Upload
filabert-schillo
View
107
Download
3
Embed Size (px)
Citation preview
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 1
V3 - Multiples Sequenz Alignment und Phylogenie
Literatur: Kapitel 4 in Buch von David Mount
Thioredoxin-Beispiel heute aus Buch von Arthur Lesk
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 2
• Homologie: Ähnlichkeit, die durch
Abstammung von einem gemeinsamen
Ursprungsgen herrührt –
die Identifizierung und Analyse von
Homologien ist eine zentrale Aufgabe
der Phylogenie.
• Ein Alignment ist eine Hypothese
für die positionelle Homologie
zwischen Basenpaaren bzw.
Aminosäuren.
Definition von “Homologie”
http://www.cellsignal.com
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 3
Einfach
Schwierig wegen Insertionen und Deletionen (indels)
Alignments können einfach oder schwer sein
GCGGCCCA TCAGGTACTT GGTGGGCGGCCCA TCAGGTAGTT GGTGGGCGTTCCA TCAGCTGGTT GGTGGGCGTCCCA TCAGCTAGTT GGTGGGCGGCGCA TTAGCTAGTT GGTGA******** ********** *****
TTGACATG CCGGGG---A AACCGTTGACATG CCGGTG--GT AAGCCTTGACATG -CTAGG---A ACGCGTTGACATG -CTAGGGAAC ACGCGTTGACATC -CTCTG---A ACGCG******** ?????????? *****
Kann man beweisen, dass ein Alignment korrekt ist?
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 4
Homo sapiens DjlA protein
Escherichia coli DjlA protein
Protein-Alignment kann durch tertiäre Strukturinformationen geführt werden
nur so kann man letztlich bewerten, ob ein Sequenzalignment korrekt ist.Beweisen im strikten Sinne kann man dies nie.
Gaps einesAlignmentssolltenvorwiegendin Loops liegen, nichtin Sekundär-struktur-elementen.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 5
MSA für Thioredoxin-FamilieFarbe Aminosäuretyp Aminosäurengelb klein, wenig polar Gly, Ala, Ser, Thrgrün hydrophob Cys, Val, Ile, Leu
Pro, Phe, Tyr, Met, Trpviolett polar Asn, Gln, Hisrot negativ geladen Asp, Glublau positiv geladen Lys, Arg
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 6
Infos aus MSA von Thioredoxin-Familie
Thioredoxin: aus 5 beta-Strängen bestehendes beta-Faltblatt, das auf beiden Seiten von alpha-Helices flankiert ist.
gemeinsamer Mechanismus: Reduktion von Disulfidbrücken in Proteinen
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 7
Infos aus MSA von Thioredoxin-Familie
1) Die am stärksten konservierten Abschnitte entsprechen wahrscheinlich dem
aktiven Zentrum. Disulfidbrücke zwischen Cys32 und Cys35 gehört zu dem
konservierten WCGPC[K oder R] Motiv. Andere konservierte Sequenzabschnitte,
z.B. Pro76Thr77 und Gly92Gly93 sind an der Substratbindung beteiligt.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 8
Infos aus MSA von Thioredoxin-Familie
2) Abschnitte mit vielen Insertionen und Deletionen entsprechen vermutlich
Schleifen an der Oberfläche. Eine Position mit einem konservierten Gly oder
Pro lässt auf eine Wendung der Kette (‚turn‘) schließen.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 9
Infos aus MSA von Thioredoxin-Familie3) Ein konserviertes Muster hydrophober Bausteine mit dem Abstand 2 (d.h.,
an jeder zweiten Position), bei dem die dazwischenliegenden Bausteine
vielfältiger sind und auch hydrophil sein können, läßt auf ein -Faltblatt an der
Moleküloberfläche schließen.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 10
Infos aus MSA von Thioredoxin-Familie
4) Ein konserviertes Muster hydrophober Aminosäurereste mit dem Abstand
von ungefähr 4 läßt auf eine -Helix schließen.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 11
Infos aus MSA von Thioredoxin-Familie
Die Thioredoxine sind Teil einer Superfamilie, zu der auch viele weiter entfernte
homologe Protein gehören,
z.B. Glutaredoxin (Wasserstoffdonor für die Reduktion von Ribonukleotiden bei
der DNA-Synthese)
Protein-Disulfidisomerase (katalysiert bei der Proteinfaltung den Austausch
falsch gefalteter Disulfidbrücken)
Phosducin (Regulator in G-Protein-abhängigen Signalübertragungswegen)
Glutathion-S-Transferasen (Proteine der chemischen Abwehr).
Die Tabelle des MSAs für Thioredoxinsequenzen enthält implizit Muster,
die man zur Identifizierung dieser entfernteren Verwandten nutzen kann.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 12
Es gibt im wesentlichen 3 unterschiedliche Vorgehensweisen:
(1) Manuell
ein manuelles Alignment bietet sich an falls
• Alignment einfach ist.
• es zusätzliche (strukturelle) Information gibt
• automatische Alignment –Methoden in lokalen Minima feststecken.
• ein automatisch erzeugtes Alignment manuell “verbessert” werden kann.
(2) Automatisch
(3) Kombiniert
Multiples Sequenz-Alignment - Methoden
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 13
Hier gibt es vor allem folgende 2 wichtigen Methoden:
• Dynamische Programmierung
– liefert garantiert das optimale Alignment!
– aber: betrache 2 Proteinsequenzen von 100 Aminosäuren Länge.
wenn es 1002 Sekunden dauert, diese beiden Sequenzen erschöpfend
zu alignieren, dann wird es
1003 Sekunden dauern um 3 Sequenzen zu alignieren,
1004 Sekunden für 4 Sequenzen und
1.90258x1034 Jahre für 20 Sequenzen.
• Progressives Alignment
Automatisches multiples Sequenzalignment
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 14
berechne zunächst paarweise Alignments
für 3 Sequenzen wird Würfel aufgespannt:
D.h. dynamische Programmierung hat nun Komplexität n1 * n2 * n3mit den Sequenzlängen n1, n2, n3.
Sehr aufwändig! Versuche, Suchraum einzuschränken und nur einen kleinenTeil des Würfels abzusuchen.
dynamische Programmierung mit MSA Programm
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 15
• wurde von Feng & Doolittle 1987 vorgestellt
• ist eine heuristische Methode.
Daher ist nicht garantiert, das “optimale” Alignment zu finden.
• benötigt (n-1) + (n-2) + (n-3) ... (n-n+1) paarweise Sequenzalignments als
Ausgangspunkt.
• weitverbreitete Implementation in Clustal (Des Higgins)
• ClustalW ist eine neuere Version, in der den Parameter für Sequenzen und
Programm Gewichte (weights) zugeteilt werden.
Progressives Alignment
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 16
• Berechne alle möglichen paarweisen Alignments von Sequenzpaaren.
Es gibt (n-1)+(n-2)...(n-n+1) Möglichkeiten.
• Berechne aus diesen isolierten paarweisen Alignments den “Abstand”
zwischen jedem Sequenzpaar.
• Erstelle eine Abstandsmatrix.
• aus den paarweisen Distanzen wird ein Nachbarschafts-Baum erstellt
• Dieser Baum gibt die Reihenfolge an, in der das progressive Alignment
ausgeführt werden wird.
ClustalW- Paarweise Alignments
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 17
Schnelle paarweise Alignments:
berechne Matrix der Abstände
1 PEEKSAVTALWGKVN--VDEVGG2 GEEKAAVLALWDKVN--EEEVGG3 PADKTNVKAAWGKVGAHAGEYGA4 AADKTNVKAAWSKVGGHAGEYGA5 EHEWQLVLHVWAKVEADVAGHGQ
Hbb_Human 1 -Hbb_Horse 2 .17 -Hba_Human 3 .59 .60 -Hba_Horse 4 .59 .59 .13 -Myg_Whale 5 .77 .77 .75 .75 -
Hbb_Human
Hbb_Horse
Hba_Horse
Hba_Human
Myg_Whale
2
1
3 4
2
1
3 4
alpha-helices
Nachbar-Verbindungs-
Baumdiagramm
progressive Alignments
entsprechend dem
Baumdiagramm
CLUSTAL W
Überblick der ClustalW Prozedur
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 18
• aligniere die beiden ähnlichsten Sequenzen zuerst.
• dieses Alignment ist dann “fest” und wird nicht mehr angetastet.
Falls später ein GAP eingeführt werden muss, wird er in beiden
Sequenzen an der gleichen Stelle eingeführt.
• Deren relatives Alignment bleibt unverändert.
Multiples Alignment - Erstes Paar
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 19
Ziehe den Baum heran um festzulegen, welches Alignment als nächstes
durchgeführt werden soll:
– aligniere eine dritte Sequenz zu den ersten beiden
oder
– aligniere zwei total verschiedene Sequenzen miteinander.
Option 1Option 1 Option 2Option 2
Clustal W – Zeit der Entscheidung
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 20
Wenn beim Alignment einer dritten Sequenz mit
den ersten beiden eine Lücke eingefügt werden
muss um das Alignment zu verbessern, werden
beide als Einzelsequenzen betrachtet.
+
ClustalW- 2 Alternativen
+Falls, andererseits, zwei getrennte Sequenzen
aligniert werden müssen, werden diese zunächst
miteinander aligniert.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 21
gctcgatacgatacgatgactagctagctcgatacaagacgatgacagctagctcgatacacgatgactagctagctcgatacacgatgacgagcgactcgaacgatacgatgactagct
gctcgatacgatacgatgactagctagctcgatacaagacgatgac-agcta
Progressives Alignment – 1. Schritt
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 22
gctcgatacgatacgatgactagctagctcgatacaagacgatgacagctagctcgatacacgatgactagctagctcgatacacgatgacgagcgactcgaacgatacgatgactagct
gctcgatacacgatgactagctagctcgatacacgatgacgagcga
Progressives Alignment – 2. Schritt
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 23
gctcgatacgatacgatgactagctagctcgatacaagacgatgac-agcta+gctcgatacacgatgactagctagctcgatacacgatgacgagcga
gctcgatacgatacgatgactagctagctcgatacaagacgatgac-agctagctcgatacacga---tgactagctagctcgatacacga---tgacgagcga
Progressives Alignment – 3. Schritt
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 24
gctcgatacgatacgatgactagctagctcgatacaagacgatgac-agctagctcgatacacga---tgactagctagctcgatacacga---tgacgagcga+ctcgaacgatacgatgactagct
gctcgatacgatacgatgactagctagctcgatacaagacgatgac-agctagctcgatacacga---tgactagctagctcgatacacga---tgacgagcga-ctcga-acgatacgatgactagct-
Progressives Alignment – letzter Schritt
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 25
Vorteil:
– Geschwindigkeit.
Nachteile:
– keine objektive Funktion.
– Keine Möglichkeit zu quantifizieren ob Alignment gut oder schlecht ist
(vgl. E-value für BLAST)
– Keine Möglichkeit festzustellen, ob das Alignment “korrekt” ist
Mögliche Probleme:
– Prozedur kann in ein lokales Minimum geraten.
D.h. falls zu einem frühen Zeitpunkt ein Fehler im Alignment eingebaut
wird, kann dieser später nicht mehr korrigiert werden.
– Zufälliges Alignment.
ClustalW- Vor- und Nachteile
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 26
• Sollen all Sequenzen gleich behandelt werden?
Obwohl manche Sequenzen eng verwandt und andere entfernt
verwandt sind?
• Sollen alle Positionen der Sequenzen gleich behandelt werden?
Obwohl sie unterschiedliche Funktionen und Positionen in der
dreidimensionalen Strukturen haben können?
Genauigkeit des Alignments verbessern
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 27
• Sequenzgewichtung
• Variable Substitutionsmatrizen
• Residuen-spezifische Gap-Penalties und verringerte Penalties in hydrophilen
Regionen (externe Regionen von Proteinsequenzen), bevorzugt Gaps in
Loops anstatt im Proteinkern.
• Positionen in frühen Alignments, an denen Gaps geöffnet wurden, erhalten
lokal reduzierte Gap Penalties um in späteren Alignments Gaps an den
gleichen Stellen zu bevorzugen
ClustalW- Besonderheiten
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 28
• Zwei Parameter sind festzulegen (es gibt Default-Werte, aber man sollte
sich bewusst sein, dass diese abgeändert werden können):
• Die GOP- Gap Opening Penalty ist aufzubringen um eine Lücke in
einem Alignment zu erzeugen
• Die GEP- Gap Extension Penalty ist aufzubringen um diese Lücke um
eine Position zu verlängern.
ClustalW- vom Benutzer festzulegende Parameter
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 29
• Bevor irgendein Sequenzpaar aligniert wird, wird eine Tabelle von GOPs
erstellt für jede Position der beiden Sequenzen.
• Die GOP werden positions-spezifisch behandelt und können über die
Sequenzlänge variieren.
• Falls ein GAP an einer Position existiert, werden die GOP und GEP
penalties herabgesetzt – und alle anderen Regeln treffen nicht zu.
• Daher wird die Bildung von Gaps an Positionen wahrscheinlicher, an
denen bereits Gaps existieren.
Positions-spezifische Gap penalties
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 30
• Solange kein GAP offen ist, wird GOP hochgesetzt falls die Position
innerhalb von 8 Residuen von einem bestehenden Gap liegt.
• Dadurch werden Gaps vermieden, die zu eng beieinander liegen.
• An jeder Position innerhalb einer Reihe von hydrophilen Residuen wird GOP
herabgesetzt, da diese gewöhnlich in Loop-Regionen von Proteinstrukturen
liegen.
• Eine Reihe von 5 hydrophilen Residuen gilt als hydrophiler stretch.
• Die üblichen hydrophilen Residuen sind:
D Asp K Lys P Pro
E Glu N Asn R Arg
G Gly Q Gln S Ser
Dies kann durch den Benutzer geändert werden.
Vermeide zu viele Gaps
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 31
• Progressives Alignment ist ein mathematischer Vorgang, der völlig unabhängig von
der biologischen Realität abläuft.
• Es kann eine sehr gute Abschätzung sein.
• Es kann eine unglaublich schlechte Abschätzung sein.
• Erfordert Input und Erfahrung des Benutzers.
• Sollte mit Vorsicht verwendet werden.
• Kann (gewöhnlich) manuell verbessert werden.
• Es hilft oft, farbliche Darstellungen zu wählen.
• Je nach Einsatzgebiet sollte der Benutzer in der Lage sein, die zuverlässigen
Regionen des Alignments zu beurteilen.
• Für phylogenetische Rekonstruktionen sollte man nur die Positionen verwenden, für
die eine zweifelsfreie Hypothese über positionelle Homologie vorliegt.
Tips für progressives Alignment
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 32
• Es macht wenig Sinn, proteinkodierende DNS-Abschnitte
zu alignieren!
ATGCTGTTAGGGATGCTCGTAGGG
ATGCT-GTTAGGGATGCTCGT-AGGG
Das Ergebnis kann sehr unplausibel sein und entspricht eventuell nicht dem
biologischen Prozess.
Es ist viel sinnvoller, die Sequenzen in die entsprechenden Proteinsequenzen
zu übersetzen, diese zu alignieren und dann in den DNS-Sequenzen an den
Stellen Gaps einzufügen, an denen sie im Aminosäure-Alignment zu finden
sind.
Alignment von Protein-kodierenden DNS-Sequenzen
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 33
Progressive Alignments sind die am weitesten verbreitete Methode für
multiple Sequenzalignments.
Sehr sensitive Methode ebenfalls: Hidden Markov Modelle (HMMer)
Multiples Sequenzalignment ist nicht trivial. Manuelle Nacharbeit kann in
Einzelfällen das Alignment verbessern.
Multiples Sequenzalignment erlaubt Denken in Proteinfamilien und –
funktionen.
Zusammenfassung
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 34
Prediction of Phylogenies based on single genes
Material of this lecture taken from
- chapter 6, DW Mount „Bioinformatics“
and from Julian Felsenstein‘s book.
A phylogenetic analysis of a family of related
nucleic acid or protein sequences is a determination
of how the family might have been derived during
evolution.
Placing the sequences as outer branches on a tree,
the evolutionary relationships among the sequences
are depicted.
Phylogenies, or evolutionary trees, are the basic structures to describe
differences between species, and to analyze them statistically.
They have been around for over 140 years.
Statistical, computational, and algorithmic work on them is ca. 40 years old.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 35
3 main approaches in single-gene phylogeny
- maximum parsimony
- distance matrix
- maximum likelihood (not covered here)
Popular programs:
PHYLIP (phylogenetic inference package – J Felsenstein)
PAUP (phylogenetic analysis using parsimony – Sinauer Assoc
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 36
Parsimony methods
Edwards & Cavalli-Sforza (1963): that evolutionary tree is to be preferred that
involves „the minimum net amount of evolution“.
seek that phylogeny on which, when we reconstruct the evolutionary events
leading to our data, there are as few events as possible.
(1) We must be able to make a reconstruction of events, involving as few events
as possible, for any proposed phylogeny.
(2) We must be able to search among all possible phylogenies for the one or
ones that minimize the number of events.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 37
A simple example
Suppose that we have 5 species,
each of which has been scored for 6 characters (0,1)
We will allow changes 0 1 and 1 0.
The initial state at the root of a tree may be either state 0 or state 1.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 38
Evaluating a particular tree
To find the most parsimonious tree, we must have a way of calculating how many
changes of state are needed on a given tree.
This tree represents the phylogeny of character 1.
Reconstruct phylogeny of character 1 on this tree.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 39
Evaluating a particular tree
There are 2 equally good reconstructions,
each involving just one change of character state.
They differ in which state they assume at the root of the tree,
and they differ in which branch they place the single change.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 40
Evaluating a particular tree
3 equally good reconstructions for character 2, which needs two changes of state.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 41
Evaluating a particular tree
A single reconstruction for character 3, involving one change of state.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 42
on the right: 2 reconstructions for character 4 and 5 because these characters have
identical patterns.
single reconstruction for character 6,
one change of state.
Evaluating a particular tree
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 43
Evaluating a particular tree
The total number of changes of character state needed on this tree is
1 + 2 + 1 + 2 + 2 + 1 = 9
Reconstruction of the changes in state on this tree
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 44
Evaluating a particular tree
Alternative tree with only 8 changes of state.
The minimum number of changes of state would be 6, as there are 6 characters that
can each have 2 states.
Thus, we have two „extra“ changes called „homoplasmy“.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 45
Finding the best tree by heuristic search
The obvious method for searching for the most parsimonious tree is to consider ALL
trees and evaluate each one.
Unfortunately, generally the number of possible trees is too large.
use heuristic search methods that attempt to find the best trees without looking at
all possible trees.
(1) Make an initial estimate of the tree and make small rearrangements of it
= find „neighboring“ trees.
(2) If any of these neighbors are better, consider them and continue search.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 46
Counting evolutionary changes
2 related dynamic programming algorithms: Fitch (1971) and Sankoff (1975)
- evaluate a phylogeny character by character
- for each character, consider it as rooted tree, placing the root wherever seems
appropriate.
- update some information down a tree; when we reach the bottom, the number of
changes of state is available.
Do not actually locate changes or reconstruct interior states at the nodes of the tree.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 47
Sankoff algorithm
If we can compute these values for all nodes,
we can also compute them for the bottom node in the tree.
Simply choose the minimum of these values
which is the desired total cost we seek, the minimum cost of evolution for this
character.
At the tips of the tree, the S(i) are easy to compute. The cost is 0 if the observed
state is state i, and infinite otherwise.
If we have observed an ambigous state, the cost is 0 for all states that it could be,
and infinite for the rest.
Now we just need an algorithm to calculate the S(i) for the immediate common
ancestor of two nodes.
iSSi
0min
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 48
Sankoff algorithm
Suppose that the two descendant nodes are called l and r (for „left“ and „right“).
For their immediate common ancestor, node a, we compute
kScjSciS rikk
lijj
a minmin
The smallest possible cost given that node a is in state i is the cost cij of going from
state i to state j in the left descendant lineage, plus the cost Sl(j) of events further up
in the subtree gien that node l is in state j. Select value of j that minimizes that sum.
Same calculation for right descendant lineage sum of these two minima is the
smallest possible cost for the subtree above node a, given that node a is in state i.
Apply equation successively to each node in the tree, working downwards.
Finally compute all S0(i) and use previous eq. to find minimum cost for whole tree.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 49
Sankoff algorithm
The array (6,6,7,8) at the bottom of the tree has a minimum value of 6
= minimum total cost of the tree for this site.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 50
Distance matrix methods
introduced by Cavalli-Sforza & Edwards (1967)
and by Fitch & Margoliash (1967)
general idea „seems as if it would not work very well“ (Felsenstein):
- calculate a measure of the distance between each pair of species
- find a tree that predicts the observed set of distances as closely as possible.
All information from higher-order combinations of character states is left out.
But computer simulation studies show that the amount of lost information is
remarkably small.
Best way to think about distance matrix methods:
consider distances as estimates of the branch length separating that pair of
species.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 51
Least square method
- observed table (matrix) of distances Dij
- any particular tree leads to a predicted set of distances dij.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 52
Least square method
Measure of the discrepancy between the observed and expected distances:
n
i
n
jijijij dDwQ
1 1
2
where the weights wij can be differently defined:
- wij = 1 (Cavalli&Sforza, 1967)
- wij = 1/Dij2 (Fitch&Margoliash, 1967)
- wij = 1/Dij (Beyer et al., 1974)
Aim: Find tree topology and branch lengths that minimize Q.
Equation above is quadratic in branch lengths.
Take derivative with respect to branch lengths, set = 0,
and solve system of linear equations. Solution will minimize Q.
Doug Brutlag‘s course
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 53
Least square method
Number all branches of the tree and introduce an indicator variable xijk:
xijk = 1 if branch k lies in the path from species i to species j
xijk = 0 otherwise.
The expected distance between i and j will then be
and
For the case with wij = 1 ij.
Note: these are k equations for each of the k branches.
k
kkijji vxd ,,
n
i ij kkkijijij vxDwQ
1
2
,
n
i ij kkkijijkijij
k
vxDxwdv
dQ
1,, 02
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 54
neighbor-joining method
introduced by Saitou and Nei (1987) – algorithm works by clustering - does not
assume a molecular clock but approximates the „minimum evolution“ model.
„Minimum evolution“ model:
among possible tree topologies, choose the one with minimal total branch length.
Neighbor-joining, as the least-squares method, is guaranteed to recover the true
tree if the distance matrix is an exact reflection of the tree.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 55
neighbor-joining method
(1) For each tip, compute
(2) Choose the i and j for which Dij – ui – uj is smallest.
(3) Join items i and j. Compute the branch length
from i to the new node (vi) and from j to the new
node (vj) as
(4) Compute distance between the new node (ij) and each of the remaining tips as
(5) Delete tips i and j from the tables and replace them by the new node, (ij), which
is now treated as a tip.
(6) If more than 2 nodes remain, go back to step (1). Otherwise, connect the two
remaining nodes (e.g. l and m) by a branch of length Dlm.
n
ij
iji n
Du
2
ijijj
jiiji
uuDv
uuDv
2
1
2
12
1
2
1
2,ijjkik
kij
DDDD
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 56
Methoden für Einzel-Gen-Phylogenien
Wähle Menge von
verwandten
Sequenzen
Berechne
multiples
Sequenz-
alignment
Gibt es
starke
Sequenz-
ähnlichkeit?
Maximale
Parsimonie
Methoden
Ja
Nein
Gibt es deutlich erkenn-
bare Sequenzähnlichkeit?
JaDistanz-
methoden
Nein
Maximum likelihood
Methoden
Analysiere wie
gut die Daten die
Vorhersage
unterstützen
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 57
zusätzliche Folien
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 58
GDE- The Genetic Data Environment (UNIX)
CINEMA- Java applet available from:
– http://www.biochem.ucl.ac.uk
Seqapp/Seqpup- Mac/PC/UNIX available from:
– http://iubio.bio.indiana.edu
SeAl for Macintosh, available from:
– http://evolve.zoo.ox.ac.uk/Se-Al/Se-Al.html
BioEdit for PC, available from:
– http://www.mbio.ncsu.edu/RNaseP/info/programs/BIOEDIT/bioedit.html
Software für manuelle Alignments
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 59
Sequenz: MGGRSSCEDP GCPRDEERAP RMGCMKSKFL QVGGNTFSKT ETSASPHCPVYVPDPTSTIK PGPNSHNSNT PGIREAGSED IIVVALYDYE AIHHEDLSFQKGDQMVVLEE SGEWWKARSL ATRKEGYIPS NYVARVDSLE TEEWFFKGISRKDAERQLLA PGNMLGSFMI RDSETTKGSY SLSVRDYDPR QGDTVKHYKIRTLDNGGFYI SPRSTFSTLQ ELVDHYKKGN DGLCQKLSVP CMSSKPQKPWEKDAWEIPRE SLKLEKKLGA GQFGEVWMAT YNKHTKVAVK TMKPGSMSVEAFLAEANVMK TLQHDKLVKL HAVVTKEPIY IITEFMAKGS LLDFLKSDEGSKQPLPKLID FSAQIAEGMA FIEQRNYIHR DLRAANILVS ASLVCKIADFGLARVIEDNE YTAREGAKFP IKWTAPEAIN FGSFTIKSDV WSFGILLMEIVTYGRIPYPG MSNPEVIRAL ERGYRMPRPE NCPEELYNIM MRCWKNRPEERPTFEYIQSV LDDFYTATES QYQQQP
SMART ergibt:
Beispiel: Src-Kinase HcK
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 60
Kinase-Einheit
Beispiel: Src-Kinase HcK
Protein Data Bankhttp://www.rcsb.org1ATP
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 61
SH3 Domäne
Src homology 3 (SH3) Domänen binden an Zielproteine mit Sequenzen, die Proline
und hydrophobe Aminosäuren enthalten. Pro-enthaltende Polypeptide können an
SH3 in zwei verschiedenen Orientierungen binden. SH3 Domänen sind kleine
Proteinmodule von ungefähr 50 Residuen Länge. Man findet sie in vielen
intrazellulären oder Membran-assoziierten Proteinen …
Beispiel: Src-Kinase HcK
CATH: 1abo
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 62
SH2 Domäne
Die Src homology 2 (SH2) Domäne ist eine Proteindomäne mit etwa 100
Aminosäuren. SH2 Domänen funktionieren als Regelmodule von intrazellulären
Signalkaskaden indem sie mit grosser Affinität an Phospho-Tyrosin enthaltende
Peptide binden. SH2 Domänen findet man oft zusammen mit SH3 Domänen …
Ihre Struktur ist alpha+beta …
Beispiel: Src-Kinase HcK
CATH: 1g83 1fbz 1aot
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 63http://jkweb.berkeley.edu/
Beispiel: Src-Kinase HcK
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 64
http://www.cellsignal.com
Was kann man mit modularem Denken erreichen?
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 65
Least square method
DAB + DAC + DAD + DAE = 4v1 + v2 + v3 + v4 + v5 + 2v6 + 2v7
DAB + DBC + DBD + DBE = v1 + 4v2 + v3 + v4 + v5 + 2v6 + 3v7
DAC + DBC + DCD + DCE = v1 + v2 + 4v3 + v4 + v5 + 3v6 + 2v7
DAD + DBD + DCD + DDE = v1 + v2 + v3 + 4v4 + v5 + 2v6 + 3v7
DAE + DBE + DCE + DDE = v1 + v2 + v3 + v4 + 4v5 + 3v6 + 2v7
DAC + DAE + DBC + DBE + DCD + DDE = 2v1 + 2v2 + 3v3 + 2v4 + 3v5 + 6v6 + 4v7
DAB + DAD + DBC + DCD + DBE + DDE = 2v1 + 3v2 + 2v3 + 3v4 + 2v5 + 4v6 + 6v7
Stack up the (4 + 3 + 2 + 1 = 10) Dij, in alphabetical order, into a vector
and the coefficients xijk
are arranged in a matrix X
with each row corresponding
to the Dij in the row of d and
containing a 1 if branch k
occurs on the path between
species i and j.
DE
CE
CD
BE
BD
BC
AE
AD
AC
AB
D
D
D
D
D
D
D
D
D
D
d
1111000
0010100
1101100
1110010
0001010
1100110
0110001
1001001
0100101
1000011
X
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 66
Least square method
If we also stack up the 7 vi into a vector v, the previous set of linear equations can
be compactly expressed as:
Multiplied from the left by the inverse of XTX one can solve for the least squares
branch lengths
This is a standard method of expressing least squares problems in matrix notation
and solving them.
check for example :-)
vXXdX TT
dXXXv TT 1
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 67
Least square method
When we have weighted least squares, with a diagonal matrix of weights in the
same order as the Dij:
DE
CE
CD
BE
BD
BC
AE
AD
AC
AB
w
w
w
w
w
w
w
w
w
w
000000000
000000000
000000000
000000000
000000000
000000000
000000000
000000000
000000000
000000000
W
then the least square equations can be written
vWXXWdX TT
and their solution WdXWXXv TT 1
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 68
Finding the least squares tree topology
Now that we are able to assign branch lengths to each tree topology.
we need to search among tree topologies.
This can be done by the same methods of heuristic search that were presented for
the Maximum Parsimony method.
Note: no-one has sofar presented a branch-and-bound method for finding the least
squares tree exactly. Day (1986) has shown that this problem is NP-complete.
The search is not only among tree topologies, but also among branch lengths.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 69
Methods of rooting the tree
There are many rooted trees, one for each branch of this unrooted tree,
and all have the same number of changes of state.
The number of changes of state only depends on the unrooted tree, and not at all on
where the tree is then rooted.
Biologists want to think of trees as rooted
need method to place the root in an otherwise unrooted tree.
(1) Outgroup criterion
(2) Use a molecular clock.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 70
Outgroup criterion
Assumes that we know the answer in advance.
Suppose that we have a number of great apes,
plus a single old-world monkey.
Suppose that we know that the great apes are a monophyletic group.
If we infer a tree of these species, we know that the root must be placed on the
lineage that connects the old-world monkey (outgroup) to the great apes (ingroup).
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 71
Molecular clock
If an equal amount of changes were observed on all lineages, there should be a
point on the tree that has equal amounts of change (branch lengths) from there to
all tips.
With a molecular clock, it is only the expected amounts of change that are equal.
The observed amounts may not be.
using various methods find a root that makes the amounts of change
approximately equal on all lineages.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 72
Branch lengths
Having found an unrooted tree, locate the changes on it and find out how many
occur in each of the branches.
The location of the changes can be ambiguous.
average over all possible reconstructions of each character for which there is
ambiguity in the unrooted tree.
Fractional numbers in some branches of left tree
add up to (integer) number of changes (right)
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 73
Open questions
* Particularly for larger data sets, need to know how to count number of changes
of state by use of an algorithm.
* need to know algorithm for reconstructing states at interior nodes of the tree.
* need to know how to search among all possible trees for the most parsimonious
ones, and how to infer branch lengths.
* sofar only considered simple model of 0/1 characters.
DNA sequences have 4 states, protein sequences 20 states.
* Justification: is it reasonable to use the parsimony criterion?
If so, what does it implicitly assume about the biology?
* What is the statistical status of finding the most parsimonious tree?
Can we make statements how well-supported it is compared to other trees?
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 74
dynamische Programmierung mit MSA Programm
Links: Baum für 5 Sequenzen ohne Paarung von Sequenzen.
Neighbour-joining Methode: berechne Summe aller Kantenlängen
S = a + b + c + d + e (Kantenlängen sind bekannt)
In diesem Fall seien sich A und B am nächsten. Konstruiere daher den Baum rechts.
Generell: Verbinde die Sequenzpaare mit den kürzesten Abständen …
Man erhält den Baum mit der kleinsten Summe der Kantenlängen.
Konstruiere anhand phylogenetischem Baum ein versuchsweises Multiples Sequenz Alignment.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 75
Dieses Alignment dient dazu, den möglichen Raum inmitten des Würfels
einzugrenzen, in dem das beste MSA zu finden sein sollte.
Grosse Rechenersparnis!
dynamische Programmierung mit MSA Programm
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 76
limitation of distance methods
Distance matrix methods are the easiest phylogeny method to program,
and they are very fast.
Distance methods have problems when the evolutionary rates vary largely.
One can correct for this in distance methods as well as in likelihood methods.
When variation of rates is large, these corrections become important.
In likelihood methods, the correction can use information from changes in one part
of the tree to inform the correction in others.
Once a particular part of the molecule is seen to change rapidly in the primates, this
will affect the interpretation of that part of the molecule among the rodents as well.
But a distance matrix method is inherently incapable of propagating the information
in this way. Once one is looking at changes within rodents, it will forget where
changes were seen among primates.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 77
Evaluating a particular tree
Figure right shows another tree also requiring 8 changes. These two most
parsimonious trees are the same tree when the roots of the tree are removed.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 78
• Die am meisten divergenten Sequenzen (also am stärksten von allen
anderen Sequenzen verschiedenen) sind gewönlich am
schwierigsten zu alignieren
• Es ist manchmal besser, ihr Alignment auf einen späteren Zeitpunkt
zu verschieben (nachdem die einfacheren Sequenzen aligniert
wurden)
• Man kann dazu einen Cutoff wählen (der Default liegt bei 40%
Identität).
Divergente Sequenzen
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 79
Fitch algorithm
intended to count the number of changes in a bifurcating tree with nucleotide
sequence data, in which any one of the 4 bases (A, C, G, T) can change to any
other.
At the particular site, we have observed the bases C, A, C, A and G in the 5 species.
Give them in the order in which they appear in the tree, left to right.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 80
Fitch algorithm
For the left two, at the node that is their immediate common ancestor,
attempt to construct the intersection of the two sets.
But as {C} {A} = instead construct
the union {C} {A} = {AC} and count 1
change of state.
For the rightmost pair of species, assign
common ancestor as {AG},
since {A} {G} = and count another
change of state.
.... proceed to bottom
Total number of changes = 3. Algorithm works on arbitrarily large trees.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 81
Complexity of Fitch algorithm
Fitch algorithm can be carried out in a number of operations that is proportional to
the number of species (tips) on the tree.
Don‘t we need to multiply this by the number of sites n ?
Any site that is invariant (which has the same base in all species, e.g. AAAAA) can
be dropped.
Other sites with a single variant base (e.g. ATAAA) will only require a single change
of state on all trees. These too can be dropped.
For sites with the same pattern (e.g. CACAG) that we have already seen, simply use
number of changes previously computed.
Pattern following same symmetry (e.g. TCTCA = CACAG) need same number of
changes numerical effort rises slower than linearly with the number of sites.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 82
Sankoff algorithm
Fitch algorithm is very effective – but we can‘t understand why it works.
Sankoff algorithm: more complex, but its structure is more apparent.
Assume that we have a table of the cost of changes cij between each character state
i and each other state j.
Compute the total cost of the most parsimonious combinations of events by
computing it for each character.
For a given character, compute for each node k in the tree a quantity Sk(i).
This is interpreted as the minimal cost, given that node k is assigned state i,
of all the events upwards from node k in the tree.
3. Vorlesung WS 2006/2007 Softwarewerkzeuge der Bioinformatik 83
Least square method
Number species in alphabetical order.
The expected distance between species A and D d14 = v1 + v7 + v4
The expected distance between species B and E d25 = v5 + v6 + v7 + v2.
v1v2
v3
v4
v5 v6 v7