A quantitative targeted proteomics approach to validate ...media.nature.com/original/nature-assets/nmeth/journal/v7/n10/extref/nmeth.1504...Blenkiron, Nicolas J Lehrbach, Xavier C

Nature Methods

A quantitative targeted proteomics approach to validate predicted microRNA targets in C. elegans Marko Jovanovic, Lukas Reiter, Paola Picotti, Vinzenz Lange, Erica Bogan, Benjamin A Hurschler, Cherie Blenkiron, Nicolas J Lehrbach, Xavier C Ding, Manuel Weiss, Sabine P Schrimpf, Eric A Miska, Helge Grosshans, Ruedi Aebersold & Michael O Hengartner Supplementary Figure 1 ICAT quantifications are suitable for SRM measurements

Supplementary Figure 2 Splice variant-specific regulation of the let-7 miRNA target let-526/lss-4

Supplementary Figure 3 Genes displaying positive protein changes in let-7(n2853) mutant worms are enriched in let-7 suppressors

Supplementary Figure 4 Normalization of the light ICAT labeled extract (let-7(n2853)) to the heavy ICAT labeled extract (wild type) for all three biological replicate samples

Supplementary Table 2 Relative protein abundance of all let-7 candidates

Supplementary Table 3 29 candidate proteins are regulated in let-7(n2853) mutants

Supplementary Table 4 Suppression of let-7(n2853) lethality – regulated candidates

Supplementary Table 5 Suppression of let-7(n2853) lethality – not regulated candidates

Supplementary Table 6 Relative mRNA levels of all candidates

Supplementary Table 7 Relative protein abundance of predicted miR-58 targets and random candidates

Supplementary Table 10 RT-qPCR primers

Supplementary Table 11 RNAi clones

Supplementary Table 12 Luciferase expression clones

Supplementary Results 1 Exact protein quantification in C. elegans using targeted proteomics

Supplementary Results 2 LET-526 shows a splice-variant specific response to let-7

Supplementary Discussion Limits of the targeted proteomics approach Note: Supplementary Tables 1, 8 and 9 are available on the Nature Methods website.

Nature Methods: doi: 10.1038/nmeth.1504

1

Supplementary Figure 1: ICAT quantifications are suitable for SRM measurements

A wild-type protein extract was split in half and one half was labeled with the light ICAT reagent, the

other half with the heavy ICAT reagent. The labeled extracts were pooled, trypsinized and processed

further for MS analysis. The measurements were done in the SRM mode on the 4000 Q-Trap. A total

of 11 peptides, representing five proteins (2 to 3 peptides per protein), were measured in a single run

(45 minutes). (a) List of the measured peptides (heavy and light form), their respective peak areas and

the ratio (light to heavy) of the corresponding peak areas. Ideally a ratio of 1 is expected. (b)

LC-SRM chromatogram. The inset shows a zoom-in on four peptide pairs. (c) Calculated average

ratio and the corresponding standard deviation.


2

Supplementary Figure 2: Splice variant-specific regulation of the let-7 miRNA target

let-526/lss-4

(a) Genomic structure of the let-526 (C01G8.9) locus. The two gene models, let-526a and let-526b

are depicted. Black boxes represent coding exonic sequences and grey boxes the untranslated regions

(5’UTR and 3’UTR). EST evidence was used to map the 3’UTR to LET-526b mRNA as shown. The

two peptides that were quantified are indicated in red. Peptide LIEFCEHNGEPLTMVPQVSK is

unambiguous and specific for LET-526a only, while peptide VPEATDSSIPCPVSPR is ambiguous

and cannot distinguish between LET-526a and LET-526b. (b) Representative LC-SRM

chromatograms showing the SRM measurements of the two peptides from let-7(n2853) and wild-type

extracts. Each peptide was measured using two transitions. For transition 1, the red and grey lines

correspond to the signal intensities in let-7(n2853) extracts and wild-type extracts, respectively. For

transition 2, let-7(n2853) intensity is depicted in blue and wild-type in green. The fold change ratios

(let-7(n2853) versus wild-type) averaged over all SRM measurements and over all biological

replicates for each peptide and the corresponding standard deviations are shown within the respective

chromatograms. (c) let-526a and let-526a,b mRNA distributions, determined by RT-qPCR, across

polysomal profiles of L4 stage wild-type and ain-2(RNAi); ain-1(ku322) mutant worms. The

let-526a,b RT-qPCR primers detect both splice variants, whereas the let-526a RT-qPCR primers are

specific to the let-526a isoform. The dotted black line indicates the boundary between monosomes

and polysomes. Representative polysome profiles of wild-type and ain-2(RNAi); ain-1(ku322) mutant

worms are shown above. Polysomal profiling experiments were performed in triplicate. The error bars

depict the standard error of the mean.


3

Supplementary Figure 3: Genes displaying positive protein changes in let-7(n2853)

mutant worms are enriched in let-7 suppressors

let-7(n2853) animals grown at 25°C die at the adult stage due to vulval bursting. Knock-down of

some known targets has been shown to rescue this lethality to different degrees1.

(a) The 19 genes that showed positive protein changes were knocked-down by RNAi to determine if

they suppress the let-7(n2853) lethal phenotype. Less than 5% of the let-7(n2853) animals treated

with control RNAi (vector RNAi or ZK617.1 (unc-22) RNAi) survived as adults. Two genes could

not be scored, as their RNAi inactivation led to either lethality or larval arrest. The remaining 17

candidates are represented by the grey bars, and the positive controls (F11A1.3 (daf-12), C12C8.3

(lin-41) and C18D1.1 (die-1) RNAi) are depicted as the black bars. Only survival rates above 5% are

shown. (b) As a control, 29 candidates that did not show a significant protein change in the

let-7(n2853) mutant animals in our targeted proteomics assay were tested as in (a), including the same

positive and negative controls. Again, 5/29 genes could not be scored due to lethality or larval arrest.

(c) The “regulated” candidates are significantly enriched in let-7(n2853) suppressors compared to the

“not regulated” group. The P-value of enrichment (Fisher’s Exact Test) was calculated for different

survival cutoffs. The table lists the number of suppressors for each group (“regulated” and “not

regulated”) at the listed cutoffs and the corresponding P-values.

All the experiments were performed at 25°C and in triplicate. The error bars depict the standard error

of the mean. The candidate marked by the asterisk (*) showed suppression in two out of three

replicate experiments and was regarded as positive as the average survival rate over all three

replicates was above the threshold.


4

Supplementary Figure 4: Normalization of the light ICAT labeled extract (let-7(n2853))

to the heavy ICAT labeled extract (wild type) for all three biological replicate samples

To normalize the two extracts to each other, the 11 standard peptides (see Supplementary Fig. 1)

were measured in the light and heavy labeled version (SRM mode) and the ratio (light to heavy) over

all 11 peptides calculated for each biological replicate. Subsequent quantifications for each biological

replicate were corrected by their respective normalization value. The normalization values for all

biological replicates and the LC-SRM chromatograms of the respective SRM measurements are

shown. All the measurements were done with non-fractionated samples.


5

Supplementary Table 2: Relative protein abundance of all let-7 candidates

Gene CGCmean log2 ratio

(let-7(n2853) / wt)

log2 ratio

replicate 1

log2 ratio

replicate 2

log2 ratio

replicate 3

replicates

quantifiedP -value Known Predicted Experiment Literature Neutral Control

C42D8.2 vit-2 -3.7 -4.3 -4.3 -2.6 3 < 0.001 - - - - - YES

F18A1.2 lin-26 -3.9 -3.3 -5.4 -4.2 3 < 0.001 - YES - - - -

Y65B4BL.5 - 0.4 0.4 NA 0.3 2 < 0.001 - YES - - - -

Y47G6A.10 spg-7 0.3 0.5 0.1 0.2 3 < 0.001 - - YES - - -

Y22D7AL.5 hsp-60 0.2 0.2 0.0 0.2 3 < 0.001 - - YES - - -

C14C10.5 - 2.0 2.0 1.6 2.3 3 < 0.001 - YES - - - -

K07H8.6a vit-6 -4.5 -4.1 -5.7 -3.8 3 < 0.001 - YES - - - YES

F35G12.8 smc-4 -5.5 -5.0 -5.2 -6.2 3 < 0.001 - - YES - - -

F41E6.4a smk-1 -3.7 -3.3 -3.2 -4.7 3 < 0.001 - YES - - - -

C56E6.1 abcx-1 3.4 5.6 2.4 3.1 3 < 0.001 - YES - - - -

K12H4.8 dcr-1 -3.0 -2.5 -2.3 -4.0 3 < 0.001 - - - YES - -

F23H11.4a - -4.5 -6.0 -3.5 -3.8 3 < 0.001 - YES - - - -

Y48A6C.4 - 2.8 2.7 NA 2.9 2 < 0.001 - YES - - - -

C47B2.5 eif-6 0.4 0.4 0.3 0.5 3 < 0.001 - - YES - - -

W01F3.3 mlt-11 0.4 0.3 0.4 0.8 3 < 0.001 - YES - - - -

ZC168.4 cyb-1 -2.8 NA -2.8 -2.9 2 < 0.001 - YES - - - -

K09D9.1 - 1.5 1.3 1.7 NA 2 0.0024 - YES - - - -

T19A6.2a ngp-1 1.9 2.4 0.8 2.0 3 0.0028 - - YES - - -

R31.1 sma-1 0.3 0.4 0.2 0.2 3 0.0031 - - YES - - -

F53A9.10a tnt-2 0.2 0.2 0.4 0.1 3 0.0033 - - - - YES -

T21E12.4 dhc-1 0.2 0.2 0.1 0.3 3 0.0036 - - YES - - -

W06A7.3a ret-1 -0.2 -0.2 -0.1 -0.3 3 0.0045 - YES - - - -

F46H5.3a - 0.3 0.4 0.3 0.1 3 0.0045 - - - - YES -

F46B6.7 ztf-7 0.1 0.2 0.0 0.2 3 0.0047 - YES - - - -

C01G8.9a let-526 0.9 0.8 1.0 0.9 3 0.0049 YES YES YES - - -

ZK180.4 - -1.2 -1.2 -2.2 -0.7 3 0.0067 - YES - - - -

T22B11.5 - 0.2 0.2 0.0 0.3 3 0.0071 - YES - - - -

F46E10.8 ubh-1 1.4 1.2 NA 1.7 2 0.0082 - YES - - - -

F56A3.4 spd-5 0.7 0.9 0.2 1.0 3 0.0093 - - YES - - -

LLC1.3 - 0.2 0.2 0.1 0.3 3 0.0103 - - - - YES -

K03H1.4 ttr-2 -0.1 -0.2 -0.1 0.0 3 0.0117 - - YES - - -

F49E10.5 ctbp-1 0.7 0.8 0.6 NA 2 0.0148 - YES - - - -

Y105C5B.28 gln-3 0.4 0.4 NA 0.5 2 0.0153 - - - - YES -

B0464.7 baf-1 0.3 0.4 0.2 0.2 3 0.0163 - YES - - - -

Y49A3A.2 vha-13 0.1 0.1 0.1 0.1 3 0.0196 - - - - YES -

F25H2.10 rpa-0 -0.2 -0.2 -0.1 -0.2 3 0.0206 - - - - YES -

E04F6.3 maoc-1 0.2 0.2 -0.2 0.5 3 0.0213 - - YES - - -

R06C7.10 let-75 -0.2 -0.2 -0.3 -0.2 3 0.0229 - - - - YES -

T08B2.10 rps-17 0.2 0.1 0.3 0.2 3 0.0241 - - - - YES -

T23D8.4 eif-3.C 0.9 1.1 0.8 0.9 3 0.0244 - - YES - - -

B0041.4 rpl-4 0.2 0.2 0.2 0.1 3 0.0247 - - - - YES -

K02B12.7 - -0.3 -0.3 -0.3 -0.2 3 0.0277 - - YES - - -

Y37A1B.5 - 0.2 0.2 0.1 0.4 3 0.0282 - YES - - - -

B0412.4 rps-29 -0.1 -0.2 -0.1 0.0 3 0.0369 - YES - - - -

F26F12.7 let-418 -0.5 -0.3 -0.7 -0.5 3 0.0416 - YES - - - -

F48E3.3 - 0.1 0.0 0.0 0.2 3 0.0419 - YES - - - -

Y48G1A.5 xpo-2 -0.2 -0.1 -0.4 -0.2 3 0.0427 - - YES - - -

F48E8.5 paa-1 -0.1 0.0 -0.1 -0.3 3 0.0434 - YES - - - -

C01G5.6 - 0.1 0.1 0.0 0.2 3 0.0446 - - YES - - -

C34E10.6 atp-2 0.2 0.3 0.0 0.2 3 0.0489 - - - - YES -

F56H11.4 elo-1 0.3 0.5 0.4 0.0 3 0.0494 - - YES - - -

W08F4.8 - 0.2 0.2 0.0 0.4 3 0.0543 - - YES - - -

F35H10.10 - 0.3 0.2 0.2 0.4 3 0.0572 - YES YES - - -

K11D9.2a sca-1 0.1 0.1 0.0 0.2 3 0.0573 - YES - - - -

C53B7.1 rig-3 -0.9 -0.5 -0.3 -2.1 3 0.0580 - YES - - - -

Y47G6A.22 - 0.3 0.4 0.1 0.4 3 0.0622 - - YES - - -

Y110A7A.14 pas-3 0.1 0.2 -0.1 0.1 3 0.0644 - YES - - - -

K08D12.1 pbs-1 0.2 0.2 0.0 0.3 3 0.0680 - - YES - - -

C47E12.5 uba-1 0.1 0.1 0.2 0.0 3 0.0697 - YES - - - -

F29G9.4 - 0.4 NA 0.4 0.3 2 0.0699 - YES - - - -

Y55F3AR.3 cct-8 0.1 0.2 0.0 0.1 3 0.0757 - - - - YES -

F25H2.5 - -0.1 -0.1 -0.1 0.1 3 0.0770 - - - - YES -

B0365.3 eat-6 0.1 0.2 0.0 0.2 3 0.0784 - - - - YES -

T10B5.5a cct-7 0.1 0.2 0.1 0.0 3 0.0810 - - - - YES -

C38C3.5c unc-60 0.5 0.2 0.7 0.9 3 0.0815 - YES YES - - -

K10C3.3 zig-1 -0.2 -0.1 -0.4 0.0 3 0.0819 - YES YES - - -

F40F4.6 - 0.1 0.3 0.1 0.0 3 0.0845 - - - - YES -

F20B6.2 vha-12 0.1 0.1 0.0 0.2 3 0.0913 - - - - YES -

F02A9.4a - -0.1 0.0 -0.1 -0.2 3 0.0939 - YES - - - -

K04D7.1 rack-1 0.1 0.2 0.0 0.1 3 0.0994 - - YES - - -

C56G2.1a - 0.6 0.3 0.9 0.6 3 0.1171 - YES - - - -

Y40B10A.1 lbp-9 -0.1 -0.1 -0.2 -0.1 3 0.1203 - - YES - - -

C36B1.3 rpb-3 0.1 0.1 0.1 0.1 3 0.1211 - - YES - - -

Y110A7A.18 ppw-2 4.1 NA NA 4.1 1 0.1221 - - YES - - -

F41D9.3a wrk-1 -0.2 -0.1 -0.4 -0.2 3 0.1230 - YES - - - -

Y37E3.8a - 0.1 0.2 0.3 -0.1 3 0.1241 - - - - YES -

T02E1.7 - 0.2 0.3 0.2 0.1 3 0.1247 - YES - - - -

T22D1.3a - 0.2 0.6 0.1 0.0 3 0.1252 - - YES - - -

F25H5.4 eft-2 -0.2 -0.2 -0.1 -0.2 3 0.1274 - - - - YES -

ZK673.2 - 0.2 0.2 0.0 0.4 3 0.1314 - - YES - - -

R07G3.1 cdc-42 0.1 0.1 0.1 0.2 3 0.1318 - - YES - - -

M117.2 par-5 -0.1 -0.1 0.4 -0.4 3 0.1394 - - YES - - -

K12G11.3 sodh-1 -0.2 -0.2 -0.3 0.0 3 0.1422 - - YES - - -

F57C2.5 - 2.0 2.0 NA NA 1 0.1466 - - YES - - -

Y51H4A.3 rho-1 0.2 0.2 NA 0.2 2 0.1594 - - - - YES -

Y73B6BL.18 smg-3 -2.0 NA NA -2.0 1 0.1600 - YES - - - -

R11A5.4a - 0.1 0.0 0.1 0.1 3 0.1693 - - - - YES -

C18A11.7a dim-1 -0.1 -0.1 -0.2 0.0 3 0.1740 - - - - YES -

M18.5 ddb-1 0.2 0.2 0.1 0.4 3 0.1748 - YES - - - -

C38C3.5a unc-60 0.2 0.2 0.0 0.3 3 0.1778 - YES YES - - -

C53D5.6 imb-3 0.1 0.2 0.0 0.0 3 0.1848 - YES - - - -

F11C3.3 unc-54 -0.1 -0.2 0.1 -0.2 3 0.1905 - - - - YES -

F32H2.5 fasn-1 0.1 -0.1 0.4 0.2 3 0.1929 - - - - YES -

Y37E3.17a - 0.2 0.4 0.2 -0.1 3 0.1992 - - - - YES -

F14B4.3 - 0.1 0.2 0.0 0.1 3 0.2014 - - YES - - -

C05D11.11a mel-32 0.1 0.2 0.2 0.0 3 0.2136 - - - - YES -

Y48B6A.12 - 0.2 0.6 0.0 0.1 3 0.2233 - YES - - - -

T25C8.2 act-5 -0.1 -0.2 -0.1 -0.1 3 0.2285 - - - - YES -

K07C5.4 - -0.1 0.0 0.0 -0.2 3 0.2408 - - YES - - -


6


(let-7(n2853) / wt)

log2 ratio

replicate 1

log2 ratio

replicate 2

log2 ratio

replicate 3

replicates

quantifiedP -value Known Predicted Experiment Literature Neutral Control

Y113G7B.23 psa-1 0.1 0.2 0.0 0.2 3 0.2463 - YES - - - -

ZK829.4 - 0.1 0.1 0.1 0.1 3 0.2713 - - - - YES -

C35D10.16 arx-6 0.2 NA NA 0.2 1 0.2784 - - - - YES -

F45E12.5a - -0.2 -0.2 -0.5 0.1 3 0.2856 - - YES - - -

Y39B6A.20 asp-1 0.0 0.0 -0.1 0.2 3 0.2923 - - - - YES -

ZK1307.6 fzr-1 -1.9 NA NA -1.9 1 0.2955 - - YES - - -

C41D11.2 eif-3.H 0.1 0.2 0.2 -0.2 3 0.3033 - - YES - - -

F36H1.2 tag-144 -0.2 0.2 -0.1 -0.5 3 0.3074 - - YES - - -

F35G2.2 - -0.1 0.0 -0.1 -0.2 3 0.3106 - YES - - - -

Y54E10A.3 - -0.1 -0.2 -0.1 0.3 3 0.3300 - - YES - - -

C09H10.2 rpl-41 0.1 0.1 -0.1 0.2 3 0.3371 - - YES - - -

Y48B6A.1 - -0.1 0.2 -0.4 -0.3 3 0.3438 - - YES - - -

F38A3.1 col-81 -2.8 NA NA -2.8 1 0.3576 - - YES - - -

F35C5.8 clec-65 0.1 -0.1 0.3 0.3 3 0.3689 - YES - - - -

B0393.1 rps-0 0.0 0.1 0.1 -0.1 3 0.3698 - - - - YES -

Y63D3A.6a dnj-29 -0.1 0.2 -0.1 -0.2 3 0.3872 - YES - - - -

W07G4.3 - -0.1 -0.1 -0.3 0.1 3 0.4058 - YES - - - -

K08F11.3 cif-1 -0.1 0.2 -0.2 -0.1 3 0.4248 - YES - - - -

C23F12.1a fl--1 -0.1 0.0 -0.5 0.1 3 0.4488 - YES - - - -

C05G5.4 - -0.1 -0.2 0.0 NA 2 0.4602 - YES - - - -

R10E4.2a tag-310 -0.2 -0.3 -0.1 -0.4 3 0.4939 - YES - - - -

Y54E10A.9a vbh-1 0.0 0.0 0.0 -0.1 3 0.5009 - YES - - - -

Y54E10BR.6 rpb-7 0.1 0.1 NA NA 1 0.5053 - - YES - - -

F13H6.3 - -0.1 -0.1 0.0 -0.1 3 0.5055 - - YES - - -

Y65B4A.8 - 0.1 0.4 0.0 -0.1 3 0.5160 - YES - - - -

K04G2.1 iftb-1 0.1 0.4 0.0 -0.2 3 0.5233 - - YES - - -

C37C3.6a ppn-1 -0.1 0.0 -0.2 0.1 3 0.5327 - - - - YES -

W01B11.3 nol-5 0.0 0.1 0.1 -0.2 3 0.5368 - - YES - - -

T21B10.7 cct-2 0.1 0.1 NA 0.0 2 0.5402 - - - - YES -

Y41D4A.5 - 0.2 NA 0.1 0.3 2 0.5566 - YES - - - -

C41C4.8 cdc-48.2 0.1 0.2 -0.2 0.1 3 0.5702 - - YES - - -

Y39B6A.2 pph-5 0.0 0.0 -0.3 0.1 3 0.5713 - YES - - - -

Y106G6H.2a pab-1 0.1 0.0 0.3 -0.3 3 0.5722 - - YES - - -

W08E12.7 - 0.0 -0.1 0.0 0.1 3 0.6023 - YES - - - -

C36E8.5 tbb-2 0.0 0.0 -0.2 0.1 3 0.6049 - - YES - - -

F20D12.1 - 0.0 0.0 0.1 -0.2 3 0.6208 - - YES - - -

Y17G7B.7 tpi-1 0.0 0.0 0.1 -0.3 3 0.6401 - YES - - - -

F26D10.3 hsp-1 0.0 0.1 -0.1 0.1 3 0.6422 - - - - YES -

F36A4.7 ama-1 0.0 0.2 0.0 -0.1 3 0.6438 - YES YES - - -

Y71F9AM.5 nxt-1 0.0 -0.1 0.1 0.0 3 0.6569 - - YES - - -

F32D1.10 mcm-7 -0.6 -0.5 0.6 -1.3 3 0.6789 - - YES - - -

T03F1.8 - 0.0 0.2 -0.3 0.0 3 0.6832 - YES - - - -

Y73B6BL.6 sqd-1 0.0 0.2 0.0 0.0 3 0.6878 - YES - - - -

T18D3.4 myo-2 0.0 0.0 -0.2 0.2 3 0.7134 - - - - YES -

F08F3.4 - 0.0 0.0 0.0 0.1 3 0.7164 - YES - - - -

F58D5.1 hrp-2 -0.1 0.3 -0.2 -0.3 3 0.7265 - YES - - - -

F20D12.5 exc-9 -0.1 NA -0.4 0.2 2 0.7349 - YES - - - -

T07D3.7a alg-2 0.0 0.0 NA 0.0 2 0.7388 - - - YES - -

F40F11.1 rps-11 0.0 -0.1 0.0 0.1 3 0.7565 - - - - YES -

B0491.7 - 0.0 0.0 0.4 -0.5 3 0.7706 - YES - - - -

T05E11.1 rps-5 0.0 0.0 0.1 -0.1 3 0.7741 - - - - YES -

T02C5.3 igcm-3 0.0 0.0 -0.3 0.1 3 0.7850 - YES - - - -

T05F1.3 rps-19 0.0 0.1 NA 0.0 2 0.8272 - - - - YES -

R07E5.14 rnp-4 0.0 0.2 -0.4 0.0 3 0.8608 - YES - - - -

T26C12.1 - 0.0 -0.1 -0.2 0.2 3 0.8754 - YES - - - -

C30C11.4 - 0.0 0.2 0.0 0.0 3 0.8843 - YES - - - -

F54A3.3 cct-3 0.0 0.3 0.0 -0.1 3 0.9024 - YES - - - -

F53A2.7 - 0.0 0.2 -0.1 0.0 3 0.9035 - - - - YES -

F57B10.3a - 0.0 0.1 -0.2 0.1 3 0.9330 - - - - YES -

C09D1.1a unc-89 0.0 0.0 -0.1 0.1 3 0.9690 - - YES - - -

C06A1.1 cdc-48.1 0.0 -0.1 -0.3 0.3 3 0.9888 - - YES - - -

Y53C12A.4 mop-25.2 0.0 -0.2 0.4 0.2 3 0.9962 - - YES - - -

F25F2.2 cdh-4 0.0 NA NA NA 0 NA - YES - - - -

B0395.3 - 0.0 NA NA NA 0 NA - YES - - - -

F13D11.2 hbl-1 0.0 NA NA NA 0 NA YES YES YES - - -

R01B10.1a cpi-2 0.0 NA NA NA 0 NA - YES - - - -

C41C4.6 ulp-4 0.0 NA NA NA 0 NA - YES - - - -

F55A3.1 marc-6 0.0 NA NA NA 0 NA - YES - - - -

F13H6.1 - 0.0 NA NA NA 0 NA - YES - - - -

C29E6.5 nhr-43 1.1 1.1 NA NA 1 NA - YES - - - -

M28.5 - 2.8 2.8 NA NA 1 NA - YES - - - -

Y69A2AR.18a - 0.0 NA NA NA 0 NA - - - - YES -

T09B4.8 - 3.7 3.7 NA NA 1 NA - - - - YES -

F39H11.3 cdk-8 0.0 NA NA NA 0 NA - - - YES - -

Y97E10AR.4 - 0.0 NA NA NA 0 NA - - YES - - -

Y48G1A.4 - 0.0 NA NA NA 0 NA - - YES - - -

F32G8.6 cat-4 0.0 NA NA NA 0 NA - - YES - - -

C55A6.5 sdz-8 0.0 NA NA NA 0 NA - - YES - - -

F32D1.5 - 0.0 NA NA NA 0 NA - - YES - - -

W02D9.1 pri-2 0.0 NA NA NA 0 NA - - YES - - -

K02E2.4 ins-35 0.0 NA NA NA 0 NA - - YES - - -

T05H10.5a ufd-2 2.1 NA NA 2.1 1 NA - - YES - - -

Quantification data for the 181 proteins analyzed in our targeted proteomics approach. The table lists

the gene name, the CGC synonym (if available), the mean log2 ratio of the protein (let-7(n2853) / wt;

averaged over all measurements), the log2 ratio of the protein (let-7(n2853) / wt) in each biological

replicate, the number of biological replicates (maximum = 3) where the protein could be quantified by

at least one peptide, the P-value for the protein change, and their group affiliation from the candidate

list (see Supplementary Table 1).

Genes that have an “NA” ( = ”Not Available”) listed in the P-value column have less than three

independent quantification measurements (transition ratios) and were regarded as “not successfully

quantified” (red font).


7

Supplementary Table 3: 29 candidate proteins are regulated in let-7(n2853) mutants


(let-7(n2853) / wt)P -value Known Predicted Experiment Literature Neutral Control

C42D8.2 vit-2 -3.7 < 0.001 - - - - - YES

F18A1.2 lin-26 -3.9 < 0.001 - YES - - - -

Y65B4BL.5 - 0.4 < 0.001 - YES - - - -

Y47G6A.10 spg-7 0.3 < 0.001 - - YES - - -

Y22D7AL.5 hsp-60 0.2 < 0.001 - - YES - - -

C14C10.5 - 2.0 < 0.001 - YES - - - -

K07H8.6a vit-6 -4.5 < 0.001 - YES - - - YES

F35G12.8 smc-4 -5.5 < 0.001 - - YES - - -

F41E6.4a smk-1 -3.7 < 0.001 - YES - - - -

C56E6.1 abcx-1 3.4 < 0.001 - YES - - - -

K12H4.8 dcr-1 -3.0 < 0.001 - - - YES - -

F23H11.4a - -4.5 < 0.001 - YES - - - -

Y48A6C.4 - 2.8 < 0.001 - YES - - - -

C47B2.5 eif-6 0.4 < 0.001 - - YES - - -

W01F3.3 mlt-11 0.4 < 0.001 - YES - - - -

ZC168.4 cyb-1 -2.8 < 0.001 - YES - - - -

K09D9.1 - 1.5 0.0024 - YES - - - -

T19A6.2a ngp-1 1.9 0.0028 - - YES - - -

R31.1 sma-1 0.3 0.0031 - - YES - - -

F53A9.10a tnt-2 0.2 0.0033 - - - - YES -

T21E12.4 dhc-1 0.2 0.0036 - - YES - - -

W06A7.3a ret-1 -0.2 0.0045 - YES - - - -

F46H5.3a - 0.3 0.0045 - - - - YES -

F46B6.7 ztf-7 0.1 0.0047 - YES - - - -

C01G8.9a let-526 0.9 0.0049 YES YES YES - - -

ZK180.4 - -1.2 0.0067 - YES - - - -

T22B11.5 - 0.2 0.0071 - YES - - - -

F46E10.8 ubh-1 1.4 0.0082 - YES - - - -

F56A3.4 spd-5 0.7 0.0093 - - YES - - -

Proteins that made our P < 0.01 cut-off were regarded as regulated on the protein level in let-7(n2853)

mutants compared to wild-type worms. The table lists the gene name, the CGC synonym (if

available), the mean log2 ratio of the protein (let-7(n2853) / wt; averaged over all measurements), the

P-value for the protein change, and their group affiliation from the candidate list (see Supplementary

Table 1).


8

Supplementary Table 4: Suppression of let-7(n2853) lethality – regulated candidates

RNAi cloneFraction Survivors

(Alive / Total)

Standard Error of

the Mean

Positive

Control

Negative

Control

partial let-7(n2853)

suppressor

F41E6.4a < 0.05 NA - - -

C01G8.9a 0.56 0.07 - - YES

C14C10.5 < 0.05 NA - - -

Y48A6C.4 0.05 0.01 - - -

F35G12.8 0.84 0.04 - - YES

T22B11.5 0.21 0.02 - - YES

W06A7.3a < 0.05 NA - - -

F46H5.3a < 0.05 NA - - -

C56E6.1 0.51 0.09 - - YES

F46E10.8 < 0.05 NA - - -

F53A9.10a < 0.05 NA - - -

T19A6.2a 0.42 0.06 - - YES

K09D9.1 < 0.05 NA - - -

ZC168.4 < 0.05 NA - - -

F23H11.4a < 0.05 NA - - -

F56A3.4 0.58 0.13 - - YES

R31.1 < 0.05 NA - - -

Y47G6A.10 0.41 0.29 - - YES

Y65B4BL.5 < 0.05 NA - - -

C47B2.5 0.58 0.14 - - YES

Y22D7AL.5 0.62 0.07 - - YES

F46B6.7 0.29 0.00 - - YES

K12H4.8 < 0.05 NA - - -

F11A1.3 0.70 0.02 YES - YES

C12C8.3 0.63 0.04 YES - YES

C18D1.1 0.20 0.06 YES - YES

ZK617.1 < 0.05 NA - YES -

vector < 0.05 NA - YES -

The 29 genes that showed significant protein changes (P < 0.01, see Supplementary Table 3) in our

targeted proteomics assay were knocked-down by RNAi to see whether they suppressed the lethal

let-7(n2853) vulval bursting phenotype. 23 out of the 29 genes tested reached the adult stage and

could be scored for suppression of lethality. Three independent replicate experiments were performed

at 25°C. Only values above 5% survival are shown.

Y47G6A.10 showed suppression in two out of three replicate experiments and was regarded a

positive suppressor because the average survival rate over all three replicates was above the threshold

set.

Less than 5% of the let-7(n2853) worms treated with negative control RNAi (vector RNAi or

ZK617.1 (unc-22) RNAi) survived as adults. Positive controls (F11A1.3 (daf-12), C12C8.3 (lin-41)

and C18D1.1 (die-1) RNAi) were included. “NA” = ”Not Available”.


9

Supplementary Table 5: Suppression of let-7(n2853) lethality – not regulated candidates

RNAi cloneFraction Survivors

(Alive / Total)

Standard Error of the

Mean

Positive

Control

Negative

Control

partial let-7(n2853)

suppressorF20D12.5 < 0.05 NA - - -

F58D5.1 0.39 0.04 - - YES

T02C5.3 < 0.05 NA - - -

B0491.7 < 0.05 NA - - -

Y39B6A.2 < 0.05 NA - - -

T03F1.8 < 0.05 NA - - -

T26C12.1 < 0.05 NA - - -

Y17G7B.7 < 0.05 NA - - -

R07E5.14 0.12 0.04 - - -

C30C11.4 0.22 0.02 - - YES

W08E12.7 < 0.05 NA - - -

C37C3.6a < 0.05 NA - - -

F57B10.3a < 0.05 NA - - -

F53A2.7 < 0.05 NA - - -

Y39B6A.20 < 0.05 NA - - -

R11A5.4a < 0.05 NA - - -

ZK829.4 < 0.05 NA - - -

C05D11.11a < 0.05 NA - - -

F13H6.3 < 0.05 NA - - -

F20D12.1 < 0.05 NA - - -

C09D1.1a < 0.05 NA - - -

C06A1.1 < 0.05 NA - - -

Y53C12A.4 < 0.05 NA - - -

W01B11.3 0.38 0.03 - - YES

F11A1.3 0.60 0.03 YES - YES

C12C8.3 0.81 0.04 YES - YES

C18D1.1 0.15 0.02 YES - -

ZK617.1 < 0.05 NA - YES -

vector < 0.05 NA - YES -

29 genes that did not show significant protein changes by targeted proteomics were knocked-down by

RNAi to determine whether they suppressed the lethal let-7(n2853) vulval bursting phenotype. 24 out

of the 29 genes tested reached the adult stage and could be scored for suppression of lethality. Three

independent replicate experiments were performed at 25°C. Only values above 5% survivors are

shown.

Less than 5% of the let-7(n2853) worms treated with negative control RNAi (vector RNAi or

ZK617.1 (unc-22) RNAi) survived as adults. Positive controls (F11A1.3 (daf-12), C12C8.3 (lin-41)

and C18D1.1 (die-1) RNAi) were included. “NA” = ”Not Available”.


10

Supplementary Table 6: Relative mRNA levels of all candidates

GENEAVG mRNA log2 ratio

(let-7(n2853) / wt)

mRNA log2 ratio

replicate 1

mRNA log2 ratio

replicate 2

mRNA log2 ratio

replicate 3

K07H8.6a -6.7 -6.5 -8.1 -5.4

F38A3.1 -6.6 -6.9 -6.4 -6.6

C42D8.2 -5.2 -5.3 -6.1 -4.3

F32D1.10 -0.4 -0.3 -0.2 -0.6

W01F3.3 -0.4 0.1 -1.3 0.1

T07D3.7a -0.2 0.2 -0.6 NA

Y65B4BL.5 -0.2 0.0 0.2 -0.8

C23F12.1a -0.2 -0.2 -0.3 -0.1

K12G11.3 -0.2 0.2 -0.8 0.1

ZK1307.6 -0.1 0.2 -0.1 -0.4

ZK829.4 -0.1 -0.8 0.3 0.1

Y48G1A.5 -0.1 -0.1 0.3 -0.4

R06C7.10 -0.1 0.0 -0.4 0.2

F35G12.8 -0.1 -0.1 0.0 -0.2

C14C10.5 -0.1 0.1 -0.1 -0.2

M117.2 -0.1 0.2 0.1 -0.4

T02C5.3 0.0 0.5 -1.0 0.4

Y110A7A.18 0.0 -0.1 0.3 -0.3

C56E6.1 0.0 -0.5 -0.7 1.1

C53B7.1 0.0 -0.1 -0.4 0.4

Y113G7B.23 0.0 0.5 -0.5 -0.1

C01G8.9a 0.0 0.4 0.2 -0.7

ZC168.4 0.0 -0.1 0.1 0.0

C47E12.5 0.0 0.0 0.2 -0.1

C05G5.4 0.0 0.0 -0.2 0.2

F41E6.4a 0.0 0.0 0.0 0.1

F53A9.10a 0.0 0.2 -0.1 0.0

Y63D3A.6a 0.0 0.2 0.0 -0.2

F36A4.7 0.0 0.2 0.0 -0.1

R31.1 0.0 0.6 -0.9 0.4

Y49A3A.2 0.1 0.1 0.2 -0.2

C53D5.6 0.1 0.2 0.3 -0.4

T18D3.4 0.1 -0.1 -0.1 0.4

F56H11.4 0.1 -0.2 0.0 0.5

C35D10.16 0.1 0.1 0.0 0.1

C47B2.5 0.1 0.0 0.2 0.0

F57C2.5 0.1 0.0 0.2 0.1

R11A5.4a 0.1 0.3 -0.3 0.3

Y48B6A.12 0.1 0.3 0.0 0.0

C34E10.6 0.1 0.4 0.0 -0.1

K08D12.1 0.1 0.2 0.3 -0.2

F58D5.1 0.1 0.5 -0.1 -0.1

W01B11.3 0.1 0.2 0.2 -0.1

C38C3.5a 0.1 0.2 0.2 -0.1

Y53C12A.4 0.1 0.1 0.1 0.1

C06A1.1 0.1 0.1 0.3 0.0

C05D11.11a 0.1 0.0 0.3 0.0

F35C5.8 0.1 0.1 -0.1 0.4

F11C3.3 0.1 0.0 -0.2 0.6

W08F4.8 0.1 0.1 0.3 0.0

ZK180.4 0.1 0.0 0.2 0.2

C38C3.5c 0.1 0.2 0.1 0.1

T22B11.5 0.1 0.2 0.0 0.1

R07G3.1 0.1 0.3 0.2 0.0

F56A3.4 0.1 0.1 0.2 0.2

F02A9.4a 0.2 0.1 0.1 0.3

R07E5.14 0.2 0.2 -0.1 0.4

Y73B6BL.18 0.2 0.3 0.2 0.0

F20D12.1 0.2 0.1 0.5 0.0

Y48B6A.1 0.2 0.4 0.2 -0.1

F45E12.5a 0.2 0.2 0.0 0.3

T21E12.4 0.2 0.3 0.2 0.0

F48E8.5 0.2 0.1 0.4 0.0

Y54E10A.3 0.2 0.0 0.2 0.3

ZK673.2 0.2 0.3 -0.2 0.4

M18.5 0.2 0.3 0.2 0.1

C18A11.7a 0.2 0.0 -0.1 0.7

F46H5.3a 0.2 0.3 0.2 0.1

C41C4.8 0.2 0.3 0.2 0.0

C01G5.6 0.2 -0.1 0.4 0.3

C30C11.4 0.2 0.3 0.3 0.0

F26F12.7 0.2 0.4 0.2 0.0

Y48A6C.4 0.2 0.1 0.3 0.2

F36H1.2 0.2 0.2 0.2 0.2

B0365.3 0.2 0.2 0.4 0.1

F46B6.7 0.2 0.4 0.0 0.2

C37C3.6a 0.2 0.3 0.0 0.3

F25H5.4 0.2 0.5 0.3 -0.2

Y40B10A.1 0.2 0.0 0.1 0.4

F35H10.10 0.2 -0.1 0.1 0.6

F40F4.6 0.2 0.4 0.1 0.2

K07C5.4 0.2 -0.1 0.5 0.2

W08E12.7 0.2 0.3 0.2 0.1

T05E11.1 0.2 0.3 0.2 0.2


11

GENEAVG mRNA log2 ratio

(let-7(n2853) / wt)

mRNA log2 ratio

replicate 1

mRNA log2 ratio

replicate 2

mRNA log2 ratio

replicate 3

LLC1.3 0.2 0.3 0.1 0.2

Y110A7A.14 0.2 0.0 0.4 0.3

C36E8.5 0.2 0.3 0.3 0.0

K12H4.8 0.2 0.5 0.2 0.0

F14B4.3 0.2 0.1 0.2 0.3

B0412.4 0.2 0.3 0.2 0.2

T23D8.4 0.2 0.2 0.2 0.4

Y39B6A.20 0.2 0.4 0.1 0.2

F46E10.8 0.2 0.2 0.3 0.3

Y41D4A.5 0.3 0.3 0.3 0.1

K08F11.3 0.3 0.3 0.3 0.2

F57B10.3a 0.3 0.2 0.2 0.4

F25H2.10 0.3 0.2 0.3 0.2

F23H11.4a 0.3 0.2 0.4 0.2

T05F1.3 0.3 0.3 0.3 0.3

T19A6.2a 0.3 0.4 0.1 0.3

B0464.7 0.3 0.2 0.0 0.7

Y37E3.17a 0.3 0.5 0.3 0.0

Y47G6A.22 0.3 0.1 0.2 0.6

Y47G6A.10 0.3 0.5 0.4 0.0

B0491.7 0.3 0.3 0.0 0.6

F40F11.1 0.3 0.2 0.5 0.2

T26C12.1 0.3 0.3 0.1 0.5

F20B6.2 0.3 0.2 0.6 0.0

Y17G7B.7 0.3 0.2 0.3 0.4

B0041.4 0.3 0.4 0.6 -0.1

K02B12.7 0.3 0.1 0.1 0.7

C41D11.2 0.3 0.5 0.3 0.2

T03F1.8 0.3 0.3 0.1 0.6

W07G4.3 0.3 0.5 0.2 0.3

T22D1.3a 0.3 0.3 0.2 0.4

C36B1.3 0.3 0.1 0.2 0.7

Y37E3.8a 0.3 0.3 0.4 0.3

F53A2.7 0.3 0.2 0.2 0.7

F25H2.5 0.3 0.2 0.5 0.4

C09D1.1a 0.4 NA NA 0.4

T08B2.10 0.4 0.3 0.1 0.7

T21B10.7 0.4 0.6 0.3 0.2

Y54E10A.9a 0.4 0.7 0.1 0.4

B0393.1 0.4 0.4 0.4 0.3

Y37A1B.5 0.4 0.5 -0.1 0.7

F35G2.2 0.4 0.2 0.2 0.8

C09H10.2 0.4 0.5 0.1 0.5

Y39B6A.2 0.4 0.4 0.4 0.4

Y22D7AL.5 0.4 0.4 0.6 0.3

K11D9.2a 0.4 0.4 0.3 0.5

T25C8.2 0.4 -0.1 1.0 0.4

Y65B4A.8 0.4 0.5 0.5 0.3

F26D10.3 0.4 0.3 0.4 0.6

Y73B6BL.6 0.4 0.6 0.3 0.4

Y71F9AM.5 0.5 0.5 0.1 0.8

F08F3.4 0.5 0.2 0.2 1.0

C56G2.1a 0.5 0.6 0.6 0.2

K10C3.3 0.5 0.4 0.1 0.9

F48E3.3 0.5 0.4 0.3 0.7

K04D7.1 0.5 0.3 0.6 0.5

F20D12.5 0.5 0.8 -0.1 0.8

Y55F3AR.3 0.5 0.7 0.8 0.0

F54A3.3 0.5 0.6 0.5 0.5

F29G9.4 0.5 0.5 0.4 0.7

Y105C5B.28 0.5 0.7 0.3 0.7

F49E10.5 0.5 0.5 -0.3 1.4

Y51H4A.3 0.6 0.7 0.6 0.3

T02E1.7 0.6 0.6 0.2 1.0

K03H1.4 0.6 0.5 0.7 0.5

F13H6.3 0.6 0.7 0.1 1.1

F32H2.5 0.7 0.8 0.6 0.6

T10B5.5a 0.7 0.6 0.0 1.5

E04F6.3 0.9 1.0 -0.2 1.8

K09D9.1 2.2 2.1 2.9 1.6

F18A1.2 NA NA NA NA

F41D9.3a NA NA NA NA

K04G2.1 NA NA NA NA

R10E4.2a NA NA NA NA

W06A7.3a NA NA NA NA

Y106G6H.2a NA NA NA NA

Y54E10BR.6 NA NA NA NA

C12C8.3 (lin-41) 0.5 0.7 0.5 0.2

F11A1.3a (daf-12) 1.6 1.7 1.8 1.3

The relative mRNA levels (let-7(n2853) / wt) for all the 161 genes that could be quantified on the

protein level (see Supplementary Table 2) and for two positive control genes, the known let-7

targets C12C8.3 (lin-41) and F11A1.3a (daf-12), were determined via RT-qPCR. The table lists the

gene name, the average log2 ratio of the mRNA (let-7(n2853) / wt; averaged over all measurements)

and the log2 ratio of the mRNA (let-7(n2853) / wt) for each biological replicate. Out of the 161 genes

tested, the mRNA levels for 5 genes could not be determined in a single biological replicate. The two

positive control genes are listed at the end of the table in bold.


12

Supplementary Table 7: Relative protein abundance of predicted miR-58 targets and

random candidates

Gene CGCMean log2_Ratio

(mir-58(n4640 ) / wt)STDEV log2 Ratio P -value Replicates quantified Group

C30B5.7 - -1.91 2.42 0.1068 2 TargetScan

C44H4.2 sym-5 -0.52 NA NA 1 TargetScan

F55C5.4 - -0.11 NA NA 1 TargetScan

F37A4.8 isw-1 -0.10 NA NA 1 TargetScan

B0348.6a ife-3 -0.09 0.07 0.0062 4 TargetScan

F30H5.1 unc-45 -0.07 0.50 0.3553 3 TargetScan

C33A11.1 - -0.04 NA NA 1 TargetScan

F13D12.6 - 0.07 0.20 0.1351 4 TargetScan

Y39A1B.3 dpy-28 0.16 1.68 0.4218 4 TargetScan

C56G2.1a - 0.20 0.33 0.1193 3 TargetScan

M28.8 - 0.23 0.83 0.3809 2 TargetScan

F18A1.5 rpa-1 0.25 0.23 0.0218 2 TargetScan

R11A8.5 - 0.26 0.06 0.0530 2 TargetScan

F47B7.2a - 0.28 0.08 0.0650 2 TargetScan

C26E6.2 flh-2 0.30 0.05 0.0338 2 TargetScan

F27C1.2a - 0.34 0.39 0.0912 3 TargetScan

F56D3.1 - 0.34 0.29 0.0281 3 TargetScan

F40F8.5 - 0.36 NA NA 1 TargetScan

ZK616.4 - 0.38 0.30 0.0245 3 TargetScan

F58E6.10 unc-42 0.39 NA NA 1 TargetScan

ZK418.9a - 0.40 0.45 0.0578 3 TargetScan

Y54E10BR.6 rpb-7 0.40 NA NA 1 TargetScan

M04B2.3 gfl-1 0.54 NA NA 1 TargetScan

Y48B6A.14 hmg-1.1 0.60 0.16 0.0588 2 TargetScan

Y42A5A.1 - 0.69 NA NA 1 TargetScan

ZK632.13 lin-52 0.87 1.43 0.2736 2 TargetScan

C46F11.4 - 0.92 NA NA 1 TargetScan

F54C9.6 bcs-1 -0.35 0.57 0.1999 3 random

F28A12.4 - -0.33 0.37 0.0018 4 random

R12E2.11 - -0.32 0.48 0.0214 4 random

F13G3.10 - -0.24 0.34 0.2515 2 random

F54D11.1 pmt-2 -0.16 0.19 0.0003 4 random

R10E11.8 vha-1 -0.11 0.41 0.3823 2 random

C48B4.8 - -0.09 1.78 0.4694 2 random

Y69E1A.2 - -0.07 0.40 0.2650 4 random

F35G12.2 - -0.06 0.25 0.2841 4 random

C55A6.9 - -0.06 NA NA 1 random

F32D1.5 - -0.01 0.23 0.4084 4 random

F39H2.3 - 0.00 0.46 0.4982 3 random

D1007.6 rps-10 0.01 0.19 0.4491 4 random

F57B10.10 dad-1 0.06 NA NA 1 random

F46B6.3a smg-4 0.06 0.24 0.2963 4 random

Y66H1A.4 - 0.07 0.39 0.2531 4 random

Y47G6A.8 crn-1 0.12 0.70 0.3991 2 random

F17C8.3 - 0.14 0.24 0.0648 3 random

F33A8.3 cey-1 0.16 0.48 0.2292 4 random

F45H10.2 - 0.17 0.03 NA 1 random

T10E10.2 col-167 0.18 0.19 0.1255 2 random

K01G5.4 ran-1 0.18 0.26 0.0115 4 random

C32E8.3 - 0.27 0.54 0.0953 4 random

F56H11.4 elo-1 0.45 0.38 0.0506 4 random

Quantification data for the 51 proteins analyzed in our targeted proteomics approach. The table lists

the gene name, the CGC synonym (if available), the mean log2 ratio of the protein (mir-58(n4640) /

wt; averaged over all measurements), the Standard-deviation of the log2 ratio of the protein

(mir-58(n4640) / wt), the number of biological replicates (maximum = 4) where the protein could be

quantified by at least one peptide, the P-value for the protein change (one sample Student’s t-test (one

sided)), and their group affiliation from the candidate list. “NA” = “Not Available”.


13

Supplementary Table 10: RT-qPCR primers

Gene Left primer Right primer

C42D8.2 ttcatctgaggagacctacgatt tccttgatttgtgtcttctcgac

F18A1.2 ccttgtgcgatcatatgcttt ttgtcgaatccatgcgttac

Y65B4BL.5 ggtcacctattcgggaaatg cttcaggtaggcgctgatg

Y47G6A.10 caaaggaaataagggagaggataa caactgaaacggcaatttgtt

Y22D7AL.5 ggagtcgctgtgctcaagat catcggtgacacggtcct

C14C10.5 gcgaccagtacgtacagtgaga tgtgtttataggagtatggatgttcg

K07H8.6a ccaagagaacaccattccaaa ctcctcttgatttttctcaatgc

F35G12.8 atcaaaggacccggaagaag gatggcagttgcaatgagaa

F41E6.4a tccgactcctacggtcaagt gagggaactgcgtcagga

C56E6.1 caatgcaacaatattttgagacaa tgtcatgtgtaacaaggtcaaca

K12H4.8 acgaaagcaattatatgacaaaaaga tccaattcgaatgcatagatga

F23H11.4a aacttgatgcgccattgttt tcggattgtgattcagttgc

Y48A6C.4 actggcgccaattatttca cgatcagcttcacaccttga

C47B2.5 gtaccaaacgccacgactg aagacgctcgtcaactctgc

W01F3.3 cctgccacccattcaagt gcggctctcactggtttc

ZC168.4 aatgctgtatcggtcatttgc caagcttcccctgtttgaag

K09D9.1 gggatgagcttcatgagtgg tcaacgagatgatcctccaa

T19A6.2a cgtctgatgtcgttgttcaag cgacgtgtcgacaacgagt

R31.1 gttcgcggcaagctactc ttgcgatacccttctaccttg

F53A9.10a tctgacgaagaggaagtgcttt ctcggccagggactcttc

T21E12.4 agactttgtcgccaagaatga gttctcaacggtaaggaagtcaa

W06A7.3a gatgcatggatcgatttcaa gaaaaaggcgagcaagaaca

F46H5.3a gaccccctgatccaggac ctctccgaggtcggtgttt

F46B6.7 tctgacgaagaagaggaagacaa gtttcatcggcatcgagatt

C01G8.9a agctccgggaggtagtgg tccacctggtgctccatt

ZK180.4 catatgtgcaccggaaagg gcacatgaacacttccatcg

T22B11.5 ttttgtgggctcaagaggag agtgagttgatgcgtggttg

F46E10.8 ttcatttgtttcgtcggaaag agttggaccgatttcacgag

F56A3.4 gtcccaccagttggaacatc tcgagtagggctcgtgtaatg

LLC1.3 gtttgccatccacatccaa aaaatgtgagagagagagatttagacg

K03H1.4 gcaaggacggaattacacca cgatgactccagcatcatagg

F49E10.5 aaacattccggctagatttcc ccggctcttctttgagtacg

Y105C5B.28 tgtgcgagacctatgacaaca ctccatcacctccttgcatc

B0464.7 cgatgcaggcttcgataaag tctttcagccattcgataaaca

F25H2.10 cgtcaagccatgagaggac caacaacttctcaagggatgg

E04F6.3 gagccatgcgagttctcatatt aacgtagcacaaatcttctttcg

R06C7.10 cgctcgaacacgagaagg aatcgtatgggcgggatt

T08B2.10 tcagaaacaagatcgctgga tgtagttgtctctgcgctcac

T23D8.4 tctcagaacttatttgctcacatactc agttcctcttggatgatcattttact

B0041.4 acgctgtttcctcagctattg aagtgggacctcagcgact

K02B12.7 cagggaactcgtctcttggt ccgaatccttgatatttgctg

Y37A1B.5 ttttagaattcatcctgttgaggag aagagcccatccacttacttttt

B0412.4 ctctcacccacgcaagttc ggataagtccgtggtgtcca

F26F12.7 tggaagttcatttccgtatgc cgagacgtaacggattcttca

F48E3.3 cgtgttgaaaaacgtgaagg tttctttgctgctcaccaagt

Y48G1A.5 caatttgctagccgatgtca ctcgatcggaggctgaag

F48E8.5 tgttcaattcatgccacttctt tcgcggattgagaacaca

C01G5.6 tgtttttggaagcgaaaagaa ttgtgacggcaatcatatcttc

C34E10.6 cttccagcagcttccatcc cttggcagagaccttggtg

F56H11.4 accattgccaacaaaggaat tggtgtcaacaagttcgaaaa

W08F4.8 gcacgtcgaggatcaataaga gagtctcgaagaaagtgctcatc

F35H10.10 tcatactgatctattcgaaaaagacg tgaacgatttgaagaagaagatgt

K11D9.2a agatatcttgctgtcggaacct cagtgagtgagctggtagtaggtg

C53B7.1 cgaaaatgggacgactacttg ggatttgcctcattggaaga

Y47G6A.22 ctccgaatggagttcgtgtt gtacgatgcaggttggtcac

Y110A7A.14 gctgccagctatcgtaacagt ccgaacggtctctttcctc

C47E12.5 cgtgattaatgactaccatccttg ccggaggatattcgttttctc

F29G9.4 cggctgggagaaaacctaa cgacgtttcagcctcttatca

Y55F3AR.3 cgctgataacggtgttaaggt tggaggtacatgtctccgaac

F25H2.5 caaggcccatcttgaggtt acgtcaagtccttgccaga

B0365.3 ctcaaaccagccaggaaaag gaagcaatacggacgagagc

T10B5.5a ggtattgagggcaaggatca ttcagcacgtcgagagcat

C38C3.5c ccaccacaaaccaacaacaa aagatcgtaggcgttcttgc

K10C3.3 cccgaaaccagttgtcaaa ttgaaactgattgactgagagca

F40F4.6 tcattcaagtggagggtgtg cgggggtagtagttgttactgg

F20B6.2 tctattgcccgtggacaga cggcaatctcgttatgagg

F02A9.4a tcaacttgctggatacgagatg aaacacgaccagaaactattcca

K04D7.1 gtccatcaagctgtggaaca atcggtgtggcaatcatca

C56G2.1a tgaggatgagaagacgcaga tttgtcgatcgatggtttttc

Y40B10A.1 gctgacggtcgtgatgtg cgagctttccgttctcaatg

C36B1.3 caatttatccgaatgttgaggaa gcctccttttcagtgctgtc

Y110A7A.18 agggcgtaatttgtggaatg ggtccagtaacctcgggaat

F41D9.3a ccatgctgggaagtacaactg tttcacccatggcttttca

Y37E3.8a gaggcaaatccccagtca ggctttaacgatgagtggagtc

T02E1.7 gccaagagatgagcacgag catcaagttcaagcagacacg

T22D1.3a gtaccccaatttccgatacg gctccttgagtttcttctgtgaa

F25H5.4 cgtttcactgacactcgtaagg cgagctcgaagaaaagagaga

ZK673.2 gaagcacggatcagttggag tgtgatgcacttgttttgctt

R07G3.1 tcagcgttgacgcagaag ttgtggtgggtcgagagc

M117.2 gccgccatgaagaaagtg gcaacagagagaaggttacgc

K12G11.3 ctggatggcaacttggagac aattcgcagttgaggcagtt

F57C2.5 ggacggcctcttggaatc caggatttgtgtggagattgg

Y51H4A.3 aggacggaattcgtgaggta caaaatcatgcacttgctcttc

Y73B6BL.18 gccgaacaacaaccgaat cgcaagttcgacttcatacg


14

Gene Left primer Right primer

R11A5.4a tggacatgttccgattctca atgaaacgttgcaccttgg

C18A11.7a tcgacagagagtgaagaccttg gaagtgtggggcctttcc

M18.5 gctgctgattcttcggtttt tctccgaggttgtcgtttg

C38C3.5a ccaacaacaacatctcaaaatga gagcttttggaaagatgtctgc

C53D5.6 cccagacttcaatatcttcaacaa cctccgattccgtggtatt

F11C3.3 cggcgtttttcttgctaaa cacatcggtgtatgattgaagc

F32H2.5 agtcatgctaactggtctcttcaa cgaagtttcttcttggcttgtact

Y37E3.17a tcagaaaatatgtgaaccgtgatt aggagcgtcgttttgcatac

F14B4.3 tcaaggaaggacttcattttgac atgccattccacgagtgatt

C05D11.11a ccagccaatttcgcagtc gagctggggtgaagaatcc

Y48B6A.12 gggaatcacgaaaaatgctg cgtgttgatgtggagagacg

T25C8.2 tcaacatttggctccaagc gatcctccgatccagacg

K07C5.4 gtgccttgaagaccagatcc ttggttccagcttttccaat

Y113G7B.23 cagcagcagaggggatatg tgaccatatggctgctggtat

ZK829.4 tcctacggacgtcttacattca gacggccttggagagagatt

C35D10.16 cgcaacactccaaccatatc tttcgatgtttgaacttccactt

F45E12.5a tggtggccacaaccagat tgataatgacatcagtttcgtttg

Y39B6A.20 caaccagttgacggaatcct cattggtgggacgacctg

ZK1307.6 ttatggagtgccacaacgag ccaactgccaaaagatctcc

C41D11.2 tgttcagtctgacgcagaaaa cattggaattgttggatcacc

F36H1.2 tggattccttccagcttcag tccagatcattaatattatcgtcgaat

Y54E10A.3 aatgtcggtggaggagatgt ggcgactcttttgaattcgtt

C09H10.2 gacaaaccaagccaatcttca tccgagctcgaagtgtttg

Y48B6A.1 cgttcccgactactcttgct tccagatacggacggttcc

F38A3.1 tcgctttcgttggtatctcc gcagaagtcaacctcggagt

F35C5.8 tcagccaaacgatagatcacc aacacaagcgttgcgagtt

B0393.1 ggagttccatgcaacaacaa cacggagaatgaggatctcg

Y63D3A.6a cgacgagaaggccatcaa cgatccggatggtgaatct

W07G4.3 caacggcggagaaagaaa tgaatccttcactgcgaaca

K08F11.3 tgtcgcttgctgaagagaag tcacaaattcttcgagggtctc

C23F12.1a cgcagtgaagagacaatgct cgatgatggtgcgtaggac

C05G5.4 gcaaattgccaacaatgcta ttttcaggttgttgtaagtgctg

R10E4.2a cccaaagatcaataaaactatcaaga ttgttgctggggagcttg

Y54E10A.9a cggtttcaacaacaatggag caaagttgatgccactgtcg

Y54E10BR.6 gtgcgcttacgcttcgtat ggtttcgttcaggtttggac

F13H6.3 agactggtggatttgagcaga tgggtgtgaacacattcagtg

Y65B4A.8 gaaagctatggagattgtgaagaag tccggcttcgattagtgc

K04G2.1 cgaagctgattgttgtcaatttag tgttttgcttgaagtacaaaacct

C37C3.6a cttcagccggaattgacg catttcgtgacaaagttggtg

W01B11.3 atcaagggtctttgtgaccag gcgatttttgaggtagtcgaa

T21B10.7 cagctgctaaggttcttgttga tttctcggcttctttgagga

Y41D4A.5 ctccgctaccggctacact ttaccactagtgagacacgatgc

C41C4.8 cgaaaagatggagctgattga tgattttcccattgcgaatc

Y39B6A.2 caatggctattgaggattcgta gcaacacgaattccttggtta

Y106G6H.2a gacgatccgacaccaaaact tctgattttggcctggttg

W08E12.7 ctccgatgtcaacaaagtgc aactcccatctttgccttga

C36E8.5 cggtgatttgaaccatcttgt gagatcggcattgagctgtc

F20D12.1 aactacacagcagatattccaagagat aacgtccattccaattacgaag

Y17G7B.7 ccggacacaccaaggatg ggttcgtaggcgatcacaat

F26D10.3 gaccattgaggacgagaagc cttcaagatctcgtcgcactt

F36A4.7 acgtcgcctacctacactcc tacgttggcgatgttgga

Y71F9AM.5 tggccggagctgtaactg gaagcggtcgcttttcac

F32D1.10 caattatgcagtctggcttcc ttgggttgtcgtcaagattgt

T03F1.8 cagagcaagaggaaccgaaa actttgtcgaagagcgttgg

Y73B6BL.6 tggagagggctgtaaattgg tgctggctttacctcgaca

T18D3.4 gctccagaagaagcaactcg tggacggttctgtacttgctaa

F08F3.4 attcccgggtattatctcagc gcgtcgtagaaaatttggattg

F58D5.1 tgaagtcacaattggacagagaa tggaatgtgtccgacgtaga

F20D12.5 atcaaggacaaactggacagg tgttgcggatagaatgagga

T07D3.7a tggtcgatagggatcatgg tcgagtcgggatgaacct

F40F11.1 ttacgagaagagacataagaacgtg caaggtctcctgggtggata

B0491.7 tgaagacatcactgtcaaaggatt tgcttgtgtaggcttctagatgaa

T05E11.1 aactggggatctgaaaacgtc accattttccgaagagagca

T02C5.3 gttaattggaaaccaaggatacaga tgccactttgttggcaca

R07E5.14 tacgcactggtggagtacga tcgttgctctgatcaatagctt

T26C12.1 aagtgccaatgttccagagc cgacgttgtcgtagcgagt

C30C11.4 cgtgaagaaagtttcagattgc cgcgtcgttgaacatcag

F54A3.3 ggccggtgtcagagagatt ttcccttaacaacttgactatcctc

F53A2.7 catattgtgcacgagcttcac aattaaactttttcgaagagaattgc

F57B10.3a tggagagacttccgatgagg ggcttcaagaattcgtctgttt

C09D1.1a ccagaaggaaatagctcagca cattgtgatggttgttgttgc

C06A1.1 ggccaaaaacactgttggat gcgaatagccagcttacacg

Y53C12A.4 aattctcatcactcttcttcttgga ttcacggagcatcgaacc

F43C1.2 ggaagttcatgggcaacttt agtgcagaggcgaccatc

T03F1.3 gctgttccaaccattcagc tggtttcaaggtgtacttgtcttg

T20B12.2 gtaatgggaccaaactcgattc tgcatttgcattgaagaacc

Y49A3A.2 CTCTCCAAATACTCCAACTCTGATG GGAAGTGGTGACACCTTCGACCTCC

K08D12.1 CCCGATCACCGATAATATGGTTGTG GGTAGATTGTCACTGGCTTGTTCTC

F35G2.2 CACACAGTTCCAACTCTCAAAGAAG CTTCAAAGTGTCTTCAGTTGGAGG

T05F1.3 CGATCCAGATTGGTTCTACACCCG GTTTCCTCCGTAGACCTTCTTGAAG

C12C8.3 (lin-41 ) tgagcttcagcagttgatgg ttgctgtgcttgttgtggtt

F11A1.3a (daf-12 ) tccaaacagcgatgacgac cctgatccatgatacccattc

All the genes and the corresponding primers that were used to quantify the relative mRNA levels in

let-7(n2853) animals with respect to wild-type animals are listed. The “Roche Universal Probe

Library” was used for the design of most primer pairs (lower case letters). Primers listed in capitals

were self designed. The primers for the two positive control genes (lin-41 and daf-12) are listed at the

end of the table in bold. The primers for the internal control genes that were used for

normalization (F11C3.3, T03F1.3, F43C1.2, T20B12.2, F36A4.7) are also listed.


15

Supplementary Table 11: RNAi clones

RNAi clone RNAi library Regulated Not regulated Controls

F41E6.4a ORFome library YES - -

C01G8.9a ORFome library YES - -

C14C10.5 Ahringer library YES - -

Y48A6C.4 ORFome library YES - -

F35G12.8 Ahringer library YES - -

T22B11.5 ORFome library YES - -

W06A7.3a Ahringer library YES - -

F46H5.3a Ahringer library YES - -

C56E6.1 Ahringer library YES - -

F46E10.8 Ahringer library YES - -

F53A9.10a Ahringer library YES - -

T19A6.2a Ahringer library YES - -

K09D9.1 Ahringer library YES - -

ZC168.4 ORFome library YES - -

F23H11.4a Ahringer library YES - -

F56A3.4 Ahringer library YES - -

R31.1 Ahringer library YES - -

Y47G6A.10 ORFome library YES - -

Y65B4BL.5 ORFome library YES - -

C47B2.5 Ahringer library YES - -

Y22D7AL.5 ORFome library YES - -

F46B6.7 ORFome library YES - -

K12H4.8 Ahringer library YES - -

F20D12.5 ORFome library - YES -

F58D5.1 ORFome library - YES -

T02C5.3 Ahringer library - YES -

B0491.7 Ahringer library - YES -

Y39B6A.2 ORFome library - YES -

T03F1.8 Ahringer library - YES -

T26C12.1 Ahringer library - YES -

Y17G7B.7 Ahringer library - YES -

R07E5.14 Ahringer library - YES -

C30C11.4 ORFome library - YES -

W08E12.7 ORFome library - YES -

C37C3.6a Ahringer library - YES -

F57B10.3a Ahringer library - YES -

F53A2.7 ORFome library - YES -

Y39B6A.20 Ahringer library - YES -

R11A5.4a Ahringer library - YES -

ZK829.4 ORFome library - YES -

C05D11.11a Ahringer library - YES -

F13H6.3 Ahringer library - YES -

F20D12.1 Ahringer library - YES -

C09D1.1a ORFome library - YES -

C06A1.1 Ahringer library - YES -

Y53C12A.4 ORFome library - YES -

W01B11.3 Ahringer library - YES -

F11A1.3 Ahringer library - - YES

C12C8.3 Ahringer library - - YES

C18D1.1 Ahringer library - - YES

ZK617.1 Ahringer library - - YES

Vector Ahringer library - - YES

The 47 genes (“regulated candidates” and “not regulated candidates”; see Supplementary Table 4

and 5, respectively) and the control genes (3 positive and 2 negative controls, see Supplementary

Table 4) that were knocked-down by RNAi and analyzed for suppression of the let-7(n2853) lethal

vulval bursting phenotype are listed. The RNAi clones were either taken from the “Ahringer

library”2,3

or the “ORFome library”4.


16

Supplementary Table 12: Luciferase expression clones

Genelength of cloned 3'UTR

(basepairs)Primer Forward Primer Reverse

entry clones

(pDONR221)

expression clones

(pEM393)

F46B6.7 565 aaaaagcaggctTTTGACATAACTACCTCATCTCAGCTCGC agaaagctgggtCTGCCTAAATCATTTTACCATGAG pMJ002 pMJ008

C12C8.3 1149 aaaaagcaggctACACTTTCTTCTTGCTCTTTACCC agaaagctgggtTTTATTCCAATTATGTTATCAGC pMJ003 pMJ009

F11A1.3a 1393 aaaaagcaggctACCTACTAGAAATCATCTACCAAACG agaaagctgggtGATTTCAAATTTATATTCATTAGTTTTGAC pMJ004 pMJ010

F13D11.2 1379 aaaaagcaggctTGAGGACGTCCTCGTTAAGGAAACACTTCC agaaagctgggtTATTGGAGTTTTTATAAATTGATAAATTGAC pMJ005 pMJ011

T04C12.6 194 aaaaagcaggctATGCACAACTTCGTCAACTTGCACAAAC agaaagctgggtATCAATTTTTAAATTTTTATTCACACCCGC pMJ006 pMJ012

F36A4.7 381 aaaaagcaggctGATTTTTCCCGTTTTTTTGGGCAATTTTCGC agaaagctgggtTCGTTTATTGATTCAAATAATGATTCTGTGG pMJ007 pMJ013

The 3’UTRs of the listed genes were cloned into the destination vector pEM393 to generate the

corresponding expression vectors. The table lists the length of the 3’UTR, the primers used for the

amplification of the 3’UTR (capitals denote the 3’UTR specific sequence and lowercase letters the

attB specific sites), the identifier of the resulting entry clones (pDONR221 (Invitrogen) was used as

the donor vector) and the identifier of the resulting expression clones (pEM393 was used as the

destination vector).


17

Supplementary Results 1: Exact protein quantification in C. elegans using targeted

proteomics

To test if a targeted proteomics approach is suitable for C. elegans whole animal extracts, we

tested SRM for mass spectrometry (MS) measurements in combination with ICAT sample

labeling for relative quantification. We prepared a 1:1 mixture of heavy and light

ICAT-labeled extracts from a mixed stage population of wild-type C. elegans animals,

selected 5 proteins of different abundance classes based on our C. elegans proteome atlas5

and measured their abundance ratios. We measured at least two PTPs per protein and the

mean value for the light:heavy ratios of all the measured peptides was 0.97 (expected ratio 1),

with a relative standard deviation of 15.5 % (Supplementary Fig. 1). Moreover, the ratio of

different PTPs for the same protein were all in good agreement, independent of absolute

signal intensity. This experiment showed that our setup is suitable for the quantification of

proteins of interest in a complex whole animal extract generated from C. elegans.


18

Supplementary Results 2: LET-526 shows a splice-variant specific response to let-7

Previous studies had identified eight let-7 miRNA targets6,7

. We could quantify one of these

in our assay, namely C01G8.9, also known as lss-4 or let-526Ref.1

. As expected, we observed

significant upregulation of LET-526 protein levels in let-7(n2853) mutants (Supplementary

Table 3). However, we noticed that the two measured peptides matching to this protein

showed a strong discrepancy in the strength of regulation. Interestingly, this discrepancy

correlated with the known alternative splicing pattern of LET-526. Whereas the peptide

specific for the LET-526a splice form showed a strong, 3.1-fold change, the peptide matching

to a region common to both splice-isoforms displayed only a weak 1.2-fold upregulation in

let-7(n2853) mutant animals (Supplementary Fig. 2a and b).

To verify this splice-variant specific response through an independent experimental

approach, we determined the extent of polyribosome association of the LET-526a and

LET-526b mRNAs in staged L4 wild-type and ain-2(RNAi); ain-1(ku322) double mutant

animals. The GW182 proteins AIN-1 and AIN-2 are required for miRNA function8,9,10

.

Known miRNA targets display a shift towards the highly translated polysomal fractions in

ain-2(RNAi); ain-1(ku322) mutants relative to wild-type animals due to the lack of miRNA

mediated translational repression8. We found a strong shift of the let-526a mRNA towards

the polyribosome fractions upon AIN-1/AIN-2 depletion (P = 0.03, one-sided Student’s

t-test). By contrast, probes detecting both splice variants failed to detect a statistically

significant shift (P = 0.17, one-sided Student’s t-test; Supplementary Fig. 2c). Taken

together, our results suggest that the let-526a mRNA responds much more strongly to let-7

activity than the let-526b isoform.

The different response of the two splice-variants to let-7 misexpression is intriguing because

based on EST data, both splice variants have the same 3’UTR and would therefore be

expected to contain the same predicted let-7 binding sites1. However, there are three potential

seed sites within the let-526a mRNA isoform specific ORF, which could account for the

strong differences. Alternatively the b isoform could be resistant to let-7-mediated repression

or is, perhaps, simply expressed in a different set of tissues than let-7. Further experiments

will be required to test these hypotheses.


19

Supplementary Discussion: Limits of the targeted proteomics approach

Despite the clear value of our targeted proteomics approach, several challenges remain. First,

although we achieved high sensitivity, we were still not able to quantify a substantial fraction

of the proteins we had in our final target list. In the let-7 related measurements we could

quantify only approximately 50 % of all the proteins we had on our final target list, which

corresponds to about 20 % of the initial unfiltered list. The same was true for the miR-58

related experiments. Several factors might contribute to this moderate overall success rate.

For example, many of the proteins that we could not measure are probably not expressed at

the late L4 stage. Indeed, in a parallel microarray experiment in which we compared total

mRNA levels of mir-58(n4640) mutants with wild-type animals, we could only detect 66 out

of the total 118 predicted targets (data not shown), showing that we in fact quantified about

40 % of the proteins that are actually detectable on the mRNA level. For other proteins, our

current protocol might not be sensitive enough and further improvements on this front are

certainly possible. As we showed above, the use of an automated data processing tool plus

the application of chemically synthesized peptides allowed us to reach the same sensitivity in

unfractionated complex samples (miR-58 related measurements) as previously in fractionated

samples (let-7 related measurements). Combining those two strategies – chemically

synthesized peptides and fractionation – could potentially boost the sensitivity by an order of

magnitude, as has previously been shown in yeast11

.

Second, the applicability of our targeted proteomics method to whole organ or whole animals

is particularly challenging, as the miRNA of interest might be of low abundance or have a

highly restricted expression pattern. Although we could successfully validate predicted

targets for let-7 and miR-58 using whole worm extracts, both are among the more highly

expressed miRNAs12

. We expect that all miRNAs that are expressed at a similar level at

some stage in development should be within easy reach of our method. However, this

corresponds to only about 20 % of all the miRNAs in C. elegans12

. Even if abundantly

expressed, miRNAs that show a restricted expression pattern such as let-7Ref.13

present an

additional level of difficulty, as changes in protein levels of targets that are co-expressed with

let-7 in only a few cells of the animal might be masked by the stable expression of the protein

in the rest of the animal, where let-7 is not present. Indeed, it is for example very likely that

ztf-7 is regulated by let-7 only in a subset of tissues where it is expressed. For miRNAs with

very limited expression patterns, enrichment of the cells expressing the miRNA of interest

might be necessary. Unfortunately, while cell enrichment has been done successfully for

mRNA profiling14

, it is challenging to obtain sufficient material from sorted C. elegans to


20

perform proteomic analyses. We conclude that our methods functions best in situations where

sufficient material can be readily obtained, or where the sample is homogenous (e.g., cell

lines), and expect that the method described here will be even more powerful in such

systems.

Finally, a biological limitation of this targeted proteomics approach is that we are unable to

distinguish primary from secondary targets. Additional experiments will thus invariably be

necessary to establish which hits are direct targets, as we did for ztf-7.


21

References (Supplementary Information)

1. Grosshans, H., Johnson, T., Reinert, K., Gerstein, M. & Slack, F. The Temporal

Patterning MicroRNA Regulates Several Transcription Factors at the Larval to Adult

Transition in. Developmental Cell 8, 321–330 (2005).

2. Fraser, A.G. et al. Functional genomic analysis of C. elegans chromosome I by

systematic RNA interference. Nature 408, 325-30 (2000).

3. Kamath, R.S. et al. Systematic functional analysis of the Caenorhabditis elegans genome

using RNAi. Nature 421, 231-7 (2003).

4. Rual, J. et al. Toward improving Caenorhabditis elegans phenome mapping with an

ORFeome-based RNAi library. Genome Res 14, 2162-8 (2004).

5. Schrimpf, S.P. et al. Comparative Functional Analysis of the Caenorhabditis elegans and

Drosophila melanogaster Proteomes. PLoS Biol 7, e48 (2009).

6. Papadopoulos, G.L., Reczko, M., Simossis, V.A., Sethupathy, P. & Hatzigeorgiou, A.G.

The database of experimentally supported targets: a functional update of TarBase.

Nucleic Acids Res 37, D155-8 (2009).

7. Xiao, F. et al. miRecords: an integrated resource for microRNA-target interactions.

Nucleic Acids Res 37, D105-10 (2009).

8. Ding, X.C. & Grosshans, H. Repression of C. elegans microRNA targets at the initiation

level of translation requires GW182 proteins. EMBO J 28, 213-22 (2009).

9. Ding, L., Spencer, A., Morita, K. & Han, M. The Developmental Timing Regulator AIN-

1 Interacts with miRISCs and May Target the Argonaute Protein ALG-1 to Cytoplasmic

P Bodies in. Molecular Cell 19, 437–447 (2005).

10. Zhang, L. et al. Systematic Identification of C. elegans miRISC Proteins, miRNAs, and

mRNA Targets by Their Interactions with GW182 Proteins AIN-1 and AIN-2. Molecular

Cell 28, 598–613 (2007).

11. Picotti, P., Bodenmiller, B., Mueller, L.N., Domon, B. & Aebersold, R. Full dynamic

range proteome analysis of S. cerevisiae by targeted proteomics. Cell 138, 795-806

(2009).

12. Kato, M., de Lencastre, A., Pincus, Z. & Slack, F.J. Dynamic expression of small non-

coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during

Caenorhabditis elegans development. Genome Biol 10, R54 (2009).

13. Johnson, S.M., Lin, S.Y. & Slack, F.J. The time of appearance of the C. elegans let-7

microRNA is transcriptionally controlled utilizing a temporal regulatory element in its

promoter. Dev Biol 259, 364-79 (2003).

14. Clark, A.M. et al. The microRNA miR-124 controls gene expression in the sensory

nervous system of Caenorhabditis elegans. Nucleic Acids Res 38, 3780-3793 (2010).


Documents

A quantitative targeted proteomics approach to validate ...media.nature.com/original/nature-assets/nmeth/journal/v7/n10/extref/nmeth.1504...Blenkiron, Nicolas J Lehrbach, Xavier C