Embed Size (px)
Citation preview
A Transposon Mutagenesis System for Bifidobacterium longumsubsp. longum Based on an IS3 Family Insertion Sequence,ISBlo11
Mikiyasu Sakanaka,a* Shingo Nakakawaji,a Shin Nakajima,a Satoru Fukiya,a Arisa Abe,a Wataru Saburi,b Haruhide Mori,b
Atsushi Yokotaa
aLaboratory of Microbial Physiology, Research Faculty of Agriculture, Hokkaido University, Sapporo, Hokkaido,Japan
bLaboratory of Biochemistry, Research Faculty of Agriculture, Hokkaido University, Sapporo, Hokkaido, Japan
ABSTRACT Bifidobacteria are a major component of the intestinal microbiota in hu-mans, particularly breast-fed infants. Therefore, elucidation of the mechanisms bywhich these bacteria colonize the intestine is desired. One approach is transposonmutagenesis, a technique currently attracting much attention because, in combina-tion with next-generation sequencing, it enables exhaustive identification of genesthat contribute to microbial fitness. We now describe a transposon mutagenesis sys-tem for Bifidobacterium longum subsp. longum 105-A (JCM 31944) based on ISBlo11,a native IS3 family insertion sequence. To build this system, xylose-inducible or con-stitutive bifidobacterial promoters were tested to drive the expression of full-lengthor a truncated form at the N terminus of the ISBlo11 transposase. An artificial trans-poson plasmid, pBFS12, in which ISBlo11 terminal inverted repeats are separated bya 3-bp spacer, was also constructed to mimic the transposition intermediate of IS3elements. The introduction of this plasmid into a strain expressing transposase re-sulted in the insertion of the plasmid with an efficiency of �103 CFU/�g DNA. Theplasmid targets random 3- to 4-bp sequences, but with a preference for noncodingregions. This mutagenesis system also worked at least in B. longum NCC2705. Char-acterization of a transposon insertion mutant revealed that a putative �-glucosidasemediates palatinose and trehalose assimilation, demonstrating the suitability oftransposon mutagenesis for loss-of-function analysis. We anticipate that this ap-proach will accelerate functional genomic studies of B. longum subsp. longum.
IMPORTANCE Several hundred species of bacteria colonize the mammalian intes-tine. However, the genes that enable such bacteria to colonize and thrive in the in-testine remain largely unexplored. Transposon mutagenesis, combined with next-generation sequencing, is a promising tool to comprehensively identify these genesbut has so far been applied only to a small number of intestinal bacterial species. Inthis study, a transposon mutagenesis system was established for Bifidobacteriumlongum subsp. longum, a representative health-promoting Bifidobacterium species.The system enables the identification of genes that promote colonization and sur-vival in the intestine and should help illuminate the physiology of this species.
KEYWORDS bifidobacteria, functional genomics, insertion sequence, intestinalcolonization, molecular genetics, transposon mutagenesis
Transposon mutagenesis is a classic genetic tool that enables functional character-ization of gene products. It is also suitable as a functional genomic tool for many
bacterial species, because multiple transposon-insertion mutants can be easily andsimultaneously generated (1–4). Accordingly, systems combining transposon mutagen-esis and next-generation sequencing, e.g., insertion sequencing (INSeq) and transposon
Received 8 April 2018 Accepted 16 June2018
Accepted manuscript posted online 22June 2018
Citation Sakanaka M, Nakakawaji S, Nakajima S,Fukiya S, Abe A, Saburi W, Mori H, Yokota A.2018. A transposon mutagenesis system forBifidobacterium longum subsp. longum basedon an IS3 family insertion sequence, ISBlo11.Appl Environ Microbiol 84:e00824-18. https://doi.org/10.1128/AEM.00824-18.
Editor M. Julia Pettinari, University of BuenosAires
Copyright © 2018 American Society forMicrobiology. All Rights Reserved.
Address correspondence to Satoru Fukiya,[email protected].
* Present address: Mikiyasu Sakanaka, IshikawaPrefectural University, Nonoichi, Ishikawa,Japan.
GENETICS AND MOLECULAR BIOLOGY
crossm
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 1Applied and Environmental Microbiology
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
sequencing (Tn-seq), have attracted much attention recently (5). In such systems, therelative abundances of mutants in a library are simultaneously profiled by massivelyparallel sequencing of transposon insertions, leading to the efficient and exhaustiveidentification of genes that contribute to bacterial fitness in vivo or in vitro (5–9).Therefore, transposon mutagenesis is a powerful tool for elucidating the molecularfitness and behavior of commensal bacteria in relevant environments. However, a lackof suitable genetic tools and low transformation efficiencies in most bacterial speciesare a bottleneck.
Bifidobacteria are a member of the gut microbiota in humans, especially predom-inant during the exclusively breast-fed period of life (10, 11). Specific Bifidobacteriumstrains belonging to Bifidobacterium longum and Bifidobacterium animalis subsp. lactisconfer several benefits for health (12, 13), but most of the Bifidobacterium strains arerecalcitrant to genetic manipulation (14). Hence, genetic factors that mediate bifido-bacterial intestinal colonization have not been sufficiently identified. To address thisissue, a transposon mutagenesis system for two strains of Bifidobacterium breve (1, 15)was recently developed using a commercial EZ-Tn5 Transposome kit (Epicentre Bio-technologies). Although the EZ-Tn5 system is potentially applicable to other Bifidobac-terium species, including our host strain, B. longum 105-A, alternative transposonmutagenesis systems are still required to broaden researchers’ choices.
Bacterial insertion sequences, including IS3 elements, have been frequently used intransposon mutagenesis. IS3 elements consist of a transposase gene(s) sandwichedbetween terminal inverted repeats (16). Characteristically, IS3 elements generate aclosed circular DNA molecule as a transposition intermediate (17), here referred to asa transposon circle, which is efficiently recognized by the IS3 transposase (18), and inwhich the inverted repeats are end-joined by an exogenous 3-bp spacer. This featuremay facilitate the development of a transposon mutagenesis system. Accordingly, dualplasmids that separate the transposase from the transposon circle are effective mu-tagenesis systems (Fig. 1), as previously described for Lactobacillus casei using the IS3element IS1223 (2). In such systems, the first plasmid encodes an IS3 transposase under the
FIG 1 Dual-plasmid transposon mutagenesis system based on the IS3 family element. (A) The trans-posase expression plasmid is introduced into targeted bacteria, generating a transposase-expressingstrain. (B) The artificial transposon circle (suicide plasmid) bearing two inverted repeats (IRs) connectedwith a 3-bp spacer is introduced into the transposase-expressing strain, resulting in transposition of theartificial transposon circle into the genome.
Sakanaka et al. Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 2
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
control of a strong promoter and replicates in the target cell. The second plasmid is anartificial transposon circle containing IS3 inverted repeats with a 3-bp spacer and isnonreplicative in the target cell. The artificial transposon circle is transposed into thegenome when introduced into cells expressing transposase from the expression plasmid.
We previously identified ISBlo11, an active IS3 element, in B. longum 105-A, andanalyzed its activity in Escherichia coli (19). Here, we describe an ISBlo11-based trans-poson mutagenesis system in B. longum 105-A, consisting of a transposase expressionplasmid and an artificial transposon circle.
RESULTSActivity of ISBlo11 transposase translated from different start sites in E. coli.
Translation of the ISBlo11 transposase was predicted to start at 51ATG (19), althoughthe gene contains other candidate start codons, including 60ATG, 105ATG, and159GTG. Therefore, we investigated the activity of the putative full-length protein(Tpase51) and that of potentially truncated forms translated from other candidate startcodons (Tpase60, Tpase105, Tpase159, Tpase273, and Tpase354). Generation of the trans-poson circle, a characteristic intermediate of IS3 transposition, was assessed in E. coli byPCR amplification of junctions between inverted repeats using primers Pr-Blo0040 andPr-Blo0128. All transposase variants (Fig. 2) generated transposon circle fragments of�700 bp (Table 1), with 3-bp spacers, as verified by sequencing (data not shown). Theseresults strongly suggest that all transposase variants were functional in E. coli andcapable of generating transposon circles.
Transposition of TnBlo11, a transposon with the spectinomycin resistance (Spr) genesandwiched by 87-bp ISBlo11 termini, into E. coli pCJ105 was also investigated in thepresence of transposase expression plasmids (Fig. 2 and Table 1). Transposition fre-quency, calculated as described in Materials and Methods, varied from �10�3 to 10�2
for Tpase60, Tpase105, Tpase159, Tpase273, and Tpase354 and was highest at 5.72 � 10�2
for Tpase60. In E. coli transformed with pBFS24, a plasmid that does not encode a
FIG 2 Transposon vectors used in E. coli transposition efficiency conjugation assay. (A) Empty transposonvector pBFS24 containing TnBlo11 but lacking ISBlo11 transposase ORFs. (B) Transposon vectors pBFS25,pBFS26, pBFS27, pBFS28, pBFS29, and pBFS33 containing TnBlo11 and the respective ISBlo11 transposaseORFs (gray arrow). Black arrows and vertical-lined arrows indicate ISBlo11 termini and Spr gene,respectively, and comprise the artificial transposon TnBlo11. The open arrow, open box, and vertical-linedbox indicate Kmr gene, lac promoter, and ColE1 ori, respectively. Kmr, kanamycin resistance; Spr,spectinomycin resistance.
IS3 Family-Based Transposon Mutagenesis of B. longum Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 3
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
transposase, the transposition frequency was approximately 103- to 104-fold lower(Table 1). These results indicate that Tpase60, Tpase105, Tpase159, Tpase273, and Tpase354
are functional in E. coli. Unexpectedly, the transposition frequency in E. coli cellsexpressing Tpase51 was variable and dependent on donor colonies. Indeed, TnBlo11transposition was not detected in 7 of 13 colonies tested and was highly variable in theremaining six. These results were inconsistent with the apparent generation of trans-poson circles. One explanation may be that pBFS25, the plasmid encoding Tpase51, isunstable in the E. coli donor strain DH1/pCJ105.
IS3-based transposon mutagenesis in B. longum 105-A. B. longum 105-A wasidentified to the subspecies B. longum subsp. longum based on genotype and pheno-type (see supplemental Results and Tables S1 to S3 in the supplemental material). Thisstrain was deposited in the Japan Collection of Microorganisms (RIKEN, Tsukuba,Ibaraki, Japan) as B. longum subsp. longum JCM 31944, but is here referred to as B.longum 105-A to avoid redundancy and confusion. Tpase51 and Tpase60 were used intransposon mutagenesis of B. longum 105-A, with Tpase51 being the computationallypredicted full-length protein and Tpase60 being the most active in E. coli. The intro-duction of the artificial transposon circle pBFS12 in the presence of xylose generatedSpr 105-A/pBFS100 (Tpase51) and 105-A/pBFS53 (Tpase60) transformants with efficien-cies of 1,222 � 215 CFU/�g DNA and 539 � 373 CFU/�g DNA, respectively (Fig. 3 andTable 2). The respective transformants were confirmed to harbor the Spr gene by colonyPCR at proportions of 98.6% (141 out of 143) and 95.4% (63 out of 66). These resultsdemonstrate that the activity of Tpase51 is higher than that of Tpase60, at least in B.longum 105-A. In contrast, the transposition efficiency in cells transformed with pBFS34,which do not express transposase from a plasmid, was low, but not zero (Table 2),suggesting that indigenous transposase genes other than those encoding Tpase51 andTpase60 may catalyze pBFS12 insertion into B. longum 105-A. Nevertheless, these resultsstrongly suggest that Tpase51 or Tpase60 promotes the transposition of the artificialtransposon circle pBFS12.
We also investigated whether the promoter driving transposase expression affectstransposition efficiency. In the presence of glucose to repress xylose-inducible pfruEKFG_Blo
activity and Tpase51 expression in 105-A/pBFS100 (20), pBFS12 transposition decreased10-fold to 125 � 63 CFU/�g DNA (Table 2). It was supported by the quantitativereal-time PCR (qRT-PCR) analysis revealing that Tpase51 expression in 105-A/pBFS100was significantly lower in the presence of glucose than in the presence of xylose (TableS4). Conversely, transposition efficiency in the presence of glucose remained high in105-A/pBFS101, which constitutively expresses Tpase51 from pxfp_Bbr rather than frompfruEKFG_Blo (Table 2; see Materials and Methods for detailed information on the pro-moters). These results imply that transposase abundance is an important determinantof transposition efficiency. Interestingly, pEC0079 elicited only modest transposition(Table 2), although pEC0079 is identical to pBFS12, except that the spacer between
TABLE 1 Effects of each transposase of ISBlo11 on the generation of transposon circleand transposition frequency of TnBlo11 in E. coli
Plasmid TransposaseTransposoncirclea
Transposition frequency(mean � SD)
No. of biologicalreplicates
pBFS24 None � 4.47 � 1.83 � 10�6 3pBFS25 Tpase51 � Poorly reproducibleb 13pBFS26 Tpase60 � 5.72 � 2.67 � 10�2 5pBFS27 Tpase105 � 5.50 � 2.68 � 10�3 4pBFS28 Tpase159 � 4.28 � 2.81 � 10�3 4pBFS29 Tpase273 � 2.53 � 2.03 � 10�3 5pBFS33 Tpase354 � 2.00 � 0.79 � 10�3 4aPCR product of the transposon circle was detected (�) or not detected (�) by agarose gel electrophoresisanalysis.
bAmong 13 colonies of E. coli DH1/pCJ105 harboring pBFS25, the transposition frequency was unmeasurablein the seven colonies due to no detection of transconjugant harboring TnBlo11. In contrast, the other sixcolonies indicated the transposition at the following frequencies: 5.94 � 10�6, 2.75 � 10�5, 1.04 � 10�4,2.98 � 10�4; 3.07 � 10�3, and 1.09 � 10�2.
Sakanaka et al. Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 4
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
inverted repeats is 3 bp in pBFS12 and 27 bp in pEC0079. Collectively, these resultsvalidate the hypothesis that an artificial IS3 transposon circle promotes transposonmutagenesis.
We note that transposase expression plasmids were lost in most Spr transformantsat 37°C. For example, 65.3% � 20.6% of the transformants generated by introducingpBFS12 into xylose-grown 105-A/pBFS100 were sensitive to chloramphenicol (Cm).Similar tendencies were observed in Spr transformants generated by other combina-tions of transposase expression plasmids, transposons, and carbohydrates (data notshown). As the loss of transposase expression plasmids would prevent secondarytransposition, these results indicate that artificial transposon circles are stably insertedinto the genome. This interpretation was verified by Southern hybridization, by whichtransposons inserted into the chromosome in four transposon mutants were found tobe stable for at least 50 generations (Fig. 4). Also, a single band of the expected size wasobserved in each mutant, demonstrating that a single transposon was inserted.
FIG 3 Plasmids used in transposon mutagenesis of B. longum subsp. longum. (A) Transposase expression plasmidspBFS100 and pBFS53 carrying ISBlo11 transposase ORFs with protein products likely translated from 51ATG and60ATG, respectively. The open arrow designates a chloramphenicol resistance (Cmr) gene. Gray, black, and verticalline boxes indicate temperature-sensitive (Ts) pTB6 replicon, Thup (putative transcriptional terminator of a geneencoding histone-like protein HU), and pSC101 replicon, respectively. The white box and gray arrow indicatepfruEKFG_Blo and transposase ORF, respectively. (B) Transposase expression plasmid pBFS101. The symbols are thesame as in panel A, except that the white box indicates pxfp_Bbr. (C) Artificial DNA fragment containing both ISBlo11termini. The synthesized fragment was employed in constructing pEC0079 (D), which was then used to constructpBFS12 (E). Black arrows indicate ISBlo11 both termini, separated by a 27-bp spacer. Positions of the XhoI and NdeIrestriction sites are shown. (D) Construct of pEC0079. The vertical-lined box and arrow indicate ColE1 ori and Spr
gene, respectively. The black box and arrows indicate multicloning site (MCS) and ISBlo11 termini (separated by27-bp spacer), respectively. (E) Artificial transposon circle pBFS12. The symbols are the same as in panel D. ISBlo11termini are separated by a 3-bp spacer, completing the artificial transposon circle. The region between ISBlo11termini, containing ColE1 ori, Spr gene, and MCS, is the ISBlo11 transposase substrate.
IS3 Family-Based Transposon Mutagenesis of B. longum Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 5
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
Specificity of transposon insertion sites in the B. longum 105-A genome. Theinsertion sites of the artificial transposon circle pBFS12 were then determined toevaluate potential targets in the B. longum 105-A genome (GenBank accession no.AP014658.1). Transposon insertion was detected in both coding and noncoding regionsin 105-A/pBFS100, although the noncoding regions appear to be preferred (Table 3).Cointegration or tandem transposition was not observed, but multiple mutants inwhich the transposon was inserted at the same site were obtained (Table 3). Theinsertion of pBFS12 also resulted in a duplication of nonconserved target sequences,which are typically 3 to 4 bp. Similar trends were observed in 105-A/pBFS53 cells.Collectively, insertions into noncoding regions occurred in 59.6% of the mutants, whileinsertions into coding regions occurred in the remaining 40.4% of the mutants. Theseresults suggest that pBFS12 targets random 3- to 4-bp target sequences, although thetranspositions catalyzed by Tpase51 and Tpase60 tend to occur in noncoding regions, atleast in B. longum 105-A.
Potential application of IS3-based transposon mutagenesis in other Bifidobac-terium strains. We tested the versatility of our IS3-based transposon mutagenesissystem using B. longum NCC2705 and Bifidobacterium bifidum JCM 7004, in which atargeted gene mutagenesis has been conducted (21, 22). Successful transformationwith the transposase expression plasmids pBFS34 and pBFS101 was observed only in B.longum NCC2705, and these strains were named NCC2705/pBFS34 (lacking a trans-posase open reading frame [ORF]) and NCC2705/pBFS101 (Tpase51 expression underthe control of pxfp_Bbr). Then, the introduction of the artificial transposon circle pBFS12into NCC2705/pBFS101 generated Spr transformants with efficiency of 684 CFU/�gDNA (averaged value of two separate experiments). All tested transformants (total of 14
TABLE 2 Transposition efficiency of transposons into B. longum 105-A genome
Straina Transposase Promoter
Transposition efficiency(CFU/�g DNA)b
pEC0079 pBFS12
4% Xylose105-A/pBFS34 None None 31 � 10 108 � 58105-A/pBFS100 Tpase51 pfruEKFG_Blo 61 � 49 1,222 � 215105-A/pBFS53 Tpase60 pfruEKFG_Blo ND 539 � 373
1% Glucose105-A/pBFS34 None None 3 � 5 14 � 17105-A/pBFS100 Tpase51 pfruEKFG_Blo 81 � 60 125 � 63105-A/pBFS101 Tpase51 pxfp_Bbr 156 � 56 3,287 � 2,405
aXylose and glucose were each used as the sole carbohydrate added to the medium.bThe data are represented as means � standard deviation (n � 3). ND, not determined.
FIG 4 Southern hybridization analysis for evaluating the stability of the transposed pBFS12 in thegenomes of transposon mutants. NcoI-digested genomic DNAs (4 �g) from B. longum 105-A and fourtransposon mutants were electrophoresed in a 0.7% agarose gel and transferred to Hybond-N� nylonmembrane (GE Healthcare UK Ltd.). Lane P, NdeI-digested pBFS12 (10 ng) as a positive control forhybridization; lane N, B. longum 105-A as a negative control for hybridization; lanes 1 to 4, mutants51A-206, 51A-210, 60A-38, and 60A-112, respectively. a and b are DNAs prepared from precultures and50th-generation subcultures, respectively. The sizes of the DNA molecular weight marker (�-HindIIIdigest; TaKaRa Bio, Inc.) are indicated to the left of the panel. A fragment of the Spr gene region amplifiedfrom mutant 60A-38 genome was used as a probe. Signal detection was for 30 min.
Sakanaka et al. Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 6
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
TABLE 3 Genomic positions of an insertion of pBFS12 in B. longum 105-A and NCC2705
StrainDuplicated targetsequence (5= to 3=) Insertion locationa Geneb Predicted gene function
105-A/pBFS10051A-40 CTG 4129–4131 in pBFS10051A-211 GAT 4133–4135 in pBFS10051A-204 TGG 192539–192541 BL105A_0159 Hypothetical protein51A-41 TTCG 198534–198537 BL105A_0165/016651A-214 TCG 198535–198537 BL105A_0165/016651A-212 ATA 206169–206171 BL105A_0168/016951A-220 TCCT 383139–383142 BL105A_0327 Inosine-uridine preferring nucleoside hydrolase51A-215 CCT 383140–383142 BL105A_0327 Inosine-uridine preferring nucleoside hydrolase51A-44 TTC 416318–416320 BL105A_0361/036251A-46 TTC 416318–416320 BL105A_0361/036251A-210 GTC 508225–508227 BL105A_0430/043151A-4 TGG 853120–853122 BL105A_0721/072251A-219 GGT 853121–853123 BL105A_0721/072251A-6 GGTG 853121–853124 BL105A_0721/072251A-50 GGTG 853121–853124 BL105A_0721/072251A-45 GGTG 853121–853124 BL105A_0721/072251A-3 AGC 1455432–1455434 BL105A_1268 Putative acetyltransferase51A-206 AGC 1455432–1455434 BL105A_1268 Putative acetyltransferase51A-9 TTC 1651416–1651418 BL105A_1440 Hypothetical protein51A-49 TTC 1651416–1651418 BL105A_1440 Hypothetical protein51A-42 CTT 1677392–1677394 BL105A_1458 Hypothetical protein51A-213 CTT 1677392–1677394 BL105A_1458 Hypothetical protein51A-218 CTT 1677392–1677394 BL105A_1458 Hypothetical protein51A-207 AATT 1947489–1947492 BL105A_1708/170951A-217 AAC 1950376–1950378 BL105A_1710/171151A-48 GAG 1975215–1975217 BL105A_1723/172451A-202 GGG 2074929–2074931 BL105A_1805/180651A-47 CAC 2127457–2127459 BL105A_1844/1845
105-A/pBFS5360A-113 TATT 83734–83737 BL105A_0073 DNA/RNA helicase of DEAD/DEAH box family60A-25 TAG 125567–125569 BL105A_0103 Amidase domain protein60A-1 GTT 195068–195070 BL105A_0161/016260A-17 GTT 195068–195070 BL105A_0161/016260A-19 GTT 195068–195070 BL105A_0161/016260A-118 GTT 195068–195070 BL105A_0161/016260A-7 TTCG 198534–198537 BL105A_0165/016660A-10 TTCG 198534–198537 BL105A_0165/016660A-11 TCG 198535–198537 BL105A_0165/016660A-27 TCG 198535–198537 BL105A_0165/016660A-102 TCCT 383139–383142 BL105A_0327 Inosine-uridine preferring nucleoside hydrolase60A-104 TCCT 383139–383142 BL105A_0327 Inosine-uridine preferring nucleoside hydrolase60A-18 CCT 383140–383142 BL105A_0327 Inosine-uridine preferring nucleoside hydrolase60A-23 TTC 416318–416320 BL105A_0361/036260A-106 TTC 416318–416320 BL105A_0361/036260A-103 AAC 499714–499716 BL105A_0422 Transposase60A-101 GTG 533621–533623 BL105A_0453/045460A-114 TTG 550823–550825 BL105A_0464 Hypothetical protein60A-30 GGTG 853121–853124 BL105A_0721/072260A-9 GTG 853122–853124 BL105A_0721/072260A-117 GTC 857835–857837 BL105A_0725/072660A-119 GTC 857835–857837 BL105A_0725/072660A-112 GAAA 1139763–1139766 BL105A_0993/099460A-122 TAG 1276471–1276473 BL105A_1122 Hypothetical protein60A-109 TTC 1651416–1651418 BL105A_1440 Hypothetical protein60A-111 CTT 1677392–1677394 BL105A_1458 Hypothetical protein60A-115 CTT 1677392–1677394 BL105A_1458 Hypothetical protein60A-13 GAT 1947393–1947395 BL105A_1708/170960A-107 GTT 2139079–2139081 BL105A_1850 Putative transcriptional regulator60A-121 GAT 2155511–2155513 BL105A_1857/185860A-38 CCA 2203691–2203693 BL105A_1883 �-Glucosidase
(Continued on next page)
IS3 Family-Based Transposon Mutagenesis of B. longum Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 7
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
strains) were confirmed to harbor the Spr gene by colony PCR (data not shown). Incontrast, the transposition efficiency in cells transformed with pBFS34 lacking a trans-posase ORF was under the detection limit (4 CFU/�g DNA). Although the artificialtransposon circle pBFS12 seemed to have the propensity to transpose into IS256 familyISBlo5 copies in B. longum NCC2705 (Table 3; note that B. longum 105-A lacks ISBlo5copies), these results strongly suggest that our transposon mutagenesis system isavailable in other Bifidobacterium strains.
Characterization of the BL105A_1883 transposon mutant. We characterizedmutant 60A-38 (Table 3) to verify a loss of gene function due to transposon mutagen-esis. In this mutant, the transposon was inserted into BL105A_1883 (1,821 bp), whichputatively encodes an �-glucosidase belonging to glycoside hydrolase family 13 sub-family 31 (GH13_31; 607 amino acid residues; predicted molecular mass, 68.1 kDa),which shares 90% amino acid identity to Bbr_1855 �-glucosidase in B. breve UCC2003.Bbr_1855 �-glucosidase was found to cleave an �,�-(1↔1)-glucosidic linkage in treh-alose (Glc�1-1�Glc) and �-(1¡6)-glucosidic linkage in palatinose (isomaltulose; Glc�1-6Fru) and isomaltose (Glc�1-6Glc) (23). In cell extracts from mutant 60A-38, �-glucosidase activity was barely detectable against trehalose and significantly loweragainst palatinose and isomaltose than in lysates from B. longum 105-A when thestrains were cultured in the presence of isomaltose (Fig. 5) and trehalose (Fig. S1). It ispossible that the residual �-glucosidase activities against palatinose and isomaltose aredue to other �-glucosidase isozyme(s).
In line with these results, the growth of mutant 60A-38, relative to that of B. longum105-A, was severely decreased in the medium supplemented with trehalose (Fig. 6B).
TABLE 3 (Continued)
StrainDuplicated targetsequence (5= to 3=) Insertion locationa Geneb Predicted gene function
NCC2705/pBFS1015 TAG 623132–623134 ISBlo5b (noncoding region)3 CAA 722972–722974 BL0925/09261 Not determinedc 1143242–1143244? BL0235 Glycosyltransferase4 TAA 1505649–1505651 ISBlo5f (noncoding region)2 TAA 1683182–1683184 ISBlo5d (noncoding region)6 TAA 1683182–1683184 ISBlo5d (noncoding region)
aThe complete genome sequences of B. longum 105-A (GenBank accession no. AP014658.1) (32) and B. longum NCC2705 (GenBank accession numbers AE014295.3and AF540971.1) (51) were used as references.
bSlashes indicate an insertion of pBFS12 in an intergenic region.cDuplicated target sequence and precise insertion location could not be determined due to unsuccessful sequencing analysis of the ISBlo11 3= terminus, which wasPCR amplified by two-step semidegenerate PCR.
FIG 5 �-Glucosidase activity in B. longum 105-A (blue bars) and mutant 60A-38 (magenta bars). Crudeextracts were prepared from cells grown on isomaltose and assayed against trehalose, palatinose, orisomaltose contained at 10 mM in the reaction mixture. �-Glucosidase activity was determined induplicate based on the amount of liberated glucose in three biological replicates. Data are mean values �standard deviations. One unit of enzyme activity was defined as the amount of enzyme that hydrolyzes 1�mol substrate in 1 min. Asterisks indicate significant differences in �-glucosidase activity between B.longum 105-A and mutant 60A-38 (**, P 0.01) assayed by Student’s t test. N.D., not detected.
Sakanaka et al. Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 8
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
The specific growth rate (�) of the mutant in the first 24 h was 2.2-fold lower than thatof B. longum 105-A in the presence of palatinose (0.50 versus 1.10). The final opticaldensity at 660 nm (OD660) at 120 h was also significantly lower in the mutant than inthe B. longum 105-A (Fig. 6C). Interestingly, growth was comparable between themutant and parental strain in the presence of isomaltose or glucose (Fig. 6A and D), eventhough �-glucosidase activity against isomaltose was significantly diminished in the mu-tant (Fig. 5). Hence, the decreased activity may still be sufficient for growth on isomaltose.Taken together, the data indicate that BL105A_1883 encoding �-glucosidase was inacti-vated by a transposon insertion and that this enzyme contributes to the growth of B.longum 105-A on trehalose and palatinose.
DISCUSSION
Transposon mutagenesis is currently available only for a small number of intestinalbacteria, including bifidobacteria (1, 2, 7, 24–26), mainly because of their low transfor-mation efficiency. Hence, high efficiency is essential for transposon mutagenesis ofthese species. We have now constructed a dual-plasmid system that enables trans-poson mutagenesis in B. longum 105-A and NCC2705. The system consists of an ISBlo11transposase expression plasmid and an artificial transposon circle that mimics thetransposition intermediate. Transposon mutants were obtained with an efficiency of�103 CFU/�g DNA that is sufficient to construct a saturated transposon library, asdiscussed below. The data suggest that we have achieved transposon mutagenesis inbifidobacteria other than B. breve (1).
The activity of ISBlo11 transposase was first assessed using an E. coli F-plasmidconjugation system (Table 1), and two forms of the enzyme translated from differentstart codons, Tpase51 and Tpase60, were subsequently used for transposon mutagenesisof B. longum 105-A. Tpase51 was more active (Table 2), although the transpositionevents catalyzed by this form were poorly reproducible in E. coli (Table 1). Consideringthat 51ATG was predicted in silico as the primary start codon of the ISBlo11 transposase,Tpase51 appears to be the canonical enzyme, although the protein itself, its expression,and/or the plasmid encoding it might be unstable in E. coli.
In our system, the expression of transposase is driven by the bifidobacterial pro-
FIG 6 The effect of different carbohydrates on the growth of B. longum 105-A and 60A-38 mutant in 1/2MRSCS medium. Cells were precultured overnight in 1/2 MRSCS medium containing 1% glucose. Afterwashing with saline, cells were inoculated into 1/2 MRSCS medium containing different carbohydrates togive an OD660 of 0.05 and cultured at 37°C. The graphs represent growth in the presence of 1% glucose(A), 1% trehalose (B), 1% palatinose (C), and 1% isomaltose (D). Blue and magenta circles designate B.longum 105-A and mutant 60A-38, respectively. Data are presented as mean values � standarddeviations (n � 3). Significant differences (P 0.01, Student’s t test) of the final OD660 (120 h) betweenB. longum 105-A and mutant 60A-38 were observed only when grown in the presence of trehalose (B)and palatinose (C).
IS3 Family-Based Transposon Mutagenesis of B. longum Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 9
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
moters pfruEKFG_Blo and pxfp_Bbr that were previously characterized by measuring thepromoter activities using a reporter assay system (20). The activities of pfruEKFG_Blo on 4%(wt/vol) xylose and of pxfp_Bbr on 1% (wt/vol) glucose were at a similar level and wereover 25-fold higher than that of pfruEKFG_Blo on 1% (wt/vol) glucose (20). Accordingly,strong promoter activity in 105-A/pBFS100 and 105-A/pBFS101 grown on 4% (wt/vol)xylose and 1% (wt/vol) glucose, respectively, resulted in over 10-fold higher transpo-sition efficiency than weak promoter activity in 105-A/pBFS100 grown on 1% (wt/vol)glucose (Table 2), suggesting a positive correlation between promoter strength andtransposition efficiency. In practical terms, however, pfruEKFG_Blo is preferable, as addi-tional transposition events can be prevented as needed by changing carbohydrates inthe medium to suppress the transposase expression (20).
The transposase expression plasmids pBFS53, pBFS100, and pBFS101 carry a bifido-bacterial replicon from the temperature-sensitive plasmid pKO403, which replicates inB. longum 105-A at 30°C but not at 42°C (27). However, pBFS53 was efficiently lost fromB. longum 105-A in the absence of Cm selection at 30°C, 37°C, and 42°C (data notshown). In addition, all plasmids were apparently lost from most transposon mutantsgrown at 37°C without Cm (see Results, and data not shown). The poor stability of theseplasmids even at low temperatures is possibly due to decreased expression of plasmidreplication proteins, which in turn may be due to structural changes in these plasmidsin comparison to pKO403. Nevertheless, the accelerated loss of these plasmids will alsoenhance the stability of insertions, since secondary transpositions will be negligible inthe absence of transposase. The stability of inserted transposons was experimentallyverified by Southern hybridization (Fig. 4).
The use of the artificial transposon circle pBFS12 was inspired by IS911, a represen-tative IS3 element, for which a similar artificial transposon circle promotes efficienttransposition (18). A comparable system was also adopted in transposon mutagenesisof Lactobacillus via IS1223, also an IS3 element, although the impact of the artificialtransposon circle was not evaluated (2). In contrast, we found that the artificialtransposon circle pBFS12, which contains a 3-bp spacer between inverted repeats,increased transposition frequency �20-fold in comparison to the control plasmidpEC0079, which contains an extended spacer of 27 bp (Table 2). These results indicatethat the length of the spacer in the artificial transposon is critical for efficient transpo-sition.
pBFS12 targets random 3- to 4-bp sequences but appears to favor noncodingregions (Table 3). Considering that the fraction of noncoding sequences in the B.longum genome is much smaller than the fraction of coding regions, bias towardnoncoding regions suggests that insertion is not entirely random. This characteristic isdisadvantageous for random transposon mutagenesis but is widely known (28). Forexample, insertions of IS2 and IS3, which are both IS3 elements, were also reported tobe biased toward noncoding regions in E. coli (29). DNA secondary structure wasrecently proposed as the basis of biased insertion (28, 30), although this has not beenverified for ISBlo11.
A saturated transposon library, which contains at least one mutation in almost allnonessential genes in the genome, is crucial for functional genomics. For example, theB. breve UCC2003 transposon library of �20,000 mutants was reported to be saturated,with 99.99% probability of finding a mutation in a given gene (1). This probability, P,was calculated as 1 � (1 � X/G)n, where X is the average length of genes in bp, G is thegenome size in bp, and n is the number of mutants in the library (31). Accordingly, ncan be determined as [log(1 � P)]/[log(1 � X/G)]. In B. longum 105-A, the n required toachieve saturation with P of 0.9999 (99.99%) is 19,764, given that X for this strain is1,067 bp and G is 2,290,145 bp (32). The required number of mutants can theoreticallybe obtained from 42 transformation experiments using a combination of 105-A/pBFS100 and pBFS12 (Table 2), given that transposition is biased toward noncodingregions, with only approximately 40% of transpositions occurring in coding regions.Although essential genes are not considered in these calculations, a saturated trans-poson library appears to be achievable.
Sakanaka et al. Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 10
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
The function of BL105A_1883, a gene encoding a putative �-glucosidase, wascharacterized in the transposon insertion mutant 60A-38 to demonstrate the value ofour method. The physiological function of BL105A_1883 and its homologs has beenpredicted based on Bbr_1855, a gene from B. breve UCC2003 that shares 90% aminoacid identity to BL105A_1883 (23) but has not been experimentally verified. We nowreport that BL105A_1883 has �-glucosidase activity against trehalose, palatinose, andisomaltose and promotes the growth of B. longum 105-A on trehalose and palatinose(Fig. 5 and 6). These results also strongly suggest that under the growth conditionstested, BL105A_1883 is the main �-glucosidase for the assimilation of trehalose by B.longum 105-A, while multiple �-glucosidases, including BL105A_1883, mediate palati-nose and isomaltose assimilation.
To the best of our knowledge, B. longum 105-A has at least two other putative�-glucosidases, BL105A_0107 and BL105A_1885, which have 96% and 99% amino acididentity to Bbr_0111 (Agl3) and Bbr_1857 (MelD), respectively, in B. breve UCC2003 (33).BL105A_1883 and BL105A_1885 are near each other, and a transposon insertion intoBL105A_1883 was shown to reduce the transcription level of BL105A_1885 (0.6-foldthat of B. longum 105-A), possibly due to polar effects (Table S5). However, its homologBbr_1857 prefers trisaccharides rather than disaccharides (e.g., palatinose) and haslower hydrolytic activity against palatinose than Bbr_0111 (33). Also, BLLJ_0112, aBL105-A_0107 homolog in B. longum JCM 1217T with 96% amino acid identity, hasbeen verified to hydrolyze isomaltose (34). Therefore, the residual �-glucosidase activityin mutant 60A-38 against disaccharides, such as palatinose and isomaltose, may beattributed primarily to BL105_0107, although future genetic and enzymatic character-ization is necessary. It should be noted that a homolog of �-glucosidase Agl2(Bbr_0559) in B. breve UCC2003 (23) is absent in B. longum 105-A.
Application of IS3-based transposon mutagenesis to other bifidobacterial species orstrains is a future issue. Although the mutagenesis system we describe was demon-strated to work in B. longum 105-A and NCC2705, genetically manipulatable strains,application to other Bifidobacterium species or strains may require optimization oftransposase expression and of the transformation protocol (35). For example, pre-methylation by heterologous expression of Bifidobacterium methylases in the cloninghost may be required to protect vectors against restriction enzymes and therebyenhance transformation efficiency (36–38). It should be noted that B. longum strainslacking ISBlo5 copies may be suitable for generation of a saturated transposon library,because the artificial transposon circle pBFS12 prefers an insertion into IS256 familyISBlo5 copies (Table 3). Among 18 complete genome-sequenced B. longum subsp.longum or B. longum subsp. infantis strains, no ISBlo5 copies were observed in sevenstrains (105-A, BBMN68, JCM 1217T, 157F, CCUG 30698, F8, and 35624).
In summary, a transposon mutagenesis system based on IS3 was developed for B.longum subsp. longum. We anticipate that this system will accelerate functional genom-ics of this species, although its suitability for other Bifidobacterium species remains tobe established.
MATERIALS AND METHODSBacterial strains, plasmids, and culture conditions. Bacterial strains and plasmids are listed in
Table 4. B. longum NCC2705 was kindly provided from Nestec Ltd., Nestlé Research Center Lausanne(Lausanne, Switzerland). E. coli DH5� and JM109 were used as DNA cloning hosts. E. coli DH1/pCJ105 (19)and HB101 were used as a conjugation donor and recipient, respectively. E. coli was grown aerobicallyat 30°C or 37°C in LB or super optimal broth with catabolite repression (SOC) medium (39). B. longum105-A (40) was used as mutational target and was cultured anaerobically at 37°C in half-strength de Man,Rogosa, and Sharpe medium (pH 6.5) (41) containing 1% (wt/vol) glucose, 0.02% (wt/vol) L-cysteine–HCl,and 0.34% (wt/vol) sodium ascorbate (1/2 MRSCS medium). When required, glucose was replaced with1% (wt/vol) isomaltose (Tokyo Chemical Industry Co., Ltd., Tokyo, Japan), 1% (wt/vol) palatinose (TokyoChemical Industry Co., Ltd.), 1% (wt/vol) trehalose (Nacalai Tesque, Inc., Kyoto, Japan), or 4% (wt/vol)xylose (Wako Pure Chemical Industries, Ltd., Osaka, Japan). Anaerobic cultures were grown in a sealedAnaeroPack pouch (Mitsubishi Gas Chemical Co., Inc. Tokyo, Japan) or in an anaerobic chamber (CoyLaboratory Products, Inc., Grass Lake, MI, USA) with 80% N2, 10% CO2, and 10% H2. When required, mediawere supplemented with Cm (10 �g/ml for E. coli and 2.5 �g/ml for B. longum), kanamycin (50 �g/ml),nalidixic acid (15 �g/ml), streptomycin (150 �g/ml), and spectinomycin (75 �g/ml).
IS3 Family-Based Transposon Mutagenesis of B. longum Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 11
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
DNA manipulations. PCR primer pairs and template DNAs are listed in Table 5. Targets wereamplified with TaKaRa Ex Taq (TaKaRa Bio, Inc., Otsu, Japan), Kapa Taq Extra DNA polymerase (NipponGenetics Co., Ltd., Tokyo, Japan), PrimeSTAR GXL DNA polymerase (TaKaRa Bio), PrimeSTAR HS DNApolymerase (TaKaRa Bio), and KOD FX Neo (Toyobo Co., Ltd., Osaka, Japan). DNA and PCR productsdigested with restriction enzymes were purified as needed according to published methods (20, 42), andB. longum genomic DNA was extracted as reported earlier (42). B. longum was transformed by electro-poration at 12 kV/cm, 25 �F, and 200 (42), and colony PCR was conducted as described previously (20,42). Nucleotide sequences were obtained by Eurofins Genomics K.K., Tokyo, Japan.
Subspecies identification of B. longum 105-A. To identify B. longum 105-A to the subspecies level,recA at positions 373 to 603 (231 bp), tuf at positions 136 to 1199 (1,064 bp), and ldh at positions 388
TABLE 4 Bacterial strains and plasmids used in this study
Strain or plasmid Descriptiona Reference or source
StrainsBifidobacterium
B. bifidum JCM 7004 Isolate from intestine of infant National BioResource Project(Riken, Japan)
B. longum NCC2705 Isolate from infant feces Nestec Ltd. (Lausanne,Switzerland) (51)
NCC2705/pBFS34 B. longum NCC2705 harboring pBFS34 This studyNCC2705/pBFS101 B. longum NCC2705 harboring pBFS101 This study
B. longum subsp. longum105-A (JCM 31944) Isolate from adult human feces 40105-A/pBFS34 B. longum subsp. longum 105-A harboring pBFS34 This study105-A/pBFS53 B. longum subsp. longum 105-A harboring pBFS53 This study105-A/pBFS100 B. longum subsp. longum 105-A harboring pBFS100 This study105-A/pBFS101 B. longum subsp. longum 105-A harboring pBFS101 This study
Escherichia coliDH1/pCJ105 E. coli DH1 harboring F-plasmid pCJ105, Cmr Nalr 19DH5� deoR endA1 gyrA96 hsdR17 recA1 relA1 supE44 thi-1 Δ(lacZYA-argF)U169
�80lacZΔM15National BioResource Project
(NIG, Japan)HB101 hsdS20 recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1 supE44 leu thi, Smr National BioResource Project
(NIG, Japan)JM109 recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 Δ(lac-proAB)/F=[traD36 proAB� lacIq
lacZΔM15]TaKaRa Bio
PlasmidspBFS12 2.1 kbp, artificial transposon circle of ISBlo11 carrying ColE1 ori, Spr gene and
multicloning site of pKKT427, and two IRs separated by a 3-bp spacerregion, Spr
This study
pBFS24 4.1 kbp, E. coli vector containing TnBlo11 and ColE1 ori, Spr Kmr This studypBFS25 5.4 kbp, derivative of pBFS24 containing Tpase51 ORF, Spr Kmr This studypBFS26 5.4 kbp, derivative of pBFS24 containing Tpase60 ORF, Spr Kmr This studypBFS27 5.4 kbp, derivative of pBFS24 containing Tpase105 ORF, Spr Kmr This studypBFS28 5.3 kbp, derivative of pBFS24 containing Tpase159 ORF, Spr Kmr This studypBFS29 5.2 kbp, derivative of pBFS24 containing Tpase273 ORF, Spr Kmr This studypBFS32 4.9 kbp, E. coli-Bifidobacterium shuttle vector, pSC101 replicon, pTB6 replicon
(temp sensitive), Spr
This study
pBFS33 5.1 kbp, derivative of pBFS24 containing Tpase354 ORF, Spr Kmr This studypBFS34 4.8 kbp, E. coli-Bifidobacterium shuttle vector, pSC101 replicon, pTB6 replicon
(temp sensitive), Cmr
This study
pBFS49 8.2 kbp, E. coli-Bifidobacterium shuttle vector containing pfruEKFG_Blo, Cmr 20pBFS52 8.2 kbp, E. coli-Bifidobacterium shuttle vector containing pxfp_Bbr, Cmr 20pBFS53 6.4 kbp, derivative of pBFS34 containing pfruEKFG_Blo and Tpase60 ORF, Cmr This studypBFS100 6.4 kbp, derivative of pBFS34 containing pfruEKFG_Blo and Tpase51 ORF, Cmr This studypBFS101 6.4 kbp, derivative of pBFS34 containing pxfp_Bbr and Tpase51 ORF, Cmr This studypEC0079 2.1 kbp, transposon vector of ISBlo11 carrying ColE1 ori, Spr gene and
multicloning site of pKKT427, and two IRs separated by a 27-bp spacerregion, Spr
This study
pKKT427 3.9 kbp, E. coli-Bifidobacterium shuttle vector, ColE1 ori, pTB6 replicon, Spr 38pKO403 3.9 kbp, E. coli-Bifidobacterium shuttle vector, ColE1 ori, pTB6 replicon (temp
sensitive), Spr
27
pHSG298-IR-Sp-IR 4.3 kbp, E. coli vector carrying Spr gene sandwiched by termini of ISBlo11, Kmr Spr 19pKKT-sacB::ISBlo11 7.3 kbp, ISBlo11-transposed pKKT-sacB, Spr 19pMW119 4.2 kbp, E. coli vector, pSC101 replicon, Apr Nippon Gene
aApr, ampicillin resistance; Cmr, chloramphenicol resistance; Kmr, kanamycin resistance; Nalr, nalidixic acid resistance; Smr, streptomycin resistance; Spr, spectinomycinresistance.
Sakanaka et al. Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 12
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
TABLE 5 Template DNAs and oligonucleotide primer pairs used in this study
Primerno. PCR producta Template DNA
Oligonucleotide primer pair
Name 5= to 3= nucleotide sequenceb
1 Inverse PCR product ofpHSG298-IR-Sp-IR
pHSG298-IR-Sp-IR Bam_Spec_Fw GCGGATCCGGTCGATTTTCGTTCGTGAATAPr-Blo0085 CGTGGATCCGAAGTCACTGGACTGGATGAG
2 ISBlo11 Tpase51 ORF pKKT-sacB::ISBlo11 Pr-Blo0089 ACACAGGAAACAGCTATGTTTTCGATGGAGGATCGGCGCAGPr-Blo0088 CGTAATCATGGTCATTCAGGCGGCCAGTCCAAGACTTCTG
3 ISBlo11 Tpase60 ORF pKKT-sacB::ISBlo11 Pr-Blo0090 ACACAGGAAACAGCTATGGAGGATCGGCGCAGGGCCGTTGPr-Blo0088 CGTAATCATGGTCATTCAGGCGGCCAGTCCAAGACTTCTG
4 ISBlo11 Tpase105 ORF pKKT-sacB::ISBlo11 Pr-Blo0091 ACACAGGAAACAGCTATGACCATCAGGAAGGTCATTGCCGAGPr-Blo0088 CGTAATCATGGTCATTCAGGCGGCCAGTCCAAGACTTCTG
5 ISBlo11 Tpase159 ORF pKKT-sacB::ISBlo11 Pr-Blo0092 ACACAGGAAACAGCTGTGAAATGGGTTCGCGAGGACPr-Blo0088 CGTAATCATGGTCATTCAGGCGGCCAGTCCAAGACTTCTG
6 ISBlo11 Tpase273 ORF pKKT-sacB::ISBlo11 Pr-Blo0093 ACACAGGAAACAGCTGTGGCGCGCGACGCGGGTTGPr-Blo0088 CGTAATCATGGTCATTCAGGCGGCCAGTCCAAGACTTCTG
7 ISBlo11 Tpase354 ORF pKKT-sacB::ISBlo11 Pr-Blo0111 ACACAGGAAACAGCTATGGACAGGAGAAACGCGCCGATGPr-Blo0088 CGTAATCATGGTCATTCAGGCGGCCAGTCCAAGACTTCTG
8 Inverse PCR product of pBFS24 pBFS24 Pr-Blo0086 AGCTGTTTCCTGTGTGAAATTGTTATCCGCPr-Blo0087 ATGACCATGATTACGAATTCGAGCTCGGT
9 A part of transposon-circlefrom TnBlo11
Transposon-circlefrom TnBlo11
Pr-Blo0040 GCAGTTCGTAGTTATCTTGGAGAGPr-Blo0128 TCCACTCTCAACTCCTGATCCAAACAT
10 pSC101 replicon pMW119 Pr-Blo0105 CAGAATTCGACAGTAAGACGGGTAAGCCTGPr-Blo0106 CGGAATTCCATATGGACAGTTTTCCCTTTG
11 Cmr gene pHSC Pr-Blo0112 GGTCATATGTGGGCGCGGCGGCCATGAAGPr-Blo0113 GGCTGCAGTATGGAAGCGCTGAACTAGTC
12 Tpase51 ORF of ISBlo11 pKKT-sacB::ISBlo11 Pr-Blo0296 ATGTTTTCGATGGAGGATCGGCGCAGPr-Blo0203 TTGCAGGCCTGTCGATCAGGCGGCCAGTCCAAGACTTCTG
13 Tpase60 ORF of ISBlo11 pKKT-sacB::ISBlo11 Pr-Blo0199 ATGGAGGATCGGCGCAGGGCCGTTGPr-Blo0203 TTGCAGGCCTGTCGATCAGGCGGCCAGTCCAAGACTTCTG
14 pfruEKFG_Blo (for cloning withTpase51 ORF of ISBlo11)
pBFS49 Pr-Blo0238 GCGGCCGCGCCGGCAATGGTATAAGAAAAACGGTGTPr-Blo0297 CTCCATCGAAAACATAAGCACTCCTTGGGGGCCGCGCCGGCATG
15 pfruEKFG_Blo (for cloning withTpase60 ORF of ISBlo11)
pBFS49 Pr-Blo0238 GCGGCCGCGCCGGCAATGGTATAAGAAAAACGGTGTPr-Blo0236 GCGCCGATCCTCCATAAGCACTCCTTGGGGGCCGCGCCGGCATG
16 pxfp_Bbr (for cloning withTpase51 ORF of ISBlo11)
pBFS52 Pr-Blo0237 GCGGCCGCGCCGGCATCCAATCGAACGGGATCAACCPr-Blo0297 CTCCATCGAAAACATAAGCACTCCTTGGGGGCCGCGCCGGCATG
17 ColE1 ori, Spr gene, andmulticloning site
pKKT427 17_IRL_ColSp_Fw ATTAGCATATGAGAATTCTGAGCAAAAGGCCAGCAAA18_IRR_ColSp_C TACTACTCGAGGCCGGCATGCATAGATCTCACG
18 Inverse PCR product ofpEC0079
pEC0079 Pr-Blo0032 ACTCCCGGGGGGGATGCGGACGGAAAGTTGGACPr-Blo0034 TGTCCCGGGGCTGCGGATGTTTTTTTGGACG
19 Partial Spr gene Genomic DNA ofputativetransposonmutants
Pr-Blo0125 CAGCCACTGCATTTCCCGCAAPr-Blo0126 ATGTTTGGATCAGGAGTTGAGAGTGGA
20 First PCR product oftransposon insertion regionat 3= terminus
Genomic DNA ofputativetransposonmutants
Pr-Blo0305 GGCCACGCGTCGACTAGTACNNNNNNNNNNTCGCPr-Blo0303 GGAAACGCCTGGTATCTTTATAGTCCTGTC
(Continued on next page)
IS3 Family-Based Transposon Mutagenesis of B. longum Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 13
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
to 699 (312 bp), which are discriminative of B. longum subsp. longum, B. longum subsp. infantis, and B.longum subsp. suis (43), respectively, were first compared by multiple-sequence alignment to referencesequences obtained from genomes deposited in GenBank under accession numbers AP014658 for B.longum 105-A (32), AP010888 for B. longum subsp. longum JCM 1217T (21), CP011964 for B. longumsubsp. longum NCIMB8809 (36), CP002286 for B. longum subsp. longum BBMN68 (44), CP001095 for B.longum subsp. infantis ATCC 15697T (45), and CP010411 for B. longum subsp. infantis BT1. In B. longum105-A, the reference sequences were BL105A_1124, encoding recombinase A for recA (46); BL105A_0573,encoding elongation factor Tu for tuf (47); and BL105A_1248, encoding lactate dehydrogenase for ldh(48). Sequences were aligned in ClustalW 2.1 at default settings (49). Second, the conservation of thehuman milk oligosaccharide utilization gene cluster I (Blon_2331 to Blon_2361) from B. longum subsp.infantis ATCC 15697T (45) was examined by blastn against B. longum 105-A, using an E value lower than10�10 (50) as a threshold to indicate the existence of the query gene in B. longum 105-A. Third, thebiochemical characteristics of B. longum 105-A, B. longum subsp. longum JCM 1217T, and B. longumsubsp. infantis JCM 1222T were evaluated by API 20A (bioMérieux SA, Marcy l’Etoile, France), a taxonomicidentification system for anaerobic bacteria, following the manufacturer’s instructions.
Construction of transposon vectors. Six transposon vectors were constructed to express ISBlo11transposase and truncated forms thereof, including Tpase51, which was predicted by Sakanaka et al. (19)to be the full-length protein, Tpase60, Tpase105, Tpase159, Tpase273, and Tpase354 (Fig. 2). The translationstart sites, as numbered according to the ISBlo11 nucleotide sequence in GenBank (1,432 bp, accessionno. LC005249.1), were 51ATG, 60ATG, 105ATG, 159GTG, 273GTG, and 354ATG, respectively. The followingsequence up to the translation stop codon TGA1406 was retained.
Briefly, pHSG298-IR-Sp-IR (19), which carries an Spr gene sandwiched between the 5= terminus (87 bp)and 3= terminus (289 bp) of ISBlo11, was amplified by inverse PCR with primers Bam_Spec_Fw andPr-Blo0085. After digestion with BamHI, the amplified product was self-ligated and cloned in E. coli. Theresulting plasmid, pBFS24 (Fig. 2A), contains a transposon with the Spr gene sandwiched by 87-bpISBlo11 termini (TnBlo11). Open reading frames encoding Tpase51, Tpase60, Tpase105, Tpase159, Tpase273,or Tpase354 were then amplified by PCR from pKKT-sacB::ISBlo11 (19) using primer pairs 2 to 7 (Table 5).Subsequently, the amplified fragments were cloned into inverse PCR products obtained from pBFS24using primers Pr-Blo0086 and Pr-Blo0087, using E. coli JM109 and the In-Fusion HD cloning kit (ClontechLaboratories, Inc., Mountain View, CA, USA). In the resulting plasmids, pBFS25 to pBFS29 and pBFS33 (Fig.2B), the transposase is downstream of the lac promoter and ribosome-binding site derived from pBFS24.
Transposition efficiency in E. coli. The transposition frequency of TnBlo11 in E. coli cells expressingdifferent forms of transposase was analyzed by F-plasmid conjugation, as previously described (19),except that LB medium without glucose was used to culture E. coli DH1/pCJ105 cells transformed withpBFS24 to pBFS29 and pBFS33 and HB101 cells. Transposition frequency was calculated as the proportionof recipient cells harboring TnBlo11-transposed pCJ105 among total recipient cells.
Construction of transposase expression plasmids and the artificial transposon circle. Theexpression plasmids encoding Tpase51 or Tpase60 under the control of the promoter of the fructosetransporter operon fruEKFG from B. longum 105-A (pfruEKFG_Blo), and Tpase51 under the control of thepromoter of the phosphoketolase xfp from B. breve 203 (pxfp_Bbr) were constructed as described in Fig. 3.Promoter pfruEKFG_Blo is induced and repressed in B. longum 105-A cells by xylose and glucose, respec-tively, while expression from pxfp_Bbr is constitutive and strong in the presence of glucose (20). However,both promoters have low activity in E. coli (20), which probably explains the stability of the transposasegenes during cloning.
The temperature-sensitive plasmid pKO403 (27) was first digested with EcoRI, and a 3.1-kb fragmentwithout ColE1 ori was ligated with the bifidobacterial replicon pSC101, which was amplified from
TABLE 5 (Continued)
Primerno. PCR producta Template DNA
Oligonucleotide primer pair
Name 5= to 3= nucleotide sequenceb
21 Second PCR product oftransposon insertion regionat 3= terminus
First PCR productof transposoninsertion regionat 3= terminus
Pr-Blo0306 GGCCACGCGTCGACTAGTACPr-Blo0304 TTCGCCACCTCTGACTTGAGCGTC
22 First PCR product oftransposon insertion regionat 5= terminus
Genomic DNA ofputativetransposonmutants
Pr-Blo0305 GGCCACGCGTCGACTAGTACNNNNNNNNNNTCGCPr-Blo0128 TCCACTCTCAACTCCTGATCCAAACAT
23 Second PCR product oftransposon insertion regionat 5= terminus
First PCR productof transposoninsertion regionat 5= terminus
Pr-Blo0306 GGCCACGCGTCGACTAGTACSpecR_2443_
up_seqAGATTTCATTGGCTTCTAAATTTTT
aCmr, chloramphenicol resistance; Spr, spectinomycin resistance.bBold type and underlining indicate restriction sites and overlapping sequences for In-Fusion cloning, respectively.
Sakanaka et al. Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 14
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
pMW119 using primers Pr-Blo0105 and Pr-Blo0106 and digested with EcoRI. The ligated product wascloned in E. coli DH5� to generate pBFS32. After digestion of this plasmid with NdeI and PstI, a 3.8-kbfragment lacking an Spr gene was ligated with a Cm resistance gene, which was PCR amplified from pHSC(T. Suzuki, unpublished data) using primers Pr-Blo0112 and Pr-Blo0113 and also digested with NdeI andPstI. The ligated product was cloned in E. coli DH5�, and the resulting plasmid, pBFS34, was used as anegative control for transposon mutagenesis. pBFS34 does not encode transposase.
Tpase51 and Tpase60 were PCR amplified from pKKT-sacB::ISBlo11 (19) using the primer pairs Pr-Blo0296/Pr0Blo0203 and Pr-Blo0199/Pr-Blo0203, respectively. Two different pfruEKFG_Blo fragments werePCR amplified from pBFS49 (20) using the primer pairs Pr-Blo0238/Pr-Blo0297 for use with Tpase51 andPr-Blo0238/Pr-Blo0236 for use with Tpase60. The promoter pxfp_Bbr was PCR amplified from pBFS52 (20)using primers Pr-Blo0237 and Pr-Blo0297. Transposase and promoter fragments were cloned into SalI-and NsiI-digested pBFS34, using the In-Fusion HD cloning kit (Clontech) and E. coli DH5�, to generateTpase51 under the control of pfruEKFG_Blo (pBFS100) and pxfp_Bbr (pBFS101, Fig. 3A and B), as well as Tpase60
under the control of pfruEKFG_Blo (pBFS53, Fig. 3A).To construct the artificial transposon circle, a fragment containing 50 bp of the 5= and 3= termini of
ISBlo11, separated by a 27-bp spacer (Fig. 3C), was synthesized at Blue Heron Biotechnology, Inc. (Bothell,WA, USA). Also, a fragment containing ColE1 ori, an Spr gene, and a multiple-cloning site was PCRamplified from pKKT427 (38) using primers 17_IRL_ColSp_Fw and 18_IRR_ColSp_C. Both fragments werethen digested with NdeI and XhoI, ligated, and cloned in E. coli DH5�, generating plasmid pEC0079 (Fig.3D), which was used as a control in evaluating the significance of the 3-bp spacer sequence betweennative ISBlo11 inverted repeats. In contrast, the spacer sequence in pEC0079 was also shortened from 27bp to 3 bp by amplifying a fragment using primers Pr-Blo0032 and Pr-Blo0034, which was then digestedwith SmaI, self-ligated, and cloned in E. coli to generate pBFS12 (Fig. 3E).
Transposon mutagenesis. The expression plasmids pBFS53, pBFS100, pBFS101, as well as thenegative-control plasmid pBFS34, were independently introduced into B. longum 105-A by electropora-tion, and transformants were selected on 1/2 MRSCS-Cm agar. Subsequently, Cm-resistant transformantswere cultured overnight in 5 ml 1/2 MRSCS-Cm medium, harvested by centrifugation, resuspended insaline, inoculated into 40 ml 1/2 MRSCS-Cm medium or 1/2 MRSCS-Cm medium containing 4% (wt/vol)xylose instead of 1% (wt/vol) glucose, and cultured to an OD660 of �0.5 to 0.6. We note that xyloseinduces transcription from pfruEKFG_Blo (20), resulting in abundant expression of Tpase51 and Tpase60.Competent cells were then prepared and electroporated with 2 �g of the artificial transposon circle pBFS12or pEC0079. After incubation at 37°C for 3 h in 5 ml of 1/2 MRSCS-Cm medium supplemented with 50 mMsucrose, putative transposon mutants were selected at 37°C on 1/2 MRSCS-spectinomycin agar. Loss of thetransposase expression plasmid in Spr transformants was verified by replica plating on Cm.
Transposon mutagenesis in other Bifidobacterium strains (B. longum NCC2705 and B. bifidum JCM7004) was basically conducted as described above. Briefly, the transposase expression plasmid pBFS101and the negative-control plasmid pBFS34 lacking transposase ORF were independently introduced byelectroporation. Then, competent cells of these transformants were prepared and electroporated withthe artificial transposon circle pBFS12. After the recovery incubation, putative transposon mutants wereselected on Gifu anaerobic agar medium (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan) containing 30�g/ml spectinomycin.
Insertion of the artificial transposon circles into the genome was confirmed by colony PCR against Spr
gene using primers Pr-Blo0125 and Pr-Blo0126. Plasmid rescue (3) or two-step semidegenerate PCR (4)was used to determine pBFS12 insertion sites (Fig. S2). In plasmid rescue, genomic DNA from eachtransposon mutant was digested with NcoI, self-ligated, and cloned in E. coli DH5� to recover DNA withColE1 ori and the Spr gene, which was then sequenced. In two-step semidegenerate PCR, the 3=-terminalinsertion site was PCR amplified by PrimeSTAR GXL DNA polymerase (TaKaRa Bio) from each putativetransposon mutant, using pBFS12-specific primer Pr-Blo0303 and semidegenerate primer Pr-Blo0305 inthe first round, and pBFS12-specific primer Pr-Blo0304 and Pr-Blo0305-specific primer Pr-Blo0306 in thesecond round. The PCR products were then sequenced and analyzed. The 5=-terminal insertion site wasdetermined in a similar manner, using primer pairs Pr-Blo0128/Pr-Blo0305 and SpecR_2443_up_seq/Pr-Blo0306 in the first and second rounds, respectively. The B. longum 105-A and NCC2705 genomes(GenBank accession numbers AP014658.1, AE014295.3, and AF540971.1) (32, 51) were used as references.
Stability of transposons inserted into the chromosome. The transposon mutants 51A-206,51A-210, 60A-38, and 60A-112 (Table 3) were precultured in 1/2 MRSCS medium without antibiotics andinoculated into fresh 1/2 MRSCS medium at an initial OD660 of 0.002. The OD660 was then measured everyhour for 8 h, and the generation times calculated for each mutant were 0.96, 1.12, 0.90, and 1.32 h,respectively. Based on generation time, the mutants were then subcultured up to 50 generations in 1/2MRSCS medium. Chromosomal DNA was extracted from precultures and from 50th-generation subcul-tures, of which 4 �g was digested with NcoI, electrophoresed on 0.7% agarose, transferred toHybond-N� nylon membrane (GE Healthcare UK Ltd., Buckinghamshire, England), as described previ-ously (52), and probed with a fragment of the Spr gene. We note that the transposon pBFS12 does notcontain a NcoI restriction site. NcoI-digested chromosomal DNA from 105-A (4 �g) and NdeI-digestedpBFS12 (1 ng) were used as negative and positive controls of hybridization, respectively. The probe wasobtained by amplification from the chromosomal DNA from the preculture of mutant 60A-38 usingprimers Pr-Blo0125 and Pr-Blo0126. The probe was labeled, hybridized, and visualized using the AlkPhosdirect labeling and detection system (GE Healthcare UK Ltd.), according to the manufacturer’s instruc-tions. Signal intensity was collected for 30 min on the LAS-4000 luminescent image analyzer (FujifilmCorporation, Tokyo, Japan).
IS3 Family-Based Transposon Mutagenesis of B. longum Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 15
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
Measurement of �-glucosidase activity. B. longum 105-A and the transposon mutant 60A-38,which has a mutation in a putative �-glucosidase, were cultured overnight in 10 ml of 1/2 MRSCSmedium, harvested by centrifugation for 15 min at 19,000 � g and 4°C, washed with saline, inoculatedat initial OD660 of 0.5 into 5 ml of 1/2 MRSCS medium containing 1% (wt/vol) trehalose or isomaltoseinstead of 1% (wt/vol) glucose, and grown anaerobically for 6 h at 37°C. Cells were then harvested,washed with saline, resuspended in 500 �l of 30 mM HEPES-KOH buffer (pH 7.0), and lysed by sonicatingtwice for 30 s each on a UD-201 ultrasonic disrupter (Tomy Seiko Co. Ltd., Tokyo, Japan). Lysates werethen centrifuged for 15 min at 20,000 � g and 4°C, and the resulting supernatant was used as a crudeextract. Protein concentration was determined by the Bradford method using a protein assay kit (Bio-RadLaboratories, Inc., Hercules, CA). �-Glucosidase activity was measured at 37°C for 5 min in 50-�l reactionmixture containing 30 mM HEPES-KOH buffer (pH 7.0), 10 mM trehalose, palatinose, or isomaltose, and10 �l of diluted crude extract (protein concentration, 0.2 to 1.2 mg/ml) using 30 mM HEPES-KOH buffer(pH 7.0). Reactions were terminated with 100 �l of 2 M Tris-HCl (pH 7.0). Liberated glucose was measuredusing the Glucose CII test Wako kit (Wako), and 1 U of �-glucosidase activity was defined as the amountof enzyme that hydrolyzes 1 �mol substrate in 1 min at 37°C in the given reaction buffer.
Gene expression analysis. Cells were harvested from the culture at mid-log phase (OD660, 0.5 to 0.7),treated with RNAprotect bacterial reagent (Qiagen), and then sequentially treated with lysozyme (finalconcentration, 15 mg/ml; Wako) at 37°C for 1 h and achromopeptidase (final concentration, 3 mg/ml;Wako) at 37°C for 30 min. Treated cells were resuspended with the buffer RLT (Qiagen) containing 0.5 gzirconia beads (0.2 mm diameter) and disrupted by vigorous shaking at 2,500 rpm in a Multi-BeadsShocker (Yasui Kikai Corp., Osaka, Japan) at 4°C for six cycles of shaking for 45 s, followed by a 15-s break.Total RNAs were extracted from the cell lysate using the RNeasy minikit (Qiagen). cDNA was synthesizedfrom the DNase I-treated total RNA using the SuperScript VILO cDNA synthesis kit (Thermo FisherScientific, Waltham, MA) and subjected to qRT-PCR analysis using Fast SYBR green PCR master mix andStepOnePlus real-time PCR system (Thermo Fisher Scientific). Primer pairs Pr-Blo0380/Pr-Blo0381 (5=-TGCAGAGTACTGAGCTCAAGCTTG-3=/5=-TCAAGAAGTCACTGGACTGGATGAG-3=) and Pr-Blo0376/Pr-Blo0377(5=-ACAGTCGCGTCAGACACAAGTAG-3=/5=-AGTTCTCGTGGCTTACCAACGAAG-3=) were used for the ex-pression analysis of the Tpase51 gene and BL105A_1885, encoding putative �-glucosidase, respectively.Primer pair Pr-Blo0372/Pr-Blo0373 (5=-GCCTTCGCGATCTGCTGATCTAG-3=/5=-ACCCGTAATACGGTGAAGCGTAG-3=) was used for amplification of BL105A_1946 (rnpA) encoding the RNase P protein component.BL105A_1946 was used as a reference gene as previously used for the qRT-PCR analysis in B. breveUCC2003 (53). Each 20-�l reaction mixture contained 2 �l of cDNA, 0.5 �M each primer, and 10 �l ofSYBR green PCR master mix. Serially diluted cDNAs from 100- to 105-fold were used for drawing astandard curve. The thermal cycling parameters for PCR consisted of initial activation at 95°C for 10 min,followed by 40 cycles of denaturation at 95°C for 15 s and annealing/extension at 65°C (for Tpase51 gene)or 63°C (for BL105A_1885) for 1 min. The relative standard curve method was used to calculate relativechanges in gene expression based on the data from qRT-PCR analysis. Data were obtained from threebiological replicates.
Statistical analysis. The significance of the differences of the data between samples was evaluatedusing Student’s t test. P values lower than 0.05 were considered significant.
SUPPLEMENTAL MATERIAL
Supplemental material for this article may be found at https://doi.org/10.1128/AEM.00824-18.
SUPPLEMENTAL FILE 1, PDF file, 0.4 MB.
ACKNOWLEDGMENTSWe acknowledge Tohru Suzuki (Graduate School of Applied Biological Sciences, Gifu
University, Japan) for providing us with the temperature-sensitive plasmid pKO403 andplasmid pHSC. We also acknowledge Takane Katayama (Graduate School of Biostudies,Kyoto University, Japan) for sharing the information on the selection conditions oftransformants. We are grateful to Yasunobu Kano (Department of Molecular Genetics,Kyoto Pharmaceutical University, Japan) and Hideki Nakayama (Faculty of Life Sci-ence, Kyoto Sangyo University, Japan) for helpful discussions. We thank the NationalBioResource Project (NIG, Japan) for providing us with E. coli strains DH1, DH5�, andHB101. We thank Editage for English language editing.
M. Sakanaka, S. Fukiya, and A. Yokota designed the experiments. M. Sakanaka, A.Abe, and S. Fukiya constructed and evaluated the transposon mutagenesis system. S.Nakakawaji conducted a stability analysis of the transposon mutants. W. Saburi and H.Mori planned the enzyme measurement experiments, and these were conducted by S.Nakakawaji and W. Saburi. S. Nakajima conducted the gene expression analysis. M.Sakanaka, S. Nakakawaji, and S. Fukiya prepared the figures. M. Sakanaka, S. Fukiya, andA. Yokota wrote the manuscript. All authors reviewed and approved the manuscript.
This research was supported in part by Grants-in-Aid for Scientific Research (B) and
Sakanaka et al. Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 16
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
(C), and for JSPS Fellows from the Japan Society for the Promotion of Science (grants16H04893 and 25450090 to S. Fukiya and grant 2523·23 to M. Sakanaka).
We declare no conflicts of interest.
REFERENCES1. Ruiz L, O’Connell Motherway M, Lanigan N, van Sinderen D. 2013.
Transposon mutagenesis in Bifidobacterium breve: construction andcharacterization of a Tn5 transposon mutant library for Bifidobacte-rium breve UCC2003. PLoS One 8:e64699. https://doi.org/10.1371/journal.pone.0064699.
2. Licandro-Seraut H, Brinster S, van de Guchte M, Scornec H, Maguin E,Sansonetti P, Cavin JF, Serror P. 2012. Development of an efficient in vivosystem (Pjunc-TpaseIS1223) for random transposon mutagenesis of Lacto-bacillus casei. Appl Environ Microbiol 78:5417–5423. https://doi.org/10.1128/AEM.00531-12.
3. Sallam KI, Mitani Y, Tamura T. 2006. Construction of random transposi-tion mutagenesis system in Rhodococcus erythropolis using IS1415. JBiotechnol 121:13–22. https://doi.org/10.1016/j.jbiotec.2005.07.007.
4. Jacobs MA, Alwood A, Thaipisuttikul I, Spencer D, Haugen E, Ernst S, WillO, Kaul R, Raymond C, Levy R, Chun-Rong L, Guenthner D, Bovee D,Olson MV, Manoil C. 2003. Comprehensive transposon mutant library ofPseudomonas aeruginosa. Proc Natl Acad Sci U S A 100:14339 –14344.https://doi.org/10.1073/pnas.2036282100.
5. van Opijnen T, Camilli A. 2013. Transposon insertion sequencing: a newtool for systems-level analysis of microorganisms. Nat Rev Microbiol11:435– 442. https://doi.org/10.1038/nrmicro3033.
6. Hubbard TP, Chao MC, Abel S, Blondel CJ, Abel Zur Wiesch P, Zhou X,Davis BM, Waldor MK. 2016. Genetic analysis of Vibrio parahaemolyticusintestinal colonization. Proc Natl Acad Sci U S A 113:6283– 6288. https://doi.org/10.1073/pnas.1601718113.
7. Goodman AL, McNulty NP, Zhao Y, Leip D, Mitra RD, Lozupone CA,Knight R, Gordon JI. 2009. Identifying genetic determinants needed toestablish a human gut symbiont in its habitat. Cell Host Microbe6:279 –289. https://doi.org/10.1016/j.chom.2009.08.003.
8. Powell JE, Leonard SP, Kwong WK, Engel P, Moran NA. 2016. Genome-wide screen identifies host colonization determinants in a bacterial gutsymbiont. Proc Natl Acad Sci U S A 113:13887–13892. https://doi.org/10.1073/pnas.1610856113.
9. Wu M, McNulty NP, Rodionov DA, Khoroshkin MS, Griffin NW, Cheng J,Latreille P, Kerstetter RA, Terrapon N, Henrissat B, Osterman AL, GordonJI. 2015. Genetic determinants of in vivo fitness and diet responsivenessin multiple human gut Bacteroides. Science 350:aac5992. https://doi.org/10.1126/science.aac5992.
10. Turroni F, Peano C, Pass DA, Foroni E, Severgnini M, Claesson MJ, Kerr C,Hourihane J, Murray D, Fuligni F, Gueimonde M, Margolles A, De Bellis G,O’Toole PW, van Sinderen D, Marchesi JR, Ventura M. 2012. Diversity ofbifidobacteria within the infant gut microbiota. PLoS One 7:e36957.https://doi.org/10.1371/journal.pone.0036957.
11. Yamada C, Gotoh A, Sakanaka M, Hattie M, Stubbs KA, Katayama-Ikegami A, Hirose J, Kurihara S, Arakawa T, Kitaoka M, Okuda S, KatayamaT, Fushinobu S. 2017. Molecular insight into evolution of symbiosisbetween breast-fed infants and a member of the human gut micro-biome Bifidobacterium longum. Cell Chem Biol 24:515–524. https://doi.org/10.1016/j.chembiol.2017.03.012.
12. Leahy SC, Higgins DG, Fitzgerald GF, van Sinderen D. 2005. Gettingbetter with bifidobacteria. J Appl Microbiol 98:1303–1315. https://doi.org/10.1111/j.1365-2672.2005.02600.x.
13. Hidalgo-Cantabrana C, Delgado S, Ruiz L, Ruas-Madiedo P, Sánchez B,Margolles A. 2017. Bifidobacteria and their health-promoting effects.Microbiol Spectr 5:BAD-0010-2016. https://doi.org/10.1128/microbiolspec.BAD-0010-2016.
14. Brancaccio VF, Zhurina DS, Riedel CU. 2013. Tough nuts to crack: site-directed mutagenesis of bifidobacteria remains a challenge. Bioengi-neered 4:197–202. https://doi.org/10.4161/bioe.23381.
15. Ruiz L, Bottacini F, Boinett CJ, Cain AK, O’Connell-Motherway M, LawleyTD, van Sinderen D. 2017. The essential genomic landscape of thecommensal Bifidobacterium breve UCC2003. Sci Rep 7:5648. https://doi.org/10.1038/s41598-017-05795-y.
16. Mahillon J, Chandler M. 1998. Insertion sequences. Microbiol Mol BiolRev 62:725–774.
17. Rousseau P, Normand C, Loot C, Turlan C, Alazard R, Duval-Valentin G,
Chandler M. 2002. Transposition of IS911, p 367–383. In Craig NL,Craigie R, Gellert M, Lambowitz AM (ed), Mobile DNA II. ASM Press,Washington, DC.
18. Ton-Hoang B, Polard P, Chandler M. 1998. Efficient transposition of IS911circles in vitro. EMBO J 17:1169 –1181. https://doi.org/10.1093/emboj/17.4.1169.
19. Sakanaka M, Fukiya S, Kobayashi R, Abe A, Hirayama Y, Kano Y, YokotaA. 2015. Isolation and transposition properties of ISBlo11, an activeinsertion sequence belonging to the IS3 family, from Bifidobacteriumlongum 105-A. FEMS Microbiol Lett 362:fnv032. https://doi.org/10.1093/femsle/fnv032.
20. Sakanaka M, Tamai S, Hirayama Y, Onodera A, Koguchi H, Kano Y, YokotaA, Fukiya S. 2014. Functional analysis of bifidobacterial promoters inBifidobacterium longum and Escherichia coli using the �-galactosidasegene as a reporter. J Biosci Bioeng 118:489 – 495. https://doi.org/10.1016/j.jbiosc.2014.05.002.
21. Fukuda S, Toh H, Hase K, Oshima K, Nakanishi Y, Yoshimura K, Tobe T,Clarke JM, Topping DL, Suzuki T, Taylor TD, Itoh K, Kikuchi J, Morita H,Hattori M, Ohno H. 2011. Bifidobacteria can protect from enteropatho-genic infection through production of acetate. Nature 469:543–547.https://doi.org/10.1038/nature09646.
22. Nishiyama K, Yamamoto Y, Sugiyama M, Takaki T, Urashima T, Fukiya S,Yokota A, Okada N, Mukai T. 2017. Bifidobacterium bifidum extracellularsialidase enhances adhesion to the mucosal surface and supports car-bohydrate assimilation. mBio 8:e00928-17. https://doi.org/10.1128/mBio.00928-17.
23. Pokusaeva K, O’Connell-Motherway M, Zomer A, Fitzgerald GF, vanSinderen D. 2009. Characterization of two novel �-glucosidases fromBifidobacterium breve UCC2003. Appl Environ Microbiol 75:1135–1143.https://doi.org/10.1128/AEM.02391-08.
24. Ichimura M, Uchida K, Nakayama-Imaohji H, Hirakawa H, Tada T, MoritaH, Yasutomo K, Okazaki K, Kuwahara T. 2014. Mariner-based transposonmutagenesis for Bacteroides species. J Basic Microbiol 54:558 –567.https://doi.org/10.1002/jobm.201200763.
25. Cartman ST, Minton NP. 2010. A mariner-based transposon system for invivo random mutagenesis of Clostridium difficile. Appl Environ Microbiol76:1103–1109. https://doi.org/10.1128/AEM.02525-09.
26. Liu H, Bouillaut L, Sonenshein AL, Melville SB. 2013. Use of a mariner-based transposon mutagenesis system to isolate Clostridium perfringensmutants deficient in gliding motility. J Bacteriol 195:629 – 636. https://doi.org/10.1128/JB.01288-12.
27. Sakaguchi K, He J, Tani S, Kano Y, Suzuki T. 2012. A targeted geneknockout method using a newly constructed temperature-sensitive plas-mid mediated homologous recombination in Bifidobacterium longum.Appl Microbiol Biotechnol 95:499 –509. https://doi.org/10.1007/s00253-012-4090-4.
28. Saier MH, Jr, Kukita C, Zhang Z. 2017. Transposon-mediated directedmutation in bacteria and eukaryotes. Front Biosci (Landmark Ed) 22:1458 –1468. https://doi.org/10.2741/4553.
29. Lee H, Doak TG, Popodi E, Foster PL, Tang H. 2016. Insertion sequence-caused large-scale rearrangements in the genome of Escherichia coli.Nucleic Acids Res 44:7109 –7119. https://doi.org/10.1093/nar/gkw647.
30. Humayun MZ, Zhang Z, Butcher AM, Moshayedi A, Saier MH, Jr. 2017.Hopping into a hot seat: Role of DNA structural features on IS5-mediatedgene activation and inactivation under stress. PLoS One 12:e0180156.https://doi.org/10.1371/journal.pone.0180156.
31. Krysan PJ, Young JC, Sussman MR. 1999. T-DNA as an insertional muta-gen in Arabidopsis. Plant Cell 11:2283–2290. https://doi.org/10.1105/tpc.11.12.2283.
32. Kanesaki Y, Masutani H, Sakanaka M, Shiwa Y, Fujisawa T, Nakamura Y,Yokota A, Fukiya S, Suzuki T, Yoshikawa H. 2014. Complete genomesequence of Bifidobacterium longum 105-A, a strain with high transfor-mation efficiency. Genome Announc 2:e01311-14. https://doi.org/10.1128/genomeA.01311-14.
33. Kelly ED, Bottacini F, O’Callaghan J, O’Connell Motherway M, O’ConnellKJ, Stanton C, van Sinderen D. 2016. Glycoside hydrolase family 13
IS3 Family-Based Transposon Mutagenesis of B. longum Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 17
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
�-glucosidases encoded by Bifidobacterium breve UCC2003; a compara-tive analysis of function, structure and phylogeny. Int J Food Microbiol224:55– 65. https://doi.org/10.1016/j.ijfoodmicro.2016.02.014.
34. Kim NR, Jeong DW, Ko DS, Shim JH. 2017. Characterization of novelthermophilic alpha-glucosidase from Bifidobacterium longum. Int J BiolMacromol 99:594 –599. https://doi.org/10.1016/j.ijbiomac.2017.03.009.
35. Serafini F, Turroni F, Guglielmetti S, Gioiosa L, Foroni E, Sanghez V,Bartolomucci A, O’Connell Motherway M, Palanza P, van Sinderen D,Ventura M. 2012. An efficient and reproducible method for transforma-tion of genetically recalcitrant bifidobacteria. FEMS Microbiol Lett 333:146 –152. https://doi.org/10.1111/j.1574-6968.2012.02605.x.
36. O’Callaghan A, Bottacini F, O’Connell Motherway M, van Sinderen D.2015. Pangenome analysis of Bifidobacterium longum and site-directedmutagenesis through by-pass of restriction-modification systems. BMCGenomics 16:832. https://doi.org/10.1186/s12864-015-1968-4.
37. O’Connell Motherway M, Watson D, Bottacini F, Clark TA, Roberts RJ,Korlach J, Garault P, Chervaux C, van Hylckama Vlieg JET, Smokvina T,van Sinderen D. 2014. Identification of restriction-modification systemsof Bifidobacterium animalis subsp. lactis CNCM I-2494 by SMRT sequenc-ing and associated methylome analysis. PLoS One 9:e94875. https://doi.org/10.1371/journal.pone.0094875.
38. Yasui K, Kano Y, Tanaka K, Watanabe K, Shimizu-Kadota M, Yoshikawa H,Suzuki T. 2009. Improvement of bacterial transformation efficiency usingplasmid artificial modification. Nucleic Acids Res 37:e3. https://doi.org/10.1093/nar/gkn884.
39. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratorymanual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY.
40. Matsumura H, Takeuchi A, Kano Y. 1997. Construction of Escherichiacoli-Bifidobacterium longum shuttle vector transforming B. longum 105-Aand 108-A. Biosci Biotechnol Biochem 61:1211–1212. https://doi.org/10.1271/bbb.61.1211.
41. De Man JC, Rogosa M, Sharpe ME. 1960. A medium for the cultivation oflactobacilli. J Appl Bacteriol 23:130 –135. https://doi.org/10.1111/j.1365-2672.1960.tb00188.x.
42. Hirayama Y, Sakanaka M, Fukuma H, Murayama H, Kano Y, Fukiya S,Yokota A. 2012. Development of a double-crossover markerless genedeletion system in Bifidobacterium longum: functional analysis of the�-galactosidase gene for raffinose assimilation. Appl Environ Microbiol78:4984 – 4994. https://doi.org/10.1128/AEM.00588-12.
43. Mattarelli P, Bonaparte C, Pot B, Biavati B. 2008. Proposal to reclassify thethree biotypes of Bifidobacterium longum as three subspecies: Bifidobac-terium longum subsp. longum subsp. nov., Bifidobacterium longumsubsp. infantis comb. nov. and Bifidobacterium longum subsp. suis comb.nov. Int J Syst Evol Microbiol 58:767–772. https://doi.org/10.1099/ijs.0.65319-0.
44. Hao Y, Huang D, Guo H, Xiao M, An H, Zhao L, Zuo F, Zhang B, Hu S,
Song S, Chen S, Ren F. 2011. Complete genome sequence of Bifido-bacterium longum subsp. longum BBMN68, a new strain from ahealthy Chinese centenarian. J Bacteriol 193:787–788. https://doi.org/10.1128/JB.01213-10.
45. Sela DA, Chapman J, Adeuya A, Kim JH, Chen F, Whitehead TR, LapidusA, Rokhsar DS, Lebrilla CB, German JB, Price NP, Richardson PM, Mills DA.2008. The genome sequence of Bifidobacterium longum subsp. infantisreveals adaptations for milk utilization within the infant microbiome.Proc Natl Acad Sci U S A 105:18964 –18969. https://doi.org/10.1073/pnas.0809584105.
46. Kullen MJ, Brady LJ, O’Sullivan DJ. 1997. Evaluation of using a shortregion of the recA gene for rapid and sensitive speciation of dominantbifidobacteria in the human large intestine. FEMS Microbiol Lett 154:377–383. https://doi.org/10.1111/j.1574-6968.1997.tb12670.x.
47. Ventura M, Canchaya C, Meylan V, Klaenhammer TR, Zink R. 2003.Analysis, characterization, and loci of the tuf genes in Lactobacillus andBifidobacterium species and their direct application for species identifi-cation. Appl Environ Microbiol 69:6908 – 6922. https://doi.org/10.1128/AEM.69.11.6908-6922.2003.
48. Roy D, Sirois S. 2000. Molecular differentiation of Bifidobacterium specieswith amplified ribosomal DNA restriction analysis and alignment of shortregions of the ldh gene. FEMS Microbiol Lett 191:17–24. https://doi.org/10.1111/j.1574-6968.2000.tb09313.x.
49. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliamH, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, HigginsDG. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–2948.https://doi.org/10.1093/bioinformatics/btm404.
50. Pearson WR. 2013. An introduction to sequence similarity (“homology”)searching. Curr Protoc Bioinformatics 42:3.1.1–3.1.8. https://doi.org/10.1002/0471250953.bi0301s42.
51. Schell MA, Karmirantzou M, Snel B, Vilanova D, Berger B, Pessi G,Zwahlen MC, Desiere F, Bork P, Delley M, Pridmore RD, Arigoni F. 2002.The genome sequence of Bifidobacterium longum reflects its adaptationto the human gastrointestinal tract. Proc Natl Acad Sci U S A 99:14422–14427. https://doi.org/10.1073/pnas.212527599.
52. Fukiya S, Sugiyama T, Kano Y, Yokota A. 2010. Characterization of aninsertion sequence-like element, ISBlo15, identified in a size-increasedcryptic plasmid pBK283 in Bifidobacterium longum BK28. J Biosci Bioeng110:141–146. https://doi.org/10.1016/j.jbiosc.2010.02.013.
53. O’Connell Motherway M, Zomer A, Leahy SC, Reunanen J, Bottacini F,Claesson MJ, O’Brien F, Flynn K, Casey PG, Munoz JAM, Kearney B,Houston AM, O’Mahony C, Higgins DG, Shanahan F, Palva A, de Vos WM,Fitzgerald GF, Ventura M, O’Toole PW, van Sinderen D. 2011. Functionalgenome analysis of Bifidobacterium breve UCC2003 reveals type IVb tightadherence (Tad) pili as an essential and conserved host-colonizationfactor. Proc Natl Acad Sci U S A 108:11217–11222. https://doi.org/10.1073/pnas.1105380108.
Sakanaka et al. Applied and Environmental Microbiology
September 2018 Volume 84 Issue 17 e00824-18 aem.asm.org 18
on March 13, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Ac/Ds-transposon activation tagging in poplar: a …[23] proposed the use of a transposon-based activation tagging system for poplar. This proposal was based on the fact that the maize](https://img.pdfslide.tips/doc/110x75/5eb166a1e5b2ef1b462695af/acds-transposon-activation-tagging-in-poplar-a-23-proposed-the-use-of-a-transposon-based.jpg)
