Bacterial infection and antibiotics

--------------Bacterial pathogenesis(细菌致病机制)

Bacterial Pathogenesis

• References: 1. Murray, P. et al., Medical Microbiology (5th edition)2. Samuel Baron, Medical Microbiology (4th edition)3. Wilson, B.A. et al., Bacterial Pathogenesis: A Molecular Approach (3rd edition)4. Falkow, S. and Miller, V.L., Molecular Genetics of Bacterial Pathogenesis: A Tribute to Stanley Falkow

Outline

Bacterial Pathogenesis

• Introduction

• Host Susceptibility

• Pathogenic Mechanisms

• Virulence Factors

• Steps in Successful Infection

pathogen

The significance of normal flora

• constitute a protective host defense mechanism: Competition of nutrients and receptors Metabolic substances by normal flora: e.g., bacteriocins, antibiotics, etc.

• serve a nutritional function: several B vitamins and vitamin K

• keep our immune systems in tunenormal flora share many antigenic

determinants with pathogenic organisms

Opportunistic pathogens

• Definition: normally nonpathogenic microorganisms capable of causing an infection in an immunosuppressed host.

• Conditions of causing diseases by opportunistic pathogens:

o Alteration of colonization siteso Declination of host immune system function

What a real pathogen will do?

Introduction of Bacterial Pathogenesis

1. Infection: growth and multiplication of a microbe in or on the body with or without the production of disease.

2. The capacity of a bacterium to cause disease reflects its relative “Pathogenicity （致病性）.”

3. Virulence（毒力） is the measure of the pathogenicity of a microorganism.

4. Pathogenesis refers both to the mechanism of infection and to the mechanism by which disease develops.

Host Susceptibility

1. Susceptibility to bacterial infections => Host Defenses vs Bacterial Virulence

2. Host Defenses:- Barriers (skin & mucus) – first line- Innate Immune Responses (complement, macrophages &

cytokines) – the early stage- Adaptive Immune Responses (Ag-specific B & T cells) – the

later stage

3. Host defenses can be comprised by destructing barriers or defective immune response.e.x. Cystic Fibrosis => poor ciliary function => NOT clear mucusefficiently from the respiratory tract => Pseudomonas aeruginosa => serious respiratory distress.

Obligate pathogensare more virulent and can cause diseases in a normal person.

Opportunistic pathogensare typically members of normal flora and cause diseases when they are introduced into unprotected sites, usually occur in people with underlying conditions.

Entry into the human body

: infection : shedding

The most frequent portals of entry- Mucus

- Skin

Routes:

Ingestion, inhalation, trauma, needles, catheters, arthropod bite, sexual transmission

Pathogen ↔ Disease

• Koch‘s postulates (科赫法则)– the pathogen must be present in every case of the

disease– the pathogen must be isolated from the diseased host

& grown in pure culture– the specific disease must be reproduced when a

pure culture of the pathogen is inoculated into a healthy susceptible host

– the pathogen must be recoverable from the experimentally infected host

Stanley Falkow, Ph.D• Microbiologist and a professor of microbiology

and immunology at Stanford University School of Medicine

• The father of molecular microbial pathogenesis, which is the study of how infectious microbes and host cells interact to cause disease at the molecular level.

• He formulated molecular Koch's postulates, which have guided the study of the microbial determinants of infectious diseases since the late 1980s.

• President of the ASM (1997- 1998); elected member of the Institute of Medicine, the National Academy of Sciences, and the National Academy of Arts and Sciences. Fellow of AAAS, UK-FRS (Foreign member)

• The prestigious Lasker Award for medical research (2008)

Molecular Koch's postulates• "The phenotype or property under investigation should be associated with

pathogenic members of a genus or pathogenic strains of a species." Additionally, the gene in question should be found in all pathogenic strains of the genus or species but be absent from nonpathogenic strains.

• "Specific inactivation of the gene(s) associated with the suspected virulence trait should lead to a measurable loss in pathogenicity or virulence." Virulence of the microorganism with the inactivated gene must be less than that of the unaltered microorganism in an appropriate animal model.

• "Reversion or allelic replacement of the mutated gene should lead to restoration of pathogenicity." In other words, reintroduction of the gene into the microbe should restore virulence in the animal model.

• "The gene, which causes virulence, must be expressed during infection."• "Immunity must be protective.“• For many pathogenic microorganisms, it is not currently possible to apply

molecular Koch's postulates to a gene in question. Testing a candidate virulence gene requires a relevant animal model of the disease being examined and the ability to genetically manipulate the microorganism that causes the disease. Suitable animal models are lacking for many important human diseases. Additionally, many pathogens cannot be manipulated genetically.

Spectrum of virulence

Poliomyelitis（脊髓灰质炎） in a child0.1-1% of infections are clinically apparent

Rubella（风疹）50% of infections are clinically apparent

Rabies（狂犬病）100% of infections are clinically apparent

The iceberg concept of infectious disease

asymptomatic infection

classical clinical disease

less severe disease

1. Transmissibility2. Adherence to host cells3. Invasion of host cells and tissue4. Evasion of the host immune system 5. Toxigenicity

A bacterium may cause diseases by

1. Destroying tissue (invasiveness)

2. Producing toxins (toxigenicity)

3. Stimulating overwhelming host immune responses

Characteristics of Pathogenic Bacteria

Pathological Mechanisms of Bacterial Infections

1. Bacteria-mediated Pathogenesis

2. Host-mediated Pathogenesis

3. Bacterial virulence factors

=> bacterial factors causing diseases

Adopted from Samuel Baron “Medical Microbiology”

Bacterial Virulence Mechanisms

Bacterial virulence factorsAdhesins

Pili (fimbriae)Nonfimbrial adhesins

Invasion of host cellsTissue damage

Growth byproductsTissue-degrading enzymesImmunopathogenesis

ToxinsExotoxins (cytolytic enzymes and A-B toxins); enterotoxins; superantigens;endotoxin and other cell wall components

Antiphagocytic factorsIntracellular survivalAntigenic heterogeneity

Antigenic variationPhase variation

Iron acquisitionSiderophores Receptors for

iron-containing molecules

Resistance to antibiotics

Encapsulation (Inhibition of phagocytosis and serum bactericidal effect)

Antigenic mimicryAntigenic maskingAntigenic or phase variationIntracellular multiplicationEscape phagosomeInhibition of phagolysosome fusionResistance to lysosomal enzymesProduction of anti-immunoglobulin proteaseInhibition of chemotaxisDestruction of phagocytes

Microbial defenses against host immunologic clearance

Mechanisms for escaping phagocytic clearance and intracellular survival

Mechanisms for escaping phagocytic clearance and intracellular survival

Mechanisms for escaping phagocytic clearance and intracellular survival

Steps in successful infection

• Sex comes before disease– acquire virulence genes

• Sense environment

– and Switch virulence genes on and off

• Swim to site of infection

• Stick to site of infection

• Scavenge nutrients– especially iron

• Survive stress

• Stealth– avoid immune system

• Strike-back– damage host tissues

• Subvert– host cell cytoskeletal and

signalling pathways

• Spread– through cells and organs

• Scatter

Bacterial Sexacquiring virulence genes

• Bacteria have three ways of exchanging DNA– Transformation

• cells take up naked DNA

– Transduction • phages carry DNA

– Conjugation• cells mate through

specialised appendages

Bacterial SexMobile genetic elements

• Transposons– ST enterotoxin genes

• Virulence Plasmids– e.g. TTSSs in Shigella,

Yersinia; toxins in Salmonella, E. coli, anthrax

• Phage-encoded virulence– e.g. botulinum toxins,

diphtheria toxin, shiga-like toxin (linked to lysis), staphylococcal toxins, TTSS substrates in Salmonella.

Bacterial SexPathogenicity Islands

• Concept originated from study of uropathogenic E. coli strains

• Defining Features – Carriage of (many) virulence genes– Presence in pathogenic versus non-pathogenic

strains– Different G+C content from host chromosome– Occupy large chromosomal regions (10-100 Kb)– Compact distinct genetic units, often flanked by DRs,

tRNAs, ISs– Presence of (cryptic) mobility genes– Unstable, prone to deletion

Bacterial SexPathogenicity Islands

• often encode secretion systems– LEE region in EPEC– Spi1, Spi2 in Salmonella– Cag in H. pylori

• can also encode adhesins, siderophores, toxins– Uropathogenic E. coli (Pai I, II, IV, V)– Yersinia spp. (HPI)– V. cholerae (VPI or TCP-ACF element)

Sense environment• Bacteria can sense changes in environment

– e.g. in temperature, nutrient availability, osmolarity, cell density (“quorum sensing”).

• In simplest cases, change in intracellular concentration of ion linked directly to gene expression– e.g. fall in intra-cellular iron levels triggers de-repression of

diphtheria toxin gene • In more complex cases, sophisticated signal

transduction cascades allow bacteria to regulate gene expression in response to environmental cues– the pathogen as an information processor

Switch virulence factors on and offA multi-layered hierarchy

• Changes in DNA sequence– Gene amplification– Genetic rearrangements

• e.g. Hin flip-flop control of flagellar phase variation

• Transcriptional Regulation– Activators and Repressors

(helix-turn-helix motif)– mRNA folding and stability

• Translational Regulation• Post-translational

Regulation– Stability of protein,

controlled cleavage– Covalent modifications

• e.g. phosphorylation in two-component sensor-regulator systems

Swim• Many bacterial pathogens

are motile– Enterics, Campylobacter,

Helicobacter, spirochaetes• Motility crucial for

virulence in some cases• Usual organelle of

motility=flagellum• Variants

– Twitching motility– Swarming

Stick• To avoid physical and

immunological removal, bacteria must adhere to– cell surfaces and

extracellular matrixe.g. in respiratory, gastrointestinal and genitourinary tracts

– solid surfacese.g. teeth, heart valves, prosthetic material

– other bacteria

• Direct interaction• Molecular bridging via

e.g. fibronectin• Adherence often

combined with manipulation of host cell signalling and cytoskeleton– Invasion– Intimate adherence

Stick• Common adherence mechanisms

– Capsules and slime– Biofilm formation

• Gram-positive adhesins– MSCRAMMs (microbial surface components

recognizing adhesive matrix molecules), e.g. protein A

– Fimbriae• Gram-negative adhesins (CHO and protein

receptors)– Fimbriae, Afimbrial adhesins (FHA, Pertactin etc.)– Outer Membrane Proteins – Types III-IV secretion

Stick

Scavenge nutrientse.g. iron

• Free iron levels very low in body fluids– Acute phase response causes further drop – Iron overload increases susceptibility to infection

• Many different bacterial systems for scavenging iron– Siderophores chelate available iron & transport it into bacteria– Iron can be scavenged direct from host iron-binding proteins, e.g by

lactoferrin-binding proteins– Often co-ordinately regulated e.g. by fur locus in E. coli– Some pathogens avoid the problem by cutting out need for iron, e.g.

Treponema pallidum• Iron used to regulate aggressive virulence factors

– Diphtheria toxin (DtxR repressor)– Shiga-like toxin– Pseudomonas aeruginosa exotoxin A

Survive Stress

• In addition to nutrient-limitation stress, pathogens face many other stresses– Acid stress within stomach– Heat shock during fever– Oxidative stress within phagocytes

• Stress response proteins, such as chaperonins, feature as immunodominant antigens

• Detoxification proteins play a role in virulence, e.g. periplasmic Cu,Zn-superoxide dismutases

• Infectious dose for enteric pathogens much lower in achlorhydria (no need to overcome acid stress)

Stealthavoid immune system

• IgA proteases– metalloproteases active against IgA

• Immunoglobulin-binding proteins– e.g. protein A of S. aureus

• Resist complement, opsonisation – Capsule (usually polysaccharide)– Lipopolysaccharide– Surface proteins and OMPs

• Antigenic mimicry– e.g. sialic acid capsule of group B meningococcus

Stealthavoid immune system

• Antigenic or phase variation– Involves surface structures

such as proteins, LPS, capsules

– Variety of mechanisms• slip-strand mispairing• flip-flop• cassettes

• Adopt cryptic niche– inside phagocytes– in biofilm

67700 67710 67720GAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAATGAAGTGCATTTAACTTGGGGGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT****GGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT***GGGGGGGGGGTAATGAAGTGCATTTAACTT**GGGGGGGGGGGTAATGAAGTGCATTTAACTT*GGGGGGGGGGGGTAAT

Homopolymeric tract in Campylobacter jejuni

Strike-backDamage host tissues

• Endotoxin• Exotoxins

– Toxins acting on cell membranes– Toxins active inside cells– Superantigens

Endotoxin of Gram-negatives

cytopl. mem.

peptidoglycan

outer mem.

Gram-negative

cell

Lipid A Core polysaccharide

O sidechain

The toxic partHelps solubilise Lipid A Somatic antigen

Lipopolysaccharide(LPS)

Strike-backEndotoxin

• Actions of Endotoxin – Pyrogenicity– Leucopenia then leucocytosis– Hypotension

• “Gram-negative Shock”• Life-threatening complication of septicaemia• e.g. in meningococcal infection, in ITU or oncology patients• Endotoxic shock seen with dirty intravenous equipment

• Most of the effects of endotoxin are mediated by tumour necrosis factor– Attempts at therapy using anti-endotoxin or anti-TNF

antibodies

Strike-backMembrane-Damaging Exotoxins

• Many bacterial toxins form pores in eukaryotic cell membranes, producing oligomeric rings, e.g. – streptolysin O of

Streptococcus pyogenes– listeriolysin of Listeria

monocytogenes– alpha-toxin of S. aureus

• Other toxins, such as phospholipases, degrade components of the membrane– e.g. Clostridium perfringens

alpha toxin

LYSIS

Strike-backToxins active inside cells

• Toxins often consist of translocation and binding B subunit that delivers the active A subunit into the host cell cytoplasm

• Example of AB toxin: diphtheria toxinan ADP-ribosyltransferase

AB5 Toxins

Subvert

• inject proteins into host cells to subvert the cytoskeleton and signal-transduction pathways: – manipulating (e.g. Rho GTPases and the

cytoskeleton) to induce membrane ruffling and bacterial invasion

– preventing uptake by phagocytic cells, e.g. Yersinia spp. and Pseudomonas spp.

– remaining within a vacuole by manipulating host cell vesicular transport and endocytosis

Spread

…through cells and organs:• within macrophages, e.g.

in typhoid• through blood (need to be

complement-resistant)• within cells

– actin-based motility of Listeria monocyogenes, depends on ActA protein.

ScatterTransmission, virulence and evolution

• Established dogmas– balanced

pathogenicity– being too virulent is no

good– high virulence is a sign

of recent emergence of a pathogen

– pathogens evolve towards symbiosis

• Counter-arguments– Where pathogens rely on spread

through biting arthopods, high bacteraemias advantageous

– Where pathogens rely on shedding into water, highest possible shedding rates good for pathogen

– Where pathogens cause incidental disease (e.g. Legionella) no selective pressure towards low virulence

– Virulence as a local adaptation (why meningitis?)

– Bad vaccines and effect on virulence

Summary• Spectrum of virulence

– Commensals– Opportunistic pathogens– Obligate pathogens

• Difficulties in linking pathogen to disease– Koch’s postulates– Molecular Koch’s

postulates

• Multi-dimensional view of virulence

• Sex • Sense • Switch• Swim• Stick• Scavenge • Survive stress• Stealth• Strike-back • Subvert• Spread • Scatter

Home Work

1. Name at least 3 ways bacterial pathogens can evade host defence.

2. What is endotoxin? What is exotoxin?

3. Why both escaping and overly stimulating immune system are bad for the host being infected?