerea. We suggested that the higher degree of pectin

methylesterification in the mutant results in more bioactive OGAs. Together with the higher

permeability that allows faster diffusion of elicitors, this results in a faster induction of defense

responses in sitiens, which renders these plants more resistant to B. cinerea than the wild type.

A model was presented in which synergistic effects of the alterations in cell wall and cuticle

composition contribute to the resistant interaction of sitiens with B. cinerea. Further studies

will be needed to shed light on the exact role of the cuticle and pectin composition in the

resistance of tomato against B. cinerea and in plant-pathogen interactions in general.

118

MATERIALS AND METHODS

Plant material and exogenous ABA treatment

The tomato (Solanum lycopersicum) wild-type “Moneymaker” and its sitiens mutant (a kind gift of

Prof. M. Koornneef, Wageningen University) were grown in potting compost soil (Substrat 4;

Klasmann-Deilmann) in a growth chamber at 22°C with 75% relative humidity under a 16-h-

light/8-h-dark regime. For the GC-MS experiment, plants were grown in a greenhouse with

approximately 65% relative humidity. ABA complementation was as described by Achuo et al.

(2006). Plants were sprayed until runoff with 100 μm ABA in 0.05% ethanol every 5 d during their

development. Controls were fed with 0.05% ethanol.

Fungal material and infection method

Conidia of Botrytis cinerea strain R16 (Faretra and Pollastro, 1991) were obtained as described

(Audenaert et al., 2002). An inoculation suspension was prepared containing 5 × 105 spores mL−1

in 0.01 m KH2PO4 and 6.67 mm Glc. Conidia were pregerminated for 2 h in the inoculation

suspension at 22°C. Fifth leaves were used for B. cinerea inoculation with 10-μL droplets.

Incubation was at 22°C under dark conditions. Symptoms were evaluated after 3 to 4 d. For mock

inoculation, the inoculation suspension was prepared omitting the spores.

Tissue fixation and immunological staining

Transverse sections of tomato leaves embedded in LR White (LRW; Sigma-Aldrich, Fluka) resin

were used for immunological staining. Leaf segments (2 mm × 8 mm) were fixed in 4%

paraformaldehyde and 1% glutaric dialdehyde (Acros Organics) in 0.05 m PIPES (Sigma-Aldrich)

for 2.5 h after 30 min of vacuum infiltration. After dehydration in a graded series of ethanol, LRW

was gradually added to the samples: one-third LRW + two-thirds ethanol for 40 min; one-half

LRW + one-half ethanol for 40 min; and two-thirds LRW + one-third ethanol for 40 min. Next,

three successive incubations of 2 h in pure LRW were done. The samples were transferred to

electron microscopy-purpose beam microembedding capsules (Laborimpex) filled with LRW and

incubated for 24 h at 60°C for polymerization. Semithin sections (2 μm) were cut with a

motorized rotary microtome (Leica RM2265; Leica Microsystems). After blocking the sections

119

using 3.33% normal rabbit serum (Gentaur) in TBSB-T (Tris-buffered saline solution, pH 7.4, +

0.1% bovine serum albumin + 0.01% Tween 20), primary antibody incubation (JIM5 and JIM7

[PlantProbes], 20 times diluted in TBSB-T) was performed overnight at 4°C. An anti-rat IgG-

fluorescein isothiocyanate conjugate (Sigma-Aldrich) was used as a secondary antibody. Samples

were washed several times, mounted in Vectashield Hardset mounting medium (VWR), and

examined with an Olympus BX51 epifluorescence microscope with U-MWB2 filter cube (450- to

480-nm excitation filter, DM500 dichroic beam splitter, and BA515 long-pass filter).

Electron microscopy

For transmission electron microscopy, tomato leaf sections (2 × 2 μm) were excised from fourth

leaves of 5-week-old plants (seventh leaf stage), briefly immersed in dextran 15% to 20%, and

frozen immediately in a high-pressure freezer (EM Pact; Leica Microsystems). Over a period of 4

d, tissues were freeze substituted in dry acetone containing 1% OsO4 and 0.1% glutaraldehyde as

follows: −90°C for 26 h, 2°C h−1 temperature increase over 15 h, −60°C for 8 h, 2°C h−1

temperature increase over 15 h, −30°C for 8 h, with rinsing three times with acetone in an

Automatic Freeze Substitution System (Leica Microsystems). At the end, samples were slowly

warmed up to 4°C and infiltrated at 4°C stepwise in Spurr’s resin over 3 d. Ultrathin sections of

gold interference color were cut with an ultramicrotome (Ultracut E; Leica Microsystems) and

collected on formvar-coated copper slot grids. Sections were poststained in an LKB ultrastainer

(http://www.lkb.com.au/) for 40 min in uranyl acetate at 40°C and for 10 min in lead stain at 20°C

and then transferred to grids. Grids were viewed with a JEOL 1010 transmission electron

microscope operating at 80 kV.

Leaf surface hydrophobicity measurement

Contact angles of 10-μL droplets of distilled water on wild-type and sitiens fourth leaf surfaces

were measured according to the sessile drop contact angle method with the EasyDrop

tensiometer and Droplet Shape Analysis software (Krüss) using the L-Y circle-fitting method.

Measurements were done at room temperature. The values of the contact angles were averages

of at least 10 measurements. For each experiment, the fourth leaves of at least five different

plants were used. A two-sided Student’s t test was applied for statistical analysis. The experiment

120

was repeated with similar results.

Trichome density

Trichome density on the adaxial leaf side was measured by counting the trichomes on leaf discs

of 4 mm diameter. At least 10 replicates of the surface of the fourth leaf of three different wild-

type and sitiens plants were examined. Data were statistically analyzed using a Mann-Whitney

test.

Toluidine Blue, Alcian Blue, and Ruthenium Red staining for assessment of cuticular

permeability

Leaf discs from fourth leaves of 5-week-old plants (seventh leaf stage) floating on the adaxial

surface were placed in a 0.05% aqueous dye solution for 1 h (Sterling, 1970; Tanaka et al., 2004).

Chlorophyll efflux rate measurement

To measure the chlorophyll efflux rate, equally sized leaflets from fourth leaves from three 5-

week-old plants were used as described (Chen et al., 2004). Three replicates of mutant and wild-

type leaves were immersed in an 80% ethanol solution in 50-mL tubes with covers. Tubes were

agitated gently on a shaker platform. Aliquots of 1 mL were removed at 0, 0.5, 1, 1.5, 2, and 4 h

after initial immersion. The amount of chlorophyll extracted into the solution was quantified with

a UV-160A spectrophotometer and calculated from UV light absorption at 480, 645, and 663 nm.

In vitro effect of leaf diffusate on B. cinerea germination

Ten-microliter droplets of quarter-strength potato dextrose broth (Difco) were incubated for 18 h

on three wild-type and sitiens leaves. Potential leaf diffusates were collected directly into these

droplets and mixed with B. cinerea spores in water to a final concentration of 5 × 104 spores

mL−1. Spore germination was observed with the microscope for 5 h.

In vivo assessment of hyphal growth

For in vivo assessment of hyphal growth, leaf discs of fifth leaves were inoculated with B. cinerea

as described above and sampled at 2, 4, 6, 8, and 10 hpi by clearing and fixing in 100% ethanol.

121

Hyphae were visualized using 0.01% trypan blue in 10% acetic acid. Bright-field microscopy was

performed as described above, and hyphae length was measured using the software package

CELL-F (Olympus Soft Imaging Solutions).

Assessment of correlation between permeability and susceptibility

To study the correlation between permeability and susceptibility in wild-type and sitiens plants,

both traits were analyzed on the same leaf. Leaf discs were cut from every leaf (leaves 1–6) of the

seventh leaf stage of wild-type and sitiens plants. Per leaf, four discs were inoculated with B.

cinerea for disease evaluation as described above, and four leaf discs were used for toluidine blue

permeability assay. A disease index was calculated with four different scores (0, resistant; 1,

slightly spreading lesion; 2, moderately spreading lesion; 3, severely spreading lesion) using the

formula [(0 × a) + (1 × b) + (2 × c) + (3 × d)/(a + b + c + d)] × 100/3 where a, b, c, and d are the

number of discs examined with scores 0, 1, 2, and 3, respectively. For each experiment, leaves of

three different plants were used (n = 12). A permeability index was determined based on the

percentage of leaf disc area covered by toluidine blue after overnight staining (0, 0%–25%; 1,

25%–50%; 2, 50%–75%; 3, 75%–100%). The correlation between both traits was analyzed using

Spearman’s rank correlation test.

Pectinase treatment

Leaf discs were excised from fifth wild-type and sitiens leaves and floated at room temperature

for 3 d on 24-well plates on pectinase solutions (Pectinex Ultra SPL; Sigma, P2611) containing 0,

100, 1,000, and 2,000 units mL−1. Degradation was quantified by measuring leaf disc surface area

(percentage coverage) with the APS Assess 2.0 software. As a control, leaf discs were floated on

cellulase solutions (Sigma, C2730).

Chemical analysis of cell walls using GC-MS

Fifth leaves of four 5-week-old wild-type and sitiens plants were washed four times with 70%

ethanol at 70°C and subsequently lyophilized overnight, ground in a potter homogenizer, and

washed in acetone and methanol. The remaining homogenate was considered as representative

of the cell walls. Five milligrams of this cell wall preparation of each sample was used for further

122

analysis. The prepared cell wall was resuspended in 1.25 mL of 1 M imidazole and reduced with 3

× 0.25 mL per 100 mg mL−1 NaBD4 for 2 h according to Kim and Carpita (1992). Samples were

neutralized with 3 × 50 μL of acetic acid and dialyzed overnight. Upon lyophilization, samples

were dissolved in 0.25 mL of water. To distinguish Gal, GalA, and methylesterified GalA by GC-MS,

the sample was split in two and a second reduction was done overnight with NaBH4 (to obtain

the proportion of esterified over total uronic acids) or NaBD4 (to obtain the total uronic acids),

followed by neutralization with acetic acid. After dialysis and freeze drying, carboxyl-reduced wall

material was hydrolyzed with 2.5 M trifluoroacetic acid for 2 h at 100°C. Alditol acetate

derivatives were prepared as described (Albersheim et al., 1967). Derivatized samples were

redissolved in 20 μL of dichloromethane, and 1-μL aliquots were analyzed by GC-MS with a high-

polarity 25-m × 0.22-mm (i.d.) BPX70 column (SGE). Myoinositol was added to the samples as an

internal standard. Identification of the derivatives was based on published mass spectra and the

elution order in relation to standards. The degree of esterification of uronic acid groups was

calculated by the relative proportions of diagnostic fragments in the NaBH4- and NaBD4-reduced

samples (mass-to-charge ratios of 217 and 219 for hexosyl derivatives).

Oligosaccharide sampling

Ten-microliter B. cinerea inoculation droplets containing 5.25 × 104 conidia mL−1 in 15.7 mm

KH2PO4 and 25 mM Glc were inoculated on fifth leaves of 5-week-old wild-type and sitiens leaves

and incubated at 22°C for 0, 6, 12, and 48 h. As a control, B. cinerea inoculation suspension was

incubated under the same conditions. After inoculation, droplets were collected and centrifuged

for 2 h at 22,000 g to remove B. cinerea spores. One hundred microliters of the supernatant was

vacuum dried and used for further analysis.

Electrophoretic separation of labeled oligosaccharides

The samples were labeled overnight by incubation at 37°C in 1 μL of a 1:1 mixture of 20 mm 8-

amino-1,3,6-pyrenetrisulfonic acid in 1.2 m citric acid and 1 m NaCNBH3 in dimethyl sulfoxide.

Samples were injected in the capillaries of an ABI 3130 DNA sequencer (Applied Biosystems) and

analyzed with Genescan 3.1 software (Applied Biosystems) as described (Laroy et al., 2006).

123

Supplemental material

Supplemental Figure S1. Pectin degradation during B. cinerea infection in sitiens and wild-type tomato.

Supplemental Figure S2. Evaluation of spore germination and hyphal growth.

124

Supplemental Figure S3. Cellulase treatment of wild-type and sitiens leaf discs.

Author contribution (only for H. Seifi)

H. Seifi generated these data: Fig. 6-3 C, D; Fig. 6-5, Fig. S2 A, B; and was partially involved in

generating these data: Fig. 6-3 A, B.

125

126

127

Chapter

7

Addendum to Chapter 6 (Abscisic acid deficiency causes changes in cuticle permeability and

pectin composition that influence tomato resistance to Botrytis cinerea; Plant Physiology,

154: 847-860)

Further characterization of potential signaling components involved in

sitiens defense response to B. cinerea

Hamed Soren Seifi, Juan Carlos Cabrera, Katrien Curvers, Pierre Van Cutsem, Monica Höfte

A fast perception of microbial challenge plays a prominent role in the timely induction of plant

defense mechanisms against pathogens. We have previously shown that the abscisic acid

deficient sitiens mutant of tomato possesses a highly permeable cuticle which plays a key role

in the observed resistance against the necrotrophic pathogen Botrytis cinerea. It was

accordingly hypothesized that the more permeable cuticle may allow a faster and more

efficient penetration of potential signaling components generated during early stages of

infection, triggering downstream defenses in sitiens. It was also proposed that, due to the

higher level of methyl esterification in pectin content, a highly active signaling molecule

conformation with strong elicitation capacity, termed as egg-box molecule, might have a higher

chance to be formed in the sitiens mutant. As an addendum to the previous chapter, this

chapter has been dedicated to our follow-up analyses on the nature of potential signaling

molecules that are involved in the fast defense response of sitiens against B. cinerea.

128

Introduction

Plants have evolved several strategies to defend themselves against the pathogens they are

constantly surrounded with, including preformed and induced mechanisms. Preformed barriers

include the plant cuticle and cell wall, where the battle between plant and fungus starts. The

main constituents of the primary cell wall are a cellulose-xyloglucan network embedded in a

matrix of pectic polysaccharides. A cuticular layer, composed of cutin and wax components,

covers the cell wall. Pathogens that penetrate the cell wall to gain access to the nutrient

content of the plant protoplast, create microscopic wounds at the site of penetration, by

physical or enzymatic rupture, inevitably generating plant cell wall fragments which, next to

being a carbon source for the fungi, have potential elicitor capacity. The importance of the

extracellular matrix as a source for such signaling molecules generated during plant-pathogen

interactions has been well studied (reviewed by Hématy et al., 2009). On the plant side, break-

down products of the cell wall can potentially elicit hydrogen peroxide production and induce

pathogenesis related gene expression (Fauth et al., 1998; Kim et al., 2008; Park et al., 2008).

Pectic fragments known as oligogalacturonides (OGAs) are best characterized in this context.

The eliciting capacity of OGAs was shown to depend on their degree of polymerization (DP) and

methylesterification (Mathieu et al., 1991, Messiaen and Van Cutsem, 1994; Menard et al.,

2004). It has been demonstrated that one of the most biologically active forms of OGAs, is a

homogalacturonide dimer electrostatically bridged by calcium ions, forming an egg-box-like

conformation (Decreux and Messiaen, 2005). Formation of these egg-box molecules (EBMs)

can significantly increase the level of binding of OGAs to the plant cell wall associated OGA

receptor, WAK1 (Cabrera et al., 2008).

Previously, our laboratory reported that an early epidermal production of ROS (H2O2) followed

by cell wall fortifications, results in arresting the spreading of B. cinerea in the abscisic acid-

deficient sitiens mutant of tomato (Asselbergh et al. 2007). However it was recently revealed

that the previously reported, ROS-fueled ‘fast pathogen arrest’ reaction is not solely sufficient

to resist B. cinerea infection, but a timely over-activation of an anti cell-death mechanism,

referred to as the ‘maintenance’ phase, is also critical to fully suppress the necrotrophic

129

pathogen growth in the mutant (Chapter 3). All these ‘early’ defense reactions in sitiens clearly

hint at the quality of a fast and efficient perception of the microbial challenge in the mutant. To

study the characteristics of such quality, we first investigated the structure of the cuticle and

cell wall of the mutant, as they make up the interface of the sitiens-B. cinerea interaction. In

Chapter 6, we have demonstrated that reduced levels of ABA lead to a more permeable cuticle

in sitiens which is positively correlated with the observed resistance response against B.

cinerea. We therefore hypothesized that the more permeable cuticle allows faster permeation

of pathogen-derived elicitors or any break-down product of the host cell wall resulted by the

pathogen attempt of penetration, leading to a faster induction of defense responses in the

sitiens mutant. Since stabilization of the egg-box molecule is time-dependent (Cabrera et al.,

2008), and because of the higher permeability of cuticle, it was therefore hypothesized that the

EBM maturation process might occur faster in the mutant, resulting in faster induction of

defense reaction (Curvers et al., 2010; Chapter 6). We continued our study on early signaling

events of the sitiens-B. cinerea interaction, verifying our previous hypothesis on the EBM nature

of the signaling components involved in this responsive resistance response.

Results

Assessing the effect of pre-inoculation application of synthetic egg-box compound on

susceptibility of the sitiens mutant and wild-type tomato to Botrytis cinerea

We have previously emphasized the importance of a timely elicitation in the induction of an

efficient defense mechanism to suppress B. cinerea infection in the sitiens mutant (Chapter 3;

Chapter 6). To further ascertain the prominent role of an early elicitation in tomato-B. cinerea

interaction, synthetic EBM solution (kindly provided by Prof. Van Cutsem, Notre Dame de

Namur University) was applied on sitiens and wild-type leaves. EBM solution was first solely

tested for its biological activity on the leaf surface of both genotypes. Incubation of droplets

containing 50 ppm EBM for 24 h induced visually (macroscopically) detectable HR-like

symptoms on wild-type leaves (Fig. 7-1 A); whereas 10 and 1 ppm concentrations had no effect.

130

However, lower concentration of EBMs (10 ppm) was sufficient to induce a HR-like reaction in

sitiens leaves (Fig. 7-1 B), while 1 ppm did not show any effect. Interestingly, application of 50

ppm EBMs on sitiens resulted in an even stronger induction of HR in the mutant (Fig. 7-1 C),

which (in some leaves), was accompanied by a systemic HR-reaction in the whole surface of the

leaf (Fig. 7-1 D). Further DAB staining (Asselbergh et al., 2007; Chapter 3), followed by

microscopic analysis on the HR-like symptoms (on EBM- treated wild-type and sitiens leaf disks)

revealed that EBM application can trigger an epidermal ROS-fueled HR in both plants (Fig. 7-1).

Figure 7-1. A, B, C: Macroscopic and microscopic analyses of the effect of direct application of different concentrations of synthetic EBM solution on the induction of HR in sitiens and wild-type leaves. Scale bar = 50 µm. D: The systemic effect of direct application of 50 ppm EBMs on some sitiens leaves.

131

Next, we assessed the effect of EBMs on the defense response of the wild-type and sitiens

mutant against B. cinerea. Following the previously described 24-well plate method (Chapter 3),

leaf disks of the two genotypes were incubated on different concentrations of the EBM solution

(1, 10 and 50 ppm) overnight, while the buffer solution without EBMs was used as the control

treatment. An aggressive inoculation was first used on wild-type leaf disks, that gave no

significant difference between the elicitor-treated and control samples. We then hypothesized

that the aggressive level of infection might have masked the potential of the EBM elicitor to

induce some (possibly insubstantial) levels of resistance in the host. Therefore, a mild

inoculation suspension (prepared with lesser conidial, glucose and potassium phosphate

concentrations as described in ‘Material and Methods’) was then chosen to lower the pressure

of the infection, seeking the observation of any possible effect of EBM on the basal defense

capacity of the wild-type plant. Interestingly, under a mild pressure of B. cinerea infection,

application of EBM solution with the concentration of 1ppm could reduce susceptibility in the

wild-type leaf disks, while higher concentrations did not show a significant effect (Fig. 7-2).This

observation may further confirm our previously proposed hypothesis on the importance of an

early elicitation in the induction of resistance against B. cinerea (Chapter 6).

Figure 7-1. The effect of synthetic EBM solution on the defense response of the wild-type tomato to a mild infection of B. cinerea. Vertical bars indicate ±SE of three biological replicates. Different letters indicate statistically significant difference (Duncan’s test; α=0.05).

132

Furthermore, inoculation of EBM-treated sitiens leaf disks with an aggressive conidial

suspension gave no significant effect for lower concentration (1 and 10 ppm); while

unexpectedly, at higher levels (50 ppm) of EBM application, increased susceptibility was

observed in the mutant (Fig. 7-3).

Figure 7-3. The effect of synthetic EBM solution on the defense response of sitiens to a mild infection of B. cinerea. Vertical bars indicate ±SE of three biological replicates. Different letters indicate statistically significant difference (Duncan’s test; α=0.05).

Chromatographic analysis of the compounds existing in the inoculation droplets incubated on

sitiens and wild-type leaves.

Inoculation droplets containing B. cinerea conidial suspension were placed on the adaxial

surface of sitiens and wild-type leaves following the inoculation and incubation methods

described in Chapter 6. At different time points post-inoculation the droplets, presumably

containing some exuded signaling components, were gently collected from the leaf surface of

the two genotypes, flash frozen in liquid nitrogen, and finally kept at -80° C for further

analytical experiments. High Performance Anion Exchange Chromatography with Pulse

Amperometric Detection technique (HPAEC-PAD) was used to detect the nature of the

compounds in leaf exudates of the sitiens mutant and the wild-type plants in a time course

after inoculation. Using a PA100 column, specifically designed for detecting sugar-natured

molecules, we observed one clearly different peak in the mutant chromatogram at 4 hpi, rising

up in successive time points (8, 12, 16 and 24 hpi), while in wild-type the peak was much less

133

pronounced, particularly at early time points (Fig. 7-4). This observation confirms our previous

report on the presence of some sugar-natured signals, detected using the capillary

electrophoresis technique, during early stages of the sitiens-B. cinerea interaction (Chapter 6).

However, due to some technical limitations and complexities, further analysis of this sugar-

natured signal was not carried out.

Figure 7-4. Evolution of the peak, that appeared with a retention time of 11 min on the HPLC

chromatogram ( using PA100 column), during the time course of infection.

For further analysis of the possible elicitation-associated compounds present in the samples

derived from the two genotypes, a C-18 column (Alltima HP C18 5 µ 250 x 4.6) was then chosen.

This column separates different compounds based on their hydrophobicity and charge

properties. Having performed C-18 column separation, we detected two signals, showing clear

differences between sitiens and wild type plants at early time points, particularly with the

largest difference at 12 hpi (Fig. 7-5, red arrows). Next, next purified six different possible

134

fractions derived from C-18 separation flow, to further analyze any potential elicitation activity

of the detected signals, (Fig. 7-5).

Figure 7-5. C-18 column separation chromatogram of sitiens and wild type samples at 12 hpi. Six fractions were isolated for further analyses.

Biological activity of the six isolated fractions on sitiens leaf disks

After the purification of all the 6 fractions, we next sought whether the observed peaks might

induce any defense-related reaction in tomato leaves. The very little amount of the purified

fractions, as well as, higher levels of cuticle permeability of the sitiens leaf, ensuring a more

efficient diffusion of signaling compounds (Curvers et al., 2010), convinced us to test the few

available droplets only on the sitiens mutant. To test the biological activity of the isolated

fractions, we incubated droplets containing the purified fractions on the leaf surface of sitiens

for 24h at 22°C in dark condition. As an important marker of defense response induction in the

host tissue, accumulation of ROS (H2O2) was then visualized in the inoculated sitiens leaf disks.

Using DAB staining technique, we found out that among the six isolated fractions, the two

135

different signals, existing in the fraction No. 1 and 3 (F1 and F3) (Fig. 7-5 red arrows), could

induce H2O2 generation and HR-like symptoms in sitiens leaf disks (Fig. 7-6 A,B). However, it

seems that the location and the intensity of H2O2 accumulation are different between the two

fractions. While a moderate and sporadic induction of ROS generation in both epidermal and

mesophyllic layers could be seen in F1-inoculated samples, F3 inoculation induced a much more

pronounced ROS generation, particularly in the mesophyll cells (Fig 7-6 A,B).

Figure 7-6. Macroscopic and microscopic analysis of the effect of fraction No. 1 (F1) (A), and fraction No. 3 (F3) (B), on the induction of ROS generation and epidermal HR in the inoculation site (beneath the inoculation droplet) in sitiens leaf disks. Scale bar= 50 µm.

136

Detection of the building blocks of the ROS-inducing signal No. 3.

The strong induction of ROS generation by F3-inoculation, prompted us to focus on detection of

the molecular composition of this biologically-active fraction. To achieve this, we used MALDI-

TOF (Matrix-Assisted Laser Desorption/Ionisation-Time of Flight) mass spectrometry (MS)

technique. Our MALDI-TOF MS analytical experiments lead to the identification of the presence

of six different molecules existing in F3, namely: rhamnose, arabinose, glucose, galactose,

galacturonic acid and glucose amine. However, how exactly these molecules (building blocks)

might contribute to the final biochemical structure of the observed signal in F3 (signal 3),

remained uninvestigated.

Discussion

We have previously proposed a model explaining how the permeable cuticle in the sitiens

mutant of tomato may result in a faster induction of defense response against B. cinerea. It was

also hypothesized that, due to the higher level of methyl esterification in the structure of pectic

compounds in the mutant, different type of OGA fragments, with higher degree of

polymerization (DP), might be released during early stages of sitiens-B. cinerea interaction,

which in turn may increase the chance of an effective EBM conformation (Chapter 6).

Interestingly, direct application of synthetic elicitors (EBMs) could induce an HR-like reaction in

the epidermal cells of both sitiens and the wild-type plants. The HR reaction in sitiens could be

induced by a 5 time lower concentration of the elicitor (10 ppm in sitiens compared with the

effective 50 ppm in wild type), which can be explained by the higher cuticle permeability of the

mutant. Furthermore, pre-inoculation application of synthetic EBMs on the wild-type plant

could reduce susceptibility to a mild infection of B. cinerea. This observation again highlights

the importance of a timely elicitation of plant defenses in inducing resistance to B. cinerea, as

reported previously (Caillot et al., 2012). In contrast, higher levels of EBMs (50 ppm) induced

some levels of susceptibility in the mutant. It seems that a strong induction of ROS

accumulation before inoculation and cell death in the sitiens leaf tissue, might have alleviated

137

the resistance capacity of the mutant. This observation implies that only a delicately balanced

level of ROS generation might be effective in the induction of the downstream defense

response in the mutant, whereas over-induction of ROS and HR would be detrimental for

resistance against B. cinerea.

Our analytical experiments provide some evidence for the existence of some potential sugar-

natured elicitors during early stages of the sitiens-B. cinerea interaction. However, whether the

two biologically active, isolated fractions (F1 and F3) might contain compounds with an egg-box

conformation remained totally unclear. Interestingly, it has been shown that, during a plant-

fungal pathogen interaction, EBMs may even show higher elicitation activity when stabilized

with a chain of fungal pathogen-derived chitin oligomer, called chitosan (COS). Such

interspecies complex molecules, electrostatically formed between positively charged COSs and

negatively charged OGAs, can function as the ‘danger’ signal that alerts the host cell on both

cell wall degradation and pathogen attack, triggering a considerably stronger response than the

EBM molecules alone (Cabrera et al., 2010). Our results on the building blocks of the

biologically active F3 fraction might hint at the presence of such COS-OGA molecules in the

purified active elicitor in the F3 fraction. According to our MS analysis data, the isolated F3

fraction consists of four different sugar monomers: rhamnose, arabinose, galactose and

glucose; the plant-derived pectin-degradation product, galacturonic acid and glucose amine.

This hypothesis might gain more credit considering the previous microarray data showing that,

prior to B. cinerea infection, a chitinase gene is highly upregulated in the sitiens mutant

(Asselbergh et al., 2007). Additionally the presence of glucose amine (known as the monomer

of chitin molecule) in the extracted fraction from the infected plants, might further propose the

chitinase activity in the mutant. However, more evidence is needed to prove the presence of a

fungal-derived molecule in the feraction.

Some preliminary data on the activity of the pectin hydrolyzing enzyme polygalacturonase (PG)

during early stages of infection in sitiens and the wild-type plant, revealed a higher PG activity

in the resistant mutant (data not shown). The higher PG activity in sitiens, might be likely

associated with the permeable cuticle, allowing more efficient permeation of the enzyme into

138

the host-pathogen interaction substrate, the inoculation droplet. It has been accordingly shown

that wounding stress can induce PG activity in tomato leaves, generating endogenous OGA

elicitors that in turn may trigger systemic activation of defense responses against pathogens

(Bergey et al., 1999).

Thus, it could be collectively hypothesized that during early stages of the sitiens-B. cinerea

interaction, a higher activity of the chitinase enzyme in the sitiens extracellular space may

release chitin fragments (COSs) from B. cinerea mycelium. Subsequently, degraded COSs can

bond with OGAs which may abundantly be released form the cell wall of sitiens epidermal cells,

mediated by both the fungal and plant-derived PGs. Concomitant occurrence of these early

events in the sitiens mutant might increase the chance and the level of COS-OGA formation,

culminating in a timely and strong activation of downstream defense responses. However, the

data presented here still lack substantial evidence to fully support the abovementioned

hypothesis.

Material and Methods

Mild infection inoculation

The inoculation solution was made according to our previously described method (Chapter 6),

with these concentrations: 0.01 M glucose, 6.67 mM KH2PO4 and 6.25×104 conidia/ml. Infection

method and disease index evaluation were done as described previously (Chapter 6).

Separation and collect on reverse phase

Inoculated sitiens, inoculated wild-type, mock sitiens, mock wild-type and blank were separated

(30 times for each) on C18 (Alltima HP C18 5 µ 250 x 4.6). Reverse Phase High Performance

Liquid Chromatography was performed using a Dionex GP 50 Pump following this gradient:

139

Column : (Alltima HP C18 5 µ 250 x 4.6)

T° : 35°C

Flow rate : 1ml/min

Injection: 20 µl

Eluent A : H2O/Formic acid 0.1%

Eluent B : H2O/Acetonitrile (30/70) formic acid 0.1%

Detection was performed with Shimadzu UV-vis SPD-6AV at 205 nm. Samples of interest were

collected (30 times) between 13.2 and 13.8 min. Collected fractions were then evaporated to

dryness and the residues resuspended in 0.5 mL Milli Q grade water.

Carbohydrates identifications

The aliquots were hydrolysed in trifluoroacetic acid (0.5 mL, 2 M) at 120°C for 2 h. The

hydrolysates were then evaporated to dryness and the residues resuspended in 0.5 mL Milli Q

grade water. Subsequently a 400 µL aliquot of each sample was centrifuged (13,000 g, 15 min)

prior to injection into the HPAEC system. High Performance Anion Exchange Chromatography

with Pulsed Amperometric Detection (HPAEC–PAD) was performed using a Dionex ICS 3000 in

order to identify some neutral monosaccharides collected on C18 separation. Chromatic

separation of the monosaccharides was performed on a CarboPac PA-20 column (Dionex, 3 µ

150 mm) connected to a guard column (3 µ 30 mm). Five mM NaOH at a flow rate of 0.5

mL/min was employed under constant helium pressure as the mobile phase. A post-column

derivatisation was performed by the addition of 0.75 M NaOH. The sample injection volume

was 20 µL and column oven temperature 35°C. The column was reconditioned with 200 mM

NaOH for 10 min then re-equilibrated with the starting buffer. Pure sugars from Sigma Aldrich

were used as standards and also treated to an identical hydrolysis procedure.

Mass Spectroscopy detection

Aliquots were injected in direct infusion on MS with a KD scientific syringe at 20 µl/min. The

mass spectrometer was operated in positive ionization modes and acquired data in the mass

140

range from m/z 50 to 1000 with a spectra rate of 1 Hz. The accurate mass data of the molecular

ions were processed through the software DataAnalysis 4.0 (Bruker Daltonik), which provided a

list of possible elemental formulas by using the SmartFormula Editor tool. Internal calibration

was performed using lithium formate cluster.

Acknowledgements

The first author thanks Pierre Cambier for technical assistance and valuable contribution to

analytical experiments.

Author contribution

H. Seifi designed and performed experiments. J. C. Cabrera performed analytical analyses under

the supervision of P. Van Cutsem. Prof. Van Cutsem provided synthetic EBMs. K. Curvers

contributed to the collection and preparation of samples for HPLC analyses. M. Höfte

supervised the entire process of data generation and writing the chapter.

141

142

143

Chapter

8

General conclusions and perspectives

In the first part of this final chapter, I integrated several pieces of conclusions derived from

previous parts (chapters 2-7), seeking some overall lessons from our research on the sitiens-B.

cinerea model pathosystem, while providing final answers to the essential questions posed in

the opening passage of the thesis (Chapter 1). This work may also open up new fertile

directions for future research, which are proposed in the second part of this chapter.

144

General conclusions

Glutamate metabolism is a rich source of plant enzymatic resistance (eR) genes

The plant resistance response to pathogens could be schematically divided into three

successive phases that are: (1) perception of the pathogen existence, (2) transduction of

invasion-associated signals towards the nucleus of the invaded cell and finally (3) expression of

defense-associated genes. The expression of the latter group of genes leads to the generation

of an array of defense-associated products, such as anti-microbial and cell-wall strengthening

compounds. Recently, the new concept of plant “enzymatic resistance” (eR) genes has emerged

that also suggests defensive roles for some metabolic pathways involving host central C/N

metabolism (Taler et al., 2004). The term “eR genes” was coined after studies showing that

resistance to the downy mildew pathogen Pseudoperonospora cubensis in melon is

predominantly controlled by the expression of two photorespiratory amino transferases

(Kenigsbuch and Cohen 1992; Taler et al., 2004). The latter authors have shown that the higher

activity of the two aminotransferases, and the resulted consumption of the substrate of the

enzymes, glyoxylate, leads to a ROS-dependent resistance response against the biotrophic

pathogen P. cubensis (see Chapter 2, section “cell death/viability).

The present work suggests that plant glutamate metabolism (GM) could be considered as a rich

source for some effective eR genes against both biotrophic and necrotrophic pathogens

(Chapter 2). Our empirical research based on previous microarray data (Asselbergh et al., 2007;

Chapter 1) has revealed a prominent role for the host central amino acid metabolism in the

defense response of sitiens against B. cinerea. In this context, we have introduced some novel

GM-dependent eR genes, like GABATA1 and GS1 that critically control resistance against the

necrotrophic pathogen, B. cinerea (Chapter 3). Our proposed ‘endurance’ model provides

further mechanistic insights into the indispensable role of plant eR genes in molding an

effective resistance against pathogens with true necrotrophic lifestyle (Chapter 2). According to

this model, over-activation of metabolic pathways that can maintain critical basic metabolism in

the invaded tissue may function as an anti cell-death/senescence defense strategy, resulting in

increased resistance against necrotrophic pathogens. We have also presented evidence that

145

ammonium nitrate supplementation reduces susceptibility to B. cinerea in the wild-type tomato

(Chapter 5), presumably through an eR-mediated defense mechanism. According to our

preliminary results, both photorespiration and the GABA shunt might be considered as

influential eR pathways that control ammonium nitrate-induced resistance against B. cinerea in

tomato.

Priming is a pivotal element of sitiens resistance response to B. cinerea

An important phenomenon in sitiens defense response to B. cinerea that is worth extra

attention, is the timeliness and the strength of all transcriptional, enzymatic and metabolic

alterations that occur in the mutant (Asselbergh et al., 2007; Chapter 3). It seems that

responsive activation of defense mechanisms in the mutant plays a vital role in the observed

resistance response against B. cinerea. Interestingly, for many (but not all) of defense reactions

rapidly induced in the resistant sitien, there are identical defense reactions in the susceptible

wild-type plant, yet induced much later with lesser magnitude. For instance, accumulation of

ROS, generation of GABA and induction of the PAL enzyme are all apparent in the wild type-B.

cinerea interaction as well; however, the timing and the induction level of these defense

reactions are not comparable with the sitiens plant. This may hint at the existence of ‘priming’

for pathogen defense in the sitiens mutant. It could be hypothesized that the constant presence

of the biotic drought stress in sitiens, caused by ABA deficiency, has culminated in a primed

state in the mutant resulting in a faster and stronger defense reaction to B. cinerea.

As it has been shown in this work, ABA deficiency in sitiens results in alterations in cuticle

permeability that correlates with resistance to B. cinerea (Chapter 6). It has been also proposed

that a permeable cuticle can facilitate faster perception of putative pectin/chitosan-natured

elicitors released from the freshly germinated spores, resulting in a rapid, ‘pre-penetration’

induction of defense-associated genes (Chapter 6). Therefore, it could be hypothesized that the

enhanced defense reaction in sitiens might be also associated with the capability of the mutant

for a very fast perception of the pathogen ‘presence’ on the surface of its leaf, even hours

before any physical damage caused by the penetrating pathogen germ tube. We could also

146

isolate two biologically active fractions with the potential of cell-death induction from the

sitiens-B. cinerea substrate of interaction (the inoculation droplet), which might be involved in

the proposed pre-penetration primed reaction in the mutant.

An effective resistance response against broad-host range necrotrophs relies upon a

multifaceted type of defense mechanism

An important overall lesson that can be derived from our study on the model sitiens-B. cinerea

pathosystem is that an efficient resistance against a broad-host necrotroph seems to be made

up of several layers of defenses, each playing a critical role in shaping the ultimate resistance

response. Thus, quite different form simply-inherited resistance mechanisms against biotrophic

and host-specific necrotrophic pathogens (Chapter 1), such a complex and multi-layered

defense mechanism involves separate features that all work synergistically together to

eventually suppress an archetypal necrotrophic pathogen like B. cinerea.

In conclusion, the multifaceted resistance mechanism in sitiens against B. cinerea can be

summarized as following:

A fast perception of the pathogen invasion that elicit a rapid activation of defense

signaling in the host (Chapter 6).

An early epidermal HR-mediated cell wall fortification that arrests the pathogen within

the penetration site, referred to as the ‘fast pathogen arrest’ phase (Asselbergh et al.,

2007; Chapter 3).

Over-activation of genes involved in secondary metabolism, like the PAL enzyme,

culminating in the accumulation of phenolic compounds in the invaded tissue

(Audenaert et al., 2002; Chapter 3).

And finally, over-activation of several endurance-associated metabolic pathways

(Chapter 2), such as the cytosolic glutamine synthetase and the GABA-shunt, that

results in an anti cell-death/senescence defense reaction in the cells surrounding the

penetration site, referred to as the ‘maintenance phase’ (Chapter 3). Moreover, our

147

results propose a metabolic link between the initial HR-mediated PAL-dependent

pathogen containment (fast pathogen arrest’ phase), and the secondary endurance-

natured defense response (‘maintenance’ phase) through reassimilation of the

byproduct of PAL activity by the GS1 enzyme.

Perspectives and unanswered questions

The findings presented in this manuscript may have provided new insights into understanding

the complexity of plant defense mechanisms against a broad-host range necrotrophic

pathogen. However, as the old quote says: “more knowledge brings more questions”, our study

may have also raised interesting issues for future research:

We have demonstrated that over-activation of pathways involving central C/N

metabolism, referred to as the ‘endurance’ metabolic state, plays a vital role in sitiens

resistance response to B. cinerea. This finding may also explain the observed reduced

susceptibility to the pathogen in ammonium nitrate-supplemented wild-type plants.

Both the photorespiration pathway and the GABA-shunt seem to be promising

candidates for future investigation in this context. To fish out the exact role of

photorespiration in AN-induced resistance in tomato against B. cinerea, conducting

infection trials on AN-treated plants in non-photorespiratory conditions (CO2>2%) could

be considered as a useful method.

The recent work of Mur’s lab, suggesting a prominent role for NO in the induction of a

HR-mediated defense in potassium nitrate-treated tobacco plants (and not in

ammonium-treated plants) against Pseudomonas syringae (Gupta et al, 2013), is

particularly interesting. In light of these recent findings, the role of different N sources,

like non-ammonium nitrates, as well as, the mechanistic role of NO in tomato defense

response against B. cinerea could also be worth further investigation. In this case,

visualization of the spatiotemporal pattern of NO accumulation, using the cell-

permeable fluorescent dye 4,5-diaminofluoresceins (DAF-2 DA) (Zeier et al., 2004), in

148

sitiens and the wild-type plant in response to B. cinerea infection might be a possible

approach.

To further analyze the proposed mechanistic concepts of this thesis on the roles of

central C/N metabolism in plant defense mechanisms against necrotrophic pathogens,

monitoring the fluctuations of actual N-flux of the GS/GOGAT and TCA cycles in the host

tissue during the course of B. cinerea infection, seems to be a necessity for future

research.

It has been shown that ABA deficiency in the hp3 (high-pigment 3) mutant of tomato

culminates in enlargement of the plastid compartment size, resulting in enhanced

biosynthesis of carotenoids and chlorophyll (Galpaz et al., 2008). Interestingly, it has

been also shown that application of OGA-natured elicitors on Arabidopsis leaves induces

resistance against B. cinerea, which is mainly mediated by the induction of higher levels

of accumulation of the secondary metabolite phytoalexin, camalexin (Ferrari et al.,

2007). In the light of these findings, and regarding our observation on the strong

induction of PAL activity in sitiens in response to B. cinerea, a greater capacity of

biosynthesis and accumulation of different anti-microbial secondary metabolites in the

sitiens mutant could be also hypothesized. Therefore, attenuation of resistance in the

sitiens mutant by functional disruption of critical pathways of central C/N metabolism,

might be also explained by the resulted downregulation of highly energy-demanding

defense-associated secondary metabolism in the mutant. However, whether there

might be a causal metabolic link between the GS/GOGAT and the GABA-shunt

functionality and production of potent antimicrobial secondary metabolites in the

sitiens resistance response remains unexplored.

We have reported a rare phenomenon of green bionissia formation as an anti-

senescence defense strategy against a necrotrophic pathogen (Chapter 3). However, in

the typical form of green bionissia, induced by some biotrophic pathogens as a

nutritional virulence strategy, accumulation of cytokinins, mainly secreted by the

pathogen, plays a key role in delaying senescence (Walters et al., 2008). Since most

necrotrophs, including B. cinerea, do not produce cytokinins (Walters and McRoberts,

149

2006), the observed delayed senescence in the green bionissia phenomenon in sitiens

could be possibly attributed to the host-derived cytokinins. Therefore the presumable

antagonistic interaction between cytokinins and ABA in the induction of the observed

anti-cell death mechanism in the sitiens mutant, remains completely unexplored.

Measuring the levels of cytokinins during different stages of the sitiens-B. cinerea

interaction might be a preliminary step in this case. Furthermore, how exogenous

application of cytokinins may modulate the wild-type tomato defense response against

B. cinerea is also of particular important for better understanding of hormonal

regulations that govern necrotrophic plant-pathogen interactions.

It should be underlined that ABA deficiency plays the key role in all the studied

processes and mechanisms involved in sitiens resistance to B. cinerea. The outcome of

the mutation in the aldehyde oxidase (AO) gene, catalyzing the last step of ABA

biosynthesis (Chapter 1), seems to result in pleiotropic effects in tomato, affecting

different aspects of the plant physiology and morphology. The resulted ABA-deficient

sitiens mutant possesses certain physiological/morphological characteristics with

prominent roles in conferring resistance against B. cinerea. For instance, a physiological

effect of ABA deficiency in sitiens might be lower induction levels of the ABA-responsive,

senescence-associated gene (SAG), asparagine synthetase (AS) during the course of B.

cinerea infection (Chapter 4). This newly-gained metabolic characteristic might give a

higher capacity to the central C/N metabolism of the invaded cells to provide more

substrate for the anaplerotic routes, such as the GABA-shunt, rather than undergoing

the infection-induced drainage of the GS/GOGAT cycle (see Chapter 2, figure 2-1).

Consequently, the resulted availability of higher levels of glutamate for the GABA-shunt

may partially contribute to shaping an ‘endurance’-type of reaction in the invaded

tissue. However, in addition to “substrate availability”, there might be other

mechanisms regulating the observed defensive processes in the ABA-deficient mutant,

such as transcriptional regulations or post-translational modifications of the enzymes,

which warrant further investigation.

150

We could isolate two biologically active compounds with possible elicitation-associated

roles during early stages of the sitiens-B. cinerea interaction. Our analytical data on the

building blocks of the active fraction (fraction 3; Chapter 6), may hint at the presence of

some sort of interspecies signaling compounds, formed as pectic dimers that are

stabilized with chitosan fragments and calcium ions (termed as COS-OGAs, Chapter 6).

However, the exact nature of the purified active elicitor (F3), remains an open question.

Foliar application of the synthetic COS-containing egg box molecules (EBMs) (developed

by the lab of Prof. Van Cutsem, Notre Dame de Namur University, Namur, Belgium) on

the wild-type tomato, and comparing its effect to COS-free EBMs (Chapter 7) against B.

cinerea infection, seems to be an essential experiment for future investigation in this

context.

It has been previously shown that ABA deficiency in the sitiens mutant of tomato

culminated in elevated resistance to other pathogens as well, namely the

hemibiotrophic Pseudomonas syringae pv. tomato (Thaler and Bostock, 2004), the

biotrophic Oidium neolycopersici (Achuno et al., 2006), and the necrotrophic, Erwinia

chrysanthemi (Asselbergh et al., 2008). This broad spectrum disease resistance against

different pathogenic lifestyles may again hint at the existence of a multilayered defese

capacity in the mutant, which has synergistic components to effectively suppress

contrasting pathogenic virulence strategies. It could be hypothesized that the rapid HR-

mediated, epidermal defense response in the mutant (referred to as ‘fast pathogen

arrest’ phase, Chapter 3), might function as an effective defense reaction towards

(hemi)biotrophic pathogens; while, the mesophyllic, anti-senescence defense

mechanism might result in resistance against necrotrophs. For instance, Asselbergh et

al. (2008) have reported that sitiens leaves exhibit levels of resistance against the

necrotrophic bacterial pathogen E. chrysanthemi, mediated by a ROS-dependent, cell-

wall-strengthening response that restrict the pathogen spread within the infiltration

site. They observed a clear border between the mesophyllic area of ROS accumulation

and a zone of normal, ROS-free cells, encircling the infiltration site (Fig. 8-1); while such

phenomenon could not be seen in the susceptible wild-type plant. However, how

151

mechanistically the extent of this defensive ROS accumulation in the mutant might have

been tightly restricted during a necrotrophic interaction, was not explained. In light of

our results, we may see a similar reaction in sitiens towards B. cinerea infection (Fig. 8-

1), comprising of an over-activated ‘maintenance’-natured defense mechanism in the

region in the vicinity of the pathogen penetration site (Chapter 3). However, fishing out

mechanistic similarities between our model pathosystem and those abovementioned

ones remain empirically unexplored.

Figure 8-1. The symptomatic resemblance between the defense response of the sitiens mutant to B. cinerea (right), and E. chrysanthemi (left). The image of E. chrysanthemi has been adopted from Asselbergh et al. (2008).

It is commonly known that growth conditions with low light regime are generally

favorable for B. cinerea infection. This positive correlation may be explained by the

negative effect of dark incubation on photosynthesis and the resulted induced-

senescence in the plant leaf. Having stated this, the standardized experimental

conditions used in this work, imposing continuous dark incubation on all detached leaf

samples, may have been largely in favor of the necrotrophic pathogen. However, some

preliminary experiments on detached leaves under 16/8 hours light/dark regime have

shown no obvious qualitative change in the defense response of sitiens and wild-type

152

plants to the pathogen. Nevertheless, how natural light/dark circadian rhythm may

affect the quantitative aspects of the previously studied defense response to B. cinerea

(such as alterations in the genes controlling central amino acid metabolism), warrants

further investigation.

It is known that some strains of B. cinerea (such as B05.10 and SAS56) produce and

secrete ABA with possible roles in pathogenicity (Siewers et al., 2006). Regarding our

findings, ABA production by B. cinerea could be considered as a virulence mechanism via

which the necrotrophic pathogen manipulates its host central metabolism to induce

senescence. An example of such senescence-triggering metabolic manipulation by the

pathogen could be seen in the strong induction of the ABA-responsive, senescence-

associated gene, asparagine synthetase in the wild-type plant. Therefore, it would be

very interesting to know, firstly, whether the R16 strain used in this study, resulting

from the cross SAS56 × SAS405 (Faretra and Pollastro, 1991), is able to produce ABA

both in axenic cultures and in planta; and secondly, whether in planta secretion of ABA

(if any) plays a role in the senescence-inducing virulence mechanism of the R16 strain in

our model pathosystem.

B. cinerea belongs to a group of plant pathogens which actively acidify the host tissue

during their infection (Miyara et al., 2012). This pH-dependent virulence strategy is

mainly induced by secretion of oxalic acid by the pathogen, which ultimately results in

the induction of cell death and also extension of macerated lesions in the host tissue

(Dickmen and Mitra, 1992; Rollins, 2003; van Kan 2006). In this context, measuring the

alteration of pH during different stages of B. cinerea infection on sitiens and wild-type

leaves could be very informative for understanding the essential role of B. cinerea-

induced pH modulation in both resistant and susceptible responses.

Studying the multifaceted resistance response of sitiens against B. cinerea infection can

be very informative and useful to understand the complex orchestration of signaling,

transcriptional, proteomic and metabolic events ruling necrotrophic host-pathogen

interactions. Nevertheless, careful consideration towards all the similar events in the

pathogen side is a vital necessity as well. However, in the present work the pathogenic

153

behavior of B. cinerea during this incompatible interaction remained totally unstudied,

leaving many important unanswered questions. Questions like, what happens to B.

cinerea’s virulence components, such as phytotoxins and oxalic acid? Why B. cinerea

seems to be pathogenically ‘paused’ up to three weeks post-inoculation (Chapter 3)?

And probably more importantly, what are the most determining metabolic modulations

in the pathogen side that may have formed such a biotrophic-like behavior in a well-

established necrotrophic pathogen?

154

155

Summary

As the inevitable result of a ping-pong-type co-evolution, plants have devised sophisticated

defense mechanisms to cope with the constant threat of pathogenic microorganisms. These

mechanisms are diverse, varying from constructing physical barriers in order to mechanically

halt pathogen penetration, to de novo synthesis of various anti-microbial compounds in order

to chemically suppress pathogen growth in the host tissue. On the other hand, pathogens have

also developed different virulence mechanisms to surpass plant defenses, which have

ultimately culminated in shaping distinct invasion strategies, often categorized into three main

groups of lifestyles, i.e. biotrophy, necrotrophy and hemibiotrophy. Biotrophic pathogens need

living host tissue to establish their life cycle, whereas necrotrophs kill host cells first, and then

feed on the dead tissue. The third group, hemibiotrophs, exhibit an early biotrophic phase

followed by a necrotrophic lifestyle in later stages of infection. Moreover, necrotrophic

pathogens have been further categorized into two major groups based on their host

specificity/range, as host-specific necrotrophs, and broad-host range necrotrophs.

Studying a model incompatible pathosystem in the present work, we have explored host

resistance mechanisms which can efficiently suppress an archetypal broad-host range

necrotrophic pathogen, the ascomycete Botrytis cinerea. B. cinerea (teleomorph: Botryotinia

fuckeliana) is the causal agent of the gray mold disease (or Botrytis blight), attacking over 200

species worldwide. Our lab has previously shown that deficiency of the phytohormone abscisic

acid (ABA) in the sitiens mutant of tomato (Solanum lycopersicum Mill. cv Moneymaker) results

in increased resistance to the necrotrophic fungus B. cinerea through rapid hydrogen peroxide

production in the epidermis, followed by epidermal hypersensitive response cell death and cell

wall fortifications which ultimately suppress the pathogen progress. Moreover, microarray

analysis revealed that in addition to groups of genes coding for pathogenesis related proteins

and enzymes related to cell-wall structure being upregulated, expression of a cluster of genes

involved in central carbon/nitrogen (C/N) metabolism also significantly increased in the

resistant mutant.

156

In the present work, we have initially provided a review on the reconfiguration of plant central

C/N metabolism in response to different pathogenic lifestyles, and the potential roles it may

play in plant defense responses. The main focus in the review has been directed at the plant

glutamate metabolism (GM). Being at the interface between central carbon and nitrogen

metabolism, the plant GM orchestrates critical defense-associated events related to nitrogen

transportation, cellular redox regulation, and TCA cycle-dependent energy reprogramming.

These modulations seem to eventually result in either ‘endurance’, i.e. maintaining the

functionality of critical pathways involved in basic metabolism of the challenged cell; or

‘evasion’, i.e. disruption of cellular basic metabolism, facilitating the death process in the

challenged cell. The success and failure of these ‘endurance’ or ‘evasion’-natured defenses

appear to be highly dependent on the invasion style of the pathogen, i.e. biotrophy,

hemibiotrophy and necrotrophy. In other words, alterations in the host glutamate metabolism

in response to different pathogenic scenarios may function in two opposing ways, either

backing the ongoing defense strategy, or being exploited by the pathogen to facilitate infection.

In addition, we have shown that the efficiency of the previously observed HR-mediated defense

response against the B.cinerea in the sitiens mutant of tomato is vitally dependent on

restructuring of the central C/N metabolism. Our transcriptional, enzymatic and metabolic

results revealed an influential role for the cytosolic glutamine synthetase (GS1) and the GABA-

shunt in shaping a secondary line of defense in sitiens, functioning as an anti-cell death

mechanism to tightly control the extent and localization of the defense-associated HR. Further

genetic evidence, gained through virus induced gene silencing, and microscopic analysis

confirmed the importance of the GABA-shunt and the GS1 genes in restricting the growth of the

pathogen within the inoculation site in the sitiens mutant. It was also shown that exogenous

application of GABA can reduce susceptibility to the pathogen in the wild-type plant, seemingly

through the anti-cell death defense mechanism observed in sitiens. Collectively, these results

suggest an interplay between primary amino acid metabolism and defense response during the

necrotrophic sitiens-B.cinerea interaction, whereby the epidermal H2O2-mediated pathogen

arrestment is crucially linked with a durable maintenance of basic metabolism in the challenged

area.

157

Having paid attention to the important role for a fast reaction in the observed resistance

response in the mutant, we also explored early signaling events in the sitiens-B. cinerea

interaction. In this part of the study, evidence has been presented that ABA-deficiency in sitiens

results in increased cuticle permeability which is also positively correlated with disease

resistance. It was then hypothesized that a permeable cuticle can facilitate faster perception of

putative elicitors released from the pathogen, or from the mechanical attempt of pathogen

penetration, resulting in a rapid induction of defense-associated genes. Moreover, the pectin

molecule in sitiens was found to have a higher degree of methylesterification. Therefore, it was

also proposed that upon challenge with B. cinerea, different types of oligosaccharides with

more efficiency in elicitation may possibly be released from the altered pectin fraction of the

sitiens cell wall. We could also isolate two biologically active compounds with possible

elicitation-associated roles during early stages of the sitiens-B. cinerea interaction. Our

analytical data may hint at the presence of some complex interspecies signaling compounds,

formed as pectic dimers that are stabilized with chitosan fragments and calcium ions (termed as

COS-OGAs).

In conclusion, we have shown that ABA deficiency in the sitiens mutant of tomato has resulted

in a multifaceted resistance response against the broad-host range necrotrophic pathogen B.

cinerea, in which several layers of defenses, such as primary metabolism, secondary

metabolism, cuticle permeability and potent signaling components, play critical roles.

158

159

Samenvatting

De co-evolutie van planten met hun pathogene micro-organismen heeft onvermijdelijk geleid

tot het ontstaan van gesofisticeerde verdedigingsmechanismen die de plant in staat stellen

weerstand te bieden aan de constante bedreiging van deze pathogenen. Deze

verdedigingsmechanismen zijn zeer verscheiden, gaande van fysieke barrières die de pathogeen

mechanistisch tegenhouden tot de novo synthese van anti-microbiële componenten die de

groei van de pathogeen in de waardplant chemisch een halt toe roepen. Langs de andere kant

hebben pathogenen ook verschillende virulentiemechanismen ontwikkeld om zo de

verdediging van de plant te omzeilen. Dit heeft uiteindelijk geleid tot drie categorieën van

pathogenen met elk een verschillende invasieve strategie, nl biotrofen, hemibiotrofen en

necrotrofen. Biotrofe pathogenen hebben levend plantenweefsel nodig om hun levenscyclus te

voltooien, terwijl necrotrofen de gastheercellen eerst afdoden en vervolgens overleven op het

dode weefsel. De hemibiotrofen doorlopen achtereenvolgens een biotrofe fase en schakelen

nadien over naar een necrotrofe levenswijze in latere fasen van de infectie. Necrotrofe

pathogenen kunnen verder onderverdeeld worden in twee grote groepen op basis van hun

gastheerspecificiteit: waardplantspecifieke necrotrofen en necrotrofen met een breed

waardplantspectrum.

Gebruikmakend van een incompatibel model pathosysteem hebben we de

resistentiemechanismen onderzocht die de waardplant in staat stellen om op efficiënte wijze

de ascomyceet Botrytis cinerea te onderdrukken, een archetypische necrotroof met een breed

waardplantspectrum. B. cinerea (teleomorf: Botryotinia fuckeliana) is de veroorzaker van de

grauwe schimmel ziekte (Botrytis blight) in meer dan 200 plantensoorten wereldwijd. Ons labo

heeft reeds eerder aangetoond dat deficiëntie van het plantenhormoon abscissinezuur (ABA) in

de sitiens mutant van tomaat (Solanum lycopersicum Mill. cv Moneymaker) resulteert in

verhoogde resistentie tegen de necrotrofe schimmel B. cinerea. Een snelle productie van

waterstofperoxide in de epidermis, gevolgd door epidermale hypersensitieve respons celdood

en celwandverstevigingen onderdrukken de pathogeeninfectie. Bovendien toonde microarray

analyse niet alleen de opregulatie aan van genen die coderen voor pathogenese gerelateerde

160

eiwitten en enzymen die betrokken zijn bij celwandstructuren, maar ook de significant

toegenomen expressie van een gencluster die betrokken is bij het centraal koolstof/stikstof

(C/N) metabolisme.

In het voorliggende werk bieden we eerst een overzicht van de regulatie van het centrale C/N

metabolisme in de plant als reactie op pathogenen met een verschillende levensstijl en zijn

mogelijke rol in de verdedigingsmechanismen van de plant. De nadruk in dit overzichtsartikel

ligt op het glutamaatmetabolisme van de plant dat dankzij zijn positionering op het raakvlak

tussen het centraal koolstof en stikstof metabolisme in staat is een controlerende rol uit te

oefenen op belangrijke verdedigingsgerelateerde processen die betrekking hebben op het

stikstoftransport, cellulaire redoxregulatie en TCA-cyclus afhankelijke

energieherprogrammering. Deze aanpassingen lijken uiteindelijk te resulteren in ofwel

‘volharding’, dit houdt in dat de functionaliteit van kritieke pathways in het basale

metabolisme van de aangevallen cel behouden blijft, ofwel ‘ontwijking’, waarbij het basale

metabolisme verstoord wordt en het sterfproces in de aangevallen cel vergemakkelijkt. Succes

of mislukking van deze ‘volharding’ of ‘ontwijkings’ strategieën lijkt sterk af te hangen van de

invasieve levensstijl van de pathogeen, biotrofie, hemibiotrofie of necrotrofie. Met andere

woorden, veranderingen in het glutamaatmetabolisme van de gastheer als reactie op

verschillende pathogene scenarios kan in twee tegengestelde richtingen werken: 1) ofwel

wordt de opgestarte verdediging ondersteund, ofwel wordt 2) het glutamaatmetabolisme

uitgebuit door de pathogeen om zo infectie te vergemakkelijken.

Voorts hebben we aangetoond dat de efficiëntie van de eerder waargenomen HR-gestuurde

verdediging tegen B. cinerea in de sitiens mutant van tomaat hoofdzakelijk steunt op de

herstructurering van het centrale C/N metabolisme. Onze transcriptionele, enzymatische en

metabolische resultaten onthullen een belangrijke rol voor het cytosolische glutamine

synthetase en de GABA-shunt in de vorming van een secundaire verdedigingslinie in sitiens die

werkt als een anticeldood mechanisme om het niveau en de lokalisatie van de HR te

controleren. Genetisch bewijs verkregen via virus geïnduceerde gen-silencing en

microscopische analyses bevestigden het belang van de GABA-shunt en de glutamine

161

synthetase genen in het inperken van de groei van de pathogeen ter hoogte van de

inoculatieplaats in de sitiens mutant. Tevens werd aangetoond dat exogene toediening van

GABA de gevoeligheid voor de pathogeen kan verminderen in het wild-type, waarschijnlijk via

het anticeldoodmechanisme dat ook werd waargenomen in sitiens.

Samengenomen suggereren deze resultaten dat er een wisselwerking plaatsvindt tussen het

primaire aminozuurmetabolisme en verdedigingsreacties tijdens de necrotrofe sitiens-B.

cinerea interactie, waarbij de link tussen de epidermale H2O2-gereguleerde onderdrukking van

de pathogeen en de duurzame instandhouding van het basale metabolisme in de aangetaste

zone van cruciaal belang is.

Aangezien een snelle reactie in de waargenomen resistentiereactie in de mutant van groot

belang is, hebben we ook gekeken naar vroege signalisatie in de sitiens-B. cinerea interactie. In

dit deel van de studie hebben we bewijs geleverd dat ABA-deficiëntie in sitiens leidt tot een

verhoogde cuticula permeabiliteit, wat tevens gecorreleerd is met ziekteresistentie. We stelden

de hypothese dat een meer doorlaatbare cuticula een snellere perceptie toelaat van elicitoren

die worden vrijgesteld door de pathogeen of tijdens de penetratie, wat resulteert in een

snellere inductie van verdediging-geassocieerde genen. Bovendien maten we in sitiens een

hogere graad van pectine-methylesterificatie. Daarom stelden we dat door de gewijzigde

methylesterificatie van de pectinefractie in de sitiens celwand, na infectie met B. cinerea

mogelijk andere types van oligosacchariden zouden kunnen vrijgesteld worden die een

efficiëntere elicitatie mogelijk maken. Daarnaast hebben we ook twee biologisch actieve

componenten kunnen isoleren waarvan de functie mogelijk gerelateerd is aan vrijstelling

tijdens de eerste stadia van de sitiens-B. cinerea interactie. Onze analytische data kunnen een

aanwijzing vormen voor de aanwezigheid van complexe, interspecies signaalcomponenten,

gevormd als pectine dimeren die gestabiliseerd worden met chitosan fragmenten en calcium

ionen (aangeduid als COS-OGAs).

Als besluit kunnen we zeggen dat we hebben aangetoond dat een tekort aan ABA in de sitiens

mutant van tomaat resulteert in een veelzijdige resistentie tegen de necrotrofe breed

waardplantspectrum pathogeen B. cinerea, waarbij verschillende lagen van het

162

afweermechanisme, zoals het primaire metabolisme, het secundaire metabolisme, de

doorlaatbaarheid van de cuticula en krachtige signaalmoleculen, een belangrijke rol spelen.

163

164

165

References AbuQamar S, Chen X, Dhawan R, Bluhm B, Salmeron J, Lam S, Dietrich RA, Mengiste T. 2006. Expression profiling and mutant analysis reveals complex regulatory networks involved in Arabidopsis response to Botrytis infection. Plant Journal 48: 28-44.

Achuo EA, Prinsen E, Hofte M. 2006. Influence of drought, salt stress and abscisic acid on the resistance of tomato to Botrytis cinerea and Oidium neolycopersici. Plant Pathology 55: 178-186.

Albersheim P. 1979. Classic method for the analysis of sugars in plant cell wall Polysaccharides by gas liquid chromatography. Current Contents/Physical Chemical & Earth Sciences 10.

Allwood JW, Ellis DI, Goodacre R. 2008. Biomarker metabolites capturing the metabolite variance present in a rice plant developmental period. Physiologia Plantarum 132: 117-135.

Allwood JW, Clarke A, Goodacre R, Mur LAJ. 2010. Dual metabolomics: A novel approach to understanding plant-pathogen interactions. Phytochemistry 71: 590-597.

Amrhein N, Gdِek KH. 1977. -aminooxy--phenylpropanoic acid, a potent inhibitor of L-phenylalanine ammonia-lyase in vitro and in vivo. Plant Science Letters. 8: 313-317.

Anand A, Vaghchhipawala Z, Ryu CM, Kang L, Wang K, del-Pozo O, Martin GB, Mysore KS. 2007. Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Molecular Plant-Microbe Interactions 20: 41-52.

Ansari MI, Lee RH, Chen SCG. 2005. A novel senescence-associated gene encoding gamma-aminobutyric acid (GABA): pyruvate transaminase is upregulated during rice leaf senescence. Physiologia Plantarum 123: 1-8.

Araujo WL, Nunes-Nesi A, Trenkamp S, Bunik VI, Fernie AR. 2008. Inhibition of 2-oxoglutarate dehydrogenase in potato tuber suggests the enzyme is limiting for respiration and confirms its importance in nitrogen assimilation. Plant Physiology 148: 1782-1796.

Arrebola E, Cazorla FM, Duran VE, Rivera E, Olea F, Codina JC, Perez-Garcia A, de Vicente A. 2003. Mangotoxin: a novel antimetabolite toxin produced by Pseudomonas syringae inhibiting ornithine/arginine biosynthesis. Physiological and Molecular Plant Pathology 63: 117-127.

Arrebola E, Cazorla FM, Perez-Garcia A, de Vicente A. 2011. Chemical and metabolic aspects of antimetabolite toxins produced by Pseudomonas syringae pathovars. Toxins 3: 1089-1110.

Arrom L, Munne-Bosch S. 2012. Hormonal regulation of leaf senescence in Lilium. Journal of Plant Physiology 169: 1542-1550.

166

Asselbergh B, Curvers K, Franca SC, Audenaert K, Vuylsteke M, Van Breusegem F, Hofte M. 2007. Resistance to Botrytis cinerea in sitiens, an abscisic acid-deficient tomato mutant, involves timely production of hydrogen peroxide and cell wall modifications in the epidermis. Plant Physiology 144: 1863-1877.

Asselbergh B, De Vleesschauwer D, Hofte M. 2008. Global switches and fine-tuning - ABA modulates plant pathogen defense. Molecular Plant-Microbe Interactions 21: 709-719.

Asselbergh B, Achuo AE, Hofte M, Van Gijsegem F. 2008. Abscisic acid deficiency leads to rapid activation of tomato defence responses upon infection with Erwinia chrysanthemi. Molecular Plant Pathology 9: 11-24.

Audenaert K, De Meyer GB, Hofte MM. 2002. Abscisic acid determines basal susceptibility of tomato to Botrytis cinerea and suppresses salicylic acid-dependent signaling mechanisms. Plant Physiology 128: 491-501.

Azami-Sardooei Z, Franca SC, De Vleesschauwer D, Hofte M. 2010. Riboflavin induces resistance against Botrytis cinerea in bean, but not in tomato, by priming for a hydrogen peroxide-fueled resistance response. Physiological and Molecular Plant Pathology 75: 23-29.

Aziz A, Brun O, Audran JC. 2001. Involvement of polyamines in the control of fruitlet physiological abscission in grapevine (Vitis vinifera). Physiologia Plantarum 113: 50-58.

Baum G, LevYadun S, Fridmann Y, Arazi T, Katsnelson H, Zik M, Fromm H. 1996. Calmodulin binding to glutamate decarboxylase is required for regulation of glutamate and GABA metabolism and normal development in plants. Embo Journal 15: 2988-2996.

Bellincampi D, Salvi G, Delorenzo G, Cervone F, Marfa V, Eberhard S, Darvill A, Albersheim P. 1993. Oligogalacturonides Inhibit the Formation of Roots on Tobacco Explants. Plant Journal 4: 207-213.

Bennett RN, Wallsgrove RM. 1994. Secondary Metabolites in Plant Defense-Mechanisms. New Phytologist 127: 617-633.

Berger S, Sinha AK, Roitsch T. 2007. Plant physiology meets phytopathology: plant primary metabolism and plant-pathogen interactions. Journal of Experimental Botany 58: 4019-4026.

Bergey DR, Orozco-Cardenas M, de Moura DS, Ryan CA. 1999. A wound- and systemin-inducible polygalacturonase in tomato leaves. Proceedings of the National Academy of Sciences of the United States of America 96: 1756-1760.

Bernard SM, Habash DZ. 2009. The importance of cytosolic glutamine synthetase in nitrogen assimilation and recycling. New Phytologist 182: 608-620.

167

Bessire M, Chassot C, Jacquat AC, Humphry M, Borel S, Petetot JMC, Metraux JP, Nawrath C. 2007. A permeable cuticle in Arabidopsis leads to a strong resistance to Botrytis cinerea. Embo Journal 26: 2158-2168.

Block A, Li GY, Fu ZQ, Alfano JR. 2008. Phytopathogen type III effector weaponry and their plant targets. Current Opinion in Plant Biology 11: 396-403.

Bolton MD, Kolmer JA, Xu WW, Garvin DF. 2008. Lr34-mediated leaf rust resistance in wheat: transcript profiling reveals a high energetic demand supported by transient recruitment of multiple metabolic pathways. Molecular Plant-Microbe Interactions 21: 1515-1527.

Bolton MD, Thomma BPHJ. 2008. The complexity of nitrogen metabolism and nitrogen-regulated gene expression in plant pathogenic fungi. Physiological and Molecular Plant Pathology 72: 104-110.

Bolton MD. 2009. Primary metabolism and plant defense-fuel for the fire. Molecular Plant-Microbe Interactions 22: 487-497.

Bouche N, Fait A, Bouchez D, Moller SG, Fromm H. 2003. Mitochondrial succinic-semialdehyde dehydrogenase of the gamma-aminobutyrate shunt is required to restrict levels of reactive oxygen intermediates in plants. Proceedings of the National Academy of Sciences of the United States of America 100: 6843-6848.

Boudart G, Dechampguillaume G, Lafitte C, Ricart G, Barthe JP, Mazau D, Esquerretugaye MT. 1995. Elicitors and suppressors of hydroxyproline-rich glycoprotein accumulation are solubilized from plant-cell walls by endopolygalacturonase. European Journal of Biochemistry 232: 449-457.

Bradford MM. 1976. Rapid and sensitive method for quantitation of microgram quantities of protein utilizing principle of protein-dye binding. Analytical Biochemistry 72: 248-254.

Brauc S, De Vooght E, Claeys M, Hofte M, Angenon G. 2011. Influence of over-expression of cytosolic aspartate aminotransferase on amino acid metabolism and defence responses against Botrytis cinerea infection in Arabidopsis thaliana. Journal of Plant Physiology 168: 1813-1819.

Brauc S, De Vooght E, Claeys M, Geuns JMC, Hofte M, Angenon G. 2012. Overexpression of arginase in Arabidopsis thaliana influences defence responses against Botrytis cinerea. Plant Biology 14: 39-45.

Bray EA. 2004. Genes commonly regulated by water-deficit stress in Arabidopsis thaliana. Journal of Experimental Botany 55: 2331-2341.

Bringe K, Schumacher CFA, Schmitz-Eiberger M, Steiner U, Oerke EC. 2006. Ontogenetic variation in chemical and physical characteristics of adaxial apple leaf surfaces. Phytochemistry 67: 161-170.

168

Bryant JP, Chapin FS, Klein DR. 1983. Carbon/nutrient balance of boreal plants in relation to vertebrate herbivory. Oikos 40: 357–368.

Busch KB, Fromm H. 1999. Plant succinic semialdehyde dehydrogenase. Cloning, purification, localization in mitochondria, and regulation by adenine nucleotides. Plant Physiology 121: 589-597.

Cabrera JC, Boland A, Messiaen J, Cambier P, Van Cutsem P. 2008. Egg box conformation of oligogalacturonides: The time-dependent stabilization of the elicitor-active conformation increases its biological activity. Glycobiology 18: 473-482.

Cabrera JC, Boland A, Cambier P, Frettinger P, Van Cutsem P. 2010. Chitosan oligosaccharides modulate the supramolecular conformation and the biological activity of oligogalacturonides in Arabidopsis. Glycobiology 20: 775-786.

Caillot S, Rat S, Tavernier ML, Michaud P, Kovensky J, Wadouachi A, Clement C, Baillieul F, Petit E. 2012. Native and sulfated oligoglucuronans as elicitors of defence-related responses inducing protection against Botrytis cinerea of Vitis vinifera. Carbohydrate Polymers 87: 1728-1736.

Cameron KD, Teece MA, Smart LB. 2006. Increased accumulation of cuticular wax and expression of lipid transfer protein in response to periodic drying events in leaves of tree tobacco. Plant Physiology 140: 176-183.

Cecchini NM, Monteoliva MI, Alvarez ME. 2011. Proline dehydrogenase contributes to pathogen defense in Arabidopsis. Plant Physiology 155: 1947-1959.

Chang A, Lim MH, Lee SW, Robb EJ, Nazar RN. 2008. Tomato phenylalanine ammonia-lyase gene family, highly redundant but strongly underutilized. Journal of Biological Chemistry 283: 33591-33601.

Chassot C, Metraux JP. 2005. The cuticle as source of signals for plant defense. Plant Biosystems 139: 28-31.

Chassot C, Nawrath C, Metraux JP. 2007. Cuticular defects lead to full immunity to a major plant pathogen. Plant Journal 49: 972-980.

Chen GX, Sagi MS, Song WN, Krugman T, Fahima T, Korol AB, Nevo E. 2004. Wild barley eibi1 mutation identifies a gene essential for leaf water conservation. Planta 219: 684-693.

Clark SM, Di Leo R, Van Cauwenberghe OR, Mullen RT, Shelp BJ. 2009. Subcellular localization and expression of multiple tomato gamma-aminobutyrate transaminases that utilize both pyruvate and glyoxylate. Journal of Experimental Botany 60: 3255-3267.

Cominelli E, Sala T, Calvi D, Gusmaroli G, Tonelli C. 2008. Over-expression of the Arabidopsis AtMYB41 gene alters cell expansion and leaf surface permeability. Plant Journal 53: 53-64.

169

Cote F, Hahn MG. 1994. Oligosaccharins structures and signal transduction. Plant Molecular Biology 26: 1379-1411.

Cowley T, Walters DR. 2002. Polyamine metabolism in an incompatible interaction between barley and the powdery mildew fungus, Blumeria graminis f. Sp hordei. Journal of Phytopathology-Phytopathologische Zeitschrift 150: 581-586.

Crawford NM. 2006. Mechanisms for nitric oxide synthesis in plants. Journal of Experimental Botany 57: 471-478.

Cren M, Hirel B. 1999. Glutamine synthetase in higher plants: Regulation of gene and protein expression from the organ to the cell. Plant and Cell Physiology 40: 1187-1193.

Curvers K, Seifi H, Mouille G, de Rycke R, Asselbergh B, Van Hecke A, Vanderschaeghe D, Hofte H, Callewaert N, Van Breusegem F, Hofte M. 2010. Abscisic acid deficiency causes changes in cuticle permeability and pectin composition that influence tomato resistance to Botrytis cinerea. Plant Physiology 154: 847-860.

Dangl JL, Jones JDG. 2001. Plant pathogens and integrated defence responses to infection. Nature 411: 826-833.

De Gara L, de Pinto MC, Tommasi F. 2003. The antioxidant systems vis-a-vis reactive oxygen species during plant-pathogen interaction. Plant Physiology and Biochemistry 41: 863-870.

De Lorenzo G, Ferrari S. 2002. Polygalacturonase-inhibiting proteins in defense against phytopathogenic fungi. Current Opinion in Plant Biology 5: 295-299.

De Vleesschauwer D, Yang YN, Cruz CV, Hofte M. 2010. Abscisic acid-induced resistance against the brown spot pathogen Cochliobolus miyabeanus in rice involves MAP kinase-mediated repression of ethylene signaling. Plant Physiology 152: 2036-2052.

Dean R, Van Kan JAL, Pretorius ZA, Hammond-Kosack KE, Di Pietro A, Spanu PD, Rudd JJ, Dickman M, Kahmann R, Ellis J, Foster GD. 2012. The Top 10 fungal pathogens in molecular plant pathology. Molecular Plant Pathology 13: 414-430.

Decreux A, Messiaen J. 2005. Wall-associated kinase WAK1 interacts with cell wall pectins in a calcium-induced conformation. Plant and Cell Physiology 46: 268-278.

Dennis DT, Blakeley SD. 1995. The regulation of carbon partitioning in plants. Current Topics in Plant Physiology. 13: 258-267.

Devaux C, Baldet P, Joubes J, Dieuaide-Noubhani M, Just D, Chevalier C, Raymond P. 2003. Physiological, biochemical and molecular analysis of sugar-starvation responses in tomato roots. Journal of Experimental Botany 54: 1143-1151.

170

Dhawan R, Luo HL, Foerster AM, AbuQamar S, Du HN, Briggs SD, Scheid OM, Mengiste T. 2009. Histone monoubiquitination1 interacts with A subunit of the mediator complex and regulates defense against necrotrophic fungal pathogens in Arabidopsis. Plant Cell 21: 1000-1019.

Di Matteo A, Bonivento D, Tsernoglou D, Federici L, Cervone F. 2006. Polygalacturonase-inhibiting protein (PGIP) in plant defence: a structural view. Phytochemistry 67: 528-533.

Dickman MB, Mitra A. 1992. Arabidopsis thaliana as a model for studying Sclerotinia sclerotiorum pathogenesis. Physiological and Molecular Plant Pathology 41: 255-263.

Dickman MB, Ha YS, Yang Z, Adams B, Huang C. 2003. A protein kinase from Colletotrichum trifolii is induced by plant cutin and is required for appressorium formation. Molecular Plant-Microbe Interactions 16: 411-421.

Dietrich R, Ploss K, Heil M. 2004. Constitutive and induced resistance to pathogens in Arabidopsis thaliana depends on nitrogen supply. Plant, Cell and Environment 27: 896-906.

Dixon RA, Achnine L, Kota P, Liu CJ, Reddy MSS, Wang LJ. 2002. The phenylpropanoid pathway and plant defence - a genomics perspective. Molecular Plant Pathology 3: 371-390.

Doss RP. 1999. Composition and enzymatic activity of the extracellular matrix secreted by germlings of Botrytis cinerea. Applied and Environmental Microbiology 65: 404-408.

Duke SO, Dayan FE. 2011. Modes of action of microbially-produced phytotoxins. Toxins 3: 1038-1064.

Dulermo T, Bligny R, Gout E, Cotton P. 2009. Amino acid changes during sunflower infection by the necrotrophic fungus B. cinerea. Plant Signaling & Behavior 4: 859-861.

Dulermo T, Rascle C, Chinnici G, Gout E, Bligny R, Cotton P. 2009. Dynamic carbon transfer during pathogenesis of sunflower by the necrotrophic fungus Botrytis cinerea: from plant hexoses to mannitol. New Phytologist 183: 1149-1162.

Elzahaby HM, Gullner G, Kiraly Z. 1995. Effects of powdery mildew infection of barley on the ascorbate glutathione cycle and other antioxidants in different host pathogen interactions. Phytopathology 85: 1225-1230.

Fabro G, Kovacs I, Pavet V, Szabados L, Alvarez ME. 2004. Proline accumulation and AtP5CS2 gene activation are induced by plant-pathogen incompatible interactions in Arabidopsis. Molecular Plant-Microbe Interactions 17: 343-350.

Fahnenstich H, Scarpeci TE, Valle EM, Flugge UI, Maurino VG. 2008. Generation of hydrogen peroxide in chloroplasts of Arabidopsis overexpressing glycolate oxidase as an inducible system to study oxidative stress. Plant Physiology 148: 719-729.

171

Fait A, Yellin A, Fromm H. 2005. GABA shunt deficiencies and accumulation of reactive oxygen intermediates: insight from Arabidopsis mutants. Febs Letters 579: 415-420.

Fait A, Fromm H, Walter D, Galili G, Fernie AR. 2008. Highway or byway: the metabolic role of the GABA shunt in plants. Trends in Plant Science 13: 14-19.

Faretra F, Pollastro S. 1991. Genetic basis of resistance to benzimidazole and dicarboximide fungicides in Botryotinia fuckeliana (Botrytis cinerea). Mycological Research 95: 943-951.

Fauth M, Schweizer P, Buchala A, Markstadter C, Riederer M, Kato T, Kauss H. 1999. Cutin monomers and surface wax constituents elicit H2O2 in conditioned cucumber hypocotyl segments and enhance the activity of other H2O2 elicitors (vol 117, pg 1373, 1998). Plant Physiology 121: 1057.

Ferguson AR, Sims AP. 1971. Inactivation in vivo of glutamine synthetase and NAD-specific glutamate dehydrogenase - Its role in regulation of glutamine synthesis in yeasts. Journal of General Microbiology 69: 423-&.

Ferrari S, Vairo D, Ausubel FM, Cervone F, De Lorenzo G. 2003. Tandemly duplicated arabidopsis genes that encode polygalacturonase-inhibiting proteins are regulated coordinately by different signal transduction pathways in response to fungal infection. Plant Cell 15: 93-106.

Ferrari S, Galletti R, Denoux C, De Lorenzo G, Ausubel FM, Dewdney J. 2007. Resistance to Botrytis cinerea induced in Arabidopsis by elicitors is independent of salicylic acid, ethylene, or jasmonate signaling but requires PHYTOALEXIN DEFICIENT3. Plant Physiology 144: 367-379.

Ferreira RB, Monteiro S, Freitas R, Santos CN, Chen Z, Batista LM, Duarte J, Borges A, Teixeira AR. 2007. The role of plant defence proteins in fungal pathogenesis. Molecular Plant Pathology 8: 677-700.

Fiebig A, Mayfield JA, Miley NL, Chau S, Fischer RL, Preuss D. 2000. Alterations in CER6, a gene identical to CUT1, differentially affect long-chain lipid content on the surface of pollen and stems. Plant Cell 12: 2001-2008.

Flor HH. 1956. The complementary genic systems in flax and flax rust. Advances in Genetics Incorporating Molecular Genetic Medicine 8: 29-54.

Fodor J, Gullner G, Adam AL, Barna B, Komives T, Kiraly Z. 1997. Local and systemic responses of antioxidants to tobacco mosaic virus infection and to salicylic acid in tobacco - Role in systemic acquired resistance. Plant Physiology 114: 1443-1451.

Forde BG, Lea PJ. 2007. Glutamate in plants: metabolism, regulation, and signalling. Journal of Experimental Botany 58: 2339-2358.

Foyer CH, Noctor G. 2005. Redox homeostasis and antioxidant signaling: A metabolic interface between stress perception and physiological responses. Plant Cell 17: 1866-1875.

172

Francis SA, Dewey FM, Gurr SJ. 1996. The role of cutinase in germling development and infection by Erysiphe graminis f. sp. hordei. Physiological and Molecular Plant Pathology 49: 201-211.

Galili G, Tang GL, Zhu XH, Gakiere B. 2001. Lysine catabolism: a stress and development super-regulated metabolic pathway. Current Opinion in Plant Biology 4: 261-266.

Galpaz N, Wang Q, Menda N, Zamir D, Hirschberg J. 2008. Abscisic acid deficiency in the tomato mutant high-pigment 3 leading to increased plastid number and higher fruit lycopene content. Plant Journal 53: 717-730.

Garbay B, Tautu MT, Costaglioli P. 2007. Low level of pathogenesis-related protein 1 mRNA expression in 15-day-old Arabidopsis cer6-2 and cer2 eceriferum mutants. Plant Science 172: 299-305.

Gayoso C, Pomar F, Novo-Uzal E, Merino F, de Ilarduya OM. 2010. The Ve-mediated resistance response of the tomato to Verticillium dahliae involves H2O2, peroxidase and lignins and drives PAL gene expression. BMC Plant Biology 10.

Gilbert RD, Johnson AM, Dean RA. 1996. Chemical signals responsible for appressorium formation in the rice blast fungus Magnaporthe grisea. Physiological and Molecular Plant Pathology 48: 335-346.

Gimeno-Gilles C, Lelievre E, Viau L, Malik-Ghulam M, Ricoult C, Niebel A, Leduc N, Limami AM. 2009. ABA-mediated inhibition of germination is related to the inhibition of genes encoding cell-wall biosynthetic and architecture: modifying enzymes and structural proteins in Medicago truncatula embryo axis. Molecular Plant 2: 108-119.

Goubet F, Strom A, Quemener B, Stephens E, Williams MAK, Dupree P. 2006. Resolution of the structural isomers of partially methylesterified oligogalacturonides by polysaccharide analysis using carbohydrate gel electrophoresis. Glycobiology 16: 29-35.

Govrin EM, Levine A. 2000. The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea. Current Biology 10: 751-757.

Govrin EM, Rachmilevitch S, Tiwari BS, Soloman M, Levine A. 2006. An elicitor from Botrytis cinerea induces the hypersensitive response in Arabidopsis thaliana and other plants and promotes the gray mold disease. Phytopathology 96: 299-307.

Grosskinsky DK, Koffler BE, Roitsch T, Maier R, Zechmann B. 2012. Compartment-specific antioxidative defense in Arabidopsis against virulent and avirulent Pseudomonas syringae. Phytopathology 102: 662-673.

Gupta KJ, Brotman Y, Segu S, Zeier T, Zeier J, Persijn ST, Cristescu SM, Harren FJ, Bauwe H, Fernie AR, Kaiser WM, Mur LA. 2013. The form of nitrogen nutrition affects resistance against

173

Pseudomonas syringae pv. phaseolicola in tobacco. Journal of Experimental Botany 64: 553-568.

Hahn MG, Darvill AG, Albersheim P. 1981. The endogenous elicitor, a fragment of a plant-cell wall polysaccharide that elicits phytoalexin accumulation in soybeans. Plant Physiology 68: 1161-1169.

Hare PD, Cress WA. 1997. Metabolic implications of stress-induced proline accumulation in plants. Plant Growth Regulation 21: 79-102.

Hartley RD, Ford CW. 1989. Phenolic constituents of plant-cell walls and wall biodegradability. Acs Symposium Series 399: 137-145.

Hauke V, Schreiber L. 1998. Ontogenetic and seasonal development of wax composition and cuticular transpiration of ivy (Hedera helix L.) sun and shade leaves. Planta 207: 67-75.

Heil M, Bostock RM. 2002. Induced systemic resistance (ISR) against pathogens in the context of induced plant defences. Annals of Botany 89: 503-512.

Hematy K, Sado PE, Van Tuinen A, Rochange S, Desnos T, Balzergue S, Pelletier S, Renou JP, Hofte H. 2007. A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis. Current Biology 17: 922-931.

Hematy K, Cherk C, Somerville S. 2009. Host-pathogen warfare at the plant cell wall. Current Opinion in Plant Biology 12: 406-413.

Hoffland E, Jeger MJ, van Beusichem ML. 2000. Effect of nitrogen supply rate on disease resistance in tomato depends on the pathogen. Plant and Soil 218: 239-247.

Hooker TS, Millar AA, Kunst L. 2002. Significance of the expression of the CER6 condensing enzyme for cuticular wax production in Arabidopsis. Plant Physiology 129: 1568-1580.

Horst RJ, Doehlemann G, Wahl R, Hofmann J, Schmiedl A, Kahmann R, Kamper J, Sonnewald U, Voll LM. 2010. Ustilago maydis infection strongly alters organic nitrogen allocation in maize and stimulates productivity of systemic source leaves. Plant Physiology 152: 293-308.

Humphrey TV, Bonetta DT, Goring DR. 2007. Sentinels at the wall: cell wall receptors and sensors. New Phytologist 176: 7-21.

Hwang IS, An SH, Hwang BK. 2011. Pepper asparagine synthetase 1 (CaAS1) is required for plant nitrogen assimilation and defense responses to microbial pathogens. Plant Journal 67: 749-762.

Jakob K, Kniskern JM, Bergelson J. 2007. The role of pectate lyase and the jasmonic acid defense response in Pseudomonas viridiflava virulence. Molecular Plant-Microbe Interactions 20: 146-158.

174

Jankanpaa HJ, Mishra Y, Schroder WP, Jansson S. 2012. Metabolic profiling reveals metabolic shifts in Arabidopsis plants grown under different light conditions. Plant Cell and Environment 35: 1824-1836.

Jenks MA, Joly RJ, Peters PJ, Rich PJ, Axtell JD, Ashworth EN. 1994. Chemically-induced cuticle mutation affecting epidermal conductance to water-vapor and disease susceptibility in Sorghum bicolor (L) Moench. Plant Physiology 105: 1239-1245.

Jones JDG, Dangl JL. 2006. The plant immune system. Nature 444: 323-329.

Joubert DA, Slaughter AR, Kemp G, Becker JVW, Krooshof GH, Bergmann C, Benen J, Pretorius IS, Vivier MA. 2006. The grapevine polygalacturonase-inhibiting protein (VvPGIP1) reduces Botrytis cinerea susceptibility in transgenic tobacco and differentially inhibits fungal polygalacturonases. Transgenic Research 15: 687-702.

Jubault M, Hamon C, Gravot A, Lariagon C, Delourme R, Bouchereau A, Manzanares-Dauleux MJ. 2008. Differential regulation of root arginine catabolism and polyamine metabolism in clubroot-susceptible and partially resistant Arabidopsis genotypes. Plant Physiology 146: 2008-2019.

Jung KH, Han MJ, Lee DY, Lee YS, Schreiber L, Franke R, Faust A, Yephremov A, Saedler H, Kim YW, Hwang I, An G. 2006. Wax-deficient anther1 is involved in cuticle and wax production in rice anther walls and is required for pollen development. Plant Cell 18: 3015-3032.

Kang S, Kim HB, Lee H, Choi JY, Heu S, Oh CJ, Kwon SI, An CS. 2006. Overexpression in Arabidopsis of a plasma membrane-targeting glutamate receptor from small radish increases glutamate-mediated Ca2+ influx and delays fungal infection. Molecules and Cells 21: 418-427.

Kars I, McCalman M, Wagemakers L, Van Kan JAL. 2005. Functional analysis of Botrytis cinerea pectin methylesterase genes by PCR-based targeted mutagenesis: Bcpme1 and Bcpme2 are dispensable for virulence of strain B05.10. Molecular Plant Pathology 6: 641-652.

Kasahara Y, Morisaki H, Hattori T. 1993. Hydrophobicity of the cells of fast-growing and slow-growing bacteria isolated from a grassland soil. Journal of General and Applied Microbiology 39: 381-388.

Kawasaki T, Nam J, Boyes DC, Holt BF, Hubert DA, Wiig A, Dangl JL. 2005. A duplicated pair of Arabidopsis RING-finger E3 ligases contribute to the RPM1-and RPS2-mediated hypersensitive response. Plant Journal 44: 258-270.

Kenigsbuch D, Cohen Y. 1992. Inheritance of resistance to downy mildew in cucumis-melo pi-124112 and commonality of resistance genes with Pi-124111F. Plant Disease 76: 615-617.

Kim HB, Lee SH, An CS. 1999. Isolation and characterization of a cDNA clone encoding asparagine synthetase from root nodules of Elaeagnus umbellata. Plant Science 149: 85-94.

175

Kim JB, Carpita NC. 1992. Changes in esterification of the uronic acid groups of Cell-Wall polysaccharides during elongation of maize coleoptiles. Plant Physiology 98: 646-653.

Kim TH, Park JH, Kim MC, Cho SH. 2008. Cutin monomer induces expression of the rice OsLTP5 lipid transfer protein gene. Journal of Plant Physiology 165: 345-349.

Kinnersley AM, Turano FJ. 2000. Gamma aminobutyric acid (GABA) and plant responses to stress. Critical Reviews in Plant Sciences 19: 479-509.

Koch K, Ensikat HJ. 2008. The hydrophobic coatings of plant surfaces: Epicuticular wax crystals and their morphologies, crystallinity and molecular self-assembly. Micron 39: 759-772.

Kolattukudy PE, Rogers LM, Li DX, Hwang CS, Flaishman MA. 1995. Surface signaling in pathogenesis. Proceedings of the National Academy of Sciences of the United States of America 92: 4080-4087.

Kornberg HL. 1965. Anaplerotic sequences in microbial metabolism. Angewandte Chemie-International Edition English 4: 558-565.

Kurata T, Kawabata-Awai C, Sakuradani E, Shimizu S, Okada K, Wada T. 2003. The YORE-YORE gene regulates multiple aspects of epidermal cell differentiation in Arabidopsis. Plant Journal 36: 55-66.

Kuznetsov VV, Radyukina NL, Shevyakova NI. 2006. Polyamines and stress: Biological role, metabolism, and regulation. Russian Journal of Plant Physiology 53: 583-604.

Kuzniak E, Sklodowska M. 1999. The effect of Botrytis cinerea infection on ascorbate-glutathione cycle in tomato leaves. Plant Science 148: 69-76.

Lam HM, Coschigano KT, Oliveira IC, MeloOliveira R, Coruzzi GM. 1996. The molecular-genetics of nitrogen assimilation into amino acids in higher plants. Annual Review of Plant Physiology and Plant Molecular Biology 47: 569-593.

Laroy W, Contreras R, Callewaert N. 2006. Glycome mapping on DNA sequencing equipment. Nature Protocols 1: 397-405.

Lea PJ, Azevedo RA. 2007. Nitrogen use efficiency. 2. Amino acid metabolism. Annals of Applied Biology 151: 269-275.

Lecompte F, Abro MA, Nicot PC. 2010. Contrasted responses of Botrytis cinerea isolates developing on tomato plants grown under different nitrogen nutrition regimes. Plant Pathology 59: 891-899.

Lee SW, Robb J, Nazar RN. 1992. Truncated phenylalanine ammonia-lyase expression in tomato (Lycopersicon-Esculentum). Journal of Biological Chemistry 267: 11824-11830.

176

Leroch M, Mernke D, Koppenhoefer D, Schneider P, Mosbach A, Doehlemann G, Hahn M. 2011. Living colors in the gray mold pathogen Botrytis cinerea: Codon-optimized genes encoding green fluorescent protein and mCherry, which exhibit bright fluorescence. Applied and Environmental Microbiology 77: 2887-2897.

Less H, Galili G. 2008. Principal transcriptional programs regulating plant amino acid metabolism in response to abiotic stresses. Plant Physiol 147: 316-330.

Lionetti V, Raiola A, Camardella L, Giovane A, Obel N, Pauly M, Favaron F, Cervone F, Bellincampi D. 2007. Overexpression of pectin methylesterase inhibitors in Arabidopsis restricts fungal infection by Botrytis cinerea. Plant Physiology 143: 1871-1880.

Liu GS, Ji YY, Bhuiyan NH, Pilot G, Selvaraj G, Zou JT, Wei YD. 2010. Amino acid homeostasis modulates salicylic acid-associated redox status and defense responses in Arabidopsis. Plant Cell 22: 3845-3863.

Liu YL, Schiff M, Marathe R, Dinesh-Kumar SP. 2002. Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Plant Journal 30: 415-429.

Liu YL, Schiff M, Dinesh-Kumar SP. 2002. Virus-induced gene silencing in tomato. Plant Journal 31: 777-786.

Lohani S, Trivedi PK, Nath P. 2004. Changes in activities of cell wall hydrolases during ethylene-induced ripening in banana: effect of 1-MCP, ABA and IAA. Postharvest Biology and Technology 31: 119-126.

Lovdal T, Lillo C. 2009. Reference gene selection for quantitative real-time PCR normalization in tomato subjected to nitrogen, cold, and light stress. Analytical Biochemistry 387: 238-242.

Lucena MA, Romero-Aranda R, Mercado JA, Cuartero J, Valpuesta V, Quesada MA. 2003. Structural and physiological changes in the roots of tomato plants over-expressing a basic peroxidase. Physiologia Plantarum 118: 422-429.

Ludewig F, Huser A, Fromm H, Beauclair L, Bouche N. 2008. Mutants of GABA transaminase (POP2) suppress the severe phenotype of succinic semialdehyde dehydrogenase (ssadh) mutants in Arabidopsis. Plos One 3.

Luo HL, Laluk K, Lai ZB, Veronese P, Song FM, Mengiste T. 2010. The Arabidopsis Botrytis susceptible1 interactor defines a dubclass of RING E3 ligases that regulate pathogen and stress responses. Plant Physiology 154: 1766-1782.

Machado AT, Sodek L, Fernandes MS. 2001. N-partitioning, nitrate reductase and glutamine synthetase activities in two contrasting varieties of maize. Pesquisa Agropecuaria Brasileira 36: 249-256.

177

Macheroux P, Massey V, Thiele DJ, Volokita M. 1991. Expression of spinach glycolate oxidase in Saccharomyces cerevisiae - Purification and characterization. Biochemistry 30: 4612-4619.

Mang HG, Laluk KA, Parsons EP, Kosma DK, Cooper BR, Park HC, AbuQamar S, Boccongelli C, Miyazaki S, Consiglio F, Chilosi G, Bohnert HJ, Bressan RA, Mengiste T, Jenks MA. 2009. The Arabidopsis RESURRECTION1 gene regulates a novel antagonistic Interaction in plant defense to biotrophs and necrotrophs. Plant Physiology 151: 290-305.

Mansfield JW, Richardson A. 1981. The Ultrastructure of Interactions Between Botrytis Species and Broad Bean-Leaves. Physiological Plant Pathology 19: 41-&.

Masclaux-Daubresse C, Valadier MH, Carrayol E, Reisdorf-Cren M, Hirel B. 2002. Diurnal changes in the expression of glutamate dehydrogenase and nitrate reductase are involved in the C/N balance of tobacco source leaves. Plant Cell and Environment 25: 1451-1462.

Masclaux-Daubresse C, Carrayol E, Valadier MH. 2005. The two nitrogen mobilisation- and senescence-associated GS1 and GDH genes are controlled by C and N metabolites. Planta 221: 580-588.

Mathews DE, Durbin RD. 1990. Tagetitoxin inhibits RNA synthesis directed by RNA polymerases from chloroplasts and Escherichia coli. Journal of Biological Chemistry 265: 493-498.

Mathieu Y, Kurkdjian A, Xia H, Guern J, Koller A, Spiro MD, Oneill M, Albersheim P, Darvill A. 1991. Membrane responses induced by oligogalacturonides in suspension cultured Tobacco cells. Plant Journal 1: 333-343.

Mauch-Mani B, Mauch F. 2005. The role of abscisic acid in plant-pathogen interactions. Current Opinion in Plant Biology 8: 409-414.

Menard R, Alban S, de Ruffray P, Jamois F, Franz G, Fritig B, Yvin JC, Kauffmann S. 2004. beta-1,3 glucan sulfate, but not beta-1,3 glucan, induces the salicylic acid signaling pathway in tobacco and Arabidopsis. Plant Cell 16: 3020-3032.

Mengiste T. 2012. Plant immunity to necrotrophs. Annual Review of Phytopathology 50: 267-294.

Messiaen J, Vancutsem P. 1994. Pectic signal transduction in carrot cells membrane, cytosolic and nuclear responses induced by oligogalacturonides. Plant and Cell Physiology 35: 677-689.

Mhamdi A, Mauve C, Gouia H, Saindrenan P, Hodges M, Noctor G. 2010. Cytosolic NADP-dependent isocitrate dehydrogenase contributes to redox homeostasis and the regulation of pathogen responses in Arabidopsis leaves. Plant Cell and Environment 33: 1112-1123.

Michaeli S, Fait A, Lagor K, Nunes-Nesi A, Grillich N, Yellin A, Bar D, Khan M, Fernie AR, Turano FJ, Fromm H. 2011. A mitochondrial GABA permease connects the GABA shunt and the TCA cycle, and is essential for normal carbon metabolism. Plant Journal 67: 485-498.

178

Micheli F. 2001. Pectin methylesterases: cell wall enzymes with important roles in plant physiology. Trends in Plant Science 6: 414-419.

Miller G, Honig A, Stein H, Suzuki N, Mittler R, Zilberstein A. 2009. Unraveling delta(1)-pyrroline-5-carboxylate-proline cycle in plants by uncoupled expression of proline oxidation enzymes. Journal of Biological Chemistry 284: 26482-26492.

Miyara I, Shnaiderman C, Meng X, Vargas WA, Diaz-Minguez JM, Sherman A, Thon M, Prusky D. 2012. Role of nitrogen-metabolism genes expressed during pathogenicity of the alkalinizing Colletotrichum gloeosporioides and their differential expression in acidifying pathogens. Molecular Plant-Microbe Interactions 25: 1251-1263.

Moerschbacher BM, Mierau M, Graessner B, Noll U, Mort AJ. 1999. Small oligomers of galacturonic acid are endogenous suppressors of disease resistance reactions in wheat leaves. Journal of Experimental Botany 50: 605-612.

Mohr PG, Cahill DM. 2001. Relative roles of glyceollin, lignin and the hypersensitive response and the influence of ABA in compatible and incompatible interactions of soybeans with Phytophthora sojae. Physiological and Molecular Plant Pathology 58: 31-41.

Moreau M, Lindermayr C, Durner J, Klessig DF. 2010. NO synthesis and signaling in plants - where do we stand? Physiologia Plantarum 138: 372-383.

Mur LAJ, Carver TLW, Prats E. 2006. NO way to live; the various roles of nitric oxide in plant-pathogen interactions. Journal of Experimental Botany 57: 489-505.

Natarajan SK, Becker DF. 2012. Role of apoptosis-inducing factor, proline dehydrogenase, and NADPH oxidase in apoptosis and oxidative stress. Cell Health Cytoskelet. 2012: 11-27.

Navarre DA, Wolpert TJ. 1999. Victorin induction of an apoptotic/senescence-like response in oats. Plant Cell 11: 237-249.

Noctor G, Mhamdi A, Chaouch S, Han Y, Neukermans J, Marquez-Garcia B, Queval G, Foyer CH. 2012. Glutathione in plants: an integrated overview. Plant Cell and Environment 35: 454-484.

Norman C, Vidal S, Palva ET. 1999. Oligogalacturonide-mediated induction of a gene involved in jasmonic acid synthesis in response to the cell-wall-degrading enzymes of the plant pathogen Erwinia carotovora. Molecular Plant-Microbe Interactions 12: 640-644.

Oeser B, Heidrich PM, Muller U, Tudzynski P, Tenberge KB. 2002. Polygalacturonase is a pathogenicity factor in the Claviceps purpurea-rye interaction. Fungal Genetics and Biology 36: 176-186.

Olea F, Perez-Garcia A, Canton FR, Rivera ME, Canas R, Avila C, Cazorla FM, Canovas FM, de Vicente A. 2004. Up-regulation and localization of asparagine synthetase in tomato leaves

179

infected by the bacterial pathogen Pseudomonas syringae. Plant and Cell Physiology 45: 770-780.

Olivieira IC, Brenner E, Chiu J, Hsieh MH, Kouranov A, Lam HM, Shin MJ, Coruzzi G. 2001. Metabolite and light regulation of metabolism in plants: lessons from the study of a single biochemical pathway. Brazilian Journal of Medical and Biological Research 34: 567-575.

Osorio S, Castillejo C, Quesada MA, Medina-Escobar N, Brownsey GJ, Suau R, Heredia A, Botella MA, Valpuesta V. 2008. Partial demethylation of oligogalacturonides by pectin methyl esterase 1 is required for eliciting defence responses in wild strawberry (Fragaria vesca). Plant Journal 54: 43-55.

Pageau K, Reisdorf-Cren M, Morot-Gaudry JF, Masclaux-Daubresse C. 2006. The two senescence-related markers, GS1 (cytosolic glutamine synthetase) and GDH (glutamate dehydrogenase), involved in nitrogen mobilization, are differentially regulated during pathogen attack and by stress hormones and reactive oxygen species in Nicotiana tabacum L. leaves. Journal of Experimental Botany 57: 547-557.

Park DH, Mirabella R, Bronstein PA, Preston GM, Haring MA, Lim CK, Collmer A, Schuurink RC. 2010. Mutations in gamma-aminobutyric acid (GABA) transaminase genes in plants or Pseudomonas syringae reduce bacterial virulence. Plant Journal 64: 318-330.

Park JH, Suh MC, Kim TH, Kim MC, Cho SH. 2008. Expression of glycine-rich protein genes, AtGRP5 and AtGRP23, induced by the cutin monomer 16-hydroxypalmitic acid in Arabidopsis thaliana. Plant Physiology and Biochemistry 46: 1015-1018.

Patil SS, Tam LQ, Sakai WS. 1972. Mode of action of toxin from Pseudomonas phaseolicola .1. Toxin specificity, chlorosis, and ornithine accumulation. Plant Physiology 49: 803-&.

Perez-Garcia A, Canovas FM, Gallardo F, Hirel B, Devicente A. 1995. Differential expression of glutamine synthetase isoforms in tomato detached leaflets infected with Pseudomonas syringae pv tomato. Molecular Plant-Microbe Interactions 8: 96-103.

Perez-Garcia A, de Vicente A, Canton FR, Cazorla FM, Codina JC, Garcia-Gutierrez A, Canovas FM. 1998. Light-dependent changes of tomato glutamine synthetase in response to Pseudomonas syringae infection or phosphinothricin treatment. Physiologia Plantarum 102: 377-384.

Perez-Garcia A, Pereira S, Pissarra J, Gutierrez AG, Cazorla FM, Salema R, de Vicente A, Canovas FM. 1998. Cytosolic localization in tomato mesophyll cells of a novel glutamine synthetase induced in response to bacterial infection or phosphinothricin treatment. Planta 206: 426-434.

Perez-Garcia A, Snoeijers SS, Joosten MHAJ, Goosen T, De Wit PJGM. 2001. Expression of the avirulence gene Avr9 of the fungal tomato pathogen Cladosporium fulvum is regulated by the global nitrogen response factor NRF1. Molecular Plant-Microbe Interactions 14: 316-325.

180

Phang JM, Donald SP, Pandhare J, Liu YM. 2008. The metabolism of proline, a stress substrate, modulates carcinogenic pathways. Amino Acids 35: 681-690.

Pieterse CMJ, Verbakel HM, Spaans JH, Davidse LC, Govers F. 1993. Increased expression of the calmodulin gene of the late blight fungus Phytophthora Infestans during pathogenesis on potato. Molecular Plant-Microbe Interactions 6: 164-172.

Pieterse CMJ, Leon-Reyes A, Van der Ent S, Van Wees SCM. 2009. Networking by small-molecule hormones in plant immunity. Nature Chemical Biology 5: 308-316.

Popp C, Burghardt M, Friedmann A, Riederer M. 2005. Characterization of hydrophilic and lipophilic pathways of Hedera helix L. cuticular membranes: permeation of water and uncharged organic compounds. Journal of Experimental Botany 56: 2797-2806.

Powell ALT, van Kan J, ten Have A, Visser J, Greve LC, Bennett AB, Labavitch JM. 2000. Transgenic expression of pear PGIP in tomato limits fungal colonization. Molecular Plant-Microbe Interactions 13: 942-950.

Quirino BF, Noh YS, Himelblau E, Amasino RM. 2000. Molecular aspects of leaf senescence. Trends in Plant Science 5: 278-282.

Reina-Pinto JJ, Yephremov A. 2009. Surface lipids and plant defenses. Plant Physiology and Biochemistry 47: 540-549.

Ren CW, Kermode AR. 1999. Analyses to determine the role of the megagametophyte and other seed tissues in dormancy maintenance of yellow cedar (Chamaecyparis nootkatensis) seeds: morphological, cellular and physiological changes following moist chilling and during germination. Journal of Experimental Botany 50: 1403-1419.

Rico A, Preston GM. 2008. Pseudomonas syringae pv. tomato DC3000 uses constitutive and apoplast-induced nutrient assimilation pathways to catabolize nutrients that are abundant in the tomato apoplast. Molecular Plant-Microbe Interactions 21: 269-282.

Rico A, Mccraw SL, Preston GM. 2011. The metabolic interface between Pseudomonas syringae and plant cells. Current Opinion in Microbiology 14: 31-38.

Ridley BL, O'Neill MA, Mohnen DA. 2001. Pectins: structure, biosynthesis, and oligogalacturonide-related signaling. Phytochemistry 57: 929-967.

Robert-Seilaniantz A, Navarro L, Bari R, Jones JD. 2007. Pathological hormone imbalances. Current Opinion in Plant Biology 10: 372-379.

Roberts RM. 2007. Does GABA Act as a Signal in Plants? Hints from Molecular Studies. Plant Signaling & Behavior 2: 408-409.

181

Rojas CM, Senthil-Kumar M, Wang K, Ryu CM, Kaundal A, Mysore KS. 2012. Glycolate oxidase modulates reactive oxygen species-mediated signal transduction during nonhost Resistance in Nicotiana benthamiana and Arabidopsis. Plant Cell 24: 336-352.

Rollins JA. 2003. The Sclerotinia sclerotiorum pac1 gene is required for sclerotial development and virulence. Molecular Plant-Microbe Interactions 16: 785-795.

Rossato L, Laine P, Ourry A. 2001. Nitrogen storage and remobilization in Brassica napus L. during the growth cycle: nitrogen fluxes within the plant and changes in soluble protein patterns. Journal of Experimental Botany 52: 1655-1663.

Sakurai N, Katayama Y, Yamaya T. 2001. Overlapping expression of cytosolic glutamine synthetase and phenylalanine ammonia-lyase in immature leaf blades of rice. Physiologia Plantarum 113: 400-408.

Saladie M, Matas AJ, Isaacson T, Jenks MA, Goodwin SM, Niklas KJ, Ren XL, Labavitch JM, Shackel KA, Fernie AR, Lytovchenko A, O'Neill MA, Watkins CB, Rose JKC. 2007. A reevaluation of the key factors that influence tomato fruit softening and integrity. Plant Physiology 144: 1012-1028.

Sarma AD, Sreelakshmi Y, Sharma R. 1998. Differential expression and properties of phenylalanine ammonia-lyase isoforms in tomato leaves. Phytochemistry 49: 2233-2243.

Schweizer P, Felix G, Buchala A, Muller C, Metraux JP. 1996. Perception of free cutin monomers by plant cells. Plant Journal 10: 331-341.

Schweizer P, Jeanguenat A, Whitacre D, Metraux JP, Mosinger E. 1996. Induction of resistance in barley against Erysiphe graminis f sp hordei by free cutin monomers. Physiological and Molecular Plant Pathology 49: 103-120.

Seifi HS, Van BJ, Angenon G, Hofte M. 2013. Glutamate metabolism in plant disease and defense: friend or foe? Molecuar Plant-Microbe Interactions 26: 475-485.

Senthil-Kumar M, Mysore KS. 2012. Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response. Plant Cell and Environment 35: 1329-1343.

Servet C, Ghelis T, Richard L, Zilberstein A, Savoure A. 2012. Proline dehydrogenase: a key enzyme in controlling cellular homeostasis. Frontiers in Bioscience-Landmark 17: 607-620.

Shelp BJ, Mullen RT, Waller JC. 2012. Compartmentation of GABA metabolism raises intriguing questions. Trends in Plant Science 17: 57-59.

182

Shibata Y, Kawakita K, Takemoto D. 2010. Age-related resistance of Nicotiana benthamiana against hemibiotrophic pathogen Phytophthora infestans requires both ethylene- and salicylic acid-mediated signaling pathways. Molecular Plant-Microbe Interactions 23: 1130-1142.

Showalter AM. 2001. Arabinogalactan-proteins: structure, expression and function. Cellular and Molecular Life Sciences 58: 1399-1417.

Sicilia F, Fernandez-Recio J, Caprari C, De Lorenzo G, Tsernoglou D, Cervone F, Federici L. 2005. The polygalacturonase-inhibiting protein PGIP2 of Phaseolus vulgaris has evolved a mixed mode of inhibition of endopolygalacturonase PG1 of Botrytis cinerea. Plant Physiology 139: 1380-1388.

Sieber P, Schorderet M, Ryser U, Buchala A, Kolattukudy P, Metraux JP, Nawrath C. 2000. Transgenic Arabidopsis plants expressing a fungal cutinase show alterations in the structure and properties of the cuticle and postgenital organ fusions. Plant Cell 12: 721-737.

Simpson SD, Ashford DA, Harvey DJ, Bowles DJ. 1998. Short chain oligogalacturonides induce ethylene production and expression of the gene encoding aminocyclopropane 1-carboxylic acid oxidase in tomato plants. Glycobiology 8: 579-583.

Smith MA, Davies PJ. 1985. Separation and quantitation of polyamines in plant tissue by high-performance liquid-chromatography of their dansyl derivatives. Plant Physiology 78: 89-91.

Solomon PS, Oliver RP. 2001. The nitrogen content of the tomato leaf apoplast increases during infection by Cladosporium fulvum. Planta 213: 241-249.

Solomon PS, Oliver RP. 2002. Evidence that gamma-aminobutyric acid is a major nitrogen source during Cladosporium fulvum infection of tomato. Planta 214: 414-420.

Solomon PS, Tan KC, Oliver RP. 2003. The nutrient supply of pathogenic fungi; a fertile field for study. Molecular Plant Pathology 4: 203-210.

Sreelakshmi Y, Sharma R. 2008. Differential regulation of phenylalanine ammonia lyase activity and protein level by light in tomato seedlings. Plant Physiology and Biochemistry 46: 444-451.

Staswick PE. 2009. The tryptophan conjugates of jasmonic and indole-3-acetic acids are endogenous auxin inhibitors. Plant Physiology 150: 1310-1321.

Strom A, Williams MAK. 2004. On the separation, detection and quantification of pectin derived oligosaccharides by capillary electrophoresis. Carbohydrate Research 339: 1711-1716.

Studart-Guimaraes C, Fait A, Nunes-Nesi A, Carrari F, Usadel B, Fernie AR. 2007. Reduced expression of succinyl-coenzyme A ligase can be compensated for by up-regulation of the gamma-aminobutyrate shunt in illuminated tomato leaves. Plant Physiology 145: 626-639.

183

Swartzberg D, Kirshner B, Rav-David D, Elad Y, Granot D. 2008. Botrytis cinerea induces senescence and is inhibited by autoregulated expression of the IPT gene. European Journal of Plant Pathology 120: 289-297.

Sweetlove LJ, Heazlewood JL, Herald V, Holtzapffel R, Day DA, Leaver CJ, Millar AH. 2002. The impact of oxidative stress on Arabidopsis mitochondria. Plant Journal 32: 891-904.

Szabados L, Savoure A. 2010. Proline: a multifunctional amino acid. Trends in Plant Science 15: 89-97.

Takeba G. 1984. Inhibition of photosensitive lettuce seed germination by methionine sulfoximine, a specific inhibitor of glutamine synthetase. Plant and Cell Physiology 25: 49-54.

Taler D, Galperin M, Benjamin I, Cohen Y, Kenigsbuch D . 2004. Plant eR genes that encode photorespiratory enzymes confer resistance against disease. Plant Cell 16: 172-184.

Talukder ZI, McDonald AJS, Price AH. 2005. Loci controlling partial resistance to rice blast do not show marked QTL x environment interaction when plant nitrogen status alters disease severity. New Phytologist 168: 455-64.

Tang DZ, Simonich MT, Innes RW. 2007. Mutations in LACS2, a long-chain acyl-coenzyme a synthetase, enhance susceptibility to avirulent Pseudomonas syringae but confer resistance to Botrytis cinerea in Arabidopsis. Plant Physiology 144: 1093-1103.

Tao YH, Yuan Z, Tang XQ, Xu HB, Yang XL. 2006. Inhibition of GABA shunt enzymes' activity by 4-hydroxybenzaldehyde derivatives. Bioorganic & Medicinal Chemistry Letters 16: 592-595.

Tavernier V, Cadiou S, Pageau K, Lauge R, Reisdorf-Cren M, Langin T, Masclaux-Daubresse C. 2007. The plant nitrogen mobilization promoted by Colletotrichum lindemuthianum in Phaseolus leaves depends on fungus pathogenicity. Journal of Experimental Botany 58: 3351-3360.

Taylor IB, Linforth RST, Alnaieb RJ, Bowman WR, Marples BA. 1988. The wilty tomato mutants flacca and sitiens are impaired in the oxidation of ABA-aldehyde to ABA. Plant Cell and Environment 11: 739-745.

Taylor IB, Burbidge A, Thompson AJ. 2000. Control of abscisic acid synthesis. Journal of Experimental Botany 51: 1563-1574.

ten Have A, Mulder W, Visser J, Van Kan JAL. 1998. The endopolygalacturonase gene Bcpg1 is required for full virulence of Botrytis cinerea. Molecular Plant-Microbe Interactions 11: 1009-1016.

ten Have A, Breuil WO, Wubben JP, Visser J, Van Kan JAL. 2001. Botrytis cinerea endopolygalacturonase genes are differentially expressed in various plant tissues. Fungal Genetics and Biology 33: 97-105.

184

Thaler JS, Bostock RM. 2004. Interactions between abscisic-acid-mediated responses and plant resistance to pathogens and insects. Ecology 85: 48-58.

Thomas MD, Langstonunkefer PJ, Uchytil TF, Durbin RD. 1983. Inhibition of glutamine synthetase from pea by tabtoxinine-beta-lactam. Plant Physiology 71: 912-915.

ThordalChristensen H, Zhang ZG, Wei YD, Collinge DB. 1997. Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. Plant Journal 11: 1187-1194.

Tourte C, Manceau C. 1995. A strain of Pseudomonas syringae which does not belong to pathovar phaseolicola produces phaseolotoxin. European Journal of Plant Pathology 101: 483-490.

Trevino MB, O'Connell MA. 1998. Three drought-responsive members of the nonspecific lipid-transfer protein gene family in Lycopersicon pennellii show different developmental patterns of expression. Plant Physiology 116: 1461-1468.

Tsuge T, Harimoto Y, Akimitsu K, Ohtani K, Kodama M, Akagi Y, Egusa M, Yamamoto M, Otani H. 2012. Host-selective toxins produced by the plant pathogenic fungus Alternaria alternata. FEMS Microbiology Reviews 37: 44-66.

Turner JG. 1981. Tabtoxin, produced by Pseudomonas tabaci, decreases Nicotiana tabacum glutamine synthetase in vivo and causes accumulation of ammonia. Physiological Plant Pathology 19: 57-67.

Urbanczyk-Wochniak E, Fernie AR. 2005. Metabolic profiling reveals altered nitrogen nutrient regimes have diverse effects on the metabolism of hydroponically-grown tomato (Solanum lycopersicum) plants. Journal of Experimental Botany 56: 309-321.

Valette-Collet O, Cimerman A, Reignault P, Levis C, Boccara M. 2003. Disruption of Botrytis cinerea pectin methylesterase gene Bcpme1 reduces virulence on several host plants. Molecular Plant-Microbe Interactions 16: 360-367.

Van Baarlen P, Staats M, Van Kan JAL. 2004. Induction of programmed cell death in lily by the fungal pathogen Botrytis elliptica. Molecular Plant Pathology 5: 559-574.

Van Baarlen P, Woltering EJ, Staats M, Van Kan JAL. 2007. Histochemical and genetic analysis of host and non-host interactions of Arabidopsis with three Botrytis species: an important role for cell death control. Molecular Plant Pathology 8: 41-54.

van Doorn WG, Beers EP, Dangl JL, Franklin-Tong VE, Gallois P, Hara-Nishimura I, Jones AM, Kawai-Yamada M, Lam E, Mundy J, Mur LAJ, Petersen M, Smertenko A, Taliansky M, Van Breusegem F, Wolpert T, Woltering E, Zhivotovsky B, Bozhkov PV. 2011. Morphological classification of plant cell deaths. Cell Death and Differentiation 18: 1241-1246.

185

Van Kan JAL. 2006. Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends in Plant Science 11: 247-253.

Vandenackerveken GFJM, Dunn RM, Cozijnsen AJ, Vossen JPMJ, Vandenbroek HWJ, Dewit PJGM. 1994. Nitrogen limitation induces expression of the avirulence gene Avr9 in the tomato pathogen Cladosporium fulvum. Molecular & General Genetics 243: 277-285.

Velasquez AC, Chakravarthy S, Martin GB. 2009. Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. Journal of Visualized Experiments 28: e1292.

Verbruggen N, Hermans C. 2008. Proline accumulation in plants: a review. Amino Acids 35: 753-759.

Vogel JP, Raab TK, Schiff C, Somerville SC. 2002. PMR6, a pectate lyase-like gene required for powdery mildew susceptibility in Arabidopsis. Plant Cell 14: 2095-2106.

Vongonner M, Schlosser E. 1993. Oxidative Stress in Interactions Between Avena-Sativa l and Drechslera Spp. Physiological and Molecular Plant Pathology 42: 221-234.

Wallace W, Secor J, Schrader LE. 1984. Rapid accumulation of gamma-amino butyric acid and alanine in soybean leaves in response to an abrupt transfer to lower temperature, darkness, or mechanical manipulation. Plant physiology 75:170-175.

Walters DR. 2003. Polyamines and plant disease. Phytochemistry 64: 97-107.

Walters DR, McRoberts N. 2006. Plants and biotrophs: a pivotal role for cytokinins? Trends in Plant Science 11: 581-586.

Walters DR, McRoberts N, Fitt BDL. 2008. Are green islands red herrings? Significance of green islands in plant interactions with pathogens and pests. Biological Reviews 83: 79-102.

Wang CL, Chin CK, Gianfagna T. 2000. Relationship between cutin monomers and tomato resistance to powdery mildew infection. Physiological and Molecular Plant Pathology 57: 55-61.

Wang H, Liu D, Sun J, Zhang A. 2005. Asparagine synthetase gene TaASN1 from wheat is up-regulated by salt stress, osmotic stress and ABA. Journal of Plant Physiology 162: 81-89.

Ward JL, Forcat S, Beckmann M, Bennett M, Miller SJ, Baker JM, Hawkins ND, Vermeer CP, Lu CA, Lin WC, Truman WM, Beale MH, Draper J, Mansfield JW, Grant M. 2010. The metabolic transition during disease following infection of Arabidopsis thaliana by Pseudomonas syringae pv. tomato. Plant Journal 63: 443-457.

Williams MAK, Foster TJ, Schols HA. 2003. Elucidation of pectin methylester distributions by capillary electrophoresis. Journal of Agricultural and Food Chemistry 51: 1777-1781.

186

Williamson B, Tudzynsk B, Tudzynski P, Van Kan JAL. 2007. Botrytis cinerea: the cause of grey mould disease. Molecular Plant Pathology 8: 561-580.

Wolf S, Mouille G, Pelloux J. 2009. Homogalacturonan methyl-esterification and plant development. Molecular Plant 2: 851-860.

Woloshuk CP, Kolattukudy PE. 1986. Mechanism by which contact with plant cuticle triggers cutinase gene-expression in the spores of Fusarium solani f. sp. Pisi. Proceedings of the National Academy of Sciences of the United States of America 83: 1704-1708.

Wolpert TJ, Dunkle LD, Ciuffetti LM. 2002. Host-selective toxins and avirulence determinants: What's in a name? Annual Review of Phytopathology 40: 251-285.

Wu CX, Zhou SY, Zhang Q, Zhao WS, Peng YL. 2006. Molecular cloning and differential expression of an gamma-aminobutyrate transaminase gene, OsGABA-T, in rice (Oryza sativa) leaves infected with blast fungus. Journal of Plant Research 119: 663-669.

Xiao FM, Goodwin SM, Xiao YM, Sun ZY, Baker D, Tang XY, Jenks MA, Zhou JM. 2004. Arabidopsis CYP86A2 represses Pseudomonas syringae type III genes and is required for cuticle development. Embo Journal 23: 2903-2913.

Yephremov A, Wisman E, Huijser P, Huijser C, Wellesen K, Saedler H. 1999. Characterization of the FIDDLEHEAD gene of Arabidopsis reveals a link between adhesion response and cell differentiation in the epidermis. Plant Cell 11: 2187-2201.

Zeier J, Delledonne M, Mishina T, Sever E, Sonoda M, Lamb C. 2004. Genetic elucidation of nitric oxide signaling in incompatible plant-pathogen interactions. Plant Physiology 136: 2875-2885.

Zheng Y, Sheng JP, Zhao RR, Zhang J, Lv SN, Liu LY, Shen L. 2011. Preharvest L-arginine treatment induced postharvest disease resistance to Botrysis cinerea in tomato fruits. Journal of Agricultural and Food Chemistry 59: 6543-6549.

Zimmermann P, Hennig L, Gruissem W. 2005. Gene-expression analysis and network discovery using Genevestigator. Trends in Plant Science 10: 407-409.

Zurbriggen MD, Carrillo N, Hajirezaei MR. 2010. ROS signaling in the hypersensitive response: when, where and what for? Plant Signal & Behavior 5: 393-396.

187

188

189

Curriculum Vitae Hamed (Soren) Seifi

Address: Belvedereweg 169, Gent (9000), Belgium Email: Hamed.Seifi@UGent.be Cell phone: +32488589919 Place of birth: Arak, Iran

Education

2008 - 2013

PhD candidate of Applied Biological Sciences (Molecular Plant Pathology), Ghent University, Faculty of Bioscience Engineering1, Gent, Belgium PhD thesis: “Key roles of glutamate metabolism and cuticle permeability in the multifaceted defense response of the abscisic acid deficient sitiens tomato mutant against Botrytis cinerea”; Supervisor: Prof. Monica Höfte

2004 - 2007

Master of Science: Agricultural Biotechnology, Faculty of Agriculture and Natural Resources, Tehran University2, Iran Thesis title: “Study of the effect of medium components, explants and hormone levels on the callogenesis, regeneration and suspension culture of the medicinal plant: Teucrium polium”; Supervisor: Prof. Mansoor Omidi

1998 - 2002

Bachelor of Science: Agricultural Engineering - Plant Protection, Faculty of Agriculture and Natural Resources, Tehran University, Iran

1991 - 1998

High School Diploma (Experimental Sciences): Graduated from NODET3 "National Organization for Development of Exceptional Talents", Arak, Iran

Some extra trainings (certified)

Plant-Microbe interactions, Doctoral School of Ghent University, 2011 Advanced Light Microscopy (including confocal and fluorescence microscopy), Summer school at

the Flemish Institute of Biotechnology (VIB), Ghent, Belgium 2010 Bioinformatics and Genome Biology, Doctoral School of Ghent University, 2010 Advanced Academic Writing Skills, Doctoral School of Ghent University, 2010

190

Conference Skills and Effective Scientific Communication, Doctoral school of Ghent University, 2010

Research Methodology, Doctoral School of Ghent University, Belgium, 2009 Genetics and Molecular Biology of Aquatic Organisms (an international workshop supervised by

“Laboratory of Aquaculture & Artemia Reference Center”, Ghent University), Urmiah University, Iran, 2006

Medicinal Plants, Uses and Applications (Including these topics: G.C Mass and HPLC analyses, Production and Maintenance, Methods of Extraction of secondary metabolites). Tehran University, Iran, 2005

Publications

Paper

Seifi, HS., Curvers, K., De Vleesschaurwer, D., Delarae, I., Aziz, A., Höfte, M. Concurrent over-activation of the cytosolic glutamine synthetase and the GABA-shunt in the abscisic acid deficient sitiens mutant of tomato leads to resistance against Botrytis cinerea. New Phytologist, in press.

Seifi, HS., Van Bockhaven, J., Angenon, G., Höfte, M. Glutamate metabolism in plant disease and defense: friend or foe? Molecular Plant-Microbe Interactions, May 2013, Vol. 26, No. 5, pp. 475-485

Curvers, K., Seifi, HS., Höfte, M. et al. Changes in cuticle and pectin composition caused by ABA-deficiency play a role in tomato resistance against Botrytis cinerea. Plant Physiology, October 2010, Vol. 154, pp. 847–860

Azami Sardooi, Z., Seifi, HS., De Vleesschaurwer, D., Höfte, M. Benzothiadiazole (BTH) induced resistance against Botrytis cinerea is inversely correlated with plant growth and development in bean and cucumber, but not in tomato. Australasian Plant Pathology, March 2013, DOI 10.1007/s13313-013-0207-1

Book

Yazdani, D., Shahnazi S., Seifi, H. Cultivation of Medical Plants. Applied guide for cultivation of 40 important medical plants in Iran, 2004, J.Daneshgahi Pub., Tehran, Iran

Symposia & conferences

Oral presentation

Seifi, H., Höfte, M. The role of amino acid metabolism in the resistance mechanism of sitiens, an abscisic acid deficient tomato mutant, against Botrytis cinerea, Botrytis-Sclerotinia post-genome workshop, Lyon-France, Sep. 2011

Seifi, H., Höfte, M. Multifaceted defense mechanism in sitiens, an abscisic acid deficient tomato mutant, against the necrotrophic fungus Botrytis cinerea. 63rd International Symposium on Crop Protection (ISCP), Ghent University, Belgium, May 2011

191

Seifi, H., Höfte, M. Plant’s amino acid metabolism vis-à-vis pathogen’s virulence strategy: the case study of tomato-Botrytis cinerea interactoion. 64rd International Symposium on Crop Protection (ISCP), Ghent University, Belgium, May 2012

Poster presentation

Seifi, H., Curvers, K., Van Breusegem, F., & Höfte, M. Role of photorespiration in the defense mechanism of sitiens, an abscisic acid-deficient tomato mutant, against the necrotrophic pathogen Botrytis cinerea. 62nd Ineternational Symposium on Crop Protection (ISCP),Ghent University, Belgium, 2009

Seifi, H., Curvers, K., Cabrera, J.C., Van Cutsem, P., Van Breusegem, F., & Höfte, M. The role of cuticle permeability in the defence response of sitiens, an abscisic acid deficient tomato mutant, against the necrotrophic pathogen Botrytis cinerea. XV international Botrytis symposium, Cadiz, Spain, 2010 (awarded abstract).

Accepted abstract

Seifi, H., Omidi, M. "Study of the effect of medium component, explant and hormone level on callogenesis, regeneration of Teucrium polium", Asia Pacific Conference on Plant Tissue Culture, Kuala Lumpur, Malaysia, 2007 (fellowship awarded)

Seifi, H., Omidi, M. "Study of the effect of medium components, explant and hormones on callogenesis, regeneration and cell suspension culture of Teucrium polium", Plant Canada Conference - Saskatoon, Canada, 2007

Awards and honors

Awarded PhD scholarship, Phytopathology Lab., Ghent University, March 2008 Awarded as "Excellent Student", Tehran University, Faculty of Agriculture and Natural Resources,

2006 (for the 3rd semester of M.Sc). Rank 6 (among about 13000 participants) in the nationwide graduate schools entrance contest in

Iran, qualified for Master of Agricultural Biotechnology, Tehran University, 2004 Earned Internet Based TOEFL score of 104/120 (2007), IELTS overall band score of 7.5/9 (2011) Awarded the 1st prize of "Research and Investigation Contest for High school Students", Iran, 1998 Awarded for championship of "Volleyball league of Students", Tehran University, Iran 2006. Selected for the Ghent University mixed volleyball team for the 18th European youth sport

tournament, Hamburg, Germany, June 2011; and the Jeux Nationaux du Sport d'Entreprise 2012 - Pays de Saint-Omer, France, May 2012.

1- http://www.fbw.ugent.be/research/crop_protection.php

2- http://utcan.ut.ac.ir/en/index.aspx

3- http://en.wikipedia.org/wiki/National_Organization_for_Development_of_Exceptional_Talents