75
Aus dem Universitätsklinikum Münster Medizinische Klinik und Poliklinik A Direktor: Univ.-Prof. Dr. Wolfgang E. Berdel Tumor growth inhibition by RGD peptide directed delivery of truncated tissue factor to the tumor vasculature INAUGURAL – DISSERTATION Zur Erlangung des doctor medicinae der Medizinischen Fakultät der Westfälischen Wilhelms Universität Münster Vorgelegt von Federico Ludwig Herrera Alemán aus Tegucigalpa / Honduras 2004

Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

Embed Size (px)

Citation preview

Page 1: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

Aus dem Universitätsklinikum Münster

Medizinische Klinik und Poliklinik A

Direktor: Univ.-Prof. Dr. Wolfgang E. Berdel

Tumor growth inhibition by RGD peptide directed delivery of

truncated tissue factor to the tumor vasculature

INAUGURAL – DISSERTATION

Zur

Erlangung des doctor medicinae

der Medizinischen Fakultät

der Westfälischen Wilhelms Universität Münster

Vorgelegt von

Federico Ludwig Herrera Alemán

aus Tegucigalpa / Honduras

2004

Page 2: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

2

2

Gedruckt mit Genehmigung der Medizinischen Fakultät der Westfälischen

Wilhelms-Universität Münster

Page 3: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

3

3

Dekan: Univ.-Prof. Dr. H. Jürgens Berichterstatter: Prof. Dr. R. M. Mesters. Berichterstatter: Priv.- Doz. Dr. J. Vormoor Tag der mündlichen Prüfung 29.11.04

Page 4: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

4

4

Aus dem Universitätsklinikum Münster

Medizinische Klinik und Poliklinik A Direktor: Univ.-Prof. Dr.Wolfgang E Berdel

Referent: Prof. Dr. R. M. Mesters Korreferent: Priv. Doz. Dr. J. Vormoor

ZUSAMMENFASSUNG

Antivaskuläre Therapie von malignen Tumoren mittels

Fusionspolypeptiden bestehend aus Gewebefaktor und RGD Peptiden

Federico Herrera Alemán

Die selektive Aktivierung der Blutgerinnung in Tumorblutgefäßen ist ein

vielversprechender antivaskulärer Therapieansatz zur Behandlung bösartiger Tumoren.

Aus der Thrombusbildung resultiert eine konsekutive Tumornekrose. Für eine solche

Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated

tissue factor, kurz tTF, welcher die Blutgerinnung aktiviert) und Oligopeptiden

bestehen, die die selektive Bindung an Rezeptoren der Tumor-Endothelzelle vermitteln.

Das tTF-Fusionspolypeptid tTF-GRGDSP (kurz: tTF-RGD) wurde stabil exprimiert,

gereinigt, biochemisch umfassend charakterisiert und anschließend an Transplantaten

menschlicher Tumoren (humanes Lungenkarzinom, malignes Melanon) im Mausmodell

evaluiert. Die Tumoren der mit tTF-RGD Fusionsprotein behandelten Mäuse wurden im

Vergleich zu tTF oder NaCl in ihrem Wachstum signifikant gehemmt.

Histologische untersuchungen belegen den Wirkungsmechanismus der Induktion einer

selektiven Tumorgefäßthrombose mit konsekutiver Tumornekrose.

Eine relevante Organtoxizität wurde auch bei Dosen der tTF-Fusionsproteine, die das

mehrfach der therapeutisch effektiven Dosis überschrieten, weder makroskopisch noch

mikroskopisch beobachtet.

Genehmigung durch die Bezirksregierung Münster am 2000

Aktenzeichen.: 50083510; G67 / 2000

Tag der mündlichen Prüfung 29.11.04

Page 5: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

5

5

Contents :

Page

Introduction

8

Angiogenesis

• Definition of angiogenesis

• The coagulation system and angiogenesis

10

10

Angiogenesis in cancer

• Role of angiogenesis in cancer

• Regulators of tumor angiogenesis

• Metastasis

• Mediators of tumor angiogenesis

11

13

14

15

Anti-angiogenesis

• The process of anti-angiogenesis

• Anti-angiogenic treatment strategies

• Angiogenesis inhibitors

• Anti-angiogenic factors and pro-angiogenic factors

• Gene treatment approaches

17

17

19

20

22

Page 6: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

6

6

Vascular targets

• Targeting the tumor vasculature

• The αVβ3 and αVβ5 integrins as natural endothelial markers

• Recombinant fusion proteins

23

26

27

Objectives

• General objectives

30

Material and Methods

• Cell lines and antibodies

• Construction of the E coli expression vector for soluble TF

• Expression, refolding and purification of tTF and tTF -

RGD fusion proteins.

• Characterization of tTF and tTF -RGD peptide

• SDS-PAGE and western blot analyses

• Binding of tTF-RGD fusion proteins to FVIIa

• Factor X activation by tTF and tTF-RGD fusion proteins

• Binding of tTF-RGD fusion protein to its targets

• Tumor xenotransplantation models

• Histological studies

31

31

32

33

33

34

35

36

37

39

Page 7: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

7

7

Statistical Analysis

40

Results

• Functional characterisation of tTF and tTF-RGD fusion

proteins

• Factor X activation by tTF and tTF-RGD

• Binding of tTF-RGD to purified αvβ3

• Binding of tTF-RGD on endothelial cells

• Antitumor activity of tTF-RGD in murine tumor models

• Histological analyses

41

42

43

44

45

48

Discussion

52

Literature

56

Abbreviations

73

Acknowledgements

74

Curriculum Vitae 75

Page 8: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

8

8

Introduction

Angiogenesis, i.e., the proliferation of new blood vessels from preexisting

ones, is a characteristic feature of aggressive solid tumors (Folkman et al,

1989). Molecules capable of inhibiting angiogenesis or of selectively

targeting and destroying new blood vessels, would be promising agents for

the treatment of angiogenesis-related diseases.

Tissue factor (TF) is a cell-surface glycoprotein and a major initiator of

blood coagulation. At sites of injury, blood comes in contact with the

membrane-bound TF, which forms a complex with the serine protease

FVIIa present in blood.

The resulting complex activates factors IX and X, which leads to thrombin

activation and ultimately to blood clotting. Truncated tissue factor (tTF)

consisting of only the extra cellular soluble domain (residues 1–219),

exhibits an ability to activate the clotting cascade in solution that is five

orders of magnitude lower than full length tissue factor incorporated in a

phospholipid membrane. When tTF is relocated to a phospholipid

membrane, tTF regains full activity like native tissue factor.

New approaches are targeting not the tumor cells but the endothelial cells

on tumors. Vascular targeting requires the identification of target molecules

that are present at sufficient density on the surface of vascular endothelium

in solid tumors but absent from endothelial cells in normal tissues. Such

molecules could be used to target cytotoxic agents to the vascular

endothelium of the tumor rather than to the tumor cells themselves.

Promising candidate molecules include bFGF (basic fibroblast growth

factor), VEGF (vascular endothelial growth factor) and VEGF receptor 2

Page 9: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

9

9

(VEGFR-2), endoglin, endosialin, a fibronectin isoform (ED-B domain),

the integrins αVβ3, αVβ5, α1β1, α2β1, amino peptidase N, NG2 proteoglycan

and the matrix metalloproteinases 2 and 9 (MMP 2 and 9) (Dvorak et al,

1991 and 1995; Burrows et al, 1995; Carmemolla et al, 1989; Arap et al,

1998; Bhagwat et al, 2001; Burg et al, 1999; Kessler et al 2002; Morrissey

et al, 1993; Olson et al, 1997; Rettig et al, 1992; Sengeer et al, 1997;

Pfeifer et al, 2000).

A novel approach to cancer therapy based on targeting of the human

coagulation-inducing protein tTF to tumor vasculature has recently been

proposed ( Huang et al, 1997; Ran et al, 1998; Nilsson et al, 2001; Liu et al,

2002; Peisheng et al, 2003). The approach is based on the concept that

thrombosis of tumor vessels may stop the supply of nutrients and oxygen to

tumor cells, thereby causing their death.

The targeted delivery of tTF would be of significant therapeutic relevance if

it is directed against a naturally occurring marker of tumor angiogenesis,

and if it mediates the selective thrombosis of tumor blood vessels

sufficiently to inhibit the tumor growth or to generate tumor infarction.

In this work we show that a protein consisting of the RGD peptide fused to

tTF mediates the selective tumor growth inhibition of two different types of

solid human tumors; the lung cancer (CCL185) and the malignant

melanoma (M21) in murine tumor models.

Page 10: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

10

10

Angiogenesis

Angiogenesis is defined as a process of vascular neoformation out of

existing ones, that occurs during development, menstruation and several

pathological conditions such as rheumatoid arthritis, age-related macular

degeneration, proliferative retinopathies, and psoriasis as well as tumor

growth and metastasis. Compensatory angiogenesis is demonstrated in the

formation of collateral blood vessels when there is oxygen or nutrient

deprivation in normal tissues. Despite the fact that angiogenesis refers to

the derivation of blood vessels of all types (micro and macro vessels), the

term is usually restricted to the neoformation of capillary blood vessels.

Angiogenesis requires the coordinated activation of genes that are

responsible for proliferation, migration and differentiation of endothelial

cells to form capillary-like structures. The activation of these genes is

thought to occur through paracrine factors also, the genes activated by

these factors encode autocrine/intracrine secondary regulators, proteolytic

enzymes, and molecules that are direct downstream substrates of

endothelial cytokine receptors (Bikfalvi, 1995).

The coagulation system and angiogenesis

Angiogenesis is the process of sprouting and configuring new blood vessels

from pre-existing blood vessels, whereas the haemostatic system maintains

the liquid flow of blood by regulating platelet adherence and fibrin

deposition. Both systems normally appear quiescent. With vessel injury, a

rapid sequence of reactions must occur to occlude the vessel wall defect

and prevent hemorrhage. Activated platelets link the margins of the defect

Page 11: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

11

11

and form a provisional barrier that is quickly enmeshed with polymerized

fibrin. This clot structure initially requires immobilized vascular

endothelial cells to anchor the clot and prevent further bleeding. Thereafter,

endothelial cells at the clot margins become mobile, dismantling and

invading the cross-linked fibrin structure to rebuild a new vessel wall.

Although the positive and negative regulators that control the delicate

balance of platelet reactivity and fibrin deposition have been elucidated

over the past four decades, analogous proteins that control endothelial cell

growth and inhibition have only been discovered within the past decade.

Hemostasis and angiogenesis are becoming increasingly inter-related

pathways generated by the haemostatic system, coordinating the spatial

localization and temporal sequence of clot / endothelial cell stabilization

followed by endothelial cell growth and repair of a damaged blood vessel.

To date, a limited number of these proteins have been identified (Browder

et al, 2000).

Role of angiogenesis in cancer

Angiogenesis performs a critical role in the development of cancer, solid

tumors smaller than 1 to 2 cubic millimeters are nor vascularized to spread,

they need to be supplied by blood vessels that bring oxygen and nutrients

and remove metabolic wastes.

New blood vessel development is an important process in tumor

progression. It favors the transition from hyperplasia to neoplasia i.e. the

passage from a state of cellular multiplication to a state of uncontrolled

proliferation characteristic of tumor cells.

Page 12: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

12

12

100 years ago researchers observed that angiogenesis occurs around tumors

(Kerbel et al, 2000; Algire et al, 1945).

In 1971 it was proposed that tumor growth beyond 1 to 2 mm in size and

metastasis are angiogenesis dependent and hence blocking angiogenesis

could be a strategy to arrest tumor growth (Folkman, 1971and 1990), thus

tumor cells that undergo the phenotypic switch are able to induce changes

in endothelial cells, leading to angiogenesis and to a growing tumor

(Polverini, 1996).

Tumor cells and infiltrating cells such as macrophages and fibroblasts

activate the endothelial cells, thus initiating angiogenesis by expressing

factors such as VEGF and bFGF. Once neovascularization occurs, the

tumor experience rapid growth and an increased metastatic potential (Poon

et al, 2001; Mattern et al, 1996; Toi et al, 1994).

Angiogenesis involves a series of steps, including endothelial cell

proliferation, differentiation, migration, and organization to form tubules

(Dvorak et al, 1995), because of this stepwise process anti-angiogenic

therapy can be developed against any of several steps in the process and

can be used to stop or to inhibit pathologies that involves such processes

(Lee, 2002).

Recent data strongly suggest an important role of angiogenesis in

hematological malignancies. Thus anti-angiogenic therapy could constitute

a novel strategy not only for the treatment of solid tumors or inflammatory

disorders but also malignancies like acute myeloid leukemia (Padró et al,

2000; Mesters et al, 2001).

Page 13: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

13

13

Regulators of tumor angiogenesis

At the site of vessel injury, adhered platelets secrete both positive and

negative regulators of angiogenesis, mainly from internal α granules.

The positive regulators include: vascular endothelial growth factor-A

(VEGF-A), vascular endothelial growth factor-C (VEGF-C), basic

fibroblast growth factor (bFGF), hepatocyte growth factor (HGF),

angiopoietin-1, insulin-like growth factor-1 and –2 (IGF-1-2), epidermal

growth factor (EGF), platelet-derived growth factor (PDGF) and

sphingosine 1 phosphate (Mohle et al, 1997; Wartiovaara et al, 1998;

Brunner et al, 1993; Nakamura et al, 1986; Karey et al, 1989; Ben-Ezra et

al, 1990; Hwang et al, 1992; Bar et al, 1989; Lee et al, 1999).

Numerous investigators have evaluated the presence of angiogenic peptide,

in particular bFGF and VEGF in clinical body fluids in an effort to explore

the usefulness of these measurements as potential clinical parameters. Most

of these studies are exploratory and suggest a correlation between

detectable levels of these peptides and clinical outcome.

There was a relatively good correlation between serum but not urinary

bFGF levels and tumor stage or grade in a small number of patients with

renal cell carcinoma (Rippmann et al, 2000). More recently, a significant

over expression of VEGF and its cellular receptor KDR (VEGFR-2) and

bFGF in the bone marrow of patients with acute myeloid leukemia was

found (Padró et al, 2002; Bieker et al, 2003).

An increased presence of matrix metalloproteinases (MMPs) may be

related to increased invasive, metastasis, and angiogenic potential of

tumors.

Page 14: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

14

14

The hepatocyte growth factor (HGF) secretes also negative regulators that

suppress the inducement of angiogenesis. The anti-angiogenic HGF

fragments consisting of either the NK1 or NK2 cringle domains suppresses

HGF induced endothelial cell migration. This anti-angiogenic fragments

inhibit tumor growth in vivo by increasing tumor cell apoptosis without

affecting the proliferation rate of tumor cells (Date et al, 1998).

Thrombospondin (TSP-1) re-adjusts growth factor and integrin signaling

pathways between endothelial cells and the fibrin clot and prevent

endothelial cell motility induced by fibrin, also blocks the chemotactic

response of endothelial cells to bFGF (Good et al, 1990).

Plasminogen activator inhibitor type 1 (PAI-1), alpha 2 antiplasmin and

alpha 2-macroglobulin suppress angiogenesis by limiting plasmin

generation within the clot structure (Blei et al, 1993).

Metastasis

New blood vessel development is an important process in tumor

progression. Neovascularization also influences the dissemination of cancer

cells throughout the entire body eventually leading to metastasis formation.

It has been suggested in the past that the growth of primary solid tumors is

strictly dependent on their ability to induce angiogenesis from the

surrounding vasculature, so that tumor progression including invasion and

metastasis, involves the different phases pre-vascular and vascular

(Gimbrone et al, 1972).

It has been also observed that removal of primary tumor can be followed by

a rapid onset of metastasis. This would suggest that a primary tumor can

Page 15: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

15

15

inhibit its metastasis growth, then the switch to an angiogenic phenotype

depends upon the net balance of angiogenic stimulators and inhibitors.

The development of metastasis is then greatly influenced by angiogenesis

(Bikfalvi, 1995). Also since primary tumor growth is often controlled with

surgery and/or irradiation, anti-angiogenic agents may be most beneficial in

the treatment of widespread metastasis disease. However, several principles

must be understood; anti-angiogenic therapy may need to be delivered on a

chronic basis since this type of therapy is not cytotoxic but rather only

prevents further growth of a tumor.

Secondly, the endpoint of anti-angiogenic therapy would not be tumor

shrinkage, but rather tumor stabilization (Ellis et al, 1996), recognizing that

angiogenesis is one step in the multistep process of metastasis (Fidler et al,

1994).

Some researchers selectively targeted tumor blood vessels in vivo, using

artificial or naturally occurring markers of angiogenesis with results of

therapeutic relevance (Huang et al, 1997; Ran et al, 1998; Nilsson et al,

2001; Liu et al, 2002; Peisheng et al, 2003).

Also it has been assumed that anti-angiogenic therapy of any type might

have to be delivered for the rest of a patient’s life, or at least for many years

(Boehm et al, 1997).

Mediators of tumor angiogenesis

A large number of angiogenic factors produced by tumor cells themselves

and by accessory host cells such as macrophages, mast cells and

lymphocytes have been identified.

Page 16: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

16

16

Recent attention has been focused on members of the fibroblast growth

factors (FGF) and vascular endothelial growth factors (VEGF) families as

the most common tumor angiogenic factors (Fernig, 1994; Dvorak et al,

1995; Claffey et al, 1996), (See table 1).

These cytokines stimulate migration and proliferation of endothelial cells

(ECs). The biological effect of VEGF is mediated by the binding to two

different receptors, VEGFR-1 (flt-1) and VEGFR-2 (flk-1/KDR), that are

mainly expressed on ECs (Terman et al, 1996).

Recently, neuropilin 1 has been identified as a third VEGF receptor that

exclusively binds to the VEGF165 splice variant and modulates binding of

VEGF to VEGFR-1 and VEGFR-2 (Soker et al, 1990). VEGF and its

receptors are over expressed in the vast majority of human tumors.

The importance of VEGF is underscored by the fact that blocking of VEGF

function results in suppression of angiogenesis and growth of a variety of

tumors in vivo (Kim et al, 1993; Millauer et al, 1994; Warren et al, 1995;

Cheng et al, 1996; Millauer et al, 1996; Skobe et al, 1997).

Integrins have been identified as additional key molecules of tumor

angiogenesis. These integrins play a pivotal role in mediating cell to cell

and cell to matrix interactions, essential components for tumor

angiogenesis and metastasis (Brooks et al, 1994a and 1994b; Yun et al,

1996; Senger et al, 1997; Ruegg et al, 1998).

Certain integrins (e.g. αVβ3, αVβ5 and others) are specifically and

selectively expressed on the tumor vasculature in high density, but outside

Page 17: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

17

17

of the female reproductive tract these integrins are not expressed under

physiological conditions on ECs.

The process of anti-angiogenesis

Based on observations that expansion of a tumor mass was limited in the

absence of angiogenesis, considerable experimental supporting evidence

for this concept has been assembled from inhibition of angiogenesis by:

• Mechanical separation of tumor cells from their nearest vascular bed

(Gimbrone et al, 1972)

• Blockade of tumor-derived angiogenic factors (Kim et al, 1993)

• Administration of angiogenesis inhibitors (Boehm et al, 1997)

• Endogenous production of angiogenesis inhibitors from tumor cells

(Bouck, 1990; Cao et al, 1998).

• Demonstration of the pre angiogenic phenotype in spontaneous

tumors (Hanahan et al, 1996).

Anti-angiogenic treatment strategies

The principal target for anti-angiogenic therapy is represented by

proliferating ECs, which with the exception of the female reproductive tract

are in a quiescent state in normal tissues.

Page 18: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

18

18

Only one of 10.000 ECs (0,01%) is in cell division at a certain point

(Engerman et al, 1967; Hobson et al, 1984).

As a response to a certain stimulus ECs leave the quiescent state and

proliferate as fast as haematopoietic cells from the bone marrow or

epithelial cells from the mucosa of the gastrointestinal tract.

Based on the current knowledge of angiogenesis, which is a complex

process of EC proliferation, selective degradation of the basement

membrane, extracellular matrix and subsequent EC migration (Folkman et

al, 1992).The following anti-angiogenic strategies are currently under

investigation:

• Interfering with receptor binding or activation of a particular

angiogenic factor.

• Inhibiting the release of a particular angiogenic factor by tumor cells.

• Enhancing the production or action of an angiogenic inhibitor.

• Being similar or identical to a particular angiogenic inhibitor.

• Interfering with signal transduction processes in an autocrine /

intracrine activation of capillary endothelial cells.

• Inhibiting the matrix degradation by protease matrix degrading

enzymes (Bikfalvi, 1995; Sato et al, 1990).

Page 19: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

19

19

Angiogenesis inhibitors

Numerous angiogenic inhibitors have been identified (Hagedorn et al,

2000) and many are now in clinical trials. Whereas some agents, such as

antibodies to VEGF and VEGFR2, continue to show promise, a few drugs

have proved disappointing (Coussens et al, 2002).

Nevertheless, there is still intense interest in angiogenesis inhibitors as

future clinical tools and much work is in progress (Novak, 2002).

There are two classes of angiogenesis inhibitors “direct and indirect”:

• Direct angiogenesis inhibitors, such as vitaxin, angiostatin and

others, prevent vascular endothelial cells from proliferating,

migrating or avoiding cell death in response to a spectrum of pro-

angiogenic proteins, including VEGF, bFGF, IL-8 and platelet-

derived growth factor (PDGF).

• Indirect angiogenesis inhibitors generally prevent the expression of

or block the activity of a tumor protein that activates angiogenesis

also blocking the expression of its receptor on endothelial cells.

Direct angiogenesis inhibitors are the least likely to induce acquired drug

resistance, because they targeted genetically stable endothelial cells rather

than unstable mutating tumor cells. (See table 1).

Page 20: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

20

20

Pro-angiogenic factors Anti-angiogenic factors

Angiogenin Angiostatin (plasminogen fragment)

Angiopoetin-1 Endostatin (collagen XVIII fragment)

Del-1 Cartilage-derived inhibitor (CD1)

Fibroblast growth factor, acidic (bFGF) CD59 complement fragment

Antiangiogenic antithrombin III Fibronectin fragment

Fibroblast growth factor, basic (bFGF) Gro-beta

Follistatin Heparinases

Transforming growth factor beta (TGF- ß)

Granulocyte colony-stimulating factor (G-

CSF)

Heparin hexasaccharide fragment

Hepatocyte growth factor (HGF) Human chorionic gonadotropin (hCG)

Interleukin-8 (IL-8) Interferon inducible protein (IP-10)

Leptin Interferon alpha, beta, gamma

Midkine Interleukin 12 (IL-12)

Placental growth factor (PiGF) Cringle 5 (plasminogen fragment)

Platelet-derived endothelial cell growth

factor (PD-ECGF)

Tissue inhibitors of metalloproteinases (TIMPs)

Platelet-derived growth factor-BB(PDGF-

BB)

2-Methoxyestradiol

Pleiotrophin (PTN) Placental ribonuclease inhibitor

Proliferin Plasminogen activator inhibitor

Transforming growth factor-alpha (TGF-

alpha)

Platelet factor 4 (PF4)

Transforming growth factor beta (TGF-beta) Prolactin 16kD fragment

Tumor necrosis factor-alpha (TNF-a) Retinoids

Vascular endothelial growth factor (VEGF) Tetrahydrocortisol-S

Thrombospondin-1 (TSP-1)

Vasculostatin

Vasostatin (calreticulin fragment)

Table 1 Pro-angiogenic and Anti-angiogenic factors.

Page 21: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

21

21

In this way two approaches have been adopted: first, the use of antibodies

to either VEGF or VEGF receptors, and second, the development of

specific inhibitors of the VEGF receptor tyrosine kinase.

Ferrara and colleagues were the first to show that antibodies to VEGF

slowed tumor growth (Kim et al, 1993), and humanized forms are now in

Phase III clinical trials for the treatment of solid tumors.

Because of the difficulties and expense of using biological agents in the

clinic, others set out to identify low-molecular-weight inhibitors of the

tyrosine kinase activity of KDR (VEGFR2 in humans), also with promising

results in hematological malignancies.

In this way several compounds have been identified and are undergoing

clinical evaluation (Bikfalvi et al, 2002; Mesters et al, 2000).

Inhibitors of the KDR VEGF receptor tyrosine kinase Developer Compound Clinical stage

Pharmacia (Sugen) SU101 No longer in

development

Pharmacia (Sugen) SU5416 No longer in

development

Pharmacia (Sugen) SU6668 Phase II

AstraZeneca ZD4190 Phase II

Novartis PTK787ZK222584 Phase II

Page 22: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

22

22

Gene treatment approaches in anti-angiogenesis

Based on inhibition of angiogenesis by gene therapy Lin et al, used an

adenoviral vector to deliver a recombinant Tie2 receptor (tirosine kinase

receptor) that blocked activation of the Tie2 receptor on endothelial cells.

Most important, delivery of the soluble Tie2 receptor-adenoviral construct

at the time of surgical excision of primary tumors also inhibited subsequent

metastasis growth, demonstrating that gene therapy directed against the

Tie2 receptor on endothelial cells will inhibit tumor angiogenesis (Lin et al,

1998).

Goldman et al, reported the use of an ex vivo gene transfer method to

transfect stable human tumor cells with the cDNA encoding a truncated

form of native soluble FLT-1, a receptor for the angiogenic factor VEGF.

Soluble FLT-1 inhibited VEGF function (Goldman et al, 1998).

Moreover, researchers have to consider the local vs. systemic anti-

angiogenic gene therapy, and direct vs. indirect anti-angiogenic gene

therapy (Folkman, 1998).

Also, combinations of angiogenesis inhibitors and conventional cytotoxic

chemotherapy cured tumors in mice when either therapy alone could not

accomplish this (Teicher et al, 1994).

Page 23: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

23

23

In the future, systemic anti-angiogenic therapy may be used:

• After surgery or after radiotherapy to prevent recurrence of distant

metastases.

• In combination with conventional chemotherapy

• In combination with vaccine therapy or immunetherapy

• In combination with others types of gene therapy, for example delivery

of tumor suppressor genes.

Vascular targets

Two types of vascular target agents (VTAs) are currently being developed

for cancer treatment:

a) The ligand-directed VTAs, which use antibodies and peptides to

target toxins, pro-coagulants, and pro-apoptotic effectors to tumor

endothelium.

b) The small molecules that do not specifically localize to tumor

endothelium, but which exploit pathophysiological differences

between tumor and normal tissue endothelia to induce selective

occlusion of tumor vessels (Ching et al, 1999), (See table 2).

Page 24: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

24

24

Vascular targeting of malignant tumors has been shown to be a new

potential approach for the treatment of cancer (Huang et al, 1997), and

some of the advantages over conventional anti-tumor cell therapies are:

1. target antigen is directly accessible, and penetration of drugs

through the tumor tissue, which has been defined as a major

problem in the treatment of solid tumors is not

necessary.(Baxter et al, 1989; Fujimori et al, 1989; Jain,

1990).

2. There is a potentiation effect because the killing of one

endothelial cell results in the death of thousands of tumor cells

(Denekamp, 1990), and the coagulation process is a cascade in

which one molecule of initiating coagulation factors results in

the generation of millions of molecules fibrin per minute.

3. The target cells are unlikely to acquire genetic mutations and

to develop a drug resistance (Boehm et al, 1997).

The same targeted drug can be used for a variety of solid tumors because

the target antigen should be present in many different tumors, also a

surrogate marker of biological activity (i.e., blood flow) is measurable in

the clinic and temporary effects on vascular function may be sufficient.

Studies indicate that > 99 % of tumor cells in vivo can be killed during a 2-

hrs period of ischemia (Chaplin et al, 1994).

Page 25: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

25

25

Finally, unlike angiogenesis inhibitors, VTAs should require only

intermittent administration to synergize with conventional treatments rather

than chronic administration over months or years.

VTA approach Compound Comments

Ligand-directed Antibody-TF

Anti-VCAM1-TF

L19 scFv-TF

TF induces coagulation

VCAM-1 is a cell adhesion marker

L19 scFv targets fibronectin ED-B

domain

VEGF-gelonin

Anti-endoglin linked to ricin A

Anti-TES-23 linked to

Neocarzinostatin

L19 scFv-IL-12

L19 scFv-TNF-a

Anti-PS

Targeted ATPµ-Raf gene

DNA encoding Flk-1 fused

to Fas

Gelonin is a plant toxin

Antibody-toxin

Antibody-cytotoxic

Antibody-cytokine

Antibody-cytokine

Naked antibody

Gene therapy, blocks signaling

Gene therapy, induces apoptosis

Small molecules CA4P

ZD6126

AVE8062A

Oxi4503

DMXAA

Phosphate prodrug of CA4P

Phosphate prodrug of N-

acetylcolchinol

Combrestastatin analogue

Combrestastatin analogue

Flavonoid

Table 2. Philip Thorpe et al, The first International Conference on Vascular Targeting:

Meeting Overview.

Page 26: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

26

26

THE αVβ3 and αVβ5 integrins as natural endothelial markers

In the past decade, many molecules have been described to be up-regulated

on angiogenic endothelial cells, which can in theory be therapeutically

exploited (Schraa et al, 2002).

Some of these molecules are the integrins αVβ3 and αVβ5, which recognizes

RGD (Arg-Gly-Asp) motifs in extracellular matrix components (Brooks et

al, 1994a), and are essentially absent from the normal tissues of an adult

animal and are also selectively up-regulated in angiogenesis related

diseases.

Several members of the integrin family of adhesion receptors are expressed

on the surface of cultured smooth muscle and endothelial cells. Among

these integrins is αVβ3, the endothelial cell receptor for vitronectin, von

Willebrand factor, fibrinogen and fibronectin (Cheresh, 1987).

Cheresh showed that in both human and chick, blood vessels involved in

angiogenesis have enhanced expressions of αVβ3, playing a key role in

angiogenesis and suggesting that integrin αVβ3 will be a therapeutic target

for diseases characterized by neovascularization (Brooks et al, 1994a).

The αVβ3, αVβ5, α5β1 and other integrins are each up-regulated in

angiogenic vessels and play a role in angiogenesis (Eliceiri et al, 1999).

In the fetus, α5β1 is necessary for the development of the vasculature (Yang

et al, 1993), whereas fetal or adult angiogenesis can occur without the αV

integrins.

Page 27: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

27

27

However, αVβ3 and αVβ5 are somehow important in adult angiogenesis

because peptides and antibodies that perturb their function block

angiogenesis (Ruoslahti, 2002).

Recombinant fusion proteins

General advantages of recombinant fusion proteins are:

1 Easy production of defined homogeneous proteins

2 Protein engineering can be performed on the DNA level

3 The constructs can be produced as entirely human proteins, which

addresses the previously described problem of immunegenicity

(Kuus-Reichel et al, 1994).

4 Easy experimentation on mice.

The anti-tumor efficacy of tTF targeted to tumor vessels has already been

proved; Huang et al, 1997, targeted the TF molecule to a class II antigen in

a mouse neuroblastoma model through a bispecific antibody, transfecting

first the mice with the IFN-y gene, to generate the expression of MHC class

II antigens on the tumor vascular endothelium in mice.

To target tTF to tumor vascular endothelium, a mixture of tTF and the

bispecific F(ab´)2 antibody was injected in tumor allografted mice. The

binding of tTF to MHC class II antigen on endothelial cells induced

selective coagulation activation with tumor infarction.

The treatment induced thrombosis of tumor vessels with 38% of complete

regression. (Huang et al, 1997).

Page 28: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

28

28

One year later Sophia Ran et al, from the same group used a coaguligand

consisting of a monoclonal antibody to murine VCAM-1 (vascular cell

adhesion molecule-1) covalently linked to tTF. By antibody directed

targeting of tTF to the tumor vasculature selective infarction of solid

Hodgkin's tumors in mice was mediated.

The treatment induced thrombosis of tumor vessels and retarded tumor

growth, complete tumor regression was not observed. A 50% reduction in

tumor growth occurred, although VCAM-1 was present only in a minority

of vessels (larger vessels within the tumor mass) (Ran et al, 1998).

Dario Neri et al, used a similar approach by fusing an antibody fragment

(scFv) specific for the oncofetal ED-B domain of fibronectin to tTF. The

fusion protein mediated the complete and selective infarction of three

different types of solid tumors in mice.

In this approach 30% of mice exhibited a complete tumor regression in a

single dose treatment, but showing also signs of toxicity and the animals

were not cured (Nilsson et al, 2001).

Liu C et al, coupled tTF to an inhibitor of prostate-specific membrane

antigen. This protein induced selective local in vivo infarctive necrosis of

the rat Mat Lu prostate tumor when administered intravenously (i.v.).

The combined administration of this fusion protein with low-dose

doxorubicin produced a profound tumoricidal effect, resulting in complete

eradication of some tumors (Liu et al, 2002).

Another group induced extravascular coagulation targeting a highly

selective tumor stroma associated marker, they constructed a fusion protein

comprising of a single-chain molecule of a fibroblast activation protein

Page 29: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

29

29

(FAP)-specific humanized antibody [single chain fragment

variable(scFv)OS4] and the extra cellular domain of human tissue factor.

The fused protein scFv-tTF targeted to FAP induced an extravascular

coagulation of the tumor stroma in an antigen-specific manner (Rippmann

et al, 2000).

Recently P. Hu et al 2003, generated three MAb fusion proteins that

selectively block the blood flow to tumors by targeting different antigens;

the first one the RGD/tTF, targets endothelial αVβ3 and αVβ5 integrins

exposed on tumor vessels, the second fusion protein, chTV-1/tTF, targets a

vessel antigen, fibronectin, which is located in the basement membrane of

vessels and the third fusion protein, chTNT-3/tTF, targets necrotic regions

of the tumor in which conserved and abundant intracellular antigens are

exposed in degenerating cells.

Page 30: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

30

30

OBJECTIVES

The present study focuses on the fact that the human coagulation inducing

protein tissue factor, is the major initiator of blood coagulation. The aim of

this work was to investigate the feasibility of treating human solid tumors

by selective delivery of human truncated tissue factor fused to RGD

peptide sequences to the tumor vascular endothelium in a mouse model, as

a new approach for cancer therapy.

The objectives are:

To demonstrate that the tTF-RGD fusion proteins selectively induce

coagulation in the tumor vasculature in an animal model.

To demonstrate the anti-tumor activity of tTF-RGD fusion proteins in a

mouse xenotransplantation model.

To demonstrate that the selective thrombosis of treated solid tumors in our

approach should lead to regression and inhibition of tumor growth.

To demonstrate the safety of this anti-vascular treatment strategy.

Page 31: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

31

31

Material and methods

Cell lines and antibodies:

Lung cancer cell line (CCL185) were described earlier (Topp et al, 1993)

and the melanoma tumor cell line (M21) as described was kindly provided

by Dr. Silletti, University of California San Diego (USA)(Felding-

Habermann et al, 1992). Anti-tTF was obtained by Diagnostic international

(Karlsdorf, Germany), Integrin αVβ3 and GRGDSP-peptide was obtained

by Chemicon (Temecula, California, USA). Anti-Histag antibody (Santa

Cruz Biotechnology).

Construction of the E. coli expression vector for soluble TF (truncated

TF [tTF1-219])

The c-DNA coding for tTF1-219 and tTF1-219-GRGDSP (short tTF-RGD) was

amplified by polymerase chain reaction (PCR) using the primers :

5‘CATGCCATGGGATCAGGCACTACAAATACTGTGGCAGCATATA

AT.3‘(5‘Primer)5‘CGGGATCCTATTATCTGAATTCCCCTTTCTCCTG

GCCCAT3‘(3`Primer) for tTF and 5‘CATGCCATGGGATCAGGCACTA

CAAATACTGTGGCAGCATATAAT3‘(5‘Primer)5’CGGGATCCTATT

ATGCATGTGCTCTTCCGTTACCTCTGAATTCCCC-3’(3‘-Primer) for

tTF-RGD (primers from Oligofactory PE Applied Biosystems Germany).

The RGD sequence was ligated to the carboxyl terminus of the tTF. This

would allow the tTF-RGD to adopt an orientation perpendicular to the

Page 32: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

32

32

phospholipid membrane of the cell similar to native tissue factor (Banner et

al, 1996).

On the other hand, ligation of the peptide to the carboxyl terminus of tTF

should not result in a sterical hindrance for the interaction of tTF and its

substrate FX.

Expression, refolding and purification of tTF1-219 and tTF1-219 RGD

peptide.

With the DNA-Ligation Kit (Novagen, Madison, Wisconsin, USA), the

cDNA were cloned into the expression vector pET-30(+)a (Novagen),

using the Bam H 1 and NCO I restriction sites of the vector.

The vectors were introduced into competent Escherichia coli cells (BL21

DE3) according to the manufacturers protocol (Novagen).

After stimulating with IPTG (Novagen) the cells were harvested and 5-7 ml

lysis buffer (10 mM Tris-HCl, pH 7,5; 150 mM NaCl; 1 mM MgCl2; 10

µg/ml Aprotinin; 2 mg/ml Lysozym) per gram wet weight and 20 µl

Benzonase (Novagen) were added to the pellet.

Then the cells were incubated for 90 minutes at RT and centrifuged at

12,000 g for 20 min at 4°C. The pellet was resuspended and homogenized

by sonicating in washing buffer (10 mM Tris/Hcl, pH 7,5; 1 mM EDTA;

3% Triton X-100).

To solubilize the inclusion bodies, 2-4 ml Guanidinium buffer (6 M GuCl;

0,5 M NaCl; 20 mM NaH2PO4; 1 mM DTT) per gram wet weight was

added. After incubation over night at RT, the suspension was centrifuged at

Page 33: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

33

33

5,000g for 30 min at 4°C. The supernatant was filtered through a 0,22 µm

filter.

Purification and refolding was done with the His Bind Buffer Kit

(Novagen) according to the manufacturers protocol. To remove the salt, the

suspension was dialyzed in a Slide-A-LyzerR 10 K dialysis cassette

(Pierce, Rockford, Illinois, USA) against TBS buffer.

Characterization of tTF1-219 and tTF1-219 RGD peptide

For chemical characterization, sequences of the coding cDNA in the

expression plasmids are confirmed in an automatic sequencer equipped

with laser and CCD-camera (ABI PRISM 310, Perkin Elmer). N-terminal

amino acid sequences of proteins are confirmed by Edman degradation and

amino acid analyses is performed additionally ( Applied Biosystems

Sequencer Model 477A and AS-Analyzer 120A). Subsequently,

SDS/PAGE and Western Blot analyses are carried out with antibodies

against tTF

SDS-PAGE and Western blot analysis

The purified tTF-RGD fusion proteins were analysed by SDS-PAGE as

described above.The presence of the tTF moiety for each fusion protein

was further confirmed by western blotting analyses.

The protein samples were diluted trying to obtain a similar concentration

between them. Using a precision protein standard (Bio-rad) the

electrophoresis was runned at 120 volts and later stained with Gel code

Page 34: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

34

34

blue stain reagent (PIERCE). The tTF-RGD fusion proteins in the SDS-

PAGE gel (ready gel Bio-rad, 4°C) were transferred to a PVDF membrane

overnight at 30 volts and 90 mA.

To identify those bands containing the tTF and tTF-RGD fusion proteins,

the protein immunoblotting (Opti-4CN amplified, Bio-Rad) was done

incubating the fusion proteins with a primary antibody (anti-Histag Santa

Cruz biotechnology) biotin conjugated and a HRP antibody (streptavidin

HRP).

Tumor endothelial cells

Figure 1. Schematic

representation of the binding of

the fusion protein tTF-RGD, to

avß3-integrin.

This receptor is selectively

expressed in high density on tumor

endothelial cells, but with few

exceptions not in quiescent

endothelial cells in normal tissues.

Binding of tTF1-219 and tTF1-219 RGD peptide to FVIIa

The apparent dissociation constant (Kd) for the interaction of the tTF

constructs with FVIIa are calculated employing a published method based

on the amidolytic activity of the tTF:VIIa complex towards the

chromogenic substrate Spectrozyme Factor Xa (American Diagnostica)

(Ruf et al, 1991a and b).

Into each well of a microtiter plate the following reagents are added: a) 26

µl 0.05 M Tris/HCl, 0.15 M NaCl, pH 7.4, 0,1 % bovine serum albumin

Page 35: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

35

35

(TBS-BSA). b) 26 µl tTF 1-219 and the tTF 1-219-RGD peptide, respectively,

diluted in TBS-BSA in concentrations ranging from 300 pM to 25 µM and

c) 26 µl 8 nM recombinant FVIIa (Novo-Nordisk) in TBS-BSA. After 15

min at RT, 26 µl of Spektrozyme Factor Xa are added and the initial

reaction is monitored by change in absorption at 405 nm on a microplate

reader (Bio-Rad, Hercules, California, USA).

Rates are converted into concentrations of tTF:VIIa. On the basis of

calculated free and bound ligand, the apparent Kd is determined by fitting

these data to the single-site-binding equation:

(number of bindings sites x [free ligand]) [Bound ligand] = ________________________________________

([free ligand] + Kd)

Factor X activation by tTF and tTF-RGD

The ability of tTF and tTF-RGD to enhance the specific proteolytic

activation of Factor X by Factor VIIa was assessed as described by Ruf et

al (104). Briefly, to each well in a microtiter plate was added 20 µl of: (a)

50 nM recombinant FVIIa (Novo-Nordisc) in TBS-BSA; (b) 0,16 nM –1,6

µM tTF/tTF-RGD in TBS-BSA; (c) 25 nM CaCl2 and 500 µM

phospholipids (phosphatidylcholine/ phosphatidylserine, 70/30, MM;

Sigma).

After 10 min at room temperature, 20 µl of the substrate Factor X (Enzyme

Research Laboratories) was added in a concentration of 5 µM.

Aliquots were removed from the reaction mixture every minute and

stopped in 100 nM EDTA. Spectrozyme FXa was added and rates of Factor

Xa were monitored by the development of color at 405 nm.

Page 36: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

36

36

The activity of tTF-RGD bound to microvascular endothelial cells (MVEC)

was determined in vitro by using a chromogenic assay to detect FXa as

described by Ran et al, 1998.

Briefly, MVEC were grown in a 96 well plate to confluence. The cells were

washed two times with PBS-buffer containing 2mg/ml BSA. The cells were

incubated with different concentrations of tTF-RGD (0,025-0,4 nM) for 20

min at 37°C.

To each well in the microtiter plate was added: (a) 50 µl of Tris/HCl, 0,15

M NaCl, pH 7,4, 0,1% BSA (TBS-BSA); (b) 25 µl of 10 nM recombinant

FVIIa (Novo Nordisk, Bagsværd, Denmark) in TBS-BSA; (c) 25 µl of 5

mM CaCl2 in TBS-BSA.

After an incubation time of 20 min at room temperature, 100 µl of each

well was transferred to a new 96-well plate. 50 µl of 1,1 M EDTA and 25

µl of Spectrozyme FXa (5nM) were added.

The breakdown of substrate was measured by reading the absorbance in a

microplate reader (Bio-Rad, Hercules, California, USA) at 405 nM. The

cells were detached and counted. The results are expressed as the amount

of FXa generated per 104 cells.

Binding of tTF-RGD fusion proteins to its targets

The binding of tTF-RGD to purified immobilized αvβ3 (Chemicon) was

analyzed by ELISA (enzyme linked immunoadsorbent assay) techniques as

described earlier (Silleti et al, 2001). Binding steps were performed in the

Page 37: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

37

37

absence and presence of the synthetic peptide GRGDSP (Chemicon) as

competitive ligand in order to show the specificity of this interaction.

Subsequently, the specific binding of tTF-RGD to αvβ3 on endothelial cells

was evaluated.

To this end, the differential binding of biotinilated tTF and tTF-RGD on

endothelial cells in suspension was analyzed by FACS. Streptavidin-

phycoerythrin has been employed for detection of bound protein (See

fig.4).

Tumor Xenotransplantation models

All procedures on animals were performed in agreement with german

regulations (Tierversuchsgesetz § 8 Abs. 2) and specifically approved in

form of a project license.

Single cell suspension (2 x 106 in 100µl) of CCL185 (human

adenocarcinoma of the lung) or M21 (human melanoma) were injected

subcutaneously (s.c.) into the right anterior flank of male BALB/c nude

mice (9-12 weeks old).

Tumor growth was allowed to a volume of approximately 50-100 mm3

(CCL185) and 500-700 mm3 (M21), respectively. At this point, mice were

randomly assigned to different experimental groups. Group 1 received

0.9% NaCl (100 µl), group 2 tTF (30µg in 100µl 0.9% NaCl) and group 3

tTF-RGD (30µg in 100µl 0.9% NaCl) via tail vein injection.

Page 38: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

38

38

Depending on the growth kinetics injections were repeated twice weekly

for five times (CCL185) or daily for five times (M21).

Tumor size in vivo was evaluated using a standard caliper measuring tumor

length and width in a blind fashion. Tumor volumes were calculated using

the standardized formula (length x width² x π/6).

According to our project license, animals had to be euthanazed when

tumors became too large, if mice lost >20% of body weight, or at signs of

pain.

Representative photographs of animals and tumors were taken at the end of

each experiment (data not shown). Next, mice were sacrificed by cervical

dislocation in deep CO2 anesthesia in agreement with standard regulations

and project license.

Immediate debleeding was achieved by injection of NaCl 0,9 % and

heparinized solutions directly into the left cardiac ventricle and opening

femoral vessels. Tumors and organs (heart, lung, liver, kidney) were

excised and fixed in 4% buffered formaldehyde solution before embedding

in paraffin.

For toxicity studies an extra set of animals was injected with a higher dose

of tTF-RGD (50µg) and analyzed for signs of thrombosis in heart, lung,

kidney or liver 1h, 4h or 24 hrs after injection in a similar manner.

Page 39: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

39

39

Histological studies

Histological analyses, was performed as described earlier (31). Briefly, to

assess the toxicity of treatment by histological analysis, organs (heart, lung,

liver and kidney) were collected 1h, 4 hrs and 24 hrs after injection of 2.0

mg/kg/body weight of tTF-RGD, tTF and saline, fixed in 4 % buffered

paraformaldehyde and embedded in paraffin.

Four µm sections were cut and transferred onto glass slides.

At least, 10 sections per sample were available for evaluation.

Hematoxylin-Eosin (H&E) stained sections from organs were analyzed

using conventional light microscopy for signs of necrosis and thrombosis in

a blinded fashion.

Mice were sacrificed at different time points after injection of

2.0mg/kg/body weight. The tumors were excised, fixed in 4 % buffered

paraformaldehyde and embedded in paraffin. Sections were cut and stained

with H&E.

Thrombosis of vessels was defined as complete or incomplete occlusion of

intratumoral vessels by closely packed red blood cells.

Page 40: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

40

40

STATISTICS

The data are presented as medians and interquartile ranges.

The binding differences between tTF and tTF-RGD and the differences in

tumor growth rates between treated tTF-RGD mice and control mice (tTF

or NaCl) were tested for statistical significance using a nonparametric test

(Mann-Whitney rank sum test) for independent samples that makes no

assumptions about tumor size being normally distributed.

P values of <0.05 were considered significant.

In the tumor growth analyses the data are presented as means, standard

deviation (SD) and standard error.

Page 41: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

41

41

RESULTS

Characterization of tTF and tTF-RGD

After expression and purification, tTF and tTF-RGD were analyzed under

denaturing conditions on SDS-PAGE and Western-blot (See fig. 1-2 and

3).

M 1 2 3

Figure.2. SDS-PAGE ( Electrophoresis ready gel-Bio rad) M=molecular weight marker,

1=tTF, 2=tTF-RGD, 3=tTF-RGD

Fig. 3 Western-blot analyses of recombinant tTF and tTF fusion proteins. The

purity and identity of tTF and tTF fusion proteins was verified using SDS-PAGE (Gel

code blue ) and Western-blotting (monoclonal anti-tissue factor antibody clone VIC7

American Diagnostics, anti-Histag ab. Santa Cruz) following extraction from E. coli

(BL21 DE3) and refolding with a linear urea-gradient (6M – 1M). M=molecular weight

marker, 1-4 = tTF, 5=tTF-RGD, 6=tTF-NGR.

37 kd

25kd

37 kd

25 kd

Western-blotting, of tissue factor fusion proteins.

M 1 2 3 4 5 6

Page 42: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

42

42

Factor X activation by tTF and tTF-RGD

The ability of tTF and the tTF fusion proteins to enhance the specific

proteolytic activation of factor X (FX) by Factor VIIa (FVIIa) is

demonstrated by Michaelis-Menten analyses. The calculated Michealis

constants (Km) for tTF and the tTF-RGD was within the range of 0.15 nM

as reported in the literature (104a) (Figure 4). Thus, the ligation of the RGD

peptide sequence at the carboxyl terminus of tTF does not affect its

functional activity.

Figure 4. Determination of the Michaelis constant (Km):

For the activation of FX by FVIIa / tTF and FVIIa / tTF fusion proteins the Michaelis-

Menten kinetics were calculated according to a published method (104).

0,0016 0,016 0,16 1,6 16 160 16000

10

20

30

40

50

60

70

80

90

100

∆ m

OD

/ m

in

tTF (nM)

Km = 0,16

0,0016 0,016 0,16 1,6 16 160 16000

10

20

30

40

50

60

70

80

90

100

∆ m

OD

/ m

in

tTF-RGD (nM)

Km = 0,12

Page 43: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

43

43

Binding experiments of tTF fusion proteins (tTF-RGD) to purified αvβ3

The specific binding of tTF-RGD to immobilized αvβ3 is shown in a

purified receptor binding assay (Figure 5.a-b). Binding of our construct to

immobilized αvβ3 was dose-dependent and saturable. The specificity of this

RGD-dependent interaction is underlined by the competition of the

synthetic peptide GRGDSP. In the presence of 10-100 fold molar excess of

synthetic RGD peptide our construct showed merely no significant binding

capability to αvβ3.

Figure 5 a

Binding of tTF, tTF-RGD to the integrin

αvβ3. The binding of 0.1µM tTF, tTF-

RGD to immobilized αvβ3 was detected

with a polyclonal antibody against human

TF by ELISA. The results are presented as

median and interquartile range. The

difference in binding between tTF-RGD

and tTF was significant (p<0.005, Mann-

Whitney-Test).

Figure 5b

Specificity of the binding of tTF-RGD to

integrin αvβ3 . The binding of tTF-RGD

(0.1µM) to immobilized avß3 was

significantly inhibited by the synthetic

peptide GRGDSP (p<0.005, Mann-

Whitney test for both RGD peptide

concentrations).

0

1

2

4

6

8

0

2

4

tTF -RGDtTF 0

0

0

0

0

1

1,

,

Bin

ding

.to α

vß3 (m

OD

)

0

20

40

60

80

100

tTF-RGD tTF-RGD +1 µM RGD

tTF-RGD +10 µM RGD

Bin

ding

to

αvβ 3

(%)

Page 44: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

44

44

Binding of tTF-RGD on endothelial cells

Subsequently, the specific binding of tTF-RGD to receptors on endothelial

cells (MVEC) was evaluated by FACS. Differential binding of biotinilated

tTF and tTF-RGD on endothelial cells in suspension is shown.(Figure 6A).

Indeed, the measured fluorescence intensity was eight fold higher for tTF-

RGD compared to tTF. Furthermore, the binding of 0,1 µM tTF-RGD to

endothelial cells was reduced to 25% in the presence of 1 µM synthetic

peptide GRGDSP. These results underscore again the RGD-dependency of

tTF-RGD binding to receptors on endothelial cells such as integrins αvβ3 or

αvβ5 (See fig. 6B).

A

Cell

count

Fluorescence intensity

B

Fluorescence intensity

Figure 6. Binding of tTF and tTF-RGD to human endothelial cells. A) FACS

analyses of endothelial cells that were incubated with 0.1 µM (2) or with 0.1 µM tTF-

RGD (3)for 60 min. at 4°C. B) By the addition of 1 µM GRGDSP the binding of the

tTF-RGD fusion protein to endothelial cells was reduced by 75% due to competitive

inhibition (4). Line 1 in A and B shows the negative control.

Page 45: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

45

45

Anti-tumor activity of tTF-RGD in human malignant melanoma

tumors

The anti-tumor activity of the tTF-RGD fusion protein was determined in

BALB/c nude mice bearing 500-700 mm3 M21 tumors (human malignant

melanoma). The saline solution, tTF (20µg) and tTF-RGD (20µg) in 200 µl

saline solution respectively, were administered i.v. five times at intervals of

24 hours. The pooled results of two independent experiments are presented

(Figure 7).

The tumor growth was significantly retarded at the 4th day of the treatment

(P=0,001) in comparison to tTF and saline treatment.

The tumor weight was in the tTF-RGD treated group significant lower in

comparison to the control groups (P=0,001).

During treatment tumors showed macroscopic signs of necrosis within 24

hours of treatment start similar to the results published by other groups

(Huang et al, 1997; Ran et al, 1998; Nilsson et al, 2001; Liu et al, 2002;

Peisheng et al, 2003). Besides, histological studies revealed substantial

amount of tumor vessels which were thrombosed and confirmed the

macroscopic impression of gross tumor necrosis. Thus, the presumable

mode of action of the tTF-RGD fusion protein, i.e. the thrombotic

occlusion of tumor vessels is underlined by these observations.

The high selectivity of the tTF-RGD for tumor blood vessels is

demonstrated by the fact that no visible thrombosis or necrosis occurred in

normal tissues such as heart, kidney, liver, and lung (see fig 8). Even

Page 46: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

46

46

repeated high doses of tTF-RGD (4 mg/kg body weight) did not cause any

thrombosis or visible organ damage.

Figure 7. Anti-tumor activity of tTF-RGD on growth of M21 tumors in mice

The anti-tumor activity of the tTF-RGD fusion proteins was determined in BALB/c

nude mice bearing M21 tumors. The tTF, saline solution and tTF-RGD respectively,

were administered i.v. five times at intervals of 24 hours. The tumor growth was

significantly retarded at the 4th day of the treatment (P=0,001) in comparison to tTF and

saline treatment. The tumor weight in the tTF-RGD treated group was significantly

lower in comparison to the control group (P=0,001).

Anti-tumor activity of tTF-RGD in human lung cancer tumors in mice

Furthermore, we determined the anti-tumor activity of the tTF-RGD

protein in BALB/c/nude mice bearing 50-100 mm3 CCL185 (human lung

cancer) tumors. Because of the slower tumor growth in the experiment, the

0

300

600

900

1200

1 2 3 4 5 6 7

TIME [days]

TUM

OR

VO

LUM

E [m

m3 ]

Saline

tTF

tTF-RGD

Page 47: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

47

47

tTF-RGD (20µg) and the controls tTF(20µg) and saline solution were

administered five times at intervals of 3-4 days.

The pooled results of two independent experiments are represented (Fig.8).

After the 5th injection of tTF-RGD, we could show a significant growth

inhibition of the CCL185 tumors in comparison to the control groups

(P=0,001).

Figure 8. Anti-tumor activity of tTF-RGD on growth of CCL-185 tumors in mice

The anti-tumor activity of the tTF-RGD fusion proteins was determined in BALB/c

nude mice bearing CCL185 tumors. Because of the slower tumor growth in the

experiment, the tTF-RGD, the tTF and the saline solution, respectively, were

administered at intervals of 3-4 days. After the 5th injection of the tTF-RGD, we could

show a significant growth inhibition of the CCL185 tumors in comparison to the control

groups (P=0,001).

0

100

200

300

400

500

600

TIME [days]

TUM

OR

VO

LUM

E [m

m3 ]

Saline

tTF

tTF- RGD

1 4 7 10 13 16 19 22 25

Page 48: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

48

48

Histological analyses from mice organs treated with tTF-RGD

All animals were macroscopically and histologically analyzed after

treatment. The organs (heart, kidney, liver and lung) from the tTF-RGD

treated mice didn’t show any sign of thrombosis or necrosis (See figure 9).

Figure 9. Representative H&E sections of heart (A), kidney (B), liver (C) and lung (D),

1 hour after injection of 4 mg/kg/body weight of tTF-RGD in the mice. No visible

thrombosis or necrosis was observed in these organs (magnification x 200).

The high selectivity of tTF-RGD for tumor blood vessels is demonstrated

by the fact that no visible thrombosis or necrosis occurred in normal tissues

such as heart, kidney, liver and lung (Fig. 10).

A B

C D

Page 49: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

49

49

Histological analyses of the effect of tTF-RGD on tumor tissue

The microscopic studies revealed that tumor vessels of the malignant

melanoma and lung cancer were thrombosed (Fig. 10 A-B). Thus, the

presumable mode of action of tTF-RGD, i.e. the thrombotic occlusion of

tumor vessels is confirmed by these observations.

Figure 10. Representative Hematoxylin/eosin (H&E) sections of the malignant melanoma (M-21) tumor bearing mouse, 1 hour after injection of tTF-RGD (A and B) or saline control (C and D) in the tail vein of the mice. Blood vessels in tumors treated with tTF-RGD fusion proteins appear thrombosed (arrows). In the area surrounding an occluded blood vessel extensive tumor cell necrosis is observed (A-B). Photographs are from representative areas of the tumor (A and C: magnification x 200; B and D magnification x 400).

A

DC

B

Page 50: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

50

50

Macroscopic experiment showing the effect of the tTF-RGD on tumor

treated mice

In order to prove the mode of action that thrombotic occlusion of tumor

vessels does really occur, the following experiment was performed:

The human melanoma cell line M-21 was injected into the flank of two

male balb/c/nude mice. After having reached a tumor volume of

approximately 500 mm3, 2.0 mg/kg/body weight of tTF-RGD or 0,9 %

NaCl was injected in the tail vein of the mice.

See the photograph of the tumor bearing mouse 20 minutes after injection

of the tTF-RGD fusion protein (left side) and 0.9 % NaCl (right side)

respectively (Figure 11 A).

The tumor was bruised and blackened indicating apparent massive tumor

ischemia after injection of tTF-RGD.

The mice were sacrificed 60 min. after injection and the tumor was

completely removed for histological studies (data not shown).

We could see areas of hemorrhage and ischemia in the tumor of the mouse

treated with tTF-RGD in contrast to the apparent vital appearance of the

tumor treated with saline solution after injection.

(Figure 11 B-C).

Page 51: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

51

51

Figure 11. A, Representative photographs of the malignant melanoma (M-21) tumors bearing mice 20 minutes after injection of the tTF-RGD fusion protein (left side) and 0.9 % NaCl (right side), respectively. The tumor was bruised and blackened indicating massive tumor ischemia after injection of tTF-RGD. B, shows areas of hemorrhage in the tumor of the mouse treated with tTF-RGD in contrast to the vital appearance of the tumor treated with 0.9 % NaCl solution C.

A

CB

Page 52: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

52

52

DISCUSSION

The initial reports on the selective induction of intratumoral thrombosis

using tTF fused to antibodies or antibody fragments directed to artificial or

natural markers of angiogenesis showed impressive efficacy in terms of

tumor growth inhibition. The first report by Huang et al, on the targeted

induction of intraluminal blood coagulation in tumor blood vessels using an

artificial marker of angiogenesis generated a great interest to learn whether

the same strategy would work in tumor models carrying natural markers of

angiogenesis.

The second report on this strategy, featuring the targeting of the VCAM-1,

was less impressive because only a 50% reduction in the tumor growth rate

was observed.

The third report by Nilsson et al, featuring the targeting of the mice ED-B

domain sequence in the vasculature of aggressive growing tumors observed

a complete remission in 30 % of the mice treated, however animals were

not cured (Huang et al, 1997; Ran et al, 1998; Nilsson et al, 2001).

One last report by Peisheng Hu et al 2003, shows the results of three

different targeted tissue factor fusion proteins for inducing tumor vessel

thrombosis; the chTNT-3/tTF which targets the antigens exposed in

necrotic regions of the tumor, the chTV-1/tTF targets a vessel antigen,

fibronectin and RGD/tTF similar to the fusion protein constructed in our

approach.

Of interest, a comparison of the three targeting approaches from Hu et al, to

deliver the tTF to the tumor site demonstrated that chTNT-3 and chTV-1

were found to be the most effective vehicles. Interestingly, RGD/tTF alone

Page 53: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

53

53

did not display significant anti tumor effects on its own. The authors

explained this by the fact that the receptor for RGD, αVβ3 , is mainly

associated with endothelial cells undergoing angiogenesis known to occur

principally in newly formed capillaries and small sized vessels, not larger

sized, mature vessels. Moreover, they argued that the RGD receptors have

a relative low affinity for a ligand compared with antigen-antibody

interactions, thus explaining the less impressive results obtained with this

fusion protein (Peisheng Hu et al, 2003).

Antibody fusion proteins highly depend on the appropriate formulation to

prevent protein aggregates associated side effects. The bigger size of even

single-chain antibody fragments which are fused to tTF may be of sterical

hindrance to tTF in terms of inducing coagulation. Promising candidates to

target tTF to the tumor vasculature without the above mentioned drawbacks

include small peptide fusion proteins selective for natural markers on tumor

endothelium (Baxter et al, 1989).

Integrins αVβ3, αVβ5 as well as other integrins have been identified as

markers of activated endothelium and seem to play a crucial role in

developmental and tumor angiogenesis (Fujimori et al, 1989; Jain, 1990;

Denekamp, 1990).

RGD-peptide fusion proteins which bind to these endothelial ligands have

been identified as promising agents to target the tumor endothelium (Arap

et al, 1998).

In this study, we show the ability of tTF and tTF-RGD fusion protein to

enhance the specific proteolytic activation of factor X (FX) by Factor VIIa

(FVIIa). The calculated Michaelis constants (Km) for tTF and the tTF-RGD

Page 54: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

54

54

were within the range of 0.15 nM as reported in the literature,

demonstrating the efficacy of our tTF to activate coagulation.

The specific binding of tTF-RGD to immobilized αvβ3 is shown in a

purified receptor binding assay. Binding of our construct to immobilized

αvβ3 was dose-dependent and saturable. The specificity of this RGD-

dependent interaction is underlined by the competition using the synthetic

peptide GRGDSP. In the presence of 10-100 fold molar excess of

unlabeled synthetic RGD peptide, our construct showed merely no

significant binding capability to αvβ3, thus suggesting the specificity of

tTF-RGD binding to αvβ3.

The anti-tumor activity of the tTF-RGD fusion protein was evaluated in

BALB/c nude mice bearing 500-700 mm3 M21 tumors (malignant

melanoma) and 50-100 mm3 CCL185 tumors (lung cancer). The tumor

growth was significantly retarded in comparison to tTF alone and saline

treatment. Moreover, the tumor weight was significant lower in the tTF-

RGD treated group in comparison to the control group.

In the groups of control mice, there was no statistically significant

difference between mice injected with saline or with tTF protein alone, no

macroscopically signs of ischemia or occluded vessels by histological

analyses, confirming that the selective targeting of tTF-RGD was necessary

for the anti-tumor effect.

In our approach, the injection of the tTF-RGD fusion protein in mice

through the tail vein shows the efficacy of the fusion protein without

significant side effects in vivo.

Page 55: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

55

55

Our effective tumor growth inhibition may be explained by the fact that the

receptors for RGD, αVβ3, αVβ5 are associated with endothelial cells

undergoing angiogenesis.

Moreover, by the suggestion that for optimal effects tTF needs to be

targeted to the luminal surface of the tumor endothelium in all regions of

the tumor mass, probably because platelet activation, assembly of

coagulation factors, or both occur most efficiently on the luminal side

(Brooks, PC et al, 1994b).

The mechanism of vessel thrombosis with the reagent is readily understood

because RGD receptors are located on the luminal side of tumor vessels

(Ran et al, 1998; Nilsson et al, 2001).

According to that and based on the known crystal structure of the

tTF:FVIIa complex (Banner et al, 1996), the fusion to RGD would allow

the tTF-peptide fusion proteins to adopt an orientation perpendicular to the

phospholipid membrane of the endothelial cell similar to native TF.

On the other hand, ligation of the peptide to the carboxyl terminus of tTF,

as done in our work, should not result in a sterical hindrance for the

interaction of tTF with FVIIa and its substrate FX.

This work shows for the first time an effective in vivo inhibition of human

tumor growth by selectively targeting the tTF-RGD fusion protein to

natural markers of angiogenesis. The selective induction of intraluminal

blood coagulation in the tumor vasculature, results in effective anti tumor

therapy in two experimental solid tumor mice models. However, future

preclinical studies are necessary to optimize this antivascular treatment

strategy, e.g. by combining tTF-RGD with cytotoxic agents or other

antiangiogenic drugs.

Page 56: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

56

56

LITERATURE

1 Algire, GH., and Chalkley, HW. Vascular reactions of normal and

malignant tissues in vivo I. Vascular reactions of mice to wounds

and to normal and neoplastic implants. J Natl Cancer Inst USA;

6: 73-85, 1945.

2 Arap, W., Pasqualini, R., and Ruoslahti, E. Cancer treatment by

targeted drug delivery to tumor vasculature in a mouse model.

Science 279:377-380, 1998.

3 Bader, BL., Rayburn, H., Crowley, D., and Hynes, RO. Extensive

vasculogenesis, angiogenesis, and organogenesis precede lethality in

mice lacking all alpha v integrins. Cell, 95: 507-519, 1998.

4 Banner, DW., D´Arcy, A., Chene, C., Winkler, FK., Guha, A.,

Konigsberg,WH., Nemerson, Y., Kirchhofer, D. The crystal structure

of the complex of blood coagulation factor VIIa with soluble tissue

factor.Nature 380:41-46, 1996.

5 Bar, RS., Boes, M., Booth, BA., Dake, BL., Henley, S., & Hart, MN.

The effects of platelet-derived growth factor in cultured microvessel

endothelial cells. Endocrinology 124, 1841-1848, 1989.

6 Baxter, LT., and Jani, RK. Transport of fluid and macromolecules in

tumors.I. Role of interstitial pressure and convection. Microvasc

Res 37:77-104, 1989.

Page 57: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

57

57

7 Ben-Ezra, J., Sheibani, K., Hwabg, D L., & Lev-Ran, A. Megakaryocyte

synthesis is the source of epidermal growth factor in human platelets.

Am. J. Pathol. 137, 755-759, 1990.

8 Bhagwat, S V., Lahdenranta, J., Giordano, R., Arap, W., Pasqualini, R.,

and Shapiro, L H. CD13/APN is activated by angiogenic signals and is

essential for capillary tube formation. Blood 97: 652-659, 2001.

9 Bieker R, Padró T, Kramer J, Steins M, Kessler T, Retzlaff S, Herrera F,

Kienast J, Berdel WE, Mesters RM. Overexpression of basic fibroblast

growth factor and autocrine stimulation in acute myeloid leukemia.

Cancer Research nov 1;63:7241-7246, 2003.

10 Bikfalvi, A. Significance of Angiogenesis in Tumour Progression and

Metastasis. European Journal of Cancer Vol.31A; Nos 7/8: 1101-1104,

1995.

11 Bikfalvi, A., Bicknell, R. Recent advances in angiogenesis,

anti-angiogenesis and vascular targeting. Trends in Pharmacological

Sciences 23;12: 576-582, 2002.

12 Blei, F., Wilson, EL., Mignatti, P., Rifkin, DB. Mechanism of action of

angiostatic steroids: suppression of plasminogen activator activity via

stimulation of plasminogen activato inhibitor synthesis. J Cell Physiol;

155:568-578, 1993.

Page 58: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

58

58

13 Boehm, T., Folkman, J., Browder, T., O’Reilly, MS. Antiangiogenic therapy

of experimental cancer does not induce acquired drug resistance.

Nature ;390:404-407, 1997.

14 Boger, DL., Goldberg, J., Silletti, S., Kessler, T., and Cheresh, DA.

Identification of a novel class of small-molecule antiangiogenic agents

through the screening of combinatorial libraries which function by inhibiting

the binding and localization of proteinase MMP2 to integrin alpha(V)beta(3).

J Am Chem Soc, 123: 1280-1288,2001.

15 Bouck, N. Tumor angiogenesis: the role of oncogenes and tumor suppressor

genes. Cancer Cells 2: 179-185,1990.

16 Brooks, PC., Silleti, S., von Schalscha, TL., Friedlander, M., Cheresh, DA.

Integrin avß3 antagonists promote tumor regression by infuscing apoptosis

of angiogenic blood vessels. Cell;79:1157-1164, 1994b.

17 Brooks. PC., Clark, RAF., Cheresh, DA. Requirement of vascular integrin

avß3 for angiogenesis. Science;264:569-571, 1994a.

18 Browder, T., and -Folkman, J. The hemostatic system as a regulator of

angiogenesis. The Journal of Biological Chemistry, Jan 21;275(3):1521-4,

2000.

19 Brunner, G., Nguyen, H., Gabrilove, J., Rifkin, DB., & Wilson, EL. Basic

fibroblast growth factor expression in human bone marrow and peripheral

blood cells. Blood 81, 631-638, 1993.

Page 59: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

59

59

20 Burg, M A., Pasqualini, R., Arap, W., Ruoslahti, E., and Stallcup, W B.

NG2 proteoglycan-binding peptides target tumor neovasculature. Cancer Res

59: 2869-2874, 1999.

21 Burrows, F J., Derbyshire, E J., Tazzari, P L., Amlot, P., Gazdar, A F.,

King, S W., Letarte, M., Vitetta, E S., and Thorpe, P E.,

Up-regulation of endoglin on vascular endothelial cells in human solid

tumors: implications for diagnosis and therapy. Clin Cancer Res 1:

1623-1634, 1995.

22 Cao, Y., O’Reilly, MS., Marshall, B., Flynn, E., Jie, R-W., & Folkman, J.

Expressions of angiostatin cDNA in a murine fibrosarcoma suppresses

primary tumor growth and produces long-term dormancy of metastases.

J Clin Invest 101:1055-1063, 1998.

23 Carnemolla, B., Balza, E., Siri, A., Zardi, L., Nicotra, M R., Bigotti, A.,

and Natali, PG. A tumor-associated fibronectin isoform generated by

Alternative splicing of messenger RNA precursors.

J Cell Biol 108:1139-1148, 1989.

24 Chaplin, DJ., and Horsman, MR. The influence of tumor temperature on

ischemia-indued cell death: potential implications for the evaluation of

vascular mediated therapies. Radiother Oncol 3,0: 59-65, 1994.

25 Cheng, S-Y., Huang, HJ., Nagane, M., Ji, XD., Wang, D., Shih, CC.,

Arap, W., Huang, CM., Cavenee, WK. Suppression of glioblastoma

angiogenicity and tumorigenicity by inhibition of endogenous expression

Page 60: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

60

60

of vascular endothelial growth factor. Proc Natl Acad Sci USA 93:8502-8507,

1996.

26 Cheresh, DA. Human endothelial cells synthesize and express an

Arg-Gly-Asp-directed adhesion receptor involved in attachment to

Fibrinogen and von Willebrand factor. Proc Natl Acad Sci USA Sep;

84 (18):6471-5, 1987.

27 Ching, LM., Goldsmith, D., Joseph, WR., Komer, H., Sedgwick, JD., and

Baguley, BC. Induction of intratumoral tumor necrosis factor (TNF)

synthesis and hemorrhagic necrosis by 5,6-dimethylxanthenone-4-acetic

acid (DMXAA) in TNF knockout mice. Cancer Res 59:3304-3307, 1999.

28 Claffey, KP., Robinson, GS. Regulation of VEGF / VPF expression in

tumor cells: consequences for tumor growth and metastasis. Cancer

Metastasis Rev 15: 165-176, 1996.

29 Coussens, LM., Fingleton, B., Matrison, LM. Matrix metalloprotienase

inhibitors and cancer: trials and tribulations. Science; vol: 295(5564):

p. 2387-2392, 2002.

30 Date, K., Matsumoto, K., Kubs, K., Shimura, H., Tanaka, M., &

Nakamura, T.Inhibition of tumor growth and invasion by a four kringle-

antagonist (HGF/NK4) for hepatocyte growth factor. Oncogene 17:.

3045-3054, 1998

Page 61: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

61

61

31 Denekamp J. Vascular attack as a therapeutic strategy for cancer. Cancer

Metastasis Rev. 9:267-282, 1990.

32 Dvorak, H F., Brown, L F., Detmar, M., and Dvorak, A M. Vascular

permeability factor/vascular endothelial growth factor, microvascular hyper

permeability, and angiogenesis. Am J Pathol 146: 1029-1039, 1995.

33 Dvorak, H F., Sioussat, T M., Brown, L F., Berse, B., Nagy, J A., Sotrel, A.,

Manseau, E J., Van de Water, L., and Senger, D R. Distribution of vascular

permeability factor (vascular endothelial growth factor) in tumors:

concentration in tumor blood vessels. J Exp Med 174: 1275-1278, 1991.

34 Eliceiri, BP., and Cheresh, DA. The role of alphav integrins during

angiogenesis: insights into potential mechanisms of action and clinical

development. J Clin Invest 103: 1227-1230, 1999.

35 Ellis, LM., and Fidler, IJ. Angiogenesis and Metastasis. European Journal

of Cancer 32A; 14: 2451-2460, 1996.

36 Engerman, RL., Pfaffenbach, D., Davis, MD. Cell turnover of capillaries.

Lab Invest 17:738-743, 1967.

37 Felding-Habermann, B., Mueller, B. M., Romerdahl, C. A., and Cheresh,

D. A. Involvement of integrin alpha V gene expression in human melanoma

tumorigenicity. J Clin Invest, 89: 2018-2022, 1992.

Page 62: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

62

62

38 Fernig DG , Fibroblast growth factors and their receptors: an information

network controlling tissue growth, morphogenesis and repair.

Prog Growth Factor Res. 5: 353-377, 1994.

39 Fidler, IJ., and Ellis, LM. The implications of angiogenesis to the biology

and therapy of cancer metastasis. Cell; 79:185-188, 1994.

40 Folkman Judah. Antiangiogenic gene therapy, Proc Natl Acad Sci USA

95: 9064-9066, 1998.

41 Folkman, J. Tumor angiogenesis: therapeutic implications. N Engl J Med

Nov 18;285(21):1182-6, 1971.

42 Folkman, J. What is the evidence that tumors are angiogenesis dependent.

Journal Natl Cancer Inst, Jan 3;82(1):4-6, 1990.

43 Folkman, J., Shing, Y. Angiogenesis. J Biol Chem 267:10931-10934, 1992.

44 Folkman, J., Watson, K., Ingber, D., and Hanahan, D. Induction of

angiogenesis during the transition fromhyperplasia to neoplasia.

Nature 339: 58-61, 1989.

45 Fujimori, K., Covell, DG., Fletcher, JE., and Weinstein, JN. Modeling

analysis of the global and microscopic distribution of immunoglobulin G,

F(ab')2, and Fab in tumors.Cancer Res 49:5653-5656, 1989.

Page 63: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

63

63

46 Gimbrone, MA Jr., Leapman, S., Cotran, R., Folkman, J. Tumor dormancy

in vivo by prevention of neovascularization. J Exp. Med. 136:261-276, 1972.

47 Goldman, CK., Kendall, RL., Cabrera, G., Soroceanu, L., Heike, Y.,

Gillespie, GY. Paracrine expression of a native soluble vascular endothelial

growth factor receptor inhibits tumor growth, metastasis, and mortality rate.

Proc Natl Acad Sci USA 95:8795-8800, 1998.

48 Good, DJ., Polverini, PJ., Rastinejad, F., Le Beau, MM., Lemons, RS.,

Frazier, WA., Bouck, NP. A tumor suppressor-dependent inhibitor of

angiogenesis is immunologically and functionally indistinguishable from a

fragment of thrombospondin. Proc. Natl. Acad. Sci U.S.A. 87,6624-6628,

1990.

49 Hagedorn, M., Bikfalvi, A. Target molecules for antiangiogenic therapy:

from basis research to clinical trials. Crit Rev Oncol Hematol 34:89-110,

2000.

50 Hanahan, D., Folkman, J. Patterns and emerging mechanisms of the

angiogenic switch during tumorigenesis. Cell 86:353-364, 1996.

51 Hobson, B., Denekamp, J. Endothelial proliferation in tumors and

normal tissues: continuous labeling studies. Br J Cancer 49:405-413,

1984.

52 Huang, X., Molema, G., King, S., Watkins, L., Edgington, T S., and Thorpe,

P E. Tumor infarction in mice by antibody-directed targeting of tissue factor

Page 64: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

64

64

to tumor vasculature. Science 275: 547-550, 1997.

53 Hwang, DL., Lev-Ran, A., Yen, C F., & Sniecinski, I. Release of different

fractions of epidermal growth factor from human platelets in vitro:

preferential release of 140 kDa fraction. Regul Pept; 37: 95-100, 1992.

54 Hynes, R. O. Integrins: versatility, modulation, and signaling in cell adhesion.

Cell, 69: 11-25, 1992.

55 Jain RK. Vascular and interstitial barriers to delivery of therapeutic agents

In tumors. Cancer Metastasis Rev 9:253-266, 1990.

56 Karey, K.P., Marquardt, H., & Sirbasku, DA. Human platelet-derived

mitogens.I. Identification of insulinlike growth factors I and II by

purification and N alpha amino acid sequence analysis. Blood 74,

1084-1092, 1989.

57 Kerbel, RS. Tumor angiogenesis: past, present and the near future.

Carcinogenesis Mar;21(3):505-15, 2000, Review.

58 Kessler, T., Pfeifer, A., Silletti, S., Mesters, R M., Berdel, W E., Verma, I.,

and Cheresh, D. Matrix metalloproteinase/integrin interactions as target for

anti-angiogenic treatment strategies. Ann Hematol 81;Suppl 2: S69-70, 2002.

59 Kim, KJ., Li, B., Winer, J., Armanini, M., Gillet, N., Phillips, HS.,

Ferrara, N. Inhibition of vascular endothelial growth factor-induced

angiogenesis suppresses tumor growth in vivo. Nature 362: 841-4, 1993.

Page 65: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

65

65

60 Kuus-Reichel, K., Grauer, LS., Karavodin, LM., Knott, C., Krusemeier, M.,

Kay, NE. Will immunogenicity limit the use, efficacy, and future development

of therapeutic monoclonal antibodies? Clin Diagn Lab Immunol 1:365-372,

1994.

61 Lee S Rosen, Clinical Experience with Angiogenesis Signaling

Inhibitors: Focus on Vascular Endothelial Growth Factor Blockers.

Cancer control vol. 9; suppl. 2: 36-44, 2002.

62 Lee, OH., Kim, Y-M., Lee, YM., Moon, E-J., Lee, D-J., Kim, J-H.,

Kim, K-W., & Kwon,YG. Sphingosine 1-phosphate induces angiogenesis:

its angiogenic action and signaling mechanism in human umbilical vein

endothelial cells. Biochem Biophys Res Commun 264: 743-750, 1999.

63 Lin, P., Buxton, JA., Acheson, A., Radziejewski, C., Maisonpierre, PC.,

Yancopoulos, GD. Antiantiogenic gene therapy targeting the endothelium-

specific receptor tyrosine kinase tie2. Proc Natl Acad Sci USA;

95:8829-8834, 1998.

64 Liu, C., Huang, H., Donate, F., Dickinson, C., Santucci, R., El-Sheikh, A.,

Vessella, R., and Edgington, T. S. Prostate-specific membrane antigen directed

selective thrombotic infarction of tumors. Cancer Res 62: 5470-5475, 2002.

65 Mattern, J., Koomägi, R., Volm, M. Association of vascular endothelial

growth factor expression with intratumoral microvessel density and tumor

cell proliferation in human epidermoid lung carcinoma. Br J Cancer;

73:931-934, 1996.

Page 66: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

66

66

66 Mesters, RM., Padró, T., Bieker, R., Steins, M., Kreuter, M., Goener, M.,

Kelsey, S., Scigalla, P., Fiedler, W., Buechner, T., Berdel, WE. Stable

remission after administration of the receptor tyrosine kinase inhibitor

SU5416 in a patient with refractory acute myeloid leukemia.

Blood Jul 1;98(1):241-3, 2000.

67 Mesters, RM., Padró, T., Steins, M., Bieker, R., Retzlaff, S., Kessler T.,

Kienast, J., Berdel, WE. Angiogenesis in patients with hematologic

malignancies. Onkologie sep;24 Suppl 5:75-80, 2001.

68 Millauer, B., Shawver, LK., Plate, KH., Risau, W., Ullrich, A.

Dominant-negative inhibition of flk-1 suppresses the growth of many

tumor types in vivo. Cancer Res 56:1615-1620, 1996.

69 Millauer, B., Shawver, LK., Plate, KH., Risau, W., Ullrich, A.

Glioblastoma growth inhibited in vivo by a dominant-negative flk-1

mutant. Nature 367:576-579, 1994.

70 Mohle, R., Green, D., Moore, MA., Nachman, RL., and Rafii, S.

Constitutive production and thrombin-induced release of vascular

endothelial growth factor by human megakaryocytes and platelets.

Proc Natl Acad Sci USA, 94: 663-668, 1997.

71 Morrissey, JH., Macik, BG., Neuenschwander, PF., and Comp, PC.

Quantitation of activated factor VII levels in plasma using a tissue factor

mutant selectively deficient in promoting factor VII activation.

Blood 81: 734-744, 1993.

Page 67: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

67

67

72 Nakamura, T., Teramoto, H., & Ichihara. Purification and characterization

of a growth factor from rat platelets for mature parenchymal hepatocytes

in primary cultures. Proc Natl Acad Sci USA;83: 6489-6493, 1986.

73 Nilsson, F., Kosmehl, H., Zardi, L., and Neri, D. Targeted delivery

of tissue factor to the ED-B domain of fibronectin, a marker of

angiogenesis, mediates the infarction of solid tumors in mice.

Cancer Res 61: 711-716, 2001.

74 Novak, K. Angiogenesis inhibitors revised and revived at the AACR.

Nat Med 8: 427, 2002.

75 Olson, T A., Mohanraj, D., Roy, S., and Ramakrishnan, S. Targeting the

tumor vasculature: inhibition of tumor growth by a vascular endothelial

growth factor-toxin conjugate. Int J Cancer 73: 865-870, 1997.

76 Padró, T., Bieker, R., Ruiz, S., Steins, M., Retzlaff, S., Bürger, H.,

Büchner, T., Kessler, T., Herrera, F., Kienast, J., Müller-Tidow, C.,

Serve, H., Berdel, WE., and Mesters, RM. Overexpression of vascular

endothelial growth factor (VEGF) and its cellular receptor KDR

(VEGFR-2) in the bone marrow of patients with acute myeloid leukemia.

Leukemia 16: 1302-1310, 2002.

77 Padro, T., Ruiz, S., Bieker, R., Burger, H., Stein, M., Kienast, J.,

et al, Increased angiogenesis in the bone marrow of patients with acute

myeloid leukemia. Blood Apr 15;95(8):2637-44, 2000.

Page 68: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

68

68

78 Peisheng, Hu., Jianghua, Yan., Jahangir, Sharifi., Thomas, Bai., Leslie, A.,

Khawli, and Alan, L, Epstein. Comparison of Three Different Targeted

Tissue Factor Fusion Proteins for inducing Tumor Vessel Thrombosis.

Cancer Research ;63: 5046-5053, 2003.

79 Pfeifer, A., Kessler, T., Silletti, S., Cheresh, D A., and Verma, I M.

Suppression of angiogenesis by lentiviral delivery of PEX, a noncatalytic

fragment of matrix metalloproteinase 2. Proc Natl Acad Sci U S A,

97: 12227-12232, 2000.

80 Philip Thorpe ., David, J Chaplin., and David, C Blakey. The first

International Conference on Vascular Targeting: Meeting Overview.

Cancer Res 63, 1144-1147, 2003.

81 Polverini, PJ. How the extracellular matrix and macrophages contribute

to angiogenesis-dependent diseases. Eur. J Cancer, Dec; 32A(14):

2430-7, 1996.

82 Poon, RT., Fan, ST., Wong, J. Clinical implications of circulating

angiogenic factors in cancer patients. J Clin Oncol Feb 15;19(4):

1207-25, 2001, Review.

83 Ran, S., Gao, B., Duffy, S., Watkins, L., Rote, N., and Thorpe, P E.

Infarction of solid Hodgkin's tumors in mice by antibody-directed

targeting of tissue factor to tumor vasculature. Cancer Res, 58:

4646-4653, 1998.

Page 69: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

69

69

84 Rettig, W J., Garin-Chesa, P., Healey, J H., Su, S L., Jaffe, E A., and

Old, L J. Identification of endosialin, a cell surface glycoprotein of

vascular endothelial cells in human cancer. Proc Natl Acad Sci

U S A 89:10832-10836, 1992.

85 Reynolds, LE., Wyder, L., Lively, JC., Taverna, D., Robinson,

SD., Huang, X., Sheppard, D., Hynes, RO., and Hodivala-Dilke,

KM. Enhanced pathological angiogenesis in mice lacking beta 3

integrin or beta 3 and beta 5 integrins. Nat. Med. 8: 27-34,

2002.

86 Rippmann Pfizenmaier, K., Mattes, R., Rettig, WJ., and Dieter

Moosmayer. Fusion of the tissue factor extracellular domain to a

tumor stroma specific single-chain fragment variable antibody results

in an antigen-specific coagulation promoting molecule.

Biochem J 349: 805-812, 2000.

87 Ruegg, C., Yilmaz, A., Bieler, G., Bamat, J., Chaubert, P.,

Lejeune, F. Evidence for the involvement of endothelial cell

integrin avß3 in the disruption of the tumor vasculature induced

by TNF and IFN-y. Nature Medicine 4: 408-414, 1998.

88 Ruf, W., Rehemtulla, A., Morrissey, JH., and Edgington, TS.

Phospholipid independent and dependent interactions required

for tissue factor receptor and cofactor function. J Biol Chem 266

: 2158-2166, 1991a.

Page 70: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

70

70

89 Ruf, W., Kalnik, MW., Lund-Hansen, TS., Edgington, TS:

Characterization of factor VII association with tissue factor in

solution. J Biol Chem 266:15719-15725, 1991 b.

90 Ruoslahti, E. Specialization of tumor vasculature. Nat Rev Cancer

2: 83-90, 2002.

91 Sato, Y., Abe, M., Takaki, R. Platelet factor-4 blocks the binding

of basic fibroblasts growth factor to the receptor and inhibits the

spontaneous Migration of vascular cells. Biochem biophys Res

Commun, 172: 595-600, 1990.

92 Schraa, AJ., Everts, M., Kok, RJ., Asgeirsdottir, SA., Meijer, DK.,

de Leij, LF., Molema, G. Development of vasculature targeting strategies

for the treatment of cancer and chronic inflammatory diseases.

Biotechnology annual review; vol 8:133-165, 2002.

93 Senger, D R., Claffey, K P., Benes, J E., Perruzzi, C A., Sergiou, A P.,

and Detmar, M. Angiogenesis promoted by vascular endothelial growth

factor: regulation through alpha1beta1 and alpha2beta1 integrins.

Proc Natl Acad Sci U S A; 94: 13612-13617, 1997.

94 Silletti, S., Kessler, T., Goldberg, J., Boger, DL., and Cheresh, DA.

Disruption of matrix metalloproteinase 2 binding to integrin

alpha v beta 3 by an organic molecule inhibits angiogenesis and

tumor growth in vivo. Proc Natl Acad Sci U S A 98: 119-124, 2001.

Page 71: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

71

71

95 Skobe, M., Rockwell, P., Goldstein, N., Vosseler, S., Fusenig, NE.

Halting angiogenesis suppresses carcinoma cell invasion.

Nature Medicine 3:1222-1227,1997.

96 Soker, S., Takashima, S., Miao, HQ., Neufeld, G., Klagsbrun, M.

Neuropilin-1 is expressed by endothelial and tumor cells as an

Isoform-specific receptor for vascular endothelial growth factor.

Cell;92: 735-745, 1998.

97 Table 1Pro-angiogenic and Anti-angiogenic factors

(Angiogenesis Foundation). Understanding angiogenesis, 2002. http://www.angio.org/understanding/content understanding.html.

98 Teicher, BA., Holden, S A., Gulshan, A., Sotomayor, A., Huang, ZD.,

Chen, YN. Potentiation of cytotoxic cancer therapies by TNP-470

alone and with other anti-angiogenic agents. Int J Cancer, Jun 15;

57(6): 920-5, 1994.

99 Terman, BI., Dougher-Vermazen, M. Biological properties of

VEGF / VPF receptors. Cancer Metastasis Rev 15:159-163, 1996.

100 Toi, M., Hoshima, S., Takayanagi, T., Tominaga, T. Association of

Vascular Endothelial Growth Factor Expression with tumor angiogenesis

and with early relapse in primary breast cancer. Jpn J Cancer Res

Oct;85(10):1045-9, 1994.

Page 72: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

72

72

101 Topp, MS., Koenigsmann, M., Mire-Sluis, A., Oberberg, D.,

Eitelbach, F., von Marschall, Z., Notter, M., Reufi, B., Stein, H.,

Thiel, E., and Berdel, WE. Recombinant human interleukin-4

inhibits growth of some human lung tumor cell lines in vitro and in vivo.

Blood 82: 2837-2844, 1993.

102 Warren, RS., Yuan, H., Matli, MR., Gillett, NA., Ferrara, N.

Regulation by vascular endothelial growth factor of human colon

cancer tumorigenesis in a mouse model of experimental liver metastasis.

J Clin. Invest 95:1789-1797, 1995.

103 Wartiovaara, U., Salven, P., Mikkola, H., Lassila, R., Kaukonen, J.,

Joukov, Vl., Orpana, A., et al. Peripheral blood platelets express

VEGF-C and VEGF which are released during platelet activation.

Thromb. Hemostats 80, 171-175, 1998.

104 Yang, JT., Rayburn, H., Hynes, RO. Embryonic mesodermal defects

in alpha 5 integrin-deficient mice. Development 119: 1093-1105, 1993.

105 Yun, Z., Menter, DG., Nicolson, GL. Involvement of integrin avß3

in cell adhesion, motility and liver metastasis of murine RAW117

large cell lymphoma. Cancer Res;56: 3103-3111, 1996.

Page 73: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

73

73

ABBREVIATIONS

TF = Tissue Factor

tTF= truncated form of tissue factor

RGD = specific peptide sequence

PS = phosphatidylserene

VEGF = vascular endothelial growth factor

VCAM-1 = vascular cell adhesion molecule

B-FN = fibronecting containing ED-B

FACS = fluorescence activated cell sorting

MVEC = microvascular endothelial cells

Kd = dissociation constant

ELISA = enzyme linked immunoadsorbent assay

Ang1 = angiopoietin-1

ED-B= domain extra domai-B of fibronectin

FVIIa= activated factor VII

TNF-α= Tumor necrosis factor alpha

Page 74: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

74

74

ACKNOWLEGMENTS

I would like to express my gratitude to Prof. Dr med. Rolf M. Mesters for

providing me with opportunity and scientific environment to carry out the

studies.

I am grateful to Dr. Teresa Padró for her commitment, enthusiasm and

guidance throughout this investigation. I also thank Dr. Ralph Bieker and

Dr. Torsten Keßler for their educational advice.

I would also thank Mrs Sandra Ruiz, Dr. med. R Lüttmann, Mrs C Wilken,

Ms H Hintelmann who have contributed to a very pleasant atmosphere, for

their support and friendship in these 3 years.

Finally, I am particularly indebted to Jennifer George, mi wife, for her

emotional support, and friendship. Moreover, my family that after all,

without their, I would have never persisted in achieving this MD.

Page 75: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein

75

75