Embed Size (px)
Citation preview
Analysis of α-catenin mediated intercellular adhesion in Drosophila
by
Arun Shipstone
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Cell and Systems Biology University of Toronto
© Copyright by Arun Shipstone (2015)
ii
Analysis of α-catenin mediated intercellular adhesion in Drosophila
Arun Shipstone
Master of Science
Cell and Systems Biology University of Toronto
2015
Abstract
Dynamic linkage between the cadherin-catenin complex (CCC) and the actin cytoskeleton at
Adherens Junctions is essential for cell-cell adhesion in epithelial cells. α-catenin is a core
component of the CCC that is responsible for maintaining the linkage between the actin
cytoskeleton and the CCC.
As part of my project, I generated an α-Catenin (α-Cat) RNAi line that was used to knockdown
maternal α-Cat in Drosophila embryos. Knockdown of α-Cat in the female germline produced
embryonic lethality that was characterized by severe defects throughout the embryo which
suggests that the maternal contribution of α-Cat is indispensable for embryonic development.
I also investigated if α-catenin function is conserved among metazoans and Dictyostelium
discoideum. I generated rescue constructs using mouse, zebrafish, worm and slime mold α-
catenin proteins and attempted to rescue α-Cat1 mutant embryos. The results of my analysis
suggest that α-catenin function is conserved among metazoans but not between Dictyostelium
and metazoans.
iii
Acknowledgements
During my troublesome teenage years if someone would have told me that one day I would be
completing my Master of Science from University of Toronto I would have called the idea
outrageous. I could not have made it this far on my own without the help and council of so
many people that have guided me through the ups and downs of life. I want to take this time
to thank all those people that have guided me through this journey.
First and foremost, I want to thank you Ulli for giving me the chance to complete my Master’s
under your tutelage. You showed me the importance of being thorough when conducting
experiments and being patient when things don’t work out. I will most of all miss your hilarious
one-liner jokes aimed at Gayaanan during lab meetings. Although we didn’t get a chance to
talk about Star Trek too much I’m sure you would agree that the ranking of the Captains should
be as follows: Jean-Luc Picard > James Tiberius Kirk > Benjamin Sisko > Kathryn Janeway >
Jonathan Archer. Thank you for all your help in guiding me through this Master’s.
If Ulli is the father of the lab then Milena would have to be its mother. I remember when I first
came to see you as an undergraduate student looking for help with my project and you told me
to apply to the lab as a research assistant after which the rest is history. You showed me the
importance of being persistent even if a protocol failed repeatedly (which happens quite often)
and I would not have been able to complete this thesis without all your troubleshooting help. I
admire your ability to not get frustrated even when things are not going well and I hope I can
incorporate that into my own personality. I will miss going out to coffee with you and
discussing world events. Good luck with sailing and keep doing the hot yoga!
Next, I want to give a shout out to the boys (and one girl) in Room 617. Arman, we made these
last three years memorable as hell whether it was going out for drinks on Friday nights or just
talking about random reddit links at work. I’m going to miss our conversations about how we
wished the world worked and how we could never figure out what women want. Although you
have moved on to greener pastures in medical school I hope we will still be able to keep in
contact and catch up often to keep our friendship going. Jordan, you were a huge inspiration to
iv
me when I started my journey in the gym lifting weights. I had given up on ever gaining weight
until you told me to stick it out and told me about the principles of working out. Thanks to you
I have put on 25lbs and made working out a part of my life.
Dave, you were a huge help to me when I first started out in the lab. Without your help, I
would not have been able to do a bunch of protocols including methanol fixations and antibody
stainings. I also enjoyed our discussions on gaming and the newest cool tech gadgets. I believe
I can conclude our discussions by saying that Google is still superior to Apple and that PCs >
Macs haha. Saba, you had to put up with us for two years and I have to say that you handled it
well whether it was us talking about guy stuff or burping around the lab. You are very bright
and a have a warm personality which makes it easy to be your friend. Keep up the good work in
the lab and you will graduate soon. Sergio, although you didn’t start off in our room you have
quickly become a part of it. I have enjoyed our chats on various topics at work and at the gym.
Your positive attitude and upbeat demeanour are infectious and were very helpful to my own
morale when my experiments weren’t going well. You are very intelligent and deserving of an
academic position and I hope that one day you will fulfill your goal of becoming a professor at a
University.
I want to also thank the lab members from Room 616 in helping me finish this chapter of my
life. Ritu, I want to thank you for helping me throughout the course of my thesis. You
answered my questions no matter how dumb they were and helped me troubleshoot a lot of
the molecular biology protocols. I would not have been able to generate all of these constructs
without your input. Carol, although I usually couldn’t eat the baked goodies you brought to lab
meeting your kind gesture was appreciated. Your input during lab meetings was invaluable and
helped give me direction in each aim.
Gayaanan, you will go down as the all-time prank master of the 6th floor. I can still recall you
scaring the pants off Trupti and hiding all of our belongings especially my watch. Although you
don’t game much anymore you should try out some of the new games that are coming out just
don’t get addicted lol. In all seriousness, you are very intelligent and have a knack for staying
calm in stressful situations and I hope that in the next chapter of my life I can learn to take
v
everything in stride and stay calm like you do. Kenana, although we didn’t always agree with
each other when it came to politics or ideology I am glad that you are very active when it comes
to these topics as I feel that we need more people to be involved in politics to bring about the
change that our society desperately needs. I am also thankful for all the help you provided to
me with fly squish preps and western blotting. Luka, I remember when you were an
undergraduate student and would come in to the lab even though someone *wink wink* would
be MIA. It has been a pleasure watching you transition from an undergraduate student to a
PhD. Candidate and I wish you all the best over these next few years as you work on finishing
your thesis. Azadeh, I enjoyed going through your monthly calendar to see all the cat pictures.
Although you are quiet and reserved, you do a very good job of communicating your thesis.
Victoria, you are intelligent, chic and a great person to be around. We had some good times
together especially the first party you attended at my house hahaha. I really admire the fact
that you are willing to try almost anything once including coming to the gym with Arman and I.
I hope that we will keep in touch and Good Luck with your Masters! Stephan, you are the new
guy to Room 617 and although we haven’t gotten a chance to really hang out together I do like
that you play video games and enjoy going to the gym as well. My best piece of advice to you is
to listen to everyone’s suggestions if you are having trouble with your experiments. You will
find that the people who specialize in a specific type of protocol will have little tricks that will
help you out when you are troubleshooting experiments.
As I close this chapter of my life and prepare to join the scary real world out there I hope I have
taken a little bit of each of you with me as I feel that being around such remarkable intelligent
people has made me a better person today than when I first walked in to the lab. Good luck to
all of you and I will miss you all.
vi
Table of Contents
Chapter 1. Introduction…………………………………………………………………………………………………………1
1.1 Epithelial Morphogenesis…………………………………………………………………………………………1
1.2 Core Components of Adherens Junctions…………………………………………………………………3
1.2.1 The Cadherin-catenin Complex………………………………………………………………….3
1.2.1.1 α-catenin is a key regulator or cadherin function………………………..5
1.2.1.2 Evolution of α-catenin…………………………………………………………………5
1.2.1.3 α-catenin Domain organization……………………………………………………6
1.2.1.4 Models of αE-cat function at AJs………………………………………………….9
1.2.1.4a Direct Binding Model……………………………………………………..9
1.2.1.4b Indirect Binding Model…………………………………………………10
1.2.1.4c Allosteric Model……………………………………………………………12
1.2.1.4d Mechanosensing Model……………………………………………….13
1.2.1.5 AJ independent functions of αE-cat……………………………………………13
1.2.2 The Nectin-Afadin Complex………………………………………………………………………14
1.3 Drosophila embryogenesis as a model for studying AJ regulation……………………………15
1.4 AJ formation in Drosophila………………………………………………………………………………………18
1.4.1 Spot AJ assembly begins at cellularization………………………………………..………18
1.4.2 ZA formation occurs during Gastrulation…………………………………………..……..18
1.5 Analysis of α-Cat in Drosophila at the Tepass Lab………………………………………………..….19
1.6 Review of RNAi Machinery…………………………………………………………………………………..….20
1.7 Thesis Objectives………………………………………………………………………………………………..…..21
vii
Chapter 2 Materials and Methods…………………………………………………………………………………..……23
2.1 Generation of transgene constructs…………………………………………………………………….....23
2.1.1 shRNA constructs…………………………………………………………………………………..…23
2.1.2 Cross-species α-catenin rescue constructs……………………………………………..…23
2.2 Drosophila genetics…………………………………………………………………………………………..…….28
2.2.1 α-Cat knockdown experiment………………………………………………………………..…28
2.2.2 Cross-species α-catenin rescue experiment………………………………………………28
2.3 Evaluation of Constructs………………………………………………………………………………….……..29
2.3.1 α-Cat knockdown experiment…………………………………………………………..………29
2.3.2 Cross-species α-catenin rescue experiment……………………………………………...29
2.3.3 Immunoblotting…………………………………………………………………………………….…30
2.3.4 Immunocytochemistry………………………………………………………………………….….30
2.3.5 Statistical Analysis………………………………………………………………………………….…31
Chapter 3 Maternal α-Cat Knockdown…………………………………………………………………………….……32
3.1 Introduction……………………………………………………………………………………………………………32
3.2 Results…………………………………………………………………………………………………………………….35
3.2.1 UAS-α-CatRNAi1 is the only effective α-Cat shRNA construct………………….….35
3.2.2 Maternal knockdown of α-Cat produces a strong embryonic phenotype…..36
3.2.3 Cortical and total α-Cat protein levels are severely reduced in
α-CatRNAi1 and αCat1α-CatRNAi1 affected embryos…………………………………45
3.3 Discussion……………………………………………………………………………………………………………….50
viii
Chapter 4 Cross-species rescue of α-Cat1 mutant embryos……………………………………………………53
4.1 Introduction……………………………………………………………………………………………………………53
4.2 Results…………………………………………………………………………………………………………………….59
4.2.1 Cross-species rescue constructs are expressed in Drosophila embryos…....59
4.2.2 Metazoan α-catenin proteins rescue head defects in Drosophila embryos..61
4.2.3 All cross-species rescue constructs except Ddα-cat::HA localize at AJs……..65
4.3 Discussion……………………………………………………………………………………………………………….71
Chapter 5 General Discussion and Future Directions………………………………………………………..…..75
References……………………………………………………………………………………………………………………….….78
ix
List of Tables
Table 1. List of generated shRNA α-Cat constructs
Table 2. List of generated cross species α-catenin constructs.
Table 3. α-Cat RNA knockdown construct evaluation data.
Table 4. Biochemical properties of α-catenin.
x
List of Figures
Figure 1. Epithelial cell architecture
Figure 2. Adherens junction architecture
Figure 3. α-catenin domain organization
Figure 4. Models of αE-cat function in epithelial cells
Figure 5. Drosophila embryo development overview
Figure 6. Schematic representation of WALIUM 20 Vector
Figure 7. Schematic representation of α-Cat shRNA target locations
Figure 8. Cuticles of representative WT, α-Cat1 and α-CatRNAi embryos
Figure 9. Quantification of α-Cat knockdown defects in embryos using two germline drivers
Figure 10. Quantitative analysis of α-Cat knockdown in embryos using mat-tub-Gal4
Figure 11. α-Cat knockdown embryos showing loss of α-Cat
Figure 12. α-Cat knockdown epithelial cells showing loss and mislocalization of α-Cat
Figure 13. Multiple sequence alignment of α-catenin molecules from different species
Figure 14. Evolutionary tree alignment of α-catenin molecules from different species
Figure 15. Immunoblot of cross-species α-catenin rescue constructs showing protein expression
Figure 16. Quantification of embryonic rescue mediated by cross-species α-catenin constructs
Figure 17. Rescued embryos showing localization of cross-species α-catenin proteins
Figure 18. En-Gal4 driven embryos showing localization of cross-species α-catenin proteins
xi
List of Abbreviations
α-Cat Drosophila α-catenin
αE-cat Mammalian α-catenin found primarily in epithelial tissues
ABP F-actin binding proteins
Ago Argonaute
AJ Adherens Junctions
aPKC atypical protein kinase C
Arm Armadillo; a β-catenin homologue in Drosophila
Baz Bazooka; a Par3 homologue in Drosophila
BCM Border cell migration
Btsz Bitesize
CAM Cell adhesion molecules
CCC Cadherin-catenin complex
Crb Crumbs
DEcad Drosophila E-Cadherin
dsRNA Double-stranded Ribonucleic acid
E-cad E-cadherin
FE Follicular epithelium
p120-ctn p120 catenin
RISC RNA-induced Silencing Complex
RNAi Double-stranded ribonucleic acid interference
shRNA Short-hairpin Ribonucleic acid
wt Wild-type
ZA Zonula Adherens
1
Chapter 1
Introduction
1.1 Epithelial Morphogenesis
Multicellular animals begin their life cycle as a fertilized egg which undergoes multiple rounds of
cellular division to form a blastula containing many cells. As embryonic development proceeds
these cells influence themselves and other neighbouring cells to function in specific contexts
which allows them to form complex tissues and organs essential to multicellular life. In animals
there are two major types of cells: Mesenchymal and epithelial. Mesenchymal cells are
migratory, do not adhere to each other and often function as individual units. In contrast,
epithelial cells are usually non-migratory and adhere to other epithelial cells to form the most
common tissue architecture in the animal body; the epithelium. During development, epithelial
cells undergo multiple remodeling changes such as changes in cell shape, cell-cell interaction, cell
growth and cell division to form the animal body.
An important feature of epithelial cell architecture is the apical-basal polarity of the plasma
membrane due to differential protein and lipid composition. The apical membrane faces the
external environment or the lumen while the basolateral membrane connects the epithelial cell
to neighbouring cells and the basal lamina (Figure 1). The lateral membrane portion contains
various junctional complexes that are important for the regulation of paracellular diffusion,
intercellular communication, and cell-cell adhesion. Tight junctions (in vertebrates) and septate
junctions (in invertebrates) regulate paracellular diffusion and intercellular communication
whereas adherens junctions (AJs), a type of intercellular adhesion complex, bind adjacent
epithelial cells together to form epithelial sheets. In most epithelial cells AJs cluster into a
circumferential belt called the zonula adherens (ZA), which demarcates the apical-basolateral
boundary. AJs are essential for many cellular processes such as cell polarity, tissue integrity, and
2
wound healing. Disruption of these contacts can lead to serious diseases including epithelial
cancers (Tepass et al., 2001; Kobielak & Fuchs, 2004; Gumbiner, 2005; Banerjee et al., 2006; Shin
et al., 2006; Harris & Tepass, 2010; Maiden & Hardin, 2011; Harris, T. J. C., 2012; Tepass, U., 2012).
Although AJs have been well studied over the years it is unclear how their function is regulated
to maintain intercellular adhesion.
Figure 1 - Epithelial cell architecture.
Epithelial tissues are composed of polarized cells whose apical and basolateral membranes
possess different properties. The apical membrane of epithelial cells faces the external
environment or the lumen while the basal portion of the basolateral membrane connects
epithelial cells to the basal lamina. The lateral membrane of epithelial cells contains various
junctional complexes including the AJs.
3
1.2 Core Components of Adherens Junctions
1.2.1 The Cadherin-catenin Complex
The major core component of AJs is the cadherin-catenin-complex (CCC) in which the
extracellular domain of the transmembrane protein E-cadherin mediates Ca2+-dependent
homophilic cell-cell adhesion (Tepass et al., 2001; Harris & Tepass, 2010). The highly conserved
cytosplasmic domain of cadherins binds to two adaptor molecules, p120 catenin (p120-ctn) and
β-catenin (Arm in Drosophila) (Figure 2). Both β-catenin and p120-ctn are essential for AJ
integrity since β-catenin is required for transport of E-cadherin to the plasma membrane, and
p120-ctn stabilizes cadherin molecules at AJs by blocking cadherin endocytosis (Hinck et al., 1994;
Chen et al., 1999; Davis et al., 2003). However, p120-ctn is not essential in most Drosophila
epithelia to maintain normal tissue integrity (Myster et al., 2003; Pacquelet et al., 2003; Harris &
Tepass, 2010). In addition to binding E-cadherin, β-catenin also binds to the ABP α-catenin (α-
Cat in Drosophila), which is required for AJ stability. Like β-catenin; α-catenin is also essential for
AJ formation and function in both vertebrates and invertebrates (Kobielak & Fuchs, 2004; Maiden
& Hardin, 2011, Sarpal et al., 2012). Rescue experiments in mammalian R2/7 αE-catenin (αE-cat)
deficient cells have shown that full length (FL) αE-cat restores epithelial architecture (Yonemura
et al., 2010). Furthermore, intercellular adhesion is compromised in Drosophila embryos in the
absence of α-Cat and a zygotic null mutation leads to embryonic lethality that is characterized by
severe head defects; a phenotype similar to weak mutant alleles of Drosophila E-cadherin
(DEcad) (Tepass et al., 1996; Sarpal et al., 2012). Together these proteins serve to regulate
cadherin function and ultimately the integrity of AJs and epithelial tissues (Harris & Tepass, 2010).
4
Figure 2 - Adherens Junction architecture.
AJs demarcate the apical and basolateral membrane of epithelial cells. A major component of
AJs is the cadherin-catenin-complex consisting of the transmembrane protein E-cadherin which
mediates Ca2+ dependent homophilic cell-cell adhesion. Epithelial integrity mediated by
cadherins is regulated by α-catenin, β-catenin, and p120ctn.
5
1.2.1.1 α-catenin is a key regulator of cadherin function
α-catenin was originally identified as a binding partner of E-Cad and in vitro mutational analysis
of E-cad showed that α-catenin may associate the CCC to actin bundles (Ozawa et al., 1989; 1990).
This notion was confirmed in both vertebrate and invertebrate studies that investigated α-
catenin function and gave rise to the idea that it acts a physical linker between the CCC and the
actin cytoskeleton (Nagafuchi et al., 1991; Hirano et al., 1992; Ozawa & Kemler, 1992; Oda et al.,
1993; Rimm et al., 1995). Although α-catenin has been studied extensively in several model
organisms the mechanism by which it serves to regulate cadherin function remains largely
elusive.
1.2.1.2 Evolution of α-catenin
α-catenin is well conserved throughout metazoan phyla. αE-catenin (αE-cat) is expressed
primarily in epithelial tissues of mammals, αN-catenin (αN-cat) on the other hand is found mostly
in the neuronal tissues (Hirano et al., 1992). Studies have revealed that αE-cat is not only
essential for adhesion but is also essential for the organization of the apical junction complex by
forming spot AJs and ZA (Watabe et al., 1994; Taguchi et al., 2011). αN-cat on the other hand is
required for the synapse stability in hippocampal neurons (Abe et al., 2004). A third mammalian
isoform; αT-catenin (αT-cat) has also been identified in testis and heart cells and in heart cells it
is responsible for the formation of stretch-resistant cell-cell adhesion complexes (Janssens et al.,
2001). Although there are differences present in the amino acid sequences between the three
isoforms cell culture studies have shown that they can all bind to β-cat and restore intercellular
adhesion in α-catenin deficient cells (Hirano et al., 1992; Janssens et a., 2001).
Analysis of αE-cat function in other vertebrates such as Danio rerio (Zebrafish) has also shown
that it regulates cell-cell adhesion during development (Schepsis et al., 2012). Depletion of Drα-
cat in zebrafish embryos causes delayed epiboly due to defects in radial intercalation that are
associated with intercellular adhesion. Additionally, the deep cells of the embryo exhibit
protracted plasma membrane blebbing due to defects in the recruitment of ERM proteins to the
plasma membrane (Schepsis et al., 2012). Invertebrates such as Caenorhabditis elegans and
Drosophila possess only one copy of the α-catenin gene and in vivo analyses of intercellular
6
adhesion dynamics indicate that it is required for the development of both organisms as well
(Kwiatkowski et al., 2011; Sarpal et al., 2012; Desai et al., 2013). Zygotic loss of HMP-1 in C.
elegans leads to embryonic lethality that is characterized by a loss of junctional proximal actin
and detachment of circumferential filament bundles (Costa et al., 1998; Kwiatkowski et al., 2011).
Similarly, zygotic loss of α-Cat in Drosophila produces embryonic lethality that is characterized by
head involution defects due to compromised intercellular adhesion (Sarpal et al., 2012). Recent
experiments conducted in Dictyostelium discoideum (slime mold) suggest that α-catenin
evolution may predate that of cadherins and metazoans because an α-catenin-like protein in this
amoebozoan has been shown to organize a polarized epithelium in conjunction with Aardvark
(β-cat-like protein) in the absence of a cadherin homolog (Dickinson et al., 2011). Collectively,
the studies mentioned above indicate that regardless of organism or tissue specialization all α-
catenin isoforms play an essential role during development by mediating intercellular adhesion
through regulation of the CCC.
1.2.1.3 α-catenin Domain organization
Initial amino acid sequence analysis of α-catenin showed that it is structurally similar to another
ABP Vinculin and possesses three Vinculin-Homology regions (VH1, VH2 and VH3; Figure 3)
(Herrenknecht, K et al., 1991; Nagafuchi et al., 1994). The VH1 region is located close to the N-
terminus and contains mutually exclusive binding sites for β-catenin and another α-catenin
molecule (Koslov et al., 1997). The central region of α-catenin contains the VH2 region which in
turn contains binding sites for ABPs such as α-actinin, vinculin, formin-1 and afadin. Similarly,
the C-terminal VH3 region of α-catenin also contains ABP binding sites for ZO-1 and EPLIN (in
mammals only) in addition to a direct F-actin binding site (Herrenknecht, K., et al., 1991;
Nagafuchi et al., 1994; Kobielak & Fuchs, 2004; Harris & Tepass, 2010; Maiden & Hardin, 2011).
Recent biochemical analyses of mammalian αE-cat and αN-cat have revealed several more
functional regions within the α-catenin molecule.
Data generated in several independent investigations of α-catenin indicate that it is composed
of α-helices that fold into a series of bundles. In addition, there are also subregions within α-
catenin that influence its overall conformation and binding status (Figure 3) (Pokutta & Weis,
7
2000; Yang et al., 2001; Pokutta et al., 2002; Choi et al., 2012; Desai et al., 2013; Rangarajan &
Izard, 2012; Ishiyama et al., 2013, Rangarajan & Izard, 2013). The NT region of α-catenin
regulates binding of the N domain to either a β-catenin or another α-catenin molecule since
removal of the NT region promotes homodimerization (Pokutta & Weis, 2000; Desai et al., 2013).
The CT region and C domain are required for ZO-1, EPLIN and direct F-actin binding, however, the
CT domain is not required for adhesion in Drosophila ovaries (Nagafuchi et al., 1994; Rimm et al.,
1995; Imamura, Y et al., 1999; Pokutta et al., 2002; Yamada et al., 2005; Pappas & Rimm; 2006;
Desai et al., 2013; Ishiyama et al., 2013). The central or modulation region of α-catenin contains
three bundles of four α-helices in each of the three M-domains that allow it to bind to several
different ABPs including formin-1, afadin, α-actinin and vinculin (Knudsen et al., 1995; Nieset et
al., 1997; Watabe-Uchida et al., 1998; Weiss et al., 1998; Pokutta et al., 2002; Kobielak & Fuchs,
2004; Yonemura et al., 2010; Choi et al., 2012; Rangarajan & Izard, 2012). The M1 region of α-
catenin is of particular interest because it contains a vinculin binding site that is normally masked
due to autoinhibition via salt bridges between the M1-M3 and M2-M3 interfaces. Relief of this
autoinhibition state requires actomyosin-generated tension (Yonemura et al., 2010; Rangarajan
& Izard, 2012; Choi et al., 2013; Ishiyama et al., 2013). The major domain containing regions are
connected by several small linker regions of which the region between the M3 and C domains is
of interest as it contains casein-kinase 1 and casein-kinase 2 phosphorylation sites whose
function has not yet been investigated (Yang et al., 2001, Pokutta et al., 2002; Ishiyama et al.,
2013; Rangarajan & Izard, 2013). Collectively, these studies show that α-catenin domain
organization is much more complex than previously thought.
8
Figure 3 – α-catenin domain organization.
The α-catenin molecule contains multiple domains that contain binding sites for several
proteins. The NT domain and N α-helical bundle (formerly VH1) of α-catenin contain mutually
exclusive binding sites for β-catenin and another α-catenin molecule which facilitates
homodimerization. The CT domain and C α-helical bundle regions (formerly VH3) of α-catenin
contain binding sites for F-actin and ABPs such as EPLIN and ZO1. The central or modulation
region (formerly VH2) of α-catenin contains three bundles of four α-helices in each of the M-
regions that allow it to bind to several different ABPs. Of note is the M1 region of α-cat which
facilitates Vinculin binding upon activation by the underlying actomyosin network. A linker
region between the M3 and C domain contains CK1 and CK2 phosphorylation sites whose
purpose has not yet been investigated.
9
1.2.1.4 Models of αE-cat function at AJs
High overall amino acid sequence similarity between αE,N,T-catenins and their invertebrate
counterparts in flies (Drosophila, 78-81%) and roundworms (HMP-1; Caenorhabditis elegans,
61%) together with functional studies suggest that α-catenin function across eukaryotes is
evolutionarily well-conserved (Harris & Tepass, 2010; Maiden & Hardin, 2011). Although α-
catenin has been well characterized in both vertebrate and invertebrate systems, its molecular
function at AJs has remained elusive. Over the years, several models have been proposed by
various laboratories to explain how α-catenin functions at AJs and most of these studies have
been performed on αE-cat (Figure 4).
1.2.1.4a Direct Binding Model
The direct binding model is the oldest of all models and states that αE-cat acts as a direct physical
linker between the underlying actomyosin network and CCCs to maintain structural integrity in
epithelial cells (Figure 4). This notion is supported by studies in cell culture which have shown
that αE-cat interacts with β-catenin through its NT and N regions (aa117-143) and that removal
of the β-catenin binding region compromises intercellular adhesion mediated by AJs (Huber et
al., 1997; Koslov et al., 1997; Nieset et al., 1997; Obama & Ozawa, 1997; Watabe-Uchida et al.,
1998; Pokutta & Weis, 2000; Desai et al., 2013). Actin pelleting assays show that the CT and C
regions are essential for the direct binding of αE-cat to F-actin to restore intercellular adhesion
in αE-cat deficient cells (Rimm et al., 1995; Imamura et al., 1999; Pappas & Rimm, 2006;
Yonemura et al., 2010; Sarpal et al., 2011; Desai et al., 2013). Furthermore, the ability of E-
cadherin-αE-cat fusion proteins to rescue adhesion in E-cadherin deficient cells strengthens the
argument that the direct binding of α-cat to CCC and actin is sufficient for epithelial integrity
(Imamura et al., 1999; Pappas & Rimm, 2006; Yonemura et al., 2010). Recent studies in
Drosophila have also revealed that fusion proteins of DE-cad and α-catenin can rescue
intercellular adhesion in the Drosophila ovary and embryo (Pacquelet & Rorth, 2005; Sarpal et
al., 2012). Collectively, these studies suggest that the NT, N, C and CT regions of α-catenin are
essential for direct binding to β-catenin and F-actin to maintain intercellular adhesion at AJs.
10
Although the evidence for direct binding is strong this model fails to address how exactly α-
catenin regulates cadherin-catenin-actin association.
1.2.1.4b Indirect Binding Model
The main difference between the direct and indirect binding models lies in how α-catenin
connects the CCC to the underlying actomyosin network. The indirect model states that αE-cat
links CCCs to the actin cytoskeleton through its association with other ABPs (Figure 4). The
evidence for this notion comes from in vitro experiments which show that a fusion molecule of
E-cadherin with only the C and CT regions (aa671-906) is not sufficient to fully rescue E-cadherin
deficient cells (Ozawa, 1998; Desai et al., 2013). Additionally, DE-cad-α-catenin fusion proteins
containing α-catenin amino acid residues 509-643 which do not interact with F-actin directly are
necessary for weak intercellular adhesion in E-cad deficient cells (Imamura et al., 1999).
Furthermore, in vitro binding experiments have shown that α-catenin can associate with several
ABPs which can allow it to interact with actin (Kobielak & Fuchs, 2004). Together, these studies
suggest that the modulation region of α-catenin facilitates interactions between α-catenin and
other ABPs to maintain contact between the CCC and actin cytoskeleton.
11
Figure 4 – Models of αE-cat function in epithelial cells.
The traditional models of α-cat function state that it binds to actin filaments (twin red lines)
directly or indirectly through ABPs to stabilize AJs. In the allosteric model α-cat switches
between a monomeric and dimeric form. The dimer binds to actin filaments to prevent Arp2/3
mediated actin branching required for lamellipodial movement which in turn stabilizes AJs. The
mechanosensing model implies that under low tension α-cat binds to actin filaments either
directly or indirectly through an unknown linker. High tension from strong pulling forces
generated by the actomyosin network result in the binding of additional Myosin II to α-cat
bound actin filaments which confers a conformational change within α-cat that allows Vinculin
to bind actin filaments and α-cat simultaneously to stabilize AJs.
12
1.2.1.4c Allosteric Model
The allosteric model of α-catenin mediated regulation of the CCC proposes that mammalian αE-
cat is a molecular switch which initially localizes to the CCC (Figure 4). Following enrichment of
monomeric αE-cat at the CCC, it dissociates from the CCC, dimerizes, and then binds to actin
directly. This action inhibits Arp2/3 mediated actin branching by preventing Arp2/3-actin binding,
which is required for lamellipodial movement (Drees et al., 2005; Yamada et al., 2005; Weis &
Nelson, 2006). The allosteric model relies on in vitro data which shows that a quaternary complex
of E-cad, β-cat, α-cat, and actin cannot be isolated and that α-cat-β-cat binding and α-cat-actin
binding is mutually exclusive.
A recent investigation of α-catenin in the Tepass lab showed that only monomeric α-catenin can
support AJ integrity (Desai et al., 2013). This notion is evidenced by experiments where α-Cat
constructs lacking the homodimer and Arm binding site were fused to the oligomerization
domain of Baz or full length Baz which promotes dimerization of α-Cat. These constructs
displayed weak biochemical interactions with Arm and DEcad and showed minimal rescue of AJs
which suggests that the interaction between β-catenin and α-catenin must be persistent and is
required for normal AJ function. Furthermore, the study also showed that removal of the N-
terminal 56 or 64 amino acids from αN-cat and α-Cat respectively shifted the two proteins into a
dimeric conformation but did not rescue α-Cat1 FE cells, BCM and embryos as well as their full
length counterparts (Desai et al., 2013).
Collectively, these studies show that although this model is backed with strong in vitro evidence
it fails to address AJ function in maintaining epithelial architecture during morphogenesis when
actin filaments need to be linked to AJs to withstand strong pulling forces. Furthermore, in vivo
experiments performed by our lab show that only monomeric α-catenin is responsible for the
linkage between the CCC and the actin cytoskeleton.
13
1.2.1.4d Mechanosensing Model
The mechanosensing model asserts that under low tension αE-cat binds to actin filaments
directly or indirectly through an unknown linker protein. High tension from strong pulling forces
generated by the actomyosin network result in the binding of additional Myosin II to α-catenin
bound actin filaments which confers a conformational change within α-catenin that allows
Vinculin to bind actin filaments and α-catenin simultaneously to stabilize AJs (Figure 4). A recent
study performed in R2/7 αE-cat deficient epithelial cells revealed that α-catenin may function as
a mechanosensor (Yonemura et al., 2010). The authors found that AJ formation was
compromised and vinculin no longer accumulated at AJs when myosin II activity was inhibited
with blebbistatin. This suggested that vinculin was required to maintain integrity in the lateral
membrane and that its recruitment was myosin II dependent. This observation was further
strengthened by the detection of αE-cat at AJs by a monoclonal antibody (α18) that specifically
recognizes residues between the inhibitory region and the vinculin binding site in a myosin II
dependent manner. Furthermore, recent in vitro x-ray crystallography experiments have
revealed that the autoinhibitory state of α-catenin is maintained through salt bridges between
the M1-M3 and M2-M3 interfaces since mutation of these interfaces from charged residues to
alanine enhances a-catenin-vinculin binding (Ishiyama et al., 2013). Collectively, these studies
suggest that α-catenin functions as a mechanosensor that regulates intercellular adhesion by
changing conformation to allow for vinculin binding in response to tension generated by the
acytomyosin network.
1.2.1.5 AJ independent functions of αE-cat
In addition to being a critical component of the CCC α-catenin can also function as a signalling
molecule in vertebrates (Stepniak et al., 2009; Maiden & Hardin, 2011). Conditional ablation of
αE-cat in mice leads to hyperproliferation of epidermal cells among other downstream
consequences (Vasioukhin et al., 2001). Further characterization of α-catenin has revealed that
it is a negative regulator of Yap1 (Yorkie in flies), a Hippo signalling pathway effector involved in
contact inhibition of cell proliferation. Although α-catenin binds to Yap1 indirectly through the
adaptor protein 14-3-3, its loss in stem cells of the skin leads to dephosphorylation of cytosolic
14
Yap1 by PP2A, which causes Yap1 to translocate into the nucleus where it functions as an
oncogenic transcription factor to upregulate cell proliferation. Knockdown of other AJ
components; namely E-cadherin and β-catenin, does not affect Yap1 localization which suggests
that α-catenin mediated regulation of Yap1 is independent of its role in the CCC (Schlegelmilch
et al., 2011).
Furthermore, α-catenin can also regulate non-junctional actin dynamics in vitro (Benjamin &
Nelson, 2008). This notion has been confirmed by experiments with MDCK cells that have
shown that although the majority of αE-cat localizes to AJs a small pool of it is also distributed
in the cytosol. When cytosolic αE-cat levels are sequestered to mitochondria without affecting
its overall levels an increase in membrane dynamics and cell migration is observed which
suggests that αE-cat can regulate actin dynamics independently of CCC (Benjamin et al., 2010).
1.2.2 The Nectin-Afadin Complex
Nectins are a four member family of immunoglobulin-like cell adhesion molecules (CAM) whose
extracellular domain mediates both Ca2+-independent homophilic and heterophilic interactions
with nectins of an adjacent cell, and heterophilic only interactions with other immunoglobulin-
like molecules. The cytoplasmic tails of nectins bind to the PDZ domain of the adaptor protein
Afadin which in turn associates nectins to the underlying actin cytoskeleton to mediate cell-cell
adhesion. The Afadin mediated association of nectin to the actin cytoskeleton can be achieved
directly or indirectly via F-actin binding proteins (ABP) such as Zonula Occludens and α-catenin.
In addition to mediating intercellular adhesion Nectin and Afadin are also involved in other
cellular contexts such as cell movement, proliferation and polarization (Reviewed in Takai &
Nakanishi, 2003; Takai et al., 2008).
The genome of Drosophila melanogaster does not contain a nectin orthologue, however, another
member of the immunoglobulin-like CAM Echinoid localizes at AJs and interacts with the afadin
orthologue Canoe (Wei et al., 2005). Although mammalian tissue culture studies suggest that
15
the nectin-afadin complex recruits cadherins to AJs it has not yet been shown to be involved in
cadherin recruitment in Drosophila embryos (Harris & Tepass, 2010; Harris, T. J. C., 2012).
1.3 Drosophila embryogenesis as a model for studying AJ regulation
Over the course of development the Drosophila embryo undergoes dramatic changes in cell type,
cell shape and cell movement to produce a mature embryo with distinct structures in the head,
trunk and tail region (Figure 5). Since morphogenetic processes require the dynamic remodeling
of CCCs the Drosophila embryo can be used as a model system to study the establishment,
maintenance and regulation of cadherin-based adhesions in these processes. In this section I will
briefly discuss general morphogenetic events observed during Drosophila embryonic
development.
During stages 1-4, The Drosophila embryo undergoes 13 rapid nuclear divisions to generate a
multinuclear syncytium consisting of ~6000 nuclei. Following the completion of cleavage
divisions, the nuclei migrate to the cell periphery and arrange in a single layer beneath the egg
surface. Cellularization occurs during stage 5 of embryogenesis and is characterized by the
formation of a primary epithelial sheet that surrounds the central yolk (See 1.4.1). Stage 6 marks
the onset of gastrulation as cells invaginate to form the endoderm and mesoderm. As
gastrulation proceeds during stages seven 7-8, the germ band elongates rapidly which pushes
the posterior tip of the germ band upwards and towards the anterior until the posterior tip covers
approximately 60% of egg length (0% egg length = posterior pole). Following the end of
gastrulation, the germ band elongates further (~75% egg length) at a slower pace during stage 9-
11 and the ectoderm gives rise to several organ precursors of the foregut, hindgut, CNS and
epidermis. Stage 11 of Drosophila embryonic development is characterized by the appearance
of parasegmental furrows and tracheal pits as well as the invagination of the salivary gland. The
beginning of germ band retraction marks the onset of stage 12 during which several
morphogenetic events take place in the endoderm and mesoderm including fusion of the anterior
and posterior midgut. Stage 13 concludes with the end of germ band retraction and the start of
16
head involution and dorsal closure. Head involution marks the onset of stage 14 as head tissues
are internalized and dorsal closure begins to seal the exposed dorsal opening left by the
retracting germ band. Stages 15-17 are marked by the completion of dorsal closure and head
involution. As embryogenesis concludes the cuticle of the embryo gets thicker and
specializations such as abdominal denticle belts become visible (Campos-Ortega & Hartenstein,
1985; Hartenstein, 1993).
All of these morphogenetic processes require the dynamic assembly and disassembly of AJs
which is achieved through regulation of the CCC in the developing embryo.
17
Figure 5 – Drosophila Embryo Development overview.
Following cellularization at stage 5 the embryo enters gastrulation and morphogenesis begins.
Several structures including ones that are not shown in this figure are formed and/or replaced
during the course of development. (amg) Anterior midgut rudiment; (br) brain; (cf) cephalic
furrow; (cl) clypeolabrum; (df) dorsal fold; (dr) dorsal ridge; (es) esophagus; (gb) germ band;
(go) gonads; (hg) hindgut; (lb) labial bud; (md) mandibular bud; (mg) midgut; (mg) Malpighian
tubules; (mx) maxillary bud; (pc) pole cells; (pmg) posterior midgut rudiment; (pnb) procephalic
neuroblasts; (pro) procephalon; (ps) posterior spiracle; (po) proventriculus; (sg) salivary gland;
(stp) stomodeal plate; (st) stomodeum; (tp) tracheal pits; (vf) ventral furrow; (vnb) ventral
neuroblasts; (vnc) ventral nerve. (Adapted from Hartenstein, 1993).
18
1.4 AJ Formation in Drosophila
1.4.1 Spot AJ assembly begins at cellularization
After fertilization, the Drosophila embryo undergoes 13 nuclear divisions to produce a
multinucleate syncytium that contains ~6000 nuclei. The syncytium stage of the embryo is
followed by the formation of primary epithelium through a process called cellularization (Lecuit,
2004; Harris et al., 2009). The first step in AJ assembly during cellularization involves the
recruitment of cadherin-catenin clusters to apical cellular protrusions between adjacent cell
compartments. As cellularization proceeds, cadherin-catenin clusters that form on the apical
surface protrusions of the same cell are removed and clusters that form between adjacent cell-
cell contacts move basally towards the apico-lateral membrane and mature into spot AJs (Tepass
& Hartenstein, 1994; McGill et al., 2009).
The protein Bazooka (Baz; PAR-3 in mammals) plays a central role in the positioning and
maturation of cadherin-catenin clusters at spot AJ sites (Harris & Peifer, 2004; Harris & Peifer,
2005). Mutant analyses of embryos undergoing cellularization has shown that Baz can still
accumulate at the apico-lateral membrane in maternal-zygotic arm and shg mutants, however,
DEcad mislocalizes along the entire lateral membrane in maternal-zygotic mutants of Baz (Harris
& Peifer, 2004). Furthermore, cadherin-catenin clusters that form in the apical membrane of Baz
mutants fail to migrate to spot AJ assembly sites (McGill et al., 2009). Together, these findings
suggest that Baz acts upstream of AJ formation and is essential for the formation and positioning
of spot AJs.
1.4.2 ZA formation occurs during Gastrulation
Following the establishment of spot AJs during cellularization, the formation of belt-like ZA begins
at gastrulation. ZA formation is characterized by an apico-lateral shift of spot AJs away from the
centrosomes, a decreased interaction between spot AJs and microtubules, and an increased
interaction between spot AJs and actin (Tepass & Hartenstein, 1994; Harris & Peifer, 2004; Cavey
et al., 2008). Two apical polarity regulators; the Crumbs (Crb) and Par complexes play an essential
role in the formation of the ZA (Tepass, 2012).
19
The Par complex is composed of atypical protein kinase C (aPKC), Baz, Par6 and Cdc42. aPKC
phosphorylates Baz which causes Baz to dissociate from the Par complex and allows it to engage
cadherin-catenin clusters to position them at spot AJ sites (Harris & Peifer, 2004; Tepass., 2012).
During gastrulation, the Par6/aPKC complex abrogates spot AJ-microtubule interactions and
instead promotes spot AJ-actin interactions (Harris, 2012; Tepass, 2012). This conclusion is
supported by evidence in aPKC mutants of persistent spot AJ-microtubule association,
mislocalization of spot AJs with each centrosome, and a failure to form the ZA in primary epithelia
(Harris & Peifer, 2007).
Crb (part of the Crb-Sdt-PatJ complex) along with a synaptotagmin-like protein Bitesize (Btsz) also
plays a crucial role in the formation of ZA (Harris, 2012; Tepass, 2012). The absence of Crb leads
to severe AJ defects in early embryos (Tepass, 1996; Medina et al., 2002). Similarly, the
abrogation of Btsz also leads to severe AJ defects that appear to be caused by a disruption of
actin organization at AJs (Pilot et al., 2006). Together, both of these studies suggest that Crb and
Btsz are essential for the formation of the ZA.
1.5 Analysis of α-Cat in Drosophila at the Tepass Lab
The Tepass lab has extensively characterized the function of α-Cat through the evaluation of
more than 20 α-Cat related constructs in both Drosophila ovaries and embryos. Investigations
led by Dr. Ritu Sarpal and Dr. Ridhdhi Desai have revealed that α-Cat regulates adhesion in vivo
in epithelial cells. Their investigations have shown that α-Cat is required for whole animal survival
and both in the relatively static follicular epithelium (FE) cells and for the process of border cell
migration (Sarpal et al., 2012; Desai et al., 2013).
Whole animal experiments conducted in our lab have shown that zygotic α-Cat1 mutants die as
embryos and display head involution defects; a phenotype that is reminiscent of a weak mutant
allele of DE-cad (shgg119) (Tepass et al., 1996; Sarpal et al., 2012). Furthermore, using the Gal4-
UAS system we have shown that expression of α-Cat or αN-cat can rescue head defects in α-Cat1
20
mutant embryos (Desai et al., 2013). Experiments in FE cells and border cell migration (BCM)
show that both FE integrity and BCM, which are compromised in the absence of α-Cat, can be
rescued via expression of α-Cat or αN-cat (Desai et al., 2013). Collectively, these results provide
in vivo evidence that α-Cat is indispensable in Drosophila and that its function may be conserved
throughout the metazoan family.
1.6 Review of RNAi Machinery
In this section, I briefly discuss the concept of double-stranded RNA-mediated interference (RNAi)
because a major part of this thesis is dedicated to the knockdown of maternal α-Cat in Drosophila
embryos. RNAi-induced gene silencing is a method that is used to knock down gene expression
in a range of organisms through degradation of short RNAs that activate ribonucleases to target
downstream homologous mRNA transcripts (Reviewed in Agrawal et al., 2003; Kavi et al., 2008;
Kim & Rossi, 2008).
The knockdown of a target gene occurs in two major steps. In step I, double-stranded RNA
(dsRNA) is cleaved by RNAse III domains of the Dicer enzyme to produce 21 to 23nt long short-
interfering RNAs (siRNA) that contain 5’ and 3’ two nucleotide overhangs. Following cleavage,
these siRNAs enter the RNAi pathway (Elbashir et al., 2001ab; Zhang et al., 2004). The Drosophila
genome encodes two dicer paralogs of which dicer-2 is the one responsible for the generation of
siRNA (Kavi et al., 2008). In step II, the cleaved siRNAs are incorporated into an RNA-induced
silencing complex (RISC) composed of dicer-2, Argonaute2 (Ago2), vasa intronic gene, dFXR1 and
other associated proteins. The core component of RISC is Ago2 as it contains an active catalytic
PIWI domain for mediating cleavage activity (Liu et al., 2004; Meister et al., 2004; Okamura et al.,
2004). Ago2 cleaves the passenger strand of the siRNA duplex and incorporates the guide strand
into RISC which leads to RISC activation for silencing target mRNA transcripts through recognition
via intermolecular base pairing (Tang, G., 2005).
21
1.7 Thesis Objectives
Previous studies investigating the molecular function of α-catenin have shown that it is essential
for the formation and maintenance of AJ integrity in epithelial cells. However it is unclear how
α-catenin regulates CCC and actin dynamics to mediate intercellular adhesion. In vivo
experiments have shown that transgene expression of α-Cat and αN-cat in zygotic α-Cat1
deficient Drosophila embryos rescue embryonic head defects and lethality which suggests that
1) α-catenin is required to maintain intercellular adhesion during morphogenetic processes in
vivo and 2) α-catenin function may be conserved in vertebrates and invertebrates.
The main goals of my research were to 1) develop and study the effects of α-Cat shRNA constructs
targeting the 5’UTR of the maternal α-Cat transcript in Drosophila embryos and 2) to further
investigate whether in vitro biochemical properties, sequence conservation and/or evolutionary
relationship influence α-catenin function in metazoans and Dictyostelium. To study the effects
of maternal α-Cat knockdown in embryos I generated several UAS-α-CatRNAi constructs
targeting the 5’UTR of α-Cat. Transgenic flies containing the UAS-α-CatRNAi constructs were
driven by Gal4 female germline drivers. Using the Drosophila embryo as a model system, I
showed that maternal α-Cat knockdown produced embryonic lethality that is characterized by
severe defects throughout the whole embryo. Furthermore, immunostaining experiments
showed that the embryonic epithelium and α-Cat localization at AJs were severely disrupted.
These observations suggest that maternal α-Cat is indispensable for embryonic development and
that UAS-α-CatRNAi1 can be used alone or in combination with α-Cat1 to induce varying levels of
α-Cat knockdown.
The second objective of my study was to determine if in vitro biochemical properties, sequence
conservation and/or evolutionary relationship influence α-catenin function in metazoans and
Dictyostelium. To investigate this question I generated several transgenic UAS-α-catenin
constructs from mouse (αE-cat and αN-cat), zebrafish (Drα-cat), worm (HMP-1), and slime mold
(Ddα-cat) α-catenin cDNAs and compared their rescue activity in α-Cat1 mutant embryos
compared to α-Cat. The results of my investigation showed that all metazoan α-catenin cDNAs
(αE-cat, αN-cat, Drα-cat and HMP-1) facilitated embryonic rescue in α-Cat1 mutants and localized
22
to AJs. In contrast Ddα-cat was unable to rescue embryonic lethality and did not localize to AJs.
These results suggest that α-catenin function is conserved among metazoans but not between
metazoans and amoebozoans and that the evolutionary relationship between α-catenin
molecules from different species determines how well that particular α-catenin molecule
functions in flies.
23
Chapter 2
Materials and Methods
2.1. Generation of transgene constructs
2.1.1 shRNA constructs
The transgenes generated for knockdown analysis are listed in Table 1. These shRNA constructs
were designed by selecting several target 21-nt sequences in the α-Cat maternal transcript based
on the algorithm provided by Vert et al., (2006). The 71 base pair oligonucleotide sequences
were produced using the shRNA design protocol provided by Ni et al., (2011). The top and bottom
oligonucleotides were generated such that the annealing of the top and bottom strand
oligonucleotides produced overhangs for the restriction enzymes NheI and EcoRI. The annealed
oligonucleotides were cloned into the WALIUM20 vector (Figure 5) and transformed using TOP10
competent cells.
Transgenic animals were produced by Best Gene Inc., via ϕC31 integrase mediated injection of the
attB carrying constructs into Drosophila melanogaster flies carrying an attP2 recombination site
on the third chromosome (Thorpe & Smith, 1998; Groth et al., 2004). Construct verification in
transgenic animals was performed using Polymerase Chain Reaction.
2.1.2 Cross-species α-catenin rescue constructs
Transgenes generated for the rescue analysis are listed in Table 2. These constructs were
designed by cloning α-Cat, αN-cat, αE-cat, Drα-cat, HMP-1 and Ddα-cat cDNAs using the
Gateway® Cloning Technology system. cDNAs containing only the coding regions minus the stop
codon from each organism were subcloned into the Gateway pENTR™/D-TOPO entry vector using
kit protocols except for HMP-1 cDNA which was cloned using the NotI and AscI restriction enzyme
24
sites. The Gateway® LR Clonase® Enzyme mix was used to clone all entry vector constructs into
pPWH (pUASP-Gateway Cassette-C-term 3xHA) vectors containing an attB insertion site that was
added using the NSiI restriction enzyme site.
Transgenic animals were produced by Best Gene Inc., via ϕC31 integrase mediated injection of the
attB carrying constructs into Drosophila melanogaster flies carrying an attP2 recombination site
on the third chromosome (Thorpe & Smith, 1998; Groth et al., 2004). Construct verification in
transgenic animals was performed using Polymerase Chain Reaction.
25
Table 1- List of shRNA transgenic constructs designed to knockdown α-Cat.
Construct Sequence Targeted Site Targeted Oligonucleotide Sequence
UAS-α-CatRNAi1
GGTTAAAGAATTTATGTTAAA
5’ Untranslated Region
PhosctagcagtGGTTAAAG
AATTTATGTTAAAtagttat
attcaagcataTTTAACATA
AATTCTTTAACCgcg
UAS-α-CatRNAi2
CGACAATTACATTCTTATATA
3’ Untranslated Region
PhosctagcagtCGACAATT
ACATTCTTATATAtagttat
attcaagcataTATATAAGA
ATGTAATTGTCGgcg
UAS-α-CatRNAi3
CATTCTTATATAACTCTAATC
3’ Untranslated Region
PhosctagcagtCATTCTTA
TATAACTCTAATCtagttat
attcaagcataGATTAGAGT
TATATAAGAATGgcg
UAS-α-CatRNAi4
GTATCAATTAATTACCATACA
3’ Untranslated Region
PhosctagcagtGTATCAAT
TAATTACCATACAtagttat
attcaagcataTGTATGGTA
ATTAATTGATACgcg
UAS-α-CatRNAi5
CATTGTCGAAGATGATCTAAA
Exon-2
PhosctagcagtCATTGTCG
AAGATGATCTAAAtagttat
attcaagcataTTTAGATCA
TCTTCGACAATGgcg
UAS-α-CatRNAi6
GGACGAGCTTATGGATAATAT
Exon-2
PhosctagcagtGGACGAGC
TTATGGATAATATtagttat
attcaagcataTTTAGATCA
TCTTCGACAATGgcg
Table 2 – List of cross-species α-catenin transgene constructs used for rescue analysis during Drosophila embryogenesis.
Construct Origin % Identity to α-Catenin
UAS-α-Cat::HA Fly 100
UAS-αN-cat::HA Mouse 62.8
UAS-αE-cat::HA Mouse 61.2
UAS-Drα-cat::HA Zebrafish 60.6
UAS-HMP-1::HA Worm 40.6
UAS-Ddα-cat::HA Slime Mold 23.5
26
Figure 6 - Schematic representation of WALIUM 20 Vector.
All shRNA constructs were inserted into WALIUM 20 plasmid vectors. White is the eye-specific
selectable marker used to select for flies carrying the vector. attB site is used for site specific
integration into the fly genome. The vector carries an Ampicillin resistance gene for antibiotic
selection. The 10x UAS, Hsp70 Promoter, 2 gypsy insulators and 1 ftz intron are all used for
over-expression of the gene of interest. The vector also contains an SV40 Poly-A tail region and
Loxp sites for Cre-LoxP recombination. The MCS contains NheI and EcoRI restriction enzyme
sites for introduction of gene of interest using restriction digests and conventional ligation
protocols. (Adapted from: http://www.flyrnai.org/supplement/WALIUM20_map_seq.pdf)
27
28
2.2 Drosophila genetics
2.2.1 α-Cat knockdown experiment
All the stocks used are in the white- background. The following lines carrying Gal4 drivers were
used to express the shRNA in early embryos – mat tub 67; 15-Gal4 (mat-tub-Gal4) a gift from D.
St. Johnston & F. Wirtz-Peitz, and MTD-Gal4 (Petrella et al., 2007).
The following recombinant line was generated and utilized for the knockdown experiments –
1. α-Cat1UAS-α-CatRNAi1
2.2.2 Cross-species α-catenin rescue experiment
All the stocks used are in the white- background. The following lines carrying Gal4 drivers were
used to express the rescue constructs in early embryos – Act-Gal4Da-Gal4α-Cat1/TM3-SerTwi-
Gal4UAS-GFP (ActDa-Gal4α-Cat1; Sarpal et al., 2011) and en-Gal4.
The following recombinant lines were generated and utilized for the rescue experiments. All lines
were balanced over TM3-Ser·Twi-Gal4·UAS-GFP (TM3-GFP).
1. UAS-α-Cat::HA, a-Cat1 (Positive Control)
2. UAS-αN-cat::HA, α-Cat1
3. UAS-αE-cat::HA, α-Cat1
4. UAS-Drα-cat::HA, α-Cat1
5. UAS-HMP-1::HA, α-Cat1
6. UAS-Ddα-cat::HA, α-Cat1
29
2.3 Evaluation of Constructs
2.3.1 α-Cat knockdown experiment
To evaluate the effectiveness of each of the shRNA constructs males from each of the wild-type
(wt) and transgenic lines were crossed to female virgins of mat-tub-Gal4 and MTD-Gal4 at 25°C.
Female virgins were collected in the next generation and then crossed to wild-type male flies at
25°C. Eggs were collected on apple juice agar plates at 29°C and then monitored daily. After two
days of incubation, the plates were checked for dead embryos and larvae. The construct was
deemed effective if only dead embryos were present on the plate. The presence of larvae was
scored as ineffective knockdown of α-Cat.
To evaluate the phenotypic effects of the shRNA constructs; wild-type, transgenic and
recombinant lines were crossed to mat-tub-Gal4 and MTD-Gal4 at 25°C. Female virgins were
collected in the next generation and then crossed to wild-type male flies. Eggs were collected on
apple juice agar plates at 25°C and then monitored daily. Dead embryos were collected and
mounted on Hoyer’s medium and lactic acid (1:1 ratio) after 2-3 days in order to visualize the
cuticle.
For quantification of the severity of aberrant phenotypes the number of abdominal denticle belts
in each embryo were counted for each genotype. Each embryo was assigned a score of 0 to 8
where a score of 0 indicated that no abdominal denticle belts were present and a score of 8
indicated that all 8 abdominal denticle belts were present.
2.3.2 Cross-species α-catenin rescue experiment
To evaluate the ability of each of the transgenes to rescue α-Cat1 zygotic mutant embryos the
transgenic lines were recombined with α-Cat1 and then crossed to ActDa-Gal4·α-Cat1 or en-Gal4
at 25°C. Non-GFP eggs were collected on apple juice agar plates at 25°C and then monitored
daily. Dead embryos were collected and mounted on Hoyer’s medium and lactic acid (1:1 ratio)
in order to visualize the cuticle.
For quantification of the rescue conferred by each of the constructs 100-200 non-GFP fertilized
eggs were collected and monitored daily at 25°C. After embryogenesis, surviving first instar
30
larvae were transferred to apple juice agar plates containing a thin film of yeast. This procedure
was also performed for second and third instar larvae. Growth was monitored until either all the
pupal progeny either died or emerged as adults. A scoring system that was utilized by Sarpal et
al., (2012) was used to classify the progeny of each genotype. A score of -3 was assigned to
embryos that died and showed no ventral epidermis. Embryos that possessed fully open dorsal
epithelium were given a score of -2. A score of -1 was associated with ventral defects or dorsal
closure defects. A score of 0 was given to embryos with a strong head defect which is the most
common phenotype associated with α-Cat1 (Sarpal et al., 2012). Embryos that possessed weak
head defects or a normal head but died during embryogenesis were given a score of 1 and 2
respectively. Rescued progeny were given a score of 3, 4, 5, 6, 7 and 8 if they survived to first
instar larvae, second instar larvae, third instar larvae, early pupae, late pupae and adult flies
respectively.
2.3.3 Immunoblotting
For immunoblotting of the HA-tagged rescue constructs, Drosophila embryos were
dechorionated in a 50% bleach solution for 4 minutes. Dechorionated embryos were
homogenized in a Lamelli Buffer solution (950 µL 2x Biorad® Laemmli Sample Buffer, 50 µL 2-
Mercaptoethanol). 40 µg of lysates from whole embryos were loaded into each well and proteins
were resolved by SDS-PAGE. The gel was transferred to a nitrocellulose membrane according to
the recommended protocols provided by Life Technologies iBlot® 2 Dry Blotting system.
Life Technologies iBind™ Western System recommended protocols were used for the detection
of the HA tag. The primary antibodies used for detection were: anti-HA (Rat monoclonal – 3F10,
1:500; Abcam) and anti-tubulin (Mouse monoclonal – E7, 1:500; Hybridoma). The secondary
antibodies used for visualization were: anti-Rat 680LT (Goat – 1:5000; Licor) and anti-mouse
800CW (Donkey – 1:5000; Licor). Total incubation time was 2.5 hours. The HA tag was visualized
using the LI-COR Odyssey® Fc Dual-Mode Imaging system.
2.3.4 Immunocytochemistry
For antibody staining of both the knockdown and cross-species rescue experiment samples,
Drosophila embryos were dechorionated in a 50% bleach solution for 4 minutes. Subsequently,
31
the embryos were heat-fixed at 85°C for 10-20 seconds in 3mL of 1X E-wash buffer (70mM NaCl,
0.1% Tritox-X-100). The fixed ovaries were chilled using 5mL of ice-cold 1X E-wash buffer and
incubated on ice for 2-5 minutes. Following fixation, the embryos were methanol popped with
6 mL Heptane AND 4 mL Ethanol. The embryos were washed and blocked over a period of 3-5
hours. The primary antibodies used for embryo stainings were: anti-α-Cat (guinea pig polyclonal
– gp121, 1:1000; Sarpal et al., 2012), anti-Crb (Rat monoclonal – F3 Final, 1: 500; Pellikka et al.,
2002), anti-Fasciclin III (Mouse Monoclonal – 7G10, 1:50; Developmental Studies Hybridoma
Bank (DSHB)), anti-α-Cat (guinea pig polyclonal – gp121, 1:1000, Sarpal et al. 2012), anti-HA (Rat
monoclonal – 3F10, 1: 500; Abcam), and anti-Arm (Mouse Monoclonal – N2 7A1, 1:50; DSHB).
Primary antibody treated samples were incubated at 4°C overnight. The washing and blocking
step were repeated the next day over a period of 3-5 hours. Secondary antibodies were
conjugated to Alexa Fluor-488, Alexa Fluor-555 and Alexa Fluor-647 (Jackson Immunoresearch
Laboratories). Secondary antibody treated samples were incubated at 4°C overnight. The
stained embryos were washed over a period of 3-5 hours and mounted in Vectashield (Vector
Labs). The samples were imaged with a Leica SP8 resonant confocal microscope using the 40X or
63X lenses.
2.3.5 Statistical Analysis
All statistical analyses were performed using Graphpad 5 software. Data in graphs are
represented as mean ± standard deviation. Two-tailed unpaired t tests were used to determine
statistical significance.
32
Chapter 3
Maternal α-Cat Knockdown
3.1 Introduction
Our lab has previously shown that zygotic null mutant embryos of α-Cat (α-Cat1) display defects
in the head region from stage twelve onwards (Sarpal et al., 2012). These defects manifest as
holes in the head ectoderm which are surrounded by apically constricted epithelial cells.
Furthermore, the affected embryos are unable to complete head involution; a phenotype
previously encountered in weak mutant alleles of DEcad (shgg119) and Arm (Tepass et al., 1996;
Uemura et al., 1996; Orsulic & Peifer, 1996; Jenkins et al., 2003; Sarpal et al., 2012). In contrast
to those head defects, other tissues remain intact in α-Cat1 mutants indicating that epithelial
integrity in the head region is compromised as a result of strong pulling forces and that maternal
α-Cat is sufficient for a majority of DEcad dependent morphogenetic processes that occur in the
embryo.
A previous study conducted in Drosophila used injection of α-Cat dsRNA to knockdown its
function in the early embryo. Antibody stainings of gastrulating embryos revealed that epithelial
integrity in the posterior end was disrupted and an associated breakdown of the spectrin
cytoskeleton was observed. Consequently, these cells were unable to carry out morphogenetic
movements during gastrulation. Furthermore, DEcad levels were severely reduced in later stage
embryos (Magie et al., 2002). Taken together, these results suggest that maternal α-Cat may be
required to regulate cadherin function during gastrulation in the early embryo.
In order to continue the characterization of α-Cat function during early embryogenesis I
generated several UAS-α-CatRNAi constructs targeting different regions of the α-Cat transcript
33
for maternal knockdown (Figure 7). Four of the constructs were designed to knockdown α-Cat
by targeting the 5’ and 3’ untranslated region (UTR), whereas the remaining constructs were
designed to target the coding region of α-Cat, specifically the second exon. The primary objective
of making these knockdown constructs was to assess the embryonic phenotype conferred by
perturbing maternal α-Cat. The long term goal of this project is to knockdown endogenous α-Cat
in Drosophila embryos and tissues with shRNAs directed at the 5’ and/or 3’UTRs that do not affect
a number of structure-function α-Cat constructs generated by other lab members including those
published in Sarpal et al., (2012) and Desai et al., (2013). This would allow us to further
characterize the function of each domain within α-Cat especially the M region which may act as
a mechanosensor similar to αE-catenin (Yonemura et al., 2010).
34
Figure 7 - Schematic Representation of α-Cat shRNA target locations.
Six constructs targeting the α-Cat transcript were generated. Three constructs targeted the 3’
untranslated region (3’UTR), two constructs targeted the 2nd exon (exon-2), and one construct
targeted the 5’ untranslated region (5’UTR). Numbers indicate nucleotide position within the α-
Cat mRNA transcript.
35
3.2 Results
I generated several α-Cat shRNA knockdown constructs that were designed to target different
regions of the α-Cat mRNA transcript. The 5’ and 3’ UTR targeting constructs were designed to
specifically knockdown endogenous α-Cat in the embryo without interfering with the expression
of previously made α-Cat rescue and structure-function constructs that lack these regions.
Additionally, the two constructs targeting the second exon were designed to knockdown both
endogenous and rescue constructs as a positive control. The presence of my constructs was
confirmed phenotypically by checking for red pigmentation in the eyes. Confirmation of
genotypic attP2 insertion was performed independently by both Bestgene Inc. and myself using
PCR.
3.2.1 UAS-α-CatRNAi1 is the only effective α-Cat shRNA construct
In order to assess the effectiveness of the shRNA constructs I performed two generation crosses
for wt and transgenic lines with mat-tub-Gal4 and MTD-Gal4 to ensure that females in the second
generation carried a copy of the Gal-4 driver along with the UAS transgene for construct
expression. Female virgins expressing the shRNA constructs were crossed to wild-type male flies
and allowed to lay eggs (See 2.3.1). The knockdown was deemed effective if a genotype
produced 100% embryonic lethality similar to a positive control α-Cat RNAi line (α-CatRNAi33430)
obtained from the Bloomington Drosophila Stock Center (BDSC) at Indiana University. Based on
this criterion shRNA constructs targeting the 3’ UTR (UAS-α-CatRNAi2, UAS-α-CatRNAi3 and UAS-
α-CatRNAi4) were ineffective as no embryonic lethality was observed and all fertilized embryos
progressed into larval stages. shRNA constructs targeting the second exon of α-Cat (UAS-α-
CatRNAi5 and UAS-α-CatRNAi6) were partially effective at knocking down α-Cat since both
embryonic lethality and larvae were observed. In contrast, a shRNA construct targeting the 5’
UTR (UAS-α-CatRNAi1) produced 100% embryonic lethality. Complete lethality was also observed
in a recombinant line of α-Cat1 α-CatRNAi1. Collectively, these results suggest that α-CatRNAi1 is
the only transgenic line effective at perturbing maternal α-Cat mRNA transcripts. All subsequent
knockdown experiments were performed using UAS-α-CatRNAi1 as a means of knocking down
maternal α-Cat. Data on all constructs are summarized in Table 3.
36
Table 3 – Effectiveness of α-Cat RNA knockdown mediated by α-Cat shRNA constructs targeting different regions of the α-Cat mRNA transcript.
Genotype Site Targeted Dead Embryos? Larvae present?
WT N/A No Yes
α-CatRNAi33430 Coding region Yes No
UAS-α-CatRNAi1 5’UTR Yes No
UAS-α-CatRNAi2 3’UTR No Yes
UAS-α-CatRNAi3 3’UTR No Yes
UAS-α-CatRNAi4 3’UTR No Yes
UAS-α-CatRNAi5 Coding region Yes Yes
UAS-α-CatRNAi6 Coding region Yes Yes
α-Cat1 UAS-α-CatRNAi1
5’UTR Yes No
3.2.2 Maternal knockdown of α-Cat produces a strong embryonic phenotype
To assess the strength of α-Cat knockdown conferred by UAS-α-CatRNAi1 I tested two
independently generated lines with two different female germline drivers; MTD-Gal4 and mat-
tub-Gal4. The difference between these two drivers is that mat-tub-Gal4 does not drive
expression of the gene of interest during early oogenesis in the germarium which may allow for
the production of more eggs (Staller et al., 2013). To perform the experiment, MTD-Gal4 and
mat-tub-Gal4 female virgins were crossed to WT and transgenic males. In the next generation
female virgins carrying both Gal4 and UAS copies were crossed to wild-type male flies. Fertilized
eggs were collected and observed (See 2.3.1).
The introduction of one or two copies of each Gal4 driver with α-CatRNAi1 produced severe
defects in affected embryos that manifested as head holes, ventral holes and dorsal holes. The
majority of MTD-Gal4 and mat-tub-Gal4 driven α-CatRNAi1 cuticle phenotypes were
characterized by the presence of both head and ventral holes which were accompanied by a
marked reduction in the number of observed intact abdominal belts (Figure 8C-D). Interestingly,
visual analysis of the majority of embryos showed that head and ventral holes were often larger
in embryos that were driven by mat-tub-Gal4 compared to MTD-Gal4. α-Cat1 mutant embryos
which show abnormal head morphology due to head involution failure were used as a marker for
weak knockdown when comparing the severity of defects (Figure 8B). In contrast, α-CatRNAi33430
37
embryos were used as a marker for strong α-Cat knockdown due to a complete loss of the head
skeleton and ventral epithelia (Figure 8F). Collectively, these results suggest that maternal
knockdown of α-Cat produces an intermediate phenotype that is significantly stronger than the
reported phenotype of α-Cat1.
In order to compare the strength of defects conferred by each driver I quantified the defects by
counting the remaining number of intact abdominal belts left in each embryo for two
independently generated α-CatRNAi1 lines. Quantitative analysis of the defects showed that
both MTD-Gal4 and mat-tub-Gal4 driven α-CatRNAi1 embryos had significantly reduced number
of intact abdominal belts with means of 3.8 (MTD>αCatRNAi1-Line 1), 2.5 (mat-tub>αCatRNAi1-
Line 1), 3.4 (MTD>αCatRNAi1-Line 2), and 2.6 (mat-tub>αCatRNAi1-Line 2) respectively compared
to wild-type which had a mean of 7.9 intact abdominal belts (Figure 9). While there were no
significant differences observed between Line 1 and Line 2 for both MTD-Gal4 (p=0.0933) and
mat-tub-Gal4 (p=0.7169), further analysis of the data showed that mat-tub-Gal4 conferred a
significantly stronger denticle belt phenotype than MTD-Gal4 for both independent α-CatRNAi1
lines. Together, these data suggest that both MTD-Gal4 and mat-tub-Gal4 were effective at
inducing α-Cat mRNA knockdown, but that mat-tub-Gal4 elicits a stronger knockdown in the
embryo than MTD-Gal4. Thus, α-CatRNAi1-Line 1 was driven by mat-tub-Gal4 for the subsequent
knockdown experiment.
38
Figure 8 - Cuticles of representative WT, α-Cat1 and α-CatRNAi embryos.
Cuticle preparations in Hoyer’s medium and lactic acid (1:1) of (A) WT, (B) α-Cat1 (C) MTD-
Gal4>α-CatRNAi1, (D) m at-tub-Gal4>α-CatRNAi1, (E) mat-tub-Gal4>α-Cat1, α-CatRNAi1 and (F)
α-CatRNAi33430 embryos. Anterior is left.
39
40
Figure 9 - Quantitative analysis of α-Cat knockdown defects in embryos using two germline
drivers.
Cuticle preparations of embryos in Hoyer’s medium and lactic acid (1:1) of WT (n=106), MTD-
Gal4>α-CatRNAi1 (Line 1; n=72), mat-tub-Gal4>α-CatRNAi1 (Line 1; n=286), MTD-Gal4>α-
CatRNAi1 (Line 2, n=126), and mat-tub-Gal4>α-CatRNAi1 (Line 2; n=179) were scored for
phenotypic severity. A score of 0 indicates that no abdominal denticle belts were intact and a
score of 8 indicated that all 8 abdominal denticle belts were intact. Bars represent mean
number of intact denticle belts observed ± S.D. Three black stars represent a significant
reduction in number of intact abdominal denticle belts observed as compared to WT
(P<0.0001). Three white stars represent a significant reduction in number of abdominal
denticle belts observed between experimental line as compared to each other (P<0.0001).
Note: There was no significant difference between Line 1 and Line 2 for each driver.
41
42
To compare the strength of α-Cat knockdown conferred by the recombinant UAS-α-Cat1, α-
CatRNAi1 compared to α-Cat1 and α-CatRNAi1 alone I crossed female mat-tub-Gal4 virgins to
wild-type and transgenic males and collected female virgins in the next generation. These virgins
were then crossed to wild-type male flies and allowed to lay 100-200 eggs which were analyzed
(See 2.3.1).
Cuticle preparations of embryos showed that the majority of α-Cat1α-CatRNAi1 embryos
displayed a more severe phenotype than both α-Cat1 and α-CatRNAi1 alone. In these embryos
only patches of cuticle were observed (Figure 8E). The defects in α-Cat1αCatRNAi1 were similar
in strength to the patchy cuticle phenotype observed for the positive control line α-CatRNAi33430
(Figure 8F).
Quantitative analysis using the denticle belt scoring system showed that α-Cat1, α-CatRNAi33430,
α-CatRNAi1, and α-Cat1α-CatRNAi1 all had significantly reduced number of abdominal denticle
belts compared to WT with means of 7.4, 0.2, 2.6, and 0.3 respectively (Figure 10). Further
comparison of these lines showed that the expression of α-CatRNAi1 induced a significantly more
severe phenotype than observed in α-Cat1 zygotic mutant embryos and that the expression of α-
CatRNAi1 in an α-Cat1 background significantly enhanced the phenotype conferred by α-Cat1 or
α-CatRNAi1 alone.
Together, these results suggest that maternal germline expression of α-CatRNAi directed against
the 5’UTR of the α-Cat mRNA transcript leads to embryonic lethality that is characterized by
severe defects in the embryonic cuticle and that maternal α-Cat knockdown combined with the
zygotic mutant genotype significantly enhances the defects seen with α-CatRNAi1 maternal
knockdown alone.
43
Figure 10 - Quantitative analysis of α-Cat knockdown in embryos using mat-tub-Gal4.
Cuticle preparations of embryos in Hoyer’s medium and lactic acid (1:1) of WT (n=106), α-Cat1
(n=128), 33430 (n=164), α-CatRNAi1 (n=286), and α-Cat1, α-CatRNAi1 (n=193) were scored for
phenotypic severity. A score of 0 indicates that no denticle belts were intact and a score of 8
indicated that all 8 abdominal denticle belts were intact. Bars represent mean number of intact
denticle belts observed ± S.D. Three black stars represent a significant reduction in number of
intact denticle belts observed as compared to WT (P<0.0001). Two black stars represent a
significant reduction in number of intact denticle belts observed as compared to WT (P<0.001).
Three white stars represent a significant reduction in number of denticle belts observed
between the experimental lines (P<0.001).
44
45
3.2.3 Cortical and total α-Cat protein levels are severely reduced in α-CatRNAi1
and α-Cat1α-CatRNAi1 affected embryos
To assess the impact of suppressing maternal α-Cat in embryos at the cellular level I
immunostained WT, α-CatRNAi33430, α-CatRNAi1 and α-Cat1α-CatRNAi1 embryos with Crb, α-Cat
and FasIII which are apical membrane, AJ and basolateral membrane markers respectively. In
wild-type embryos, all three markers are distributed at the cell boundaries between adjacent
ectodermal epithelial cells which envelope the developing embryo (Figure 11 A-A’’’). In α-
CatRNAi1 embryos, only the dorsal portion of the embryo retained a recognizable epithelium
while the head and ventral regions showed large holes in the epithelial sheet which corresponded
to the phenotypes seen in cuticle preparations of α-CatRNAi1 embryos (Figure 11 C-C’’’; Figure
8D). α-Cat, Crb and FasIII marked epithelia in α-CatRNAi33430 (Figure 11 B-B’’’) and α-Cat1·α-
CatRNAi1 (Figure 11 D-D’’’) embryos were present in small patches that were distributed
throughout the embryo although more patches overall were observed in α-Cat1α-CatRNAi1
embryos than α-CatRNAi33430 which complied with cuticle observations of both genotypes and is
consistent with the observation that α-CatRNAi33430 produces the strongest knockdown (Figure 8
E-F).
A closer look at the epithelial cells in WT embryos showed that α-Cat, Crb and FasIII localized at
the cell boundaries between adjacent epithelial cells. In αCatRNAi33430 and α-Cat1α-CatRNAi1
embryos α-Cat was undetectable and levels of FasIII and Crb levels were reduced (Figure 12 B-
B’’’, D-D’’’). α-CatRNAi1 embryos showed a small dorsal region of intact epithelium that was
immunostained by Crb and FasIII, however, these cells showed severely reduced α-Cat at the cell
membrane (white arrowheads) (Figure 12 C-C’’’). Collectively, these results suggest that the
epithelial layer of cells surrounding the developing embryo is severely disrupted when maternal
α-Cat levels are diminished and that α-Cat protein levels are strongly reduced or absent in those
embryos.
46
Figure 11 – Immunostainings of α-Cat knockdown embryos showing disruption of intercellular
adhesion.
Stage 16-17 (A-A’’’) WT, (B-B’’’) α-CatRNAi33430, (C-C’’’) α-CatRNAi1, (D-D’’’) α-Cat1α-CatRNAi1
embryos immunostained for α-Cat, Crb and FasIII.
In WT embryos (A-A’’’) Crb, α-Cat, and FasIII localize throughout the embryo at the cell
membrane. α-Cat levels are strongly reduced in α-CatRNAi33430 (B), α-CatRNAi1 (C), and α-
Cat1α-CatRNAi1 (D) embryos as marked by Crb and FasIII which label the remaining epithelial
cells in α-CatRNAi33430 (B’-B’’), α-CatRNAi1 (C’-C’’), and α-Cat1α-CatRNAi1 (D’-D’’).
47
48
Figure 12 – Immunostainings of epithelial cells show that α-Cat levels and localization are
severely compromised in α-CatRNAi epithelial cells.
(A-A’’’) WT, (B-B’’’) α-CatRNAi33430, (C-C’’’) α-CatRNAi1, (D-D’’’) α-Cat1α-CatRNAi1 embryos
immunostained for α-Cat, Crb and FasIII.
In WT embryos (A-A’’’) epithelial cells cover the embryo and α-Cat, Crb, and FasIII localize at the
cell membrane. In α-CatRNAi33430 embryos (B-B’’’) only patchy remnants of epithelia remain
and α-Cat levels are reduced. α-CatRNAi1 embryos (C-C’’’) show reduced levels of α-Cat at the
cell membrane (white arrowheads) compared to WT in areas where epithelia remain as marked
by Crb and FasIII. Similar to α-CatRNAi33430, α-Cat1α-CatRNAi1 embryos show only patchy
remnants of epithelia and reduced levels of α-Cat (D-D’’’).
49
50
3.3 Discussion
The Tepass lab has previously shown that maternal α-Cat is sufficient for Drosophila embryo
development until stage twelve after which the absence of zygotic α-Cat leads to defects in the
head region. Later in development, this accumulation of defects leads to head involution failure
which causes embryonic lethality (Sarpal et al., 2012). Furthermore, dsRNA injection of α-Cat in
embryos shows a localized breakdown of epithelial sheets (Magie et al., 2002; Cavey et al., 2008).
Collectively, these results suggest that epithelial integrity in the early embryo is maintained by
maternal α-Cat during developmental processes such as gastrulation, germ band elongation and
stomodeal invagination. I generated a UAS-α-Cat shRNA construct (UAS-α-CatRNAi1) which
recognizes and knocks down endogenous maternal α-Cat in whole embryos under the control of
female germline Gal4 drivers. The objective of generating this construct was to confirm if
maternal α-Cat is important for the development of the early Drosophila embryo and to develop
an experimental reagent that would allow for the embryonic analysis of a number of structure-
function constructs lacking the 5’UTR region previously made in the lab. Here, I discuss the
results of the knockdown experiments and how maternal α-Cat knockdown may affect early
development of the Drosophila embryo.
The 5’ UTR region of α-Cat is a reliable target for inducing α-Cat knockdown
In order to knockdown an endogenous mRNA transcript via shRNAs they must first be transcribed
by the RNA machinery and transported into the cytoplasm by exportin 5. Once the shRNA arrives
in the cytoplasm it is cleaved by Dicer, unwound and incorporated into the RNA induced silencing
complex (RISC). The passenger strand is cleaved and sent for degradation by Ago2 whereas the
guide strand is incorporated into the RISC. Perfect binding (no mismatched base-pairing) of the
loaded RISC with a target sequence results in mRNA degradation. Imperfect target (some
mismatches) binding leads to translation repression (Lambeth & Smith, 2013).
The initial experiments which tested the efficacy of the shRNA constructs that among a total of
six generated shRNA constructs only α-CatRNAi1 which targets the 5’UTR of endogenous α-Cat
induced 100% embryonic lethality. This suggests that the α-CatRNAi1 sequence does not contain
any mismatches with the endogenous transcript and can easily access the target sequence site
51
within the α-Cat mRNA transcript. In contrast, α-CatRNAi2, α-CatRNAi3, and α-CatRNAi4 which
targeted regions within the 3’UTR of α-Cat produced 0% embryonic lethality. One possibility for
why these constructs may not have been successful at eliciting α-Cat knockdown may be because
the target sequences for these constructs were predicted to be less effective than the others
based on the algorithm provided by Vert et al. (2006). Another possibility could be that the target
sequence sites within the 3’UTR may be inaccessible to the shRNAs due to mRNA folding. A third
possibility for why these constructs were unsuccessful at knocking down maternal α-Cat may be
the nucleotide composition of the target sequences themselves since some nucleotides are
preferred over others at particular positions for example the presence of A/U at the 5’end and of
G/C at the 3’end of the antisense strand can significantly increase the efficacy of mRNA silencing
(Vert et al., 2006). shRNA constructs targeting the coding region of endogenous α-Cat (α-
CatRNAi5 and α-CatRNAi6) produced incomplete embryonic lethality which suggests that
targeting of this region led to translational repression of α-Cat but did not result in total mRNA
degradation. Collectively, these results indicate that not all regions of α-Cat are easily targetable
when it comes to inducing knockdown of the mRNA transcript and that the 3’UTR region of the
α-Cat mRNA transcript may be more resistant to α-Cat knockdown compared to the 5’UTR region.
Maternal expression of α-CatRNAi1 produces severe embryonic defects
Maternal knockdown of α-Cat in the Drosophila female germline produces an embryonic lethal
phenotype where a majority of analyzed cuticles show head, ventral and dorsal closure defects
which are characterized by large holes in the anterior-ventral region, dorsal region and the
posterior-ventral region (Figure 8C and D). Both qualitative analysis of cuticles and quantitative
analysis of the phenotype suggest that maternal knockdown of α-Cat by α-CatRNAi1 confers more
severe defects than α-Cat1 (Figure 8B-D; Figure 9). The increased severity of embryonic defects
is consistent with the idea that AJ and epithelial integrity are affected more severely and earlier
than zygotic null mutants which has been observed by previous studies exploring the function of
DE-cad and α-Cat (Tepass et al., 1996; Sarpal et al., 2012). Immunostainings of α-CatRNAi1
embryos show that large parts of the anterior and ventral embryonic epithelium are absent and
that α-Cat levels are severely reduced which suggests that even low levels of α-Cat may be
enough to maintain epithelial integrity to some extent which is consistent with previous
52
observations (Figure 11 C-C’’’; Figure 12 C-C’’’; Sarpal et al., 2012). Collectively, these results
indicate that maternal α-Cat is indispensable for early embryonic development and that even low
levels of α-Cat at the cell membrane may be enough to maintain epithelial integrity.
Maternal germline expression of α-CatRNAi1 in α-Cat1 heterozygous animals disrupts the entire
embryonic epithelium
The expression of α-CatRNAi1 in a heterozygous α-Cat1 background displayed a patchy cuticle
phenotype that was more severe than α-Cat1 or α-CatRNAi1 alone (Figure 8E; Figure 10). One
reason for the enhancement of phenotypic severity may be that both maternal and zygotic α-Cat
transcript levels are halved in heterozygotes which leads to a more thorough knockdown of
endogenous α-Cat. Immunostaining analysis of α-Cat1, α-CatRNAi1 embryos show that virtually
no epithelium remains in affected embryos which suggests that the knockdown of maternal α-
Cat in heterozygous flies strongly interferes with the formation and/or maintenance of the
embryonic epithelium (Figure 11 D-D’’’; Figure 12 D-D’’’).
53
Chapter 4
Cross-species rescue of α-Cat1 mutant embryos
4.1 Introduction
Previous studies investigating the function of α-catenin have shown that it can exist as a
monomer or dimer in vitro depending on the species and isoform being investigated. Drosophila
α-Cat exists in a majority dimeric pool and a smaller monomeric pool that can both directly bind
to actin, however, in vivo evidence suggests that only monomeric α-Cat functions at AJs (Desai et
al., 2013; Ishiyama et al., 2013). In contrast, in vitro studies of mammalian α-catenins have
produced conflicting data. These studies suggest that mouse αE-cat (~62% identical to α-Cat)
binds to actin directly as a dimer only, even though both isoforms exist and that αN-cat (~64%
identical to α-Cat) exists as a monomer at 25°C that can dimerize at 37°C (Drees et al., 2005;
Yamada et al., 2005; Pokutta et al., 2014). Although αN-cat can exist as a temperature dependent
monomer or dimer in vivo analysis of αN-cat in the Tepass Lab has revealed that it localizes to
AJs exclusively as a monomer (Desai et al., 2013). α-catenin has also been isolated from other
vertebrates and invertebrates such as zebrafish and worms.
Biochemical and in vivo data concerning Drα-cat (~61% identical to α-Cat) and HMP-1 (~41%
identical to α-Cat) indicate that both molecules exist exclusively as monomers but that only Drα-
cat binds to actin in vitro (Kwiatkowski et al., 2010; Schepsis et al., 2012; Miller et al., 2013).
Although HMP-1 binding to actin does not occur in vitro it is still required for the regulation of
intercellular adhesion in C. elegans since zygotic HMP-1 mutants show embryonic elongation
defects that are characterized by a loss of junctional actin. Furthermore, structure-function
analysis of HMP-1 has shown that it may be subject to head-tail autoinhibition similar to Vinculin
54
since the deletion of the head or tail region of the molecule promotes HMP-1-actin binding even
though full length HMP-1 is unable to interact with actin in vitro (Kwiatkowski et al., 2010).
Recently, a monomeric α-catenin-like protein (Ddα-cat; ~23% identical to α-Cat) has also been
identified in the amoebozoan slime mold Dictyostelium discoideum which lacks a classical
cadherin homologue. In vivo analysis of Ddα-cat has shown that it interacts with a β-cat-like
protein called Aardvark, localizes at adhesive cell-cell contacts and is required for the formation
of a polarized epithelium (Dickinson et al., 2011). The biochemical properties of α-catenin
proteins from different species are summarized in Table 4.
Multiple sequence alignment of α-catenin molecules from the species mentioned above shows
that invertebrate and vertebrate α-catenin molecules share several highly conserved regions
(Figure 13). In contrast, Ddα-cat shares little amino acid conservation with metazoan α-catenins
(~23% identity to α-Cat). Furthermore, amino acid residues that form salt-bridges to maintain
the autoinhibitory state of α-catenin to prevent α-catenin-vinculin binding (Ishiyama et al., 2013)
are also conserved between vertebrates and invertebrates but not between metazoans and the
amoebozoan Dictyostelium.
Overall, the data generated from studies investigating α-catenin function in metazoans and
amoebozoans raise two important questions that can be studied in an in vivo model system: 1)
Do the monomeric and dimeric conformations of α-catenin affect its binding properties? 2) Is
sequence conservation an important factor for α-catenin function?
The Tepass lab has generated stable α-Cat mutant Drosophila lines that can be used as a genetic
background to assess the activity of α-Cat related constructs. Furthermore, we have shown that
a UAS-α-Cat construct can fully rescue α-Cat1 mutant embryos, FE cells and BCM (Sarpal et al.,
2012; Desai et al., 2013). Since we have a system in place to study α-catenin function in vivo, I
assessed whether expression of α-catenin molecules from other species is able to replace
endogenous α-Cat in Drosophila embryos. The experimental constructs that I tested were: UAS-
αE-cat::3xHA (mouse), UAS-αN-cat::3xHA (mouse), UAS-Drα-cat::3xHA (Zebrafish), UAS-HMP-
1::3xHA (C. elegans), and UAS-Ddα-cat::3xHA (D. discoideum).
55
Table 4 - Biochemical properties of α-catenin
Organism
Identity to α-Cat (%)
Similarity to α-Cat (%)
Monomer/Dimer
Actin Binding (in vitro)
α-Cat Drosophila melanogaster
100 100 Monomer Yes
Dimer Yes
αN-cat Mus musculus 64 81 Monomer Yes
Dimer* ?
αE-cat Mus musculus 62 78 Monomer No
Dimer Yes
Drα-cat Danio rerio 61 79 Monomer Yes
HMP-1 Caenorhabditis elegans
41 61 Monomer No
Ddα-cat Dictyostelium discoideum
23 39 Monomer Yes
*Dimer at 37°C
56
Figure 13 – Multiple sequence alignment of α-catenin molecules from different species
Multiple sequence alignment of α-catenin molecules using a default Clustal alignment
algorithm in Jalview 2.8.1 shows a high degree of amino acid conservation between
invertebrate and vertebrate α-catenin proteins. Drosophila α-Cat domain regions are
highlighted with coloured horizontal bars above the sequence. Amino acid residues highlighted
with coloured boxes participate in the formation of salt-bridges between the M1-M3 and M2-
M3 interfaces to maintain an autoinhibitory state that prevents α-Cat-Vinculin binding. These
residues are identical or similar to α-Cat in every species except D. discoideum.
57
58
Figure 14 – Evolutionary tree alignment of α-catenin molecules from different species
Evolutionary tree alignment of α-catenin molecules using the BLOSUM62 Average distance
algorithm in Jalview 2.8.1 shows that α-catenin is well conserved between invertebrate and
vertebrate organisms.
59
4.2 Results
The Tepass lab previously generated a UAS-αE-cat::HA construct that contained the 5’ UTR,
coding region and 3’UTR of αE-cat. This construct failed to rescue zygotic α-Cat1 mutant embryos
and did not produce detectable levels of protein (Desai et al., 2013). To test whether the
inclusion of mammalian 5’ and 3’UTRs prevented protein expression I generated a αE-cat rescue
construct that contained only the coding region of αE-cat cDNA and applied the same strategy
for α-catenin genes utilized from other animals including mouse, zebrafish, C. elegans, slime mold
and Drosophila. These constructs were cloned into a somatic and female germline expression
vector pUASP carrying an attB recombination site using gateway cloning. Transgenic flies were
checked for the presence of the constructs phenotypically by checking for red pigmentation in
the eyes. Confirmation of genotypic attP2 insertion was performed independently by both
Bestgene Inc. and myself using PCR.
4.2.1 Cross-species rescue constructs are expressed in Drosophila embryos
Following genotypic confirmation of the cross-species rescue constructs in transgenic flies I
performed an immunoblotting experiment to ensure that transgenic α-catenin proteins were
expressed. We have previously shown that a UAS-α-Cat::HA construct expressed at the attp2 site
produces comparable levels of protein to endogenous α-Cat when driven by (Desai et al., 2013).
To perform the experiment, I crossed male recombinant flies (α-Cat1UAS-X::HA/TM3-GFP) to
ActDa-Gal4α-Cat1/TM3-GFP female virgins and immunoblotted embryonic lysates for the
presence of my construct using anti-HA, and anti-β-tubulin as a loading control. The results of
my analysis show that all cross-species rescue constructs are expressed in embryos and that α-
catenin proteins are expressed at similar levels (Figure 14).
60
Figure 15 - Western Blot of cross-species α-catenin rescue constructs.
Immunoblots of all cross-species α-catenin rescue constructs obtained from resolving 40µg of
total embryonic lysate by SDS-PAGE.
61
4.2.2 Metazoan α-catenin proteins rescue head defects in Drosophila embryos
The Tepass lab has previously shown that zygotic α-Cat1 mutants die as embryos (Sarpal et al.,
2012). Cuticle preparations and immunostaining experiments show that embryonic lethality
occurs due to a breakdown in cell-cell adhesion in the head region that leads to head involution
failure (Figure 8B; Sarpal et al., 2012). Furthermore, we have shown that α-Cat1 embryos can be
rescued to adulthood and late larval stages by constructs expressing UAS-α-Cat::HA and UAS-αN-
cat::HA respectively (Desai et al., 2013). Therefore, in order to determine the level of rescue
conferred by each of the constructs I repeated the embryonic rescue experiment performed by
Desai et al., (2013) using the cross-species α-catenin constructs that I generated.
To quantify and compare the embryonic rescue conferred by each of the α-catenin constructs I
crossed male transgenic recombinant flies (α-Cat1UAS-X::HA/TM3-GFP) to ActDa-Gal4α-
Cat1/TM3-GFP female virgins and collected non-GFP embryos to monitor for lethality during the
course of development. I used a scoring system previously described in Sarpal et al., (2012) to
classify the progeny of each genotype. A score of -3 to 2 was assigned to each dead embryo that
showed characteristic α-Cat1 defects. Embryos that were rescued but perished as first instar
larvae to late pupae were assigned scores of 3-7 and finally embryos that survived to adulthood
were given a score of 8 (See 2.3.2).
Based on this criterion, the rescue mediated by each construct showed varying degrees of rescue
and lethality during different stages of development. The majority of α-Cat::HA expressing
fertilized eggs were rescued from embryonic lethality and 85% survived to adulthood. In
contrast, 100% and 99% of α-Cat1 and Ddα-cat::HA fertilized eggs respectively died as embryos.
Fertilized eggs expressing mouse (αE-cat::HA, αN-cat::HA), zebrafish (Drα-cat::HA) and worm
(HMP-1) α-catenins all rescued the embryonic phenotype but had 0% survival to adulthood with
lethality observed from early larvae to late pupae.
Quantitative analysis of the results showed that all constructs conferred significant (P<0.0001)
but varying levels of rescue with mean rescues of 7.5 (α-Cat::HA), 4.4 (αN-cat::HA), 2.7 (αE-
cat::HA), 5.4 (Drα-cat::HA), 5.6 (HMP-1::HA) and 0.9 (Ddα-cat::HA) compared to α-Cat1 which had
a score of 0.1 (Figure 15). These results show that most α-Cat1 and Ddα-Cat::HA animals died as
62
embryos with strong and weak head defects. In contrast, vertebrate αN-cat::HA and αE-cat::HA
expressing embryos were rescued and died as second and first instar larvae respectively.
Interestingly, sequentially distant Drα-cat::HA and HMP-1::HA proteins strongly rescued
embryonic lethality with most progeny surviving to 3rd instar and early pupae respectively based
on the scoring criteria. Collectively, these results suggest that metazoan α-catenin proteins can
substitute for α-Cat during embryogenesis and in some cases can even facilitate adhesive
function during larval and pupal stages.
63
Figure 16 - Quantitative analysis of rescue conferred by various α-cat constructs from
different species.
Embryos were scored for the level of rescue conferred by α-Cat1 (n=128), α-Cat::HA (n=145),
αN-cat::HA (n=152), αE-cat::HA (n=136), Drα-cat::HA (n=110), HMP-1::HA (n=133), Ddα-cat::HA
(n=117). A score of 0 indicates observed embryonic lethality accompanied with strong head
defects and a score of 8 indicates rescue to adulthood. Bars represent mean rescue ± S.D. Solid
red stars represent a significant difference in level of rescue for each construct as compared to
α-Cat1 (P<0.0001). Hollow red stars represent a significant difference in level of rescue for each
construct as compared to α-Cat::HA (P<0.0001).
64
65
4.2.3. All cross-species rescue constructs except for Ddα-cat::HA localize at AJs
The Tepass lab has previously shown that when UAS-α-Cat::HA and UAS-αN-cat::HA constructs
are expressed in α-Cat1 embryos they localize to AJs in epithelial cells (Desai et al., 2013).
Therefore, in order to determine if the rescue constructs localized to AJs in embryonic epithelial
cells I crossed male transgenic recombinant flies (α-Cat1UAS-X::HA/TM3-GFP) to ActDa-Gal4α-
Cat1/TM3-GFP female virgins and immunostained embryos with anti-HA, anti-α-Cat, and anti-
Arm antibodies.
α-Cat1 embryos were used as a negative control to show that there were undetectable levels of
α-Cat and HA present in epithelial cells despite Arm being present at low levels at the cell cortex
(Figure 16 A-A’’’). In contrast, α-Cat::HA expressing embryos showed a strong localization of α-
Cat at AJs as evidenced by colocalization of HA and Arm (Figure 16 B-B’’’). The rescue construct
was also detected by the anti-α-Cat antibody as expected. Zebrafish (Drα-cat::HA), worm (HMP-
1::HA), and both mouse (αE-cat::HA & αN-cat::HA) α-catenins also localized at AJs in the absence
of α-Cat (Figure 16 C-F’’’). In contrast, the distribution of the slime mold α-catenin molecules was
cytoplasmic and no colocalization of Ddα-cat::HA and Arm was observed (Figure 16 G-G’’’).
Collectively, these results show that α-catenin proteins from all metazoan species but not the
amoebozoan Dictyostelium localize at AJs in Drosophila and therefore interact with Arm. This
observation is consistent with the high degree of sequence conservation observed in the β-cat
binding domain of α-catenin molecules in metazoans (Figure 13).
To further confirm the observation that metazoan but not Dictyostelium α-catenin proteins
localized to AJs in epithelial cells I crossed male transgenic recombinant flies (α-Cat1UAS-
X::HA/TM3-GFP) to En-Gal4 female virgins and immunostained embryos with anti-HA and Anti-
Arm antibodies. The expression of transgenic α-catenin proteins in an Engrailed expression
pattern allows for the visualization of the proteins in a wild-type background and ensures that
control cells which do not express the transgenes are present in the same embryo.
Immunostainings of wild-type embryos expressing α-Cat::HA in an En-Gal4 expression pattern
showed that the transgenic positive control rescue construct was expressed in the posterior
segment stripes and localized to AJs as expected (Figure 17 A-B’’). Similarly, metazoan α-catenin
66
proteins from mouse, zebrafish and worm also localized to AJs in an Engrailed expression pattern
as evidenced by colocalization of HA and Arm (Figure 17 C-F’’). In contrast to metazoan α-catenin
proteins, Ddα-cat::HA protein localization was cytoplasmic similar to the results obtained for the
whole embryo rescue experiment which further confirmed the observations from both
quantitative and protein localization experiments. Together, these results suggest that metazoan
α-catenin proteins can interact with Arm and localize to AJs in Drosophila epithelial cells but
Dictyostelium α-catenin is unable to do so which causes it to mislocalize to the cytoplasm.
67
Figure 17 - α-catenin molecules from all species except slime mold localize at the cell cortex of
embryonic epithelial cells.
(A-A’’’) α-Cat1 and α-Cat1 mutant embryos expressing (B-B’’’) α-Cat::HA, (C-C’’’) αN-cat::HA (D-
D’’’) αE-cat::HA (E-E’’’) Drα-cat::HA, (F-F’’’) HMP-1::HA, and (G-G’’’) Ddα-cat::HA
immunostained for HA, α-Cat and Arm.
In α-Cat1 embryos (A-A’’’) there are no detectable levels of HA present and α-Cat is missing at
the AJs as marked by Arm. The positive control α-Cat::HA embryos (B-B’’’) show that both the
HA tag and α-Cat are detected by antibodies specific to the molecules. αN-cat::HA, αE-cat::HA,
Drα-cat::HA and HMP-1::HA constructs (C-F’’’) all localize at AJs. In contrast, Ddα-cat::HA (G-
G’’’) localization is cytoplasmic in epithelial cells.
68
69
Figure 18 – En-Gal4 driven α-catenin molecules from all species except slime mold localize at
the cell cortex.
WT embryos expressing (A-B’’) α-Cat::HA, (C-C’’) αN-cat::HA (D-D’’) αE-cat::HA (E-E’’) Drα-
cat::HA, (F-F’’) HMP-1::HA, and (G-G’’) Ddα-cat::HA immunostained for HA and Arm.
In WT embryos the En-Gal4 driven α-Cat::HA (A-B’’) construct expresses in the posterior border
of each segment and colocalizes with Arm. Immunostainings of En-Gal4 driven αN-cat::HA, αE-
cat::HA, Drα-cat::HA and HMP-1::HA constructs (C-F’’) show that the constructs also localize at
AJs in an En-Gal4 expression pattern. In contrast, Ddα-cat::HA (G-G’’) localization is cytoplasmic
in En-Gal4 stripe cells.
70
71
4.3 Discussion
Previous in vitro studies carried out using αE-cat have argued that α-catenin may can exist as a
monomer or dimer depending on the model system. However, in vivo data generated in the
Tepass Lab are consistent with the notion that α-catenin functions at AJs exclusively as a
monomer (Drees et al., 2005; Yamada et al., 2005; Kwiatkowski et al., 2010; Yonemura et al.,
2010; Dickinson et al., 2011; Desai et al., 2013). Furthermore, multiple sequence alignment of α-
catenin from different species has shown that there is a high degree of amino acid residue
conservation across α-catenin (Figure 13). In order to determine if α-cat function is indeed
conserved across species and if amino acid sequence conservation plays a role in the function of
α-catenin across species I generated six α-catenin rescue constructs tagged with 3xHA on the C-
terminal end (UAS-α-Cat::HA, UAS-αN-cat::HA, UAS-αE-cat::HA, UAS-Drα-cat::HA, UAS-HMP-
1::HA, UAS-Drα-cat::HA) and expressed them in an α-Cat1 background to assess the level of
rescue conferred by each protein. Here, I discuss the results of the rescue analysis and how they
improve our understanding of α-catenin.
Vertebrate α-catenin proteins rescue the α-Cat1 embryonic phenotype to varying degrees
In 2005, the Nelson and Weis laboratories argued that αE-cat exists as both a monomer and
dimer. Firstly, they used actin pelleting assays to show that a quarternary complex containing
cadherin, β-cat, αE-cat, and actin could not be isolated (Yamada et al., 2005). Secondly, they also
showed that β-cat-αE-cat binding and αE-cat-actin binding was mutually exclusive and that αE-
cat monomers preferentially bound to the E-cad-β-cat complex whereas αE-cat dimers
preferentially bound actin filaments (Drees et al., 2005). The results of their studies led them to
conclude that αE-cat proteins existed in a dynamic equilibrium state where monomeric αE-cat
localized to AJs and promoted adhesion and dimeric αE-cat suppressed Arp2/3 complex activity
to prevent formation of protrusions (See 1.2.1.4c; Drees et al., 2005; Yamada et al., 2005). The
Tepass lab performed in vivo rescue experiments with αE-cat and αN-cat to test the allosteric
model proposed by Nelson and Weis. Embryonic rescue experiments showed that αN-cat but
not αE-cat rescued the head involution defect in α-Cat1 embryos. Interestingly, the embryonic
rescue conferred by αN-cat was abrogated when the protein was shifted to a dimer only
72
conformation through removal of the first 56 amino acids. These results were corroborated using
native α-Cat in Drosophila which showed that even though α-Cat can exist as both a monomer
and dimer in vitro only monomeric α-Cat rescued ~95% of α-Cat1 embryos to adulthood (Desai et
al., 2013).
Western blot analysis of embryonic lysates showed that both proteins were expressed in
embryos (Figure 14) and rescued the head involution phenotype (Figure 15). Despite the
embryonic rescue the majority of αE-cat embryos died as first instar larvae compared to αN-cat
embryos which died during later larval stages. Furthermore, Immunostaining experiments
showed that both αN-cat and αE-cat localized to AJs in conjunction with Armadillo (Figure 16 C-
D’’’ and Figure 17 C-D’’). Together, these results suggest that mammalin αN-cat and αE-cat both
interact with Drosophila Arm since they localize to AJs. These results also show that although
both αN-cat and αE-cat are highly similar to α-Cat (81% and 78% respectively) the amount of
whole animal rescue conferred by the two varies. One possibility for the difference in rescue is
that αN-cat exclusively forms monomers at 25°C which appear to be the functionally active form
of α-catenin proteins (Desai et al., 2013). Furthermore, quantitative analysis also showed that
although both mammalian α-catenin proteins rescued the head involution phenotype they do
not rescue α-Cat1 mutants as strongly as zebrafish or worm α-catenin proteins despite having
higher amino acid sequence identity and similarity. These results suggest that α-catenin
sequence conservation is less important for intercellular adhesion than the evolutionary
relationship between α-catenin proteins of different species.
Biochemical data concerning Drα-cat have shown that it exists as a monomer in solution that can
directly bind to actin filaments (Miller et al., 2013). Furthermore, in vivo experiments using Drα-
cat morpholinos have shown that Drα-cat is required for cell-cell adhesion and suppression of
membrane blebbing in deep cells during zebrafish embryonic development (Schepsis et al.,
2012). Thus, to investigate if Drα-cat can substitute for Drosophila α-Cat I expressed a UAS-Drα-
cat::HA construct in embryos to see if it could rescue the head involution defect.
Immunoblotting and quantitative rescue experiments showed that Drα-cat was expressed in
embryos (Figure 14) and that it rescued α-Cat1 embryos up to early pupal stages respectively
73
(Figure 15). Immunostaining experiments with two different drivers showed that Drα-cat
localized to AJs which suggests that it interacts with the DEcad-Arm complex to maintain
epithelial integrity during Drosophila development (Figure 16 E-E’’’ and Figure 17 E-E’’’).
Together, these results confirm the notion that monomeric α-catenin proteins regulate the
linkage between the CCC and actin cytoskeleton. Furthermore, the stronger rescue conferred by
Drα-cat compared to αE-cat and αN-cat suggests that sequence conservation may not be as
important between metazoans when it comes to the function of cross-species α-catenin
molecules in a model system.
Invertebrate HMP-1 rescues α-Cat1 mutants to early pupal stages
In vitro studies of HMP-1 have shown that it exists as a monomer in vitro but cannot bind to actin
filaments directly because it may be subject to head-tail autoinhibition (Kwiatkowski et al., 2011).
Additionally, In vivo analysis of HMP-1 suggests that it is required for embryonic development in
C. elegans since loss of HMP-1 protein abrogates embryogenesis (Kwiatkowski et al., 2011).
Furthermore, structure-function analysis of HMP-1 has shown that the N and C terminal domains
of HMP-1 are required for its function in vivo suggesting that HMP-1 binds to the CCC through its
N terminal domain and binds to actin filament through its C terminal domain like Drosophila α-
Cat (Kwiatkowski et al., 2011). Therefore, in order to investigate whether HMP-1 could substitute
for Drosophila α-Cat I performed rescue experiments with a UAS-HMP-1::HA construct containing
only the coding region of the protein.
Western blot analysis of embryonic lysates showed that HMP-1 was expressed (Figure 14) and
quantitative rescue experiments showed that not only did HMP-1 rescue the α-Cat1 head defect
but it also facilitated Drosophila development up to early pupal stages in many cases (Figure 15).
Furthermore, immunostaining experiments showed that HMP-1 protein strongly localized at AJs
in the epithelial cells of fly embryos (Figure 16 F-F’’’ and Figure 17 F-F’’). These results suggest
that HMP-1 can substitute for α-Cat to a large extent and that any perceived autoinhibition of
HMP-1 is relieved in flies which allows it to maintain epithelial integrity in embryos and up to the
later stages of development. Furthermore, the localization of the UAS-HMP-1::HA construct at
AJs shows that it interacts with Arm and confirms the notion that α-catenin functions at AJs as a
74
monomer to maintain the linkage between cadherin based cell-cell contacts and the underlying
actin cytoskeleton. The stronger rescue conferred by HMP-1 which is less similar (61% similar to
α-Cat) compared to αE-cat and αN-cat (78% and 81% similar to α-Cat) also shows that amino acid
sequence conservation may not be important for the function of cross-species α-catenin
molecules in a model system.
Ddα-cat::HA expressing embryos show weak rescue and its localization is cytoplasmic
Recently, an α-catenin homolog; Ddα-cat, was discovered in the amoebozoan Dictyostelium
discoideum, which does not possess classic cadherins that can interact with catenins. In vivo
experiments have shown that Ddα-cat is required to organize the tip epithelium which suggests
that α-catenin may predate the evolution of cadherins and these molecules may have initially
functioned in the establishment of a polarized epithelium (Dickinson et al., 2011). To determine
if the Dictyostelium α-catenin protein could facilitate intercellular adhesion in α-Cat1 embryos I
performed rescue experiments with flies carrying Ddα-cat constructs containing only the coding
region of the protein.
Multiple sequence alignment of Ddα-cat to metazoan α-catenin proteins showed relatively low
overall conservation (23% identical and 39% similar to α-Cat) in all domain regions including the
β-catenin binding site (Figure 13). The results of my experiments showed that while Ddα-cat was
expressed in fly embryos (Figure 14) it only partially rescued the head involution phenotype in α-
Cat1 mutants and was unable to rescue embryonic lethality (Figure 15). Immunostaining
experiments showed that Ddα-cat does not localize at AJs which suggests that it is unable to
interact with Arm which is responsible for recruiting α-catenin to AJs (Figure 16 G-G’’’ and Figure
17 G-G’’). The inability of this construct to localize to AJs in epithelial cells may be the primary
reason that it is unable to rescue embryonic lethality in α-Cat1 mutants. Collectively, these results
suggest that Dictyostelium α-catenin may be unable to interact with metazoan β-cat which leads
to its recruitment failure at AJs.
75
Chapter 5
General Discussion and Future Directions
During my tenure, I further characterized α-catenin function in Drosophila by knocking down
maternal α-Cat in early embryos and by analyzing embryonic rescue conferred by cross-species
α-catenin rescue constructs in α-Cat1 mutants.
The objective for investigating α-Cat function in early embryos was to assess the phenotype
conferred by abrogating maternal α-Cat contribution through targeting of the 5’-UTR and/or 3’-
UTR region of α-Cat mRNA. To accomplish this task I generated several UAS-α-Cat shRNA
constructs that could be expressed in early embryos using female germline drivers. The results
of my analysis showed that only one construct, α-CatRNAi1, which targeted the 5’-UTR was able
to successfully knockdown endogenous α-Cat as evidenced by lethality experiments (Table 3).
Phenotypic analysis of embryonic cuticles showed that the knockdown of maternal α-Cat by α-
CatRNAi1 produced an intermediate phenotype that was characterized by large anterior-ventral
and posterior-ventral holes (Figure 8C-D). Furthermore, combining the knockdown construct
with α-Cat1 gave rise to a phenotype where the majority of the cuticle was absent (Figure 8E).
Quantitative analysis of maternal α-Cat knockdown showed that mat-tub-Gal4 elicited a stronger
knockdown response than MTD-Gal4 (Figure 9) in embryos and that the expression of α-CatRNAi1
by itself or in combination with α-Cat1 produced a significantly worse phenotype than α-Cat1 on
its own (Figure 10). Immunostaining experiments confirmed the reduction in α-Cat levels at the
cell membrane in affected embryos (Figure 11 and Figure 12). Together, these results suggest
that maternal α-Cat plays an indispensable role in the development of the early embryo and that
reduction of maternal α-Cat contribution directly affects multiple morphogenetic processes that
require epithelial cells to maintain strong and dynamic intercellular adhesion.
76
To test which morphogenetic processes are affected by the abrogation of maternal α-Cat future
experiments could perform staged embryo collections to capture them at a specific stage of
development to see if a particular morphogenetic process is affected (See 1.3.3; Figure 3).
Another way to accomplish this task would be to perform live imaging on developing αCatRNAi1
embryos to observe how early these defects start to manifest. Indeed, Sergio Simoes; a post-
doctoral fellow in our laboratory has recently injected α-CatRNAi1 dsRNA into embryos and
observed that loss of α-Cat at AJs started to occur as early as the onset of gastrulation.
A unique feature of α-CatRNAi1 that can be exploited for future experiments is that it targets the
5’UTR region of α-Cat. The Tepass Lab has previously made structure-function α-Cat constructs
that lack the 5’UTR and can rescue α-Cat1 follicular epithelium cells, border cell migration and
whole animals (Desai et al., 2013). Thus, α-CatRNAi1 expressing embryos could be used as a
highly sensitive genetic background for assessing the rescue conferred by these structure-
function constructs to further improve our understanding of α-Cat function during development.
My second objective was to investigate whether cross-species α-catenin proteins could rescue α-
Cat1 zygotic mutant embryos. To perform this experiment I generated several UAS rescue
constructs from fly, mouse, zebrafish, worm and slime mold α-catenin proteins and expressed
them in flies using two different Gal4 drivers. Immunoblotting of lysates revealed that all
constructs were expressed in embryos at similar protein levels (Figure 14). Quantitative analysis
of rescue mediated by each construct showed that the expression of all metazoan constructs
rescued the α-Cat1 phenotype substantially but to varying degrees (Figure 15). These results are
consistent with the notion that α-catenin functions as a monomer at AJs as previously suggested
in Desai et al. (2013). Furthermore, these results suggest that the evolutionary relationship
between organisms appears to be more important for α-catenin function in Drosophila than
primary sequence conservation (Figure 15). Immunostaining experiments showed that all
metazoan α-catenin proteins localized to AJs in embryonic epithelial cells which implies that they
are all able to interact with Arm (Figures 16 and 17). Collectively, these results suggest that
metazoan α-catenin protein function in maintaining epithelial integrity at AJs is conserved and
that all these proteins can substitute for Drosophila α-Cat to a certain extent as evidenced by the
rescue experiments.
77
To further characterize how well these constructs function they should also be tested in FE cells
and during BCM to determine if they can facilitate adhesion in these tissues. My results showed
that the Dictyostelium α-catenin protein was unable to rescue the α-Cat1 phenotype and did not
localize to AJs in epithelial cells which suggests that it is unable to interact with Arm. Thus, to get
around this problem an experiment using a fusion construct of DE-cad::Ddα-cat::HA should be
conducted to determine if Ddα-cat can function as an adhesive molecule.
78
References
Abe, K., Chisaka, O., Van Roy, F., Takeichi, M. (2004). Stability of dendritic spines and synaptic
contacts is controlled by αN-catenin. Nat. Neurosci. 7, 357-363.
Agrawal, N., Dasaradhi, P. V., Mohmmed, A., Malhotra, P., Bhatnagar, R. K., Mukherjee, S. K.
(2003). RNA interference: biology, mechanism, and applications. Microbiol. Mol. Biol. Rev. 4,
657-85.
Banerjee, S., Sousa, A., Bhat, M. (2006). Organization and function of septate junctions: an
evolutionary perspective. Cell Biochem. Biophys. 46, 65-77.
Benjamin, J. M., Nelson, W. J. (2008). Bench to bedside and back again: molecular mechanisms
of alpha-catenin function and roles in tumorigenesis. Semin. Cancer Biol. 18, 53-64.
Benjamin, J., Kwiatkowski, A., Yang, C., Korobova, F., Pokutta, S., Switkina, T., Weis, W. I.,
Nelson, W. J. (2010). AlphaE-catenin regulates actin dynamics independently of cadherin-
mediated cell-cell adhesion. J. Cell Biol. 189, 339-52.
Campos-Ortega, J. A., Hartenstein, V. (1985). The embryonic development of Drosophila
melanogaster. Springer-Verlag: Berlin.
Cavey, M., Rauzi, M., Lenne, P., Lecuit, T. (2008). A two-tiered mechanism for stabilization and
immobilization of E-cadherin. Nature 453, 751-56.
Chen Y-T., Stewart, D. B., Nelson, W. J. (1999). Coupling assembly of the E-cadherin/β-catenin
complex to efficient endoplasmic reticulum exit and basal-lateral membrane targeting of E-
cadherin in polarized MDCK cells. J. Cell Biol. 144, 687-99.
Choi, H. J., Polutta, S., Cadwell, G. W., Bobkov, A. A., Bankston, L. A., Liddington, R. C., Weis W. I.
(2012). αE-catenin is an autoinhibited molecule that coactivates vinculin. PNAS 109, 8576-581.
Costa, M., Raich, W., Agbunag, C., Leung, B., Hardin, J., Priess, J. R. (1998). A putative catenin-
cadherin system mediates morphogenesis of the Caenohabditis elegans embryo. J. Cell Biol.
141, 297-308.
Davis, M. A., Ireton, R. C., Reynolds, A. B. (2003). A core function for p120-catenin in cadherin
turnover. J. Cell Biol. 163, 525-34.
Desai, R., Sarpal, R., Ishiyama, N., Pellikka, M., Ikura, M., Tepass, U. (2013). Monomeric α-
catenin links cadherin to the actin cytoskeleton. Nature Cell Biology 15, 261-75.
Drees, F., Pokutta, S., Yamada, S., Nelson, W. J., Weis, W. I. (2005). Α-catenin is a molecular
switch that binds E-cadherin-β-catenin and regulates actin-filament assembly. Cell 123, 903-
915.
79
Elbashir, S. M., Lendeckel, W., Tuschl, T. (2001a). RNA interference is mediated by 21- and 22-
nucleotide RNAs. Genes Dev. 15:188-200.
Elbashir, S. M., Martinez, J., Patkaniowska, A., Lendeckel, W., Tuschl, T. (2001b). Functional
anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate.
EMBO J. 20, 6877-888.
Groth, A. C., Fish, M., Nusse, R., Calos, M. P. (2003). Construction of transgenic Drosophila by
using the site-specific integrase from phage ϕC31. Genetics 166, 1775-82.
Gumbiner, B. M. (2005). Regulation of cadherin-mediated adhesion in morphogenesis. Nat.
Rev. Mol. Cell Biol. 6, 622-34.
Harris, T. J. C., Peifer, M. (2004). Adherens junction-dependent and –independent steps in the
establishment of epithelial cell polarity in Drosophila. J. Cell Biol. 167, 135-47.
Harris, T. J. C., Peifer, M. (2005). The positioning and segregation of apical cues during
epithelial polarity establishment in Drosophila. J. Cell Biol. 170, 812-23.
Harris, T. J. C., Sawyer, J. K., Peifer, M. (2009). How the cytoskeleton helps build the embryonic
body plan: models of morphogenesis from Drosophila. Curr. Top. Dev. Biol. 89, 55-85.
Harris, T. J. C., Tepass, U. (2010). Adherens junctions: from molecules to morphogenesis. Nat.
Rev. Mol. Cell Biol. 11, 502-14.
Harris, T. J. C. (2012). Adherens junction assembly and function in the Drosophila embryo. Int.
Rev. Cell Mol. Biol. 293, 45-83.
Hartenstein, H., (1993). Atlas of Drosophila Development. Cold Spring Harbor Laboratory
Press: New York.
Herrenknecht, K., Ozawa, M., Eckerskorn, C., Lottspeich, F., Lenter, M., Kemler, R. (1991). The
uvomorulin-anchorage protein alpha catenin is a vinculin homologue. PNAS 88, 9156-160.
Hinck, L., Nathke, I. S., Papkoff, J., Nelson, W. J. (1994). Dynamics of cadherin/catenin complex
formation: Novel protein interactions and pathways of complex assembly. J. Cell Biol. 125,
1327-40.
Hirano, S., Kimoto, N., Shimoyama, Y., Hirohashi, S., Takeichi, M. (1992). Identification of a
neural alpha-catenin as a key regulator of cadherin function and multicellular organization. Cell
70, 293-301.
Huber, O., Krohn, M., Kemler, R. (1997). A specific domain in alpha-catenin mediates binding to
beta-catenin or plakoglobin. J. Cell Sci. 110, 1759-65.
Imamura, Y., Itoh, M., Maeno, Y., Tsukita, S., Nagafuchi, A. (1999). Functional domains of alpha-
catenin required for the strong state of cadherin-based cell adhesion. J. Cell Biol. 144; 1311-22.
80
Ishiyama, N., Tanaka, N., Abe, K., Yang, Y. J., Abbas, Y. M., Umitsu, M., Nagar, B., Bueler, S. A.,
Rubinstein, J. L., Takeichi, M., Ikura, M. (2013). An autoinhibited structure of α-catenin and its
implications for vinculin recruitment to adherens junctions. J. Biol. Chem. 288, 15913-925.
Janssens, B., Goossens, S., Staes, K., Gilvert, B., van Hengel, J., Colpaert, C., Bruynell, E., Mareel
M., van Roy, F. (2001). alphaT-catenin: a novel tissue-specific beta-catenin-binding protein
mediating strong cell-cell adhesion. J. Cell Sci. 114, 3177-88.
Jenkins, A. B., McCaffery, J. M., Van Doren, M. (2003). Drosophila E-cadherin is essential for
proper germ cell-soma interaction during gonad morphogenesis. Development 130, 4417-426.
Kim, D. H., Rossi, J. J. (2009). RNAi mechanisms and applications. Biotechniques 613-16.
Knudsen, K. A., Soler, A. P., Johnson, K. R., Wheelock, M. J. (1995). Interaction of alpha-actinin
with the cadherin/catenin cell-cell adhesion complex via alpha-catenin. J. Cell Biol. 130, 67-77.
Kobielak, A., Fuchs, E. (2004). α-catenin: at the junction of intercellular adhesion and actin
dynamics. Nat Rev. Mol. Cell Biol. 5, 614-25.
Koslov, E., Maupin, P., Pradhan, D., Morrow, J., Rimm. D. (1997). Alpha-catenin can form
asymmetric homodimeric complexes and/or heterodimeric complexes with beta-catenin. J.
Biol. Chem. 272, 27301-306.
Kwiatkowski, A. V., Maiden, S. L., Pokutta, S., Choi, H., Benjamin, J. M., Lynch, A. M., Nelson, W.
J., Weis, W. I., Hardin, J. (2010). In vitro and in vivo reconstitution of the cadherin-catenin-actin
complex from Caenorhabditis elegans. PNAS 107, 14591-596.
Lambeth, L. S., Smith, C. A. Short hairpin RNA-mediated gene silencing. Methods. Mol. Biol.
942, 205-32.
Lecuit, T. (2004). Junctions and vesicular trafficking during Drosophila cellularization. J. Cell Sci.
117, 3427-433.
Lee, Y., Hur, I., Park, S. Y., Kim, Y. K., Suh, M. R., Kim, V. N. The role of PACT in the RNA silencing
pathway. EMBO J. 25, 522-32.
Liu, J., Carmell, M. A., Rivas, F. V., Marsden, C. G., Thomson, J. M., Song, J. J., Hammond, S. M.,
Joshua-Tor, L., Hannon, G. J. (2004). Argonaute2 is the catalytic engine of mammalian RNAi.
Science 305, 1437-41.
Magie, C. R., Pinto-Santini, D., Parkhurst, S. M. (2002). Rho1 interacts with p120ctn and α-
catenin, and regulates cadherin-based adherens junction in components in Drosophila.
Development 129, 3771-782.
Maiden, S. L., Hardin, J. (2011). The secret life of α-catenin: moonlighting in morphogenesis. J.
Cell Biol. 195, 543-52.
81
McGill, M. A., McKinley, R. F., Harris, T. J. C. (2009). Independent cadherin-catenin and Bazooka
clusters interact to assemble adherens junctions. J. Cell Biol. 185, 787-96.
Medina, E., Williams, J., Klipfell, E., Zarnescu, D., Thomas, G., Le Bivic, A. (2002). Crumbs
interacts with moesin and beta(Heavy)-spectrin in the apical membrane skeleton of Drosophila.
J. Cell Biol. 158, 941-51.
Meister, G., Landthaler, M., Patkaniowska, A., Dorsett, Y., Teng, G., Tuschl, T. (2004). Human
argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol. Cell 15, 185-97.
Miller, P. W., Pokutta, S., Ghosh, A., Almo, S. C., Weis, W. I., Nelson, W. J., Kwiatkowski, A. V.
(2013). Danio rerio αE-catenin is a monomeric F-actin binding protein with distinct properties
from Mus musculus αE-catenin. J. Biol. Chem. 288, 22324-332.
Myster, S., Cavallo, R., Anderson, C., Fox, D. T., Peifer, M. (2003). Drosophila p120catenin plays
a supporting role in cell adhesion but is not an essential adherens junction component. J. Cell
Biol. 160, 433-49.
Nagafuchi, A., Takeichi, M., Tsukita, S. (1991). The 102kd cadherin-associated protein:
similarity to vinculin and posttranscriptional regulation of expression. Cell 65, 849-57.
Nagafuchi, A., Ishihara, S., Tsukita, S. (1994). The roles of catenins in the cadherin-mediated cell
adhesion: functional analysis of E-cadherin-alpha catenin fusion molecules. J. Cell Biol. 127,
235-45.
Ni, J., Zhou, R., Czech, B., Liu, L., Holderbaum, L., Yang-Zhou, D., Shim, H., Tao, R., Handler, D.,
Karpowicz, P., Binari, R., Booker, M., Brennecke, J., Perkins, L. Z., Hannon, G. J., Perrimon, N.
(2011). A genome-scale shRNA rescource for transgenic RNAi in Drosophila. Nature Methods 8,
405-07.
Nieset, J. E., Redfield, A. R., Jin, F., Knudsen, K. A., Johnson, K. R., Wheelock, M. J. (1997).
Characterization of the interaction of alpha-catenin with alpha-actinin and beta-
catenin/plakoglobin. J. Cell Sci. 110, 1013-22.
Obama, H., Ozawa, M. (1997). Identification of the domain of alpha-catenin involves in its
association with beta-catenin and plakoglobin (gamma-catenin). J. Biol. Chem. 272, 11017-020.
Oda, H., Uemura, T., Shiomi, K., Nagafuchi, A., Tsukita, S., Takeichi, M. (1993). Identification of
a Drosophila homologue of alpha-catenin and its association with the armadillo protein. J. Cell
Biol. 121, 1133-40.
Okamura, K., Ishizuka, A., Siomi, H., Siomi, M. C. (2004). Disintict roles for argonaute proteins in
small RNA-directed RNA cleavage pathways. Genes Dev. 18, 1655-1666.
82
Orsulic, S, and Peifer, M. (1996). An in vivo structure-function study of armadillo, the β-catenin
homologue, reveals both separate and overlapping regions of the protein required for cell
adhesion and for wingless signaling. J. Cell Biol. 134, 1283-1300.
Ozawa, M., Baribault, H, Kemler, R. (1989). The cytoplasmic domain of the cell adhesion
molecule uvomorulin associates with three independent proteins structurally related in
different species. EMBO J 8, 1711-17.
Ozawa, M., Ringwald, M., Kemler, R. (1990). Uvomorulin-catenin complex formation is
regulated by a specific domain in the cytoplasmic region of the cell adhesion molecule. PNAS
87, 4246-250.
Ozawa, M., Kemler, R. (1992). Molecular organization of the uvomoroulin-catenin complex. J.
Cell Biol. 116, 989-96.
Ozawa, M. (Identification of the region of α-catenin that plays an essential role in cadherin-
mediated cell adhesion. J. Biol. Chem. 273, 29524-529.
Pacquelet, A., Lin, L., Rorth, P. (2003). Binding site for p120/delta-catenin is not required for
Drosophila E-cadherin function in vivo. J. Cell Biol. 160, 313-19.
Pacquelet, A., Rorth, P. (2005). Regulatory mechanisms required for DE-cadherin function in
cell migration and other types of adhesion. J. Cell Biol. 170, 803-12.
Pappas, D. J., Rimm, D. L. Direct interaction of the C-terminal domain of alpha-catenin and F-
actin is necessary for stabilized cell-cell adhesion. Cell Commun. Adhes. 13, 151-70.
Pellikka, M., Tanentzapf, G., Pinto, M., Smith, C., McGlade, C. J., Ready D. F., Tepass, U. (2002).
Crumbs, the Drosophila homologue of human CRB1/RP12, is essential for photoreceptor
morphogenesis. Nature 2002, 143-49.
Petrella, L., Smith-Leiker, T., Cooley, L. (2007). The Ovhts polyproteins is cleaved to produce
fusome and ring canal proteins required for Drosophila oogenesis. Development 134, 703-12.
Pilot, F., Philippe, J. M., Lemmer, C., Lecuit, T. (2006). Spatial control of actin organization at
adherens junctions by a snaptotagmin-like protein Btsz. Nature 442, 580-84.
Pokutta, S., Weis, W. I. (2000). Structure of the dimerization and beta-catenin-binding region of
alpha-catenin. Mol. Cell 5, 533-43.
Pokutta, S., Drees, F., Takai, Y., Nelson, W. J., Weis W. I. (2002). Biochemical and structural
definition of the l-afadin- and actin-binding sites of alpha-catenin. J. Biol. Chem. 277, 18868-
874.
Pokutta, S., Choi, H., Ahlsen, G., Hansen, S. D., Weis W. I. (2014). Structural and thermodynamic
characterization of Cadherin·β-catenin·α-catenin complex formation. J. Biol. Chem. 289, 13589-
601.
83
Rangarajan, E. S., Izard, T. (2012). The cytoskeletal protein alpha-catenin unfurls upon binding
to vinculin. J. Biol. Chem. 287, 18492-499.
Rangarajan, E. S., Izard, T. (2013). Dimer asymmetry defines alpha-catenin interactions. Nat.
Struct. Mol. Biol. 20, 188-93.
Rimm, D., Koslov, E., Kebriaei, P., Cianci, C., Morrow, J. (1995). Alpha 1(E)-catenin is an actin-
binding and –bundling protein mediating the attachment of F-actin to the membrane adhesion
complex. PNAS 92, 8813-17.
Sarpal, R., Pellikka, M., Patel, R. R., Hui, F. Y. W., Godt, D., Tepass, U. (2011). Mutational
analysis supports a core role for Drosophila α-Catenin in adherens junction formation. Journal
of Cell Science 125, 233-45.
Schepsis, A., Sepich, D., Nelson, W. J. (2012). αE-catenin regulates cell-cell adhesion and
membrane blebbling during zebrafish epiboly. Development 139, 537-46.
Schlegelmilch, K., Mohseni, M., Kirak, O., Pruszak, J., Rodrigues, J. R., Zhou, D., Kreger, B. T.,
Vasioukhin, V., Avruch, J., Brummelkamp, T. R., Camargo, F. D. (2011). Yap1 acts downstream
of α-catenin to control epidermal proliferation. Cell 144, 782-95.
Shin, K., Fogg, V., Margolis, B. (2006). Tight junctions and cell polarity. Annu. Rev. Cell Dev. Biol.
22, 207-35.
Staller, M. V., Yan, D., Sakara, R., Bragdon, M. D., Wunderlich, Z. B., Tao, R., Perkins, L. A.,
Depace, A. H., Perrimon, N. (2013). Depleting gene activities in early Drosophila embryos with
the “maternal-Gal4-shRNA” system. Genetics 193, 51-61.
Stepniak, E., Radice, G. L., Vaisoukhin, V. (2009). Adhesive and signaling functions of cadherins
and catenins in vertebrate development. Cold Spring Harb. Prerspect. Biol. 1, a002949.
Taguchi, J., Ishiuchi, T., Takeichi, M. (2011). Mechanosensitive EPLIN-dependent remodeling of
adherens junctions regulates epithelial reshapring. J. Cell Biol. 194, 643-656.
Takai, Y., Nakanishi, H. (2003). Nectin and afadin: novel organizers of intercellular junctions.
Journal of Cell Science 116, 17-27.
Takai, Y., Ikeda, W., Ogita, H., Rikitake, Y. (2008). The immunoglobulin-like cell adhesion
molecule nectin and its associated protein afadin. Annu. Rev. Cell Dev. Biol. 24, 309-42.
Tang, G. (2005). siRNA and miRNA: an insight into RISCs. Trends Biochem. Sci. 30, 106-14.
Tepass, U., Hartenstein V. (1994). The development of cellular junctions in the Drosophila
embryo. Dev. Biol. 161, 563-96.
Tepass, U. (1996). Crumbs, a component of the apical membrane, is required for zonula
adherens formation in the primary epithelia of Drosophila. Dev. Biol. 177, 217-25.
84
Tepass, U., Gruszynski-DeFeo, E., Haag, T. A., Omatyar, L., Torok, T., Hartenstein, V. (1996).
Shotgun encodes Drosophila E-cadherin and is preferentially required during cell
rearrangement in the neuroectoderm and other morphogenetically active epithelia. Genes
Dev. 10, 672-85.
Tepass, U., Tanentzapf, G., Ward, R., Fehon, R. (2001). Epithelial cell polarity and cell junctions
in Drosophila. Annu. Rev. Genet. 35, 747-84.
Tepass, U. (2012). The apical polarity protein network in Drosophila epithelial cells: regulation
of polarity, junctions, morphogenesis, cell growth and survival. Annu. Rev. Cell Dev. Biol. 28,
655-85.
Thorpe, H. M., Smith, M. C. M. (1998). In vitro site-specific integration of bacteriophage DNA
catalyzed by a recombinase of the resolvase/invertase family. PNAS 95, 5505-10.
Uemura, T., Oda, H., Kraut, R., Hayashi, S., Kotaoka, Y., Takeichi, M. (1996). Zygotic Drosophila
E-cadherin expression is required for processes of dynamic epithelial cell rearrangement in the
Drosophila embryo. Genes Dev. 10, 659-71.
Vasioukhin, V., Bauer, C., Degenstein, L., Wise, B., Fuchs, E. (2001). Hyperproliferation and
defects in epithelial polarity upon conditional ablation of α-catenin in skin. Cell 104, 605-617.
Vert, J. P., Foveau, N., Lajaunie, C., Vandenbrouck, Y. (2006). An accurate and interpretable
model for siRNA efficacy prediction. BMC Bioinformatics 7, 520-36.
Watabe, M., Nagafuchi, A., Tsukita, S., Takeichi, M. (1994). Induction of polarized cell-cell
association and retardation of growth by activation of the E-cadherin-catenin adhesion system
in a dispersed carcinoma line. J. Cell Biol. 127k 247-256.
Watabe-Uchida, M., Uchida, N., Imamura, Y., Nagafuchi, A., Fujimoto, K., Uemura, T.,
Vermeulen, S., van Roy, F., Adamson, E. D., Takeichi, M. (1998). alpha-Catenin-vinculin
interaction functions to organize the apical junctional complex in epithelial cells. J. Cell Biol.
142, 847-57.
Wei, S. Y., Escudero, L. M., Yu, F., Chang, L. H., Chen, L. Y., Ho, Y. H., Lin, C. M., Chou, C. S., Chia,
W., Modolell, J., Hsu, J. C. (2005). Echinoid is a component of adherens junctions that
cooperates with DE-Cadherin to mediate cell adhesion. Dev. Cell 4, 493-504.
Weis, W. I., Nelson, W. J. (2006). Re-solving the cadherin-catenin-actinin conundrum. J. Biol.
Chem. 281, 35593-597.
Weiss, E. E., Kroemker, M., Rudiger, A. H., Jockusch, B. M., Rudiger, M. (1998). Vinculin is part
of the cadherin-catenin junctional complex: complex formation between alpha-catenin and
vinculin. J. Cell Biol. 141, 755-64.
85
Yamada, S., Pokutta, S., Drees, F., Weis, W. I., Nelson, W. J. (2005). Deconstructing the
cadherin-caternin-actin complex. Cell 5, 889-901.
Yang, J., Dokurno, P., Tonks, N. K., Barford, D. (2001). Crystal structure of the M-fragment of
alpha-catenin: implications for modulation of cell adhesion. EMBO J. 20, 3645-56.
Yonemura, S., Wada, Y., Watanabe, T., Nagafuchi, A., Shibata M. (2010). α-catenin as a tension
transducer that induces adherens junction development. Nat. Cell Biol. 12, 533-42.
Zhang, H., Kolb, F. A., Jaskiewicz, L., Westhof, E., Filipowicz, W. Single processing center models
for human dicer and bacterial RNase III. Cell 118, 57-68.
