Tallinn University of TechnologyFaculty of Science

Department of Gene TechnologyChair of Molecular Biology

YTM70LTKaur Jaanson 041287

Analysis of BDNF-BAC transgenic miceand cell lines

Masters Thesis

SupervisorsIndrek Koppel, MSc

Tõnis Timmusk, PhD

Tallinn2009

Autorideklaratsioon

Kinnitan, et olen koostanud antud lõputöö iseseisvalt ning seda ei ole kellegi teisepoolt varem kaitsmisele esitatud. Kõik töö koostamisel kasutatud teiste autorite tööd,olulised seisukohad, kirjandusallikatest ja mujalt pärinevad andmed on töös viidatud.

4. juuni 2009 Kaur Jaanson

i

Contents

1 Literature overview 11.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.2 BDNF gene structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

1.2.1 Rodent BDNF gene structure . . . . . . . . . . . . . . . . . . . 11.2.2 Human BDNF gene structure . . . . . . . . . . . . . . . . . . . 2

1.3 BDNF promoters and cis-regulatory elements . . . . . . . . . . . . . . 31.4 BDNF receptors and signaling pathways . . . . . . . . . . . . . . . . . 41.5 Physiological roles for BDNF . . . . . . . . . . . . . . . . . . . . . . . 51.6 BDNF association with diseases . . . . . . . . . . . . . . . . . . . . . . 61.7 Transgenic mouse models and cell lines used for studying BDNF gene

regulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

2 Aims of the thesis 10

3 Materials and Methods 113.1 Kainic acid treatment and RT-PCR . . . . . . . . . . . . . . . . . . . . 113.2 Transgene copy estimation in monoclonal cell lines . . . . . . . . . . . . 113.3 Genome Walking of transgene integration flanking sites . . . . . . . . . 133.4 Cell line maintenance . . . . . . . . . . . . . . . . . . . . . . . . . . . . 143.5 Flourescent in situ hybridisation . . . . . . . . . . . . . . . . . . . . . . 14

3.5.1 Slide preparation and pretreatment . . . . . . . . . . . . . . . . 143.5.2 Probe labeling and hybridisation . . . . . . . . . . . . . . . . . 153.5.3 Probe detection . . . . . . . . . . . . . . . . . . . . . . . . . . . 16

4 Results and discussion 174.1 Regulation of human BDNF-EGFP and rat BDNF-lacZ mRNA expres-

sion in transgenic mouse lines by neuronal activity . . . . . . . . . . . . 17

ii

4.2 Analysis of transgene integration and integrity in BDNF-BAC transgenicmouse lines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

4.3 Transgene copy number analysis in different rBDNF-hRluc-egfp cell lines 22

Summary 24

Kokkuvõte 25

Acknowledgements 27

Supplementary 28

References 29

iii

Abbreviations

BAC Bacterial Artificial Chromosome

BDNF Brain-derived neurotrophic factor

CaRF Calcium response factor

CaRE1/2/3 Calcium responsive element 1/2/3

CRE cAMP response element

CREB cAMP response element binding protein

CAT Chloroamphenicol acetyl transferase

DNA Deoxyribonucleic acid

EGFP enhanced green fluorescent protein

GABA gamma-aminobutyric acid

GFP green fluorescent protein

HPRT hypoxanthine phosphoribosyltransferase

hRluc humanized Renilla luciferase

KA kainic acid

MeCP2 Methyl CpG binding protein 2

MAP Mitogen-activated protein

MEF2 myocyte enhancer factor-2

NGF Nerve growth factor

iv

NRSE Neuron-restrictive silencing element

NRSF Neuron-restrictive silencing factor

NT-3 Neurotrophin-3

NT-4/5 Neurotrophin-4/5

NMDA N-methyl-D-aspartic acid

p75NTR p75 neurotrophin receptor

PBS phosphate buffered saline

PI3 Phosphoinositide 3

PLC-g phospholipase C gamma

PCR polymerase chain reaction

RT-PCR reverse transcription-polymerase chain reaction

RNA ribonucleic acid

SDS sodium dodecyl sulphate

Trk tropomyosin related kinase

proBDNF uncleaved BDNF precursor protein

UTR Untranslated region

USF1/2 Upstream stimulatory factor 1/2

YAC Yeast Articicial Chromosome

v

1 Literature overview

1.1 Introduction

Brain-derived neurotrophic factor (BDNF) belongs to a family of small secreted pro-teins called neurotrophins that have important role in development and functioning ofvertebrates neural system. In addition to BDNF, neurotrophin family includes nervegrowth factor (NGF), neurotrophin-3 (NT-3) and neurotrophin-4/5 (NT-4/5). BDNFwas first purified from pig brain in 1982 (Barde et al., 1982) and has been shown tohave survival and growth promoting effects on several neuron populations in central andperipheral nervous system (Binder and Scharfman, 2004). Due to alteration of BDNFmRNA expression in several pathologies like Alzheimer’s (Narisawa-Saito et al., 1996),Huntington’s (Ferrer et al., 2000; Spires et al., 2004) and Parkinson’s disease (Howellset al., 2000), mood disorders (Dias et al., 2003) and epilepsy (Ernfors et al., 1991;Isackson et al., 1991), studies of BDNF gene structure and regulation are of greatclinical importance.

1.2 BDNF gene structure

1.2.1 Rodent BDNF gene structure

The mouse and rat BDNF gene (Figure 1A) consists of eight untranslated 5’ exons andone 3’ exon encoding the proBDNF protein. Each 5’ exon has a separate promoterand can be alternatively spliced to the 3’ protein coding exon (Timmusk et al., 1993;Aid et al., 2007). Exon II undergoes cryptic splicing producing three splice variantsof different lengths. Different usage of BDNF promoters can lead to at least elevendifferent rodent BDNF transcripts with alternative 5’ exons and a common 3’ codingexon (Aid et al., 2007). In addition, tripartite transcript that contains both 5’ exonsVII and VIII has also been described (Liu et al., 2006). The repertoire of differenttranscripts is also expanded by the usage of two different polyadenylation signals in the3’ exon that lead to transcripts with different 3’ UTR lengths (Timmusk et al., 1993).

1

I II III IV VVh VI VII VIII VIIIh IX

a b c d

ATG

ATG

ATG

TAG

B) Human BDNF gene structure

ATG

ATG

TAG

I II III IV V VI VII VIII IX

A) Rodent BDNF gene structure

Figure 1: Rodent (A) and human (B) BDNF gene structures. White boxes show exons of BDNFgene, protein coding sequences are marked with gray boxes, possible translation start sites have beenshown with ATG-s, arrows indicate transcription start sites. Rodent BDNF gene structure has beenadapted from Aid et al. 2007 and human BDNF gene structure from Pruunsild et al. 2007.

The function of 5’ non-coding exons is not well understood, but it has been suggestedthat the usage of different 5’ non-coding exons can influence the stability and translationefficiency of mRNA (Timmusk et al., 1993). Exon I contains an additional putativetranslation initiation codon (in-frame with the start codon in exon IX) that lies infavorable context for translation initiation. However, usage of this start codon has notbeen shown.

1.2.2 Human BDNF gene structure

The human BDNF gene consists of 11 exons (Figure 1B). Nine promoters direct tissuespecific expression of transcripts containing exons I, II, III, IV, V, Vh, VI, VII and IXas 5’ exons. Exons VIII and VIIIh are used rarely and only in combination with exonV as a 5’ exon. Exons Vh and VIIIh are human specific. Exons II, V and VI containalternative splice sites that can lead to transcripts with different 5’ UTR lengths. Theprotein coding exon IX consists of four different regions (marked as “a”, ”b”, ”c” and“d” in Figure 1B). Transcripts containing 5’ exons I-VIIIh preferentially include the “d”region only. However, in exon VI containing transcripts, region “b” can be includedadditionally. Occasionally transcription starts from the beginning of region “a” of exonIX. In those cases there is usually no splicing and all parts of exon IX are included inthe final transcript (sometimes region “c” is spliced out of transcripts that start fromthe beginning of exon IX). Exon IX also contains two different polyadenylation sitesthat lead to mature transcripts with different 3’ UTR lengths. Translation from all thetranscripts starts from start codon in the “d” region of exon IX. Exons I, VII and VIIIcontain an additional in-frame ATG that could be used to synthesize prepro-BDNF

2

protein with a longer N-terminus. However, usage of these these start-codons has notbeen shown in vivo (Pruunsild et al., 2007).

The human BDNF gene locus also contains untranslated antisense RNA gene, an-tiBDNF, which spans ~191kb (Liu et al., 2005; Pruunsild et al., 2007). To date, tendifferent exons of antiBDNF gene have been described. Exons 1-4 are situated down-stream of BDNF coding exon. Exon 5 is complementary to the regions “c” and “d”of BDNF exon IX and exon 6 is partially complementary to the region “a” in exonIX. The rest of the antiBDNF exons are located in the intronic regions of the BDNFgene. Majority of the transcripts transcribed from antiBDNF gene include exons 5and 6. All antiBDNF transcripts are transcribed from one promoter. Existence ofBDNF/antiBDNF dsRNA duplexes in human brain have also been shown that maynegatively regulate BDNF gene expression on post-transcriptional level (Pruunsild etal., 2007).

1.3 BDNF promoters and cis-regulatory elements

Regulation of transcription from different BDNF promoters has been shown to be com-plex involving neural activity dependent transcription.

It has been shown that differential expression of BDNF transcripts in response toneuronal activity is associated with the mode of Ca2+ entry into the cell (Poulsen et al.,2004; Tabuchi et al., 2000). This differential transcription activation is probably dueto many regulatory elements that mediate Ca2+ dependent transcription from differentBDNF promoters. Promoter I has overlapping CaRE2 and CaRE3 sites which conferCa2+ dependent transcription through binding of upstream stimulatory factors (USF1 and 2) and cAMP response element binding (CREB) protein respectively. Since thetranscription factor binding sites are overlapping, a competitive binding of USF1/2 orCREB could control the expression from promoter I depending on different Ca2+ depen-dent signaling events in neurons (Tabuchi et al., 2002). BDNF promotor IV containsthree Ca2+ responsive elements CaRE1, CaRE2 and CaRE3/CRE, binding transcrip-tion factors CaRF (Tao et al., 2002), USF1/2 (Chen et al., 2003b) and CREB (Taoet al., 1998) respectively. It has been suggested that these three transcription factorswork in cooperation to confer neuronal specific transcription activation in response toCa2+ influx (Tao et al., 2002). Ca2+ dependent transcription regulation is also medi-ated by MeCP2. MeCP2 is a global transcription repressor which binds selectively tomethylated CpGs at BDNF promoter IV. Ca2+ entry into the cell causes the calcium-dependent phosphorylation and subsequent release of MeCP2 from promoter, leading toactivation of BDNF transcription from promoter IV (Chen et al., 2003a). Promoter IV

3

also contains a binding site for transcription factor NF-κB which is activated throughNMDA signaling and conveys neuroprotective effects on neurons (Lipsky et al., 2001).Binding site for transcriptional repressor hHLHB2 is situated between CaRE3/CRE andNF-κB binding sites within promoter IV. This transcription factor is released from itsbinding site in response to NMDA receptor activation and enhances binding of CREBand NF-κB to their sites (Jiang et al., 2008). Transcription factor MEF2, which is asso-ciated with activity dependent synapse development, regulates BDNF transcription viaits binding site ~6.5kb upstream of promoter I (Flavell et al., 2008). Activity dependenttranscription from BDNF promoters I and VI is also conferred by transcription factorNpas4 which regulates development of GABAergic synapses (Lin et al., 2008).

Neuron-restrictive silencing element (NRSE), binding a transcriptional repressorneuron-restrictive silencing factor (NRSF), is located in the intron region between theexons I and II. NRSE is responsible for restricting BDNF expression to neural cellsduring organism development (Ballas et al., 2005) and is also important for controllingexpression from BDNF promoters I and II in the brain (Timmusk et al., 1999).

BDNF gene may also be regulated by distal genomic elements like enhancers. Trans-genic Timo mice, where transgene insertion caused deletion in a conserved genomicregion 857kb upstream of BDNF gene, have significantly lower BDNF expression andshow signs of hyperphagia and obesity. This region contains four highly conserved el-ements, some of which can enhance the activity of BDNF basic promoters (Sha et al.,2007). The existence of a distal regulatory region is further supported by a humancase report where de novo chromosomal inversion with break point ~17kb downstreamof the conserved region described in Timo transgenic mice was shown to cause similarphenotype (Gray et al., 2006).

1.4 BDNF receptors and signaling pathways

BDNF is synthesized initially as pro-neurotrophin (MW ~30kDa), then goes throughintracellular trafficking and is processed to its mature form (MW ~14kDa) intracel-lularily by pro-hormone convertases in trans-Golgi network (Seidah et al., 1996) orextracellularly by plasmin (Pang et al., 2004).

Mature neurotrophins bind to tropomyosin related kinase receptors (trk-s). BDNFexhibits greatest binding affinity to tropomyosin related kinase B (trkB). Binding ofmature BDNF induces receptor dimerization and kinase activation which in turn causesautophosphorylation of tyrosine residues on cytoplasmic part of trkB receptor leadingto creation of binding sites for intracellular proteins. This in turn leads to activationof intracellular signaling cascades Ras/MAP, PI3-kinase and PLC-g1 and their down-

4

stream effectors which promote neuronal survival and differentiation. One group ofdownstream effectors are Rho family of GTPases that control organization of the cy-toskeleton, cell motility and growth cone behavior. Generation of P3-phosphorylatedphosphoinositides by PI3-kinases lead to activation of several intracellular pathwaysthat promote neuronal survival and differentiation. As a result of their interactionswith receptors, BDNF mediates local actions in neuronal cell periphery by affectinggrowth cone behavior and synaptic function. After being retrogradedly transportedto cell soma in trkB-BDNF complex containing endocytic vesicles, BDNF activatessignaling pathways that control cell survival and gene expression (Reichardt, 2006).

Neurotrophins, including BDNF, are also able to bind to p75 neurotrophin receptor(p75NTR) with uncleaved pro forms showing much greater binding affinity. p75NTR acti-vation may convey apoptotic or survival and proliferation signals to cells via activationof Jun kinase pathway or transcription factor NF-κB, respectively (Dechant and Barde,2002). In addition to interacting with neurotrophins directly, p75NTR receptor can alsoconfer increased ligand specificity and increased affinity to trk receptors (Bibel et al.,1999).

1.5 Physiological roles for BDNF

BDNF has many important roles in developing and mature vertebrate nervous sys-tem. During development, survival and differentiation of several neuron populationsin central and peripheral nervous system are dependent on BDNF. BDNF promotesgrowth and survival of dorsal root ganglion cells (Acheson et al., 1995), hippocam-pal and cortical neurons (Huang and Reichardt, 2001). Homozygous BDNF null micehave disruptions in development of peripheral nervous system with heavy losses ofneurons in dorsal root, vestibular and nodose-petrosal ganglia (Huang and Reichardt,2001) and also in development of central nervous system with increased apoptosis ofcerebellar granule cells and aberrant dendritic arborization patterns of Purkinje cells(Schwartz et al., 1997). The inhibiting or enhancing effect of BDNF on dendriticgrowth can also be seen on different cortical neuron populations (McAllister et al., 1995;McAllister et al., 1997). In addition, BDNF contributes to the activity-dependent de-velopment of the ocular dominance columns in the visual cortex (Cabelli et al., 1995).Besides supporting cell survival BDNF can promote cell death of specific neuronal pop-ulations in peripheral and central nervous system (Binder and Scharfman, 2004).

In adult organism BDNF have been implicated in synaptic plasticity, regulation ofbody weight and pain sensitisation. It has been shown that BDNF is necessery for long-term potentiation in hippocampal (Tyler et al., 2002; Hall et al., 2000; Alonso et al.,

5

2002; Korte et al., 1995) and parietal cortex neurons (Alonso et al., 2005). Expressionof BDNF in ventromedial hypotalamus has been associated with energy balance (Xu etal., 2003), finding that is supported by the fact that heterozygous BDNF null mice andhumans with only one functional BDNF copy show signs of hyperphagia and obesity(Lyons et al., 1999; Kernie et al., 2000; Gray et al., 2006; Han et al., 2008). BDNFis also associated with modulation of pain sensitisation in animal studies (Kerr et al.,1999) and human case reports (Gray et al., 2006).

1.6 BDNF association with diseases

Due to its importance as a survival factor of different neuron populations in developingand mature brain, BDNF is associated with several neurodegenerative diseases of thenervous system.

In Alzheimer’s disease, levels of BDNF have been shown to be reduced in entorhinalcortex and hippocampus, two regions associated with the disease (Narisawa-Saito etal., 1996; Connor et al., 1997; Hock et al., 2000). BDNF administration in rodent andprimate models of Alzheimer’s disease has been shown to have neuroprotective effectson affected neuron populations and it is therefore considered as a therapeutic agent toreduce neurodegeneration (Nagahara et al., 2009).

Decrease of BDNF mRNA expression in substantia nigra (Howells et al., 2000)and lower levels of BDNF protein in cerebrospinal fluid of Parkinson’s disease patients(Salehi and Mashayekhi, 2009) also hints that loss of BDNF-s neuroprotective effectsmay be associated with this neurodegenerative disorder.

BDNF is also affiliated with Rett syndrome in which the reduced levels of BDNF,due to the mutation in MeCP2 gene, have been linked with faster disease progressionin mouse model of the disease (Chang et al., 2006).

Reduced levels of BDNF protein in striatum of patients and mouse models of Hunt-ington’s disease have also been noted (Ferrer et al., 2000; Spires et al., 2004). It has beenshown that wild-type huntingtin upregulates BDNF production by binding BDNF re-pressor protein NRSF and sequestering it to cytoplasm. In Huntington’s disease, mutanthuntingtin does not bind NRSF protein leading to reduced levels of BDNF protein beingexpressed and transported to striatal neurons by cortical neurons. As a result, inade-quate trophic support for striatal neurons causes their apoptosis (Zuccato et al., 2001;Zuccato et al., 2003; Zuccato et al., 2005).

In addition to neurodegenerative diseases, BDNF has been associated with neu-ropsychiatric disorders and epilepsy. It has been hypothesized that BDNF may beimplicated in bipolar disorder (Tsai, 2004). Lower levels of BDNF have been as-

6

sociated with depression (Altar, 1999) and antidepressants have been shown to in-crease BDNF mRNA (Dias et al., 2003) and protein (Chen et al., 2001) in the brain.Role of BDNF in affecting behavior is further supported by the fact that heterozy-gous BDNF null mice show increased intermale agressiveness (Lyons et al., 1999;Kernie et al., 2000) and in humans, loss of one functional copy of BDNF leads to hy-peractivity (Gray et al., 2006). BDNF expression is also upregulated in hippocampusin response to epileptic seizures (Ernfors et al., 1991; Isackson et al., 1991) and het-erozygous BDNF null mice show decreased seizure susceptibility (Kokaia et al., 1995;Barton and Shannon, 2005).

1.7 Transgenic mouse models and cell lines used for studyingBDNF gene regulation

Several transgenic mice models and cell lines have been used in studying regulation ofBDNF and its effects on different neuronal populations. Plasmid based BDNF promoterconstructs fused to the chloroamphenicol acetyl transferase (CAT) reporter gene wereused to study genomic regions responsible for mediating tissue-specific, axotomy- andneuronal activity-induced BDNF expression from rat BDNF promoters in transgenicmice (Timmusk et al., 1995). The same constructs were used to study the effects ofhuntingtin on different rat BDNF promoters (Zuccato et al., 2001).

Plasmid based rat BDNF promoter constructs using firefly luciferase reporter gene(Fluc) have been used to study Ca2+ responsive elements in promoters I and IV bytransfection into rat cortical neurons (Tao et al., 1998; Tabuchi et al., 2002; Chen etal., 2003b; Tao et al., 2002). Plasmids used in these studies contained promoter regionsof exons I and IV with deletions and mutations to pinpoint the binding sites for Ca2+

responsive factors.Plasmid based constructs with prepro BDNF-green fluorescent protein (GFP) fusion

gene have been used to study intracellular localisation, transport and synaptic releaseof BDNF-GFP fusion protein in living cells (Haubensak et al., 1998; Kohara et al.,2001; Hartmann et al., 2001). The subcellular kinetics and localisation of BDNF-GFPcontaining secretory vesicles was shown to be similar to endogenous BDNF (Haubensaket al., 1998) and futher studies have shown that BDNF-GFP protein is released atsynaptic sites in neuronal activity dependant manner (Kohara et al., 2001; Hartmannet al., 2001).

Small plasmid-based constructs traditionally used for generating transgenic animalsare limited in their size and therefore usually do not contain all the regulatory elements

7

A) hBDNF-EGFP

B) rBDNF-lacZ

C) rBDNF-hRluc-EGFP

84kb 15kb

13kb 144kb

13kb 144kb

lacZ

hRluc

EGFP

BDNF cod

EGFP

Figure 2: BAC constructs used in creating transgenic animal and cell lines. (A) hBDNF-EGFP con-struct contains hBDNF-EGFP fusion gene under the control of the human BDNF regulatory regions.(B) rBDNF-lacZ construct contains lacZ reporter gene under the control of rat BDNF regulatory re-gions. (C) rBDNF-hRluc-EGFP construct contains humanized renilla luciferase EGFP fusion reportergene under the control of rat BDNF regulatory regions (Aid, MSc thesis TUT 2005)

needed to convey faithful tissue specific expression pattern of gene under study. Thisproblem can be circumvented using large artificial chromosome type vectors such asyeast artificial chromosome (YAC), bacterial artificial chromosome (BAC) and P1 arti-ficial chromosome (Giraldo and Montoliu, 2001). Recently several transgenic mice lineswith YAC containing 145kb human BDNF locus with EGFP coding sequence in place ofthe BDNF coding exon were generated. The YAC contained the human BDNF flankedby genomic regions 45kb upstream of the exon I and 35kb downstream of the codingexon. One of the five transgenic lines largely recapitulated tissue specific transgeneexpression (Guillemot et al., 2007).

Recently, we have created transgenic mouse lines using bacterial artificial chromo-somes (BAC-s) containing human and rat BDNF genes with large genomic flankingregions. BAC-s were purchased from Chori BACPAC Resources. BAC constructs weremodified by homologous recombination in E. coli and used to generate trangenic miceby pronuclear injection. hBDNF-EGFP BAC was constructed by using BAC cloneRP11-651M4 containing the human BDNF gene together with a genomic region span-ning from 84kb upstream of BDNF exon I to 15kb downstream of BDNF 3’ UTR, whichwas modified by replacing BDNF coding sequence with human BDNF-enhanced greenfluorescent protein (EGFP) fusion reporter gene. Generation of transgenic mice yieldedfour transgenic mouse lines, out of which C3 line showed hBDNF-EGFP mRNA expres-sion pattern which was closest to the expression pattern of human and mouse BDNFmRNA in brain regions and non-neural tissues. rBDNF-lacZ BAC was constructed by

8

using BAC clone CH230-106M15 containing the rat BDNF gene together with a ge-nomic region spanning from 13kb upstream of BDNF exon I to 144kb downstream ofBDNF 3’UTR, which was modified by replacing BDNF coding sequence with the lacZreporter gene. Only one transgenic founder line (H6) was established. This transgenicline also showed rBDNF-lacZ mRNA expression pattern which highly resembled en-dogenous mouse BDNF mRNA expression pattern. Both generated transgenic mouselines could be used to study BDNF gene regulation in vivo.

We have also generated several cell lines by using rBDNF-hRluc-EGFP BAC con-structed from clone CH230-106M15 with rat BDNF locus where BDNF coding regionwas replaced with humanised Renilla luciferase (hRluc)-EGFP fusion reporter gene.All cell lines obtained showed the expression of hRluc-EGFP fusion reporter under thecontrol of the rat BDNF promoter regions.

9

2 Aims of the thesis

The aims of this thesis were:

• to study neuronal activity dependent transcription in transgenic mouse lines con-taining hBDNF-EGFP fusion protein under the control of human BDNF locusand lacZ reporter gene under the control of rat BDNF locus

• to analyse transgene integration status in the genomes of hBDNF-EGFP andrBDNF-lacZ transgenic mice

• to analyse transgene copy number and maintenance in transgenic rBDNF-hRluc-EGFP cell lines

10

3 Materials and Methods

3.1 Kainic acid treatment and RT-PCR

Kainic acid (30mg/kg of body weight) or phosphate-buffered saline (PBS) was injectedintraperitoneally to adult transgenic mice. Mice were sacrificed 3 hours after treat-ment and hippocampus and cortex were dissected. Total RNA was extracted fromhippocampus and cortex using Ambion Ribopure RNA Extraction Kit according tothe manufacturers instructions. Extracted RNAs were treated with DNase (AmbionTURBO DNA-free Kit). 2mg of total RNA was used for first-strand synthesis usingSuperScript First-Strand synthesis system (Invitrogen) according to manufacturer’s in-structions. Traditional PCR and qPCR analysis was used to assess the effect of kainicacid treatment on the expression of different BDNF transcripts in transgenic animals.PCR amplification of transgenic and endognous BDNF transcripts was carried out withHotFire DNA polymerase (Solis Biodyne, Estonia) according to manufacturers instruc-tions. qPCR reactions were performed with Eurogentec qPCR Core kit (SYBR GreenI, No ROX) using HotFire polymerase (Solis BioDyne, Estonia). Praimer pairs usedfor detection of different transcripts by qPCR are shown in Table 1. qPCR reactionswere run on Roche LightCycler 2.0 for 40 cycles using appropriate annealing tempera-ture, melting curve analysis was performed to confirm the amplification of the specificproduct. 1/40 of the volume of reverse transcriptase reaction was used as template(0.5ml) in PCR and qPCR reactions, all qPCR reactions were performed in triplicate.Relative differences in gene expression between kainic acid treated and control animalsamples were calculated using the 44Ct method by normalizing the Ct values for eachtranscript to the Ct values of the housekeeping gene HPRT1.

3.2 Transgene copy estimation in monoclonal cell lines

To estimate transgene copy number in different monoclonal transgenic cell lines byqPCR, standard curve was generated into HeLa genomic DNA by adding different

11

Transcript Sense AntisenseqPCR normalizer HPRT mr-HPRT1_RT_s mr-HPRT_RT_as

Mouseendogenousexpression(qPCR)

mBDNF total mr-BDNF-RT-cod1-F mr-BDNF-RT-cod1-RmBDNF-I m-BDNF-RT-I-s m-BDNF-RT-IXcod-asmBDNF-IV m-BDNF-RT-IVs m-BDNF-RT-IXcod-asmBDNF-VI mr-BDNF-EXON-VI-F m-BDNF-RT-IXcod-asmBDNF-eIX mIX mrBDNFIXARACEas

Mouseendogenousexpression(PCR)

mBDNF-I mrBDNF I s mrBDNF cod as oldmBDNF-II mrBDNF II s mrBDNF cod as oldmBDNF-III mBDNF III s mrBDNF cod as oldmBDNF-IV mrBDNF IV s mrBDNF cod as oldmBDNF-V mrBDNF V s mrBDNF cod as oldmBDNF-VI mBDNF VI s mrBDNF cod as oldmBDNF-eIX mBDNF IX s mrBDNF cod as old

hBDNF-EGFPexpression(qPCR)

hBDNF-EGFP-total EGFP_RT_s EGFP_RT_ashBDNF-EGFP-I hBDNFQpcrIs hmrQpcrAS2hBDNF-EGFP-IV hBDNFQpcrIVs hmrQpcrAS2hBDNF-EGFP-VI hBDNFQpcrVIs hBDNFQpcrAShBDNF-EGFP-eIX hBDNFQpcrIXcs hmrQpcrAS1

hBDNF-EGFPexpression(PCR)

hBDNF-EGFP-I hBDNF_IS hBDNF_IXbAS (13b as)hBDNF-EGFP-II hBDNF_IIS hBDNF_IXbAS (13b as)hBDNF-EGFP-III hBDNF_IIIS hBDNF_IXbAS (13b as)hBDNF-EGFP-IV hBDNF_IVS hBDNF_IXbAS (13b as)hBDNF-EGFP-V hBDNF_VS hBDNF_IXbAS (13b as)hBDNF-EGFP-Vh hBDNF_VhS hBDNF_IXbAS (13b as)hBDNF-EGFP-VI hBDNF_VIS hBDNF_IXbAS (13b as)hBDNF-EGFP-eIX hBDNF_IXS hBDNF_IXbAS (13b as)

rBDNF-lacZexpression(qPCR)

rBDNF-lacZ-total LacZ-RT-s LacZ-RT-asrBDNF-lacZ-I mrBDNF-I-s-lacz-RT b-gal154-as-RTrBDNF-lacZ-IV m-BDNF-RT-IVs b-gal126-asrBDNF-lacZ-VI mr-BDNF-EXON-VI-F b-gal126-asrBDNF-lacZ-eIX rBDNF-IXa-s-lacz-RT b-gal126-as

Table 1: Primer pairs used for PCR and qPCR reactions to see the effect of kainic acid treatmenton transgenic animals. See supplementary table for primer sequences.

12

Name Sequence

C3 transgenelocalisation

ch230-5p-gw-1 AGCTGAGAATTCCCTATGAAGATCCTTCch230-5p-gw-2 TCCTTCTATAGTGTCACCTAAATGTCGAch230-3pa-gw-1 TGAAGAAGGCAGTTCCACAGch230-3pa-gw-2 GAGGGCTGCTTTATCTGTGGch230-3pa-gw-3 GTCTGCCAAATCAAGCCAGT

H6 transgenelocalisation

pBACe-11365-s GGGGCACATTTCATTACCTCTTTCTCpBACe-11326-s CGGTTACGGTTGAGTAATAAATGGATGrp11-3p-gw-1 GTCCTACAATGTCAAGCTCGACCGATrp11-3p-gw-2 CTTGAGAGCCTTCAACCCAGTCAGrp11-3p-gw-3 GCGCCGGATCGATCCTTAATTAAGTCT

GenomeWalkeradaptor

Adaptor primer 1 GTAATACGACTCACTATAGGGCAdaptor primer 2 ACTATAGGGCACGCGTGGT5’-GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT-3’

N-CCCGACCA-PO2

3’-H

Adaptor primer 1 Adaptor primer 2

-5’4

Table 2: Primers and adaptor sequence used for adaptor mediated genome walking of transgeneintegration sites.

concentrations of pEGFP-C1 (Promega) plasmid corresponding to 16, 32, 64, 128 and256 copies per HeLa genome. DNA samples from different cell lines or copy numberstandards were analysed with primers specific for EGFP and trkB_11 (see Table 1).

qPCR reactions were performed with Eurogentec qPCR Core kit (SYBR Green I,No ROX) using HotFire polymerase (Solis BioDyne, Estonia). 20ng of cell line genomicDNA samples or copy number standards were used as templates in qPCR reactionswith all reactions performed in triplicate.

Copy number estimates were calculated from 4Ct values of standard curve samplesby subtracting the average of triplicate EGFP Ct values from the average trkB_11Ct values. Using the Microsoft Excel, 4Ct values for standards were plotted againstknown copy numbers of each standard. A logarithmic regression trendline and itsequation were generated to fit the slope. The trendline equation in the form of y =slope · ln(x) + yintercept was used to estimate copy numbers of samples based on thesample 4Ct value. Copy number x was calculated from sample 4Ct using the formulax = e

4Ct−yinterceptslope

3.3 Genome Walking of transgene integration flanking sites

Genome walking was used to map transgene integration sites in both transgenic mouselines using protocol described in GenomeWalker Universal Kit (Clontech Laborato-ries Inc., Cat. no. 638904) with primers and adaptor oligos ordered from Microsynth

13

(Switzerland). In short, genomic DNA of trangenic mice were digested with blunt-endrestriction enzymes AluI, EheI, ScaI, Eco32I, KspAI and SmaI, extracted with phe-nol:chlorophorm and adaptor sequence was ligated to ends of genomic DNA fragments.Nested adaptor and transgene end specific primers (Table 2) were used to amplify frag-ments from adaptor-ligated genomic DNA pools. Amplified products were separated onagarose gel, excised, purified with silica (AppliChem DNA isolation kit) and sequencedusing DYEnamic ET Terminator Cycle sequenceing kit (Amercham Biosciences).

3.4 Cell line maintenance

rBDNF-hRluc-EGFP-neo HeLa monoclonal cell lines were grown on 10 cm plates at37ºC with 5% CO2 environment using Dulbeco’s Modified Eagle’s medium (PAA) with10% fetal calf serum (PAA) and antibiotics (100mg/ml of penicillin G and 100mg/ml ofstreptomycin, Gibco). G418 antibiotic (Sigma) in concentration of 800mg/ml was usedfor transgene maintenance.

3.5 Flourescent in situ hybridisation

3.5.1 Slide preparation and pretreatment

To obtain metaphase chromosomes mitotic blocking was performed by treating thecells with 50ng/ml colcemid for 2h. Cells were harvested by mitotic shakeoff, collectedin PBS and pelleted by centrifugation at 500g for 5min. Hypotonic treatment wasperformed by resuspending cells in 10ml of 0.075M KCl for 15 min. After hypotonictreatment the cell suspension was pelleted by centrifugation at 500g for 5 min, resus-pended carefully in 1 ml of ice cold fixative (methanol:acetic acid, 3:1) and transferedto 1.5ml tubes. The cell suspensions were washed three times in ice cold fixative bycentrifuging for 2 min at 4500g, discarding the supernatant and resuspending the cellpellet carefully in fresh fixative. After last fixative wash the cells were resuspended in100-500ml of fixative and used for chromosome slide preparations or in 1.5ml of fixativeand stored at –20ºC.

To make chromosome preparations 10-20ml of each cell suspension were pipetedto two locations on precleaned microscope slide. When the slide surface had becomegrainy, the slide was placed face down into the steam of the hot water bath (75ºC) for3 sec, then dried by placing on warm metal plate.

Freshly prepared slides were chemically aged by placing slides on PCR thermocyclerwith slide griddle. 200ml of ethanol was pipeted on each slide, the slide was covered

14

with a coverslip and griddle was covered with griddle cover. Thermocycler was pro-grammed to increase the temperature to 94ºC, to keep it for 30 sec and to cool to roomtemperature. After the chemical ageing the slides were air dried.

For pretreatment with pepsin and formaldehyde, slides were first incubated in PBSfor 5min at 37ºC. For pepsin treatment 200ml of pepsin solution (100mg/ml pepsin,0.01M HCl) was pipeted on each slide, covered with coverslip and incubated in hu-mid chamber at 37ºC for 5 min. After pepsin treatment, slides were washed in PBSfor 5min at room temperature. For formaldehyde treatment slides were incubated informaldehyde solution (1% formaldehyde, 1xPBS, 50mM MgCl2) for 10 min at roomtemperature and then washed in PBS for 5 min at room temperature. After pretreat-ments the slides were dehydrated by incubating in 70%, 90% and 96% ethanol, 5mineach.

3.5.2 Probe labeling and hybridisation

FISH probes were made by nick-translation using biotin-16-dUTP (Roche) to labelhuman BDNF locus (using RP11-651M4 human BDNF BAC clone as template) anddigoxygenin-11-dUTP (Roche) to label transgene (using rBDNF-hRluc-EGFP-neo BACas template). DNase I stock solution for nick translation was prepared by dissolving3mg of DNase I (Roche) in 500ml of 0.3M NaCl2 and adding 500ml glycerol. For usein nick-translation, DNase I stock solution was diluted 500 times in cold mQ water.Nick-translation reaction was performed in 50ml volume using 1x DNA polymerase Ibuffer (Fermentas), 0.04mM of dATP, 0.04mM of dGTP, 0.04mM of dCTP, 0.008mMof dTTP, 0.04 mM of biotin or digoxygenin labeled dUTP, 20 units of DNA polymeraseI, 5ul of DNase I dilution and 1mg of BAC DNA to be labeled. Reactions were incubatedin PCR thermocycler block at 15ºC for 2h. Size of the labeled probe was checked byrunning 3ml of reaction mix on 2% agarose TAE gel, size of the probe was in the rangeof 200-700bp.

For each hybridisation 45ng of rBDNF-hRluc-EGFP-neo-dig probe and 45ng ofRP11-651M4-biotin probe were coprecipitated with 25mg of salmon sperm DNA byethanol precipitation. Probe DNA was first redissolved in 6ml of mQ and then 10ml ofhybridization buffer (50% deionized formamide, 2xSSC, 0.1M phosphate buffer, 10%dextran sulfate) was added. Hybridisation mix was denatured by heating at 75ºC for10 min and cooling on ice for 5 min.

For chromosome denaturing slides were placed on the slide griddle, 150-200ml of70% deionized formamide, 2xSSC was pipetted on each slide, covered with 22x50mmcoverslip and the slide griddle with slides were covered with griddle cover and placed on

15

the PCR thermocycler. The PCR thermocycler was programmed to gradually (1ºC/sec)heat the slide to 75ºC, to keep that temperature for 2 min and to gradually cool toroom temperature. Slides were dehydrated by rinsing in 70%, 90% and 96% ice-coldethanol 3 min each and air dried.

For hybridisation 10-15ml of labeled DNA probe in hybridization buffer was pipettedon prechosen location on each slide, covered with a 22x22mm coverslip, and sealed withrubber cement (Flora Kadrina AS). Slides were placed in humid chamber and incubatedat 37ºC over night.

3.5.3 Probe detection

After hybridisation, rubber cement was removed from slides and slides were first washedthree times in 50% formamide, 2xSSC for 5 min at 42ºC, then three times in 1xSSC for5 min at 60ºC. After last wash, slides were dried from the edges by paper towels, 200mlof blocking solution (4xSSC, 3% BSA (fraction V)) was pipeted on each slide. Slideswere covered with 22x50mm coverslips and incubated in humid chamber at 37ºC for30 min. After blocking, slides were dried from the edges by paper towels and 200ml ofdetection solution (4xSSC, 1% BSA, 0.1% Tween 20, 5ng/ul streptavidin-Cy2, 2ng/ulanti-DIG-Rhodamine) was pipeted on each slide, covered with coverslip and incubatedin humid chamber at 37ºC for 30 min. After incubation with detection solution, slideswere washed three times in 4xSSC, 0.1% Tween-20 for 5 min at 42ºC. Slides werecounterstained with 10ng/ml Hoechst 33342 in 2xSSC for 15 min at room temperatureand then washed in 2xSSC, 0.05% Tween-20 for 1 min at room temperature. Slideswere dried from the edges with paper towels and mounted in ProLong Gold anti-fadereagent (Invitrogen) and covered with 22x50mm coverslips. Slides were imaged withZeiss LSM DUO microscope. For longer periods, slides were stored in dark chamber at4ºC.

16

4 Results and discussion

4.1 Regulation of human BDNF-EGFP and rat BDNF-lacZmRNA expression in transgenic mouse lines by neuronalactivity

In my bachelors thesis I showed that transgenic mRNA expression in BAC transgenicmouse lines previously generated by our group resembles that of endogenous BDNFexpression in different tissues. To further assess the functionality of these transgeneswe analysed their ability to recapitulate induction of BDNF mRNA in response toneuronal activity. Neuronal activity dependent transcription can be tested by treatmentwith glutamate receptor agonist kainic acid which activates subclass of non-NMDAglutamate receptors (kainate receptors) and causes the rise of intracellular Ca2+ levels.Ca2+ activates transcription from different BDNF promoters in the hippocampus andcortex of adult rat brain (Zafra et al., 1990; Timmusk et al., 1993; Aid et al., 2007).

In hBDNF-EGFP C3 transgenic mouse line, kainic acid treatment induced ex-pression of transgenic transcripts similarly to endogenous mBDNF transcripts in hip-pocampus and cerebral cortex of C3 mice (Figure 3A). hBDNF-EGFP and endogenousmBDNF transcripts containing exons I, IV and 5’-extended exon IX (eIX) were notablyupregulated in the hippocampus and cerebral cortex while transcripts containing other5’ exons were less induced. Transgenic transcript containing human-specific exon Vhwas not induced by kainic acid.

Highly induced BDNF transcripts in C3 line mouse were further assayed by qPCRanalysis (Figure 3B). Transgenic hBDNF-EGFP exon I, IV and 5’ extended exon IX(eIX) transcripts and total hBDNF-EGFP mRNA and their respective endogenousmBDNF mRNAs were highly induced in hippocampus and cerebral cortex followingkainic acid treatment. No induction of exon VI containing transgenic or endogenoustranscripts was observed.

Taken together these results suggest that transgenic human BDNF gene is regulated

17

I

III

II

IVV

VI

VII

eIX

Vh

ND ND

hBDNF-EGFP mBDNF

CTR KAKA CTR

ND ND

hBDNF-EGFP mBDNF

CTR KAKA CTR I

III

II

IVV

VI

VII

eIX

Vh

Hippocampus Cortex

A)

B)

Hippocampus Cortex

transgenichBDNF-EGFP

endogenousmBDNF

transgenichBDNF-EGFP

endogenousmBDNF

Figure 3: Induction of different trangenic hBDNF-EGFP and endogenous BDNF mRNAs in responseto kainic acid in hippocampus and cerebral cortex of C3 line transgenic mice. (A) Induction ofalternatively spliced transgenic hBDNF-EGFP and endogenous mBDNF transcripts in hippocampusand cortex analysed with RT-PCR. CTR – PBS-treated mouse, KA – kainic acid treated mouse, ND –not detected. B) qPCR analysis of endogenous and transgenic transcripts containing exons I, IV, VI,eIX and total BDNF mRNA, represented as fold difference relative to PBS-treated mouse.

endogenousmBDNFtransgenicrBDNF-lacZ

endogenousmBDNFtransgenicrBDNF-lacZ

Figure 4: qPCR analysis of kainic acid induction of transgenic rBDNF-lacZ and endogenous mBDNFmRNA in the hippocampus and cerebral cortex of H6 transgenic mouse. Induction of transcriptscontaining exons I, IV, VI, eIX and total BDNF mRNA is represented as fold difference relative toPBS-treated mouse.

18

in neural activity dependent manner in transgenic C3 mice. While implicit evidencefor regulation of human BDNF mRNA expression in response to neural activity hasbeen shown before in patients with temporal lobe epilepsy (Murray et al., 2000), thisis the first time when neural activity dependent regulation of human BDNF gene hasbeen shown in vivo. The induction pattern of transgenic hBDNF-EGFP transcripts wasconsistent with previously reported induction pattern of respective mBDNF mRNAs inmouse and rat (Timmusk et al., 1993; Aid et al., 2007; Metsis et al., 1993).

In rBDNF-lacZ H6 transgenic mouse, the induction of BDNF transcripts in re-sponse to kainic acid was only assayed by qPCR (Figure 4). Induction pattern of totalrBDNF-lacZ mRNA and rBDNF-lacZ transcripts containing exons I and IV was similarto respective endogenous transcripts in hippocampus and cortex, while exon VI con-taining transcripts were less induced in response to kainic acid. Neither transgenic norendogenous 5’ extended exon IX (eIX) containing transcript was induced in responseto kainic acid.

These results show that in H6 transgenic mouse line neural activity dependent in-duction of different BDNF transcripts mostly recapitulates the induction of endogenousmBDNF transcripts (Timmusk et al., 1993; Aid et al., 2007; Metsis et al., 1993). Lack ofkainic acid mediated transcription of transgenic and endogenous transcripts containing5’ extended exon IX was unexpected. Mouse BDNF eIX transcript is normaly robustlyupregulated in response to kainic acid treatment (Aid et al., 2007). While missingregulatory elements in transgenic construct might explain the absence of transgeniceIX transcript induction, the fact that both transgenic and endogenous eIX transcriptsdid not respond to kainic acid treatment may hint that a signaling pathway mediatinginduction of eIX transcripts (but not transcripts containing exons I and IV) may bedisrupted in H6 transgenic mouse line. It would therefore be important to map anddescribe the position of transgene in transgenic mouse line.

4.2 Analysis of transgene integration and integrity in BDNF-BAC transgenic mouse lines

Genome walking was used to attempt mapping of transgene genomic insertion sites ofBAC transgenes in hBDNF-EGFP transgenic mouse line C3 and rBDNF-lacZ trans-genic mouse line H6.

Although we were unable to map transgene integration site in C3 transgenic mouseline by genome walking with primers specific for 5’ and 3’ ends of transgenic construct,this analysis it revealed that transgene had been inserted into the genome tandemly with

19

A)

B)

SP6

pBACp1

pBACp2

rp11-5

pT7

rp11-3

p

T7/rp11-3pSP6/rp11-5p

C3 wt bac(+) mQ

pBACp1/rp11-3ppBACp2/rp11-3p

C3 wt bac(+) mQ

C)

3’5’

Figure 5: Determination of tandemic integration and integrity of transgene in C3 transgenic mouseline containing hBDNF-EGFP BAC. (A) Schematic of linear BAC used for generation of transgenicmouse line. 5’ and 3’ ends are marked with yellow and red pentagons, respectively. pBACe3.6 vectoris marked with purple box. Human BDNF non-coding exons are marked with white boxes. BDNF 3’UTR is marked with white box with dashed line. hBDNF-EGFP reporter coding sequence is markedwith grey-green box. Arrows show locations of different primer pairs used to check integrity andtandemic repetition of transgene. (B) PCR verification of transgene tandemic repetition. (C) PCRanalysis of transgene end integrity. Primer pairs used are shown on figure part A. C3 – homozygousC3 line mouse; wt – wt mouse; bac (+) – hBDNF-EGFP BAC positive control, mQ – water.

PI-SceI restriction site (which was used to linearise BAC vector before microinjection)at the junction site (Figure 5A). Tandem integration and integrity of transgene endswas later also confirmed by PCR analysis with separate primers (Figure 5B-C).

Expression of transcripts from different trangenic BDNF promoters and intact tandemicjunction site suggests that at least one full copy of transgene has integrated into C3transgenic line.

Similarly to C3 transgenic line, genome walking did not reveal the transgene inte-gration site in H6 transgenic line but showed that transgene had integrated into thegenome tandemly with NotI restriction site (which was used to excise the rat BAC locusfrom vector prior to microinjection) at the junction site. Genome walking also showedthat the 3’ end of one transgenic construct was joined with inverted transgenic constructwhich had ended at about 96kb downstream of 3’ UTR of BDNF gene. PCR analysisby primers specific for different parts of transgenic construct (Figure 6A) showed thatall tested regions had integrated into the genome of H6 transgenic mouse line (Figure6C).

Because of the transcription from different transgenic BDNF 5’ exons and PCRanalysis showed that different parts of transgenic construct were incorporated into thegenome of transgenic mouse, it is very likely that at least one full-lenght and one broken

20

T7/3p97m

3pI s/as

3pIV s/as

3pV s/as

5pIII s/as

5pIV.1 s/as

C)

A)

B)

96kb

3pI s

/as

3pIV

s/as

3pV s/a

s

5pIV.1

s/as

5pIII

s/as

T7/3p9

7m

H6 wt mQ bac(+)

H6 wt mQ bac(+)

~12kb~84kb~18kb~30kb~1kb

5’ 3’

Figure 6: Determination of localisation and integrity of transgene in H6 transgenic mouse linecontaining rBDNF-lacZ BAC. (A) Schematic of linear BAC used for generation of transgenic mouseline. 5’ and 3’ ends are marked with yellow and red pentagons, respectively. Different rat BDNFnon-coding exons are marked with white boxes. BDNF 3’ UTR is marked with white box with dashedline. LacZ reporter coding sequence is marked with blue box. Arrows show locations of differentprimer pairs used to check integrity of transgene. (B) Schematic visualizing the probable placementof thee transgenic copyies as determined by the genome walking. (C) PCR analysis of transgeneintegration using primer pairs on figure part A. H6 – homozygous H6 line mouse; wt – wt mouse;bac (+) – rBDNF-lacZ BAC positive control, mQ – water.

21

0

50

100

150

200

250

1A4 1G1 2B2 3E2 3G4

Cell lines

Cop

y nu

mbe

rFigure 7: qPCR analysis of transgenic copy numbers in different transgenic rBDNF-hRluc-EGFPcell lines. Transgene copy numbers were normalized for HeLa genome using control primers specificfor trkB genomic sequence. Approximate copy numbers per cell were as follows: 1A4 – 198; 1G1 – 5;2B2 – 32; 3E2 – 71; 3G4 – 46.

copy of the rBDNF-lacZ transgene has integrated into H6 transgenic line. Possiblearrangement of transgene copies at the integration site of H6 mouse genome is depictedon Figure 6B.

Since it would be important to map the localisation of transgene integration site incase of both transgenic mouse lines, in further attempts Southern blot could be usedto check for the intactness of transgenic ends and to enrich the pool of transgene endfragments.

4.3 Transgene copy number analysis in different rBDNF-hRluc-egfp cell lines

We had previously established polyclonal cell line by transfecting HeLa cells withrBDNF-hRluc-EGFP BAC construct and used this polyclonal cell line to establishseveral monoclonal cell lines that showed different levels of reporter gene expression.qPCR was used to determine transgene copy numbers per cell in different transgeniccell lines. All assayed cell lines showed very high copy numbers of transgene with cellline 1A4 exhibiting almost 200 copies per HeLa genome (Figure 7).

High transgenic copy number and previous reports that plasmids containing mam-malian replication origin and matrix attachment regions can be maintained episomallyin HeLa cells (Shimizu et al., 2001) gave reason to suspect that transgene might nothave incorporated into the HeLa genome and was instead maintained as an episomalelement. Fluorescent in situ hybridisation (FISH) analysis was performed on 1A4 cellline with rBDNF-hRluc-EGFP BAC specific probe to establish whether the transgene

22

Hoechst 33342 rBDNF-Rho

hBDNF-Cy2

A) B)

C) D)

E)

Figure 8: Fluorescent in situ hybridisation analysis of 1A4 transgenic HeLa cell line carrying rBDNF-hRluc-EGFP BAC. (A) chromosomes stained with Hoecht 33342. (B) anti-DIG-Rhodamine detectionof rBDNF-hRluc-EGFP BAC. (C) streptavidin-Cy2 detection of human BDNF locus. (D) mergedimages. (E) magnification of area marked with the white box on image D.

was maintained episomally or integrated into the genome of transgenic cell line. FISHanalysis (Figure 8B–E) showed that transgenic construct was indeed maintained epi-somally with construct specific signal detected around the metaphase chromosomes instructures that resembled extrachromosomal double minutes as described in (Shimizuet al., 2001). It has been previously shown that many genomic fragments are capableof replicating autonomously in human cell lines with larger fragments replicating muchmore efficiently (Krysan et al., 1989). Due to large size of BAC it is likely that itcontains necessary sequences for its replication. Hybridisation signal specific for humanBDNF locus was detected on three chomosomes (Figure 8C) due to hypertriploid na-ture of the HeLa genome (Macville et al., 1999). These results suggest that modified207kb BAC containing rat BDNF gene contains mammalian replication origins and ma-trix attachment regions neccessary for its replication and segregation between dividingcells.

23

Summary

Brain derived neurotrophic factor (BDNF) belongs to a family of structurally relatedproteins called neurotrophins that have been shown to regulate survival and growthof neurons in the developing central and peripheral nervous system and also take partin synaptic plasticity related processes in adulthood. Study of BDNF regulation isimportant due to its involvement in several neuropsychiatric and neurodegenerativediseases.

We have previously generated two transgenic mice lines using bacterial artificialchromosomes containing human or rat BDNF gene with BDNF coding region replacedwith hBDNF-EGFP or lacZ reporter gene, respectively. Expression pattern of trans-genic mRNA in these mouse lines was highly similar to that of rodent and humanBDNF mRNA. In this thesis I show that transgene expression in human BDNF-EGFPmouse line C3 and rat BDNF-lacZ mouse line H6 is also responsive to neuronal activ-ity mediated induction, modelled with intraperitoneal injection of kainic acid. Moreimportantly, it is the first time when the regulation of human BDNF gene by neuronalactivity has been shown in vivo. Attempts to localise transgene integration sites showedthat several copies of transgene had integrated tandemly into the genome in case of bothtransgenic mouse lines. Faithful transgene induction in response to neuronal activityindicates that these transgenic mouse lines could be used for studying regulation ofBDNF gene in vivo.

We have also established several transgenic cell lines expressing hRluc-EGFP fusionreporter gene under the control of the rat BDNF regulatory region. As a part ofthis thesis I determined transgene copy numbers in transgenic cell lines and analysedtransgene maintenance in one of the cell lines. Several cell lines showed high transgenecopy numbers and transgene was shown to be maintained episomally in one cell line.

24

Kokkuvõte

Ajust pärinev neurotroofne faktor (BDNF) kuulub neurotrofiinide perekonda. BD-NF-i funktsioonideks on reguleerida areneva kesk- ja perifeerse närvisüsteemi neuroniteelulemust ja kasvu, lisaks osaleb BDNF ka sünaptilise plastilisusega seotud protses-sides täiskasvanud organismis. BDNF-i taseme muutusi ajus on seostatud mitmeteneurodegeneratiivsete ja psühhiaatriliste häiretega. BDNF-i geen koosneb mitmetest5’ mittetransleeritavatest eksonitest, mis alternatiivse splaisinguga ühendatakse ühe jasama valku kodeeriva 3’ eksoniga.

BDNF geeni ekspressioon neuronites on indutseeritav neuraalse aktiivsusega, misläbi rakusisese Ca2+ kontsentratsiooni tõusu käivitab BDNF-i transkriptsiooni. Põh-jalikult on uuritud hiire ja roti BDNF geeni promootorites paiknevate cis-elementiderolli neuraalsest aktiivsusest sõltuvas geeniregulatsioonis, inimese BDNF geeni regulat-siooni in vivo pole siiani olnud võimalik uurida sobiva mudeli puudumise tõttu. Sel-lise mudeli loomiseks on meie uurimisgrupi poolt bakteri kunstlikku tehiskromosoomi(BAC) kasutades valmistatud transgeenne hiire liin, mis sisaldab 168kb inimese BDNF-ilookust, milles BDNF valku kodeeriv järjestus on asendatud BDNF-EGFP reporter-valgu kodeeriva järjestusega. Ka oleme loonud BAC-i kasutades 207kb roti BDNFlookust sisaldava transgeense hiireliini, milles BDNF valku kodeeriv järjestus on asen-datud lacZ reportergeeniga, ning transgeense HeLa rakuliini, mis sisaldab Renilla lut-siferaasi ja EGFP hübriidset reportergeeni (hRluc-EGFP) 207kb roti BDNF lookusekontrolli all.

Käesolevas töös uurisin:

• Transgeensete BDNF mRNA-de regulatsiooni neuraalse aktiivsuse poolt BDNF-BAC transgeensetes hiirtes.

– Transgeeni ekspressioon hBDNF-EGFP BAC-i sisaldavas hiireliinis C3 jarBDNF-lacZ BAC-i sisaldavas hiireliinis H6 oli indutseeritud kainaathappepoolt esile kutsutud neuraalse aktiivsuse poolt. Transgeense inimese BDNF-i

25

geeni transkriptide indutseerumine neuraalse aktiivsuse tagajärjel näitab, etsaadud transgeenne hiireliin sobib inimese BDNF-i geeni uurimiseks in vivo.

• Transgeenide olekut BDNF-BAC hiireliinide genoomis.

– Transgeenide genoomse oleku kindlakstegemisel selgus, et nii hBDNF-EGFPBAC-i sisaldavas hiireliinis C3 kui ka rBDNF-lacZ BAC-i sisaldavas hiirelii-nis H6 on transgeen sisenenud genoomi mitme tandeemse koopiana.

• Roti BDNF-hRluc-EGFP transgeeni staatust HeLa rakuliinis.

– Mitmes rBDNF-hRluc-EGFP rakuliinis on transgeeni koopiaarv kõrge javähemalt ühes rakuliinis on transgeen episomaalse elemendina.

26

Acknowledgments

I with to thank my supervisors Indrek Koppel and Tõnis Timmusk for the guidance andwisdom they have given me during my time in neurobiology lab and for the preparationof this thesis.

I also wish to thank Ljudmilla Timofejeva for reagents and helpful advice for per-forming the fluorescent in situ hybridisation.

Finally I would like to extend my gratitude to Mari Sepp, Priit Pruunsild, KristiTamm and the rest of the wonderful people in neurobiology work group for the adviceand support they have given me over the years.

27

Supplementary

Table of primers

Primer name Sequence Primer name Sequence

hBDNF-EGFPexpressionanalysis

hBDNF_IS gatgccagttgctttgtcttctgtagrBDNF-hRluc-egfp copynumber analysis

trkB_11F cacagggctccttaaggataachBDNF_IIS gggcgataggagtccattcagcacc trkB_11R gcacagtgaggttgacagaatchBDNF_IIIS agtttcgggcgctggcttagag EGFP_RT_s cagaagaacggcatcaaggtghBDNF_IVS gctgcagaacagaaggagtaca EGFP_RT_as tgggtgctcaggtagtggttghBDNF_VS tcgcgttcgcaagctccgtagtghBDNF_VhS ggctggaacacccctcgaa Genome

WalkingAdaptor primer 1 gtaatacgactcactatagggc

hBDNF_VIS ggctttaatgagacacccaccgc Adaptor primer 2 actatagggcacgcgtggthBDNF_IXS gctgctaaagtgggaagaagghBDNF_IXbAS (13b as) gtcctcatccaacagctcttctatc

C3 line

pBACp1 ggggcacatttcattacctctttctchrBDNFQpcrIs cagcatctgttggggagacgaga pBACp2 cggttacggttgagtaataaatggatghBDNFQpcrIVs gaagtctttcccggagcagct rp11-3p-gw-1 gtcctacaatgtcaagctcgaccgathBDNFQpcrVIs atcggaaccacgatgtgact rp11-3p-gw-2 cttgagagccttcaacccagtcaghBDNFQpcrIXcs aaccttgaccctgcagaatggcct rp11-3p-gw-3 gcgccggatcgatccttaattaagtcthmrQpcrAS1 gatggtcatcactcttctcaccthmrQpcrAS2 atgggggcagccttcatgca

H6 line

ch230-5p-gw-1 agctgagaattccctatgaagatccttchBDNFQpcrAS accttgtcctcggatgtttg ch230-5p-gw-2 tccttctatagtgtcacctaaatgtcgaEGFP_RT_s cagaagaacggcatcaaggtg ch230-3pa-gw-1 tgaagaaggcagttccacagEGFP_RT_as tgggtgctcaggtagtggttg ch230-3pa-gw-2 gagggctgctttatctgtgg

ch230-3pa-gw-3 gtctgccaaatcaagccagt

rBDNF-lacZexpressionanalysis

mrBDNF-I-s_lacz_RT agtctccaggacagcaaagcmr_BDNF_RT_IVs gctgccttgatgtttactttga

Integrityanalysis

5p_III_s cccctttttaggaaggagtgagmr_BDNF-EXON-VI-F gctttgtgtggaccctgagttc 5p_III_as gccacagtggatgctagtgagrBDNF-IXa-s_lacz_RT gtgtccccaagaaagtaaggtct 5p_IV.1_s ttctgggaactttttgtgctagggcgb-gal126-as gttttcccagtcacgacgtt 5p_IV.1_as cccaagtttgttccacgcagtatcatgb-gal154-as_RT caaggcgattaagttgggtaac 3p_V_s acaactcaggaccaccttggLacZ_RT_s cgaagtgaccagcgaatacctgt 3p_V_as cagaggtcagagggcaagagLacZ_RT_as caactgtttaccttgtggagcgaca 3p_IV_s caatgccccacttttgtctt

3p_IV_as tcccggttaactgtcgtaggMouseendogenousBDNFexpressionanalysis

mrBDNFI s gtgtgacctgagcagtgggcaaagga 3p_I_s ttgtgggtgatagtcccagtcmrBDNFII s ggaagtggaagaaaccgtctagagca 3p_I_as tgtgagagcaggggttctttmBDNF III s gctttgtatcatccctccccgagagt 3p_m_97_as gtctgccaaatcaagccagtmrBDNF IV s ctctgcctagatcaaatggagcttc T7 taatacgactcactatagggmrBDNF V s ctctgtgtagtttcattgtgtgttc SP6 tatttaggtgacactatagmBDNF VI s gctggctgtcgcacggttcccagt rp11_5p ggacaacagacccaaggagamBDNF IX s ccaaagctgctaaagcgggaggaag rp11_3p gtagggtgtctgggttggtgmrBDNF cod as old gtaggccaagttgccttgtccgtmr-BDNF-RT-cod1-F ggcccaacgaagaaaaccatmr-BDNF-RT-cod1-R agcatcacccgggaagtgtm_BDNF_RT_I_s ttgaagctttgcggatattgcgm_BDNF_RT_IVs gaaatatatagtaagagtctagaaccttgmr_BDNF-EXON-VI-F gctttgtgtggaccctgagttcm_BDNF_RT_IXcod_as aagttgccttgtccgtggacmrBDNFIXARACEas gagtaaacggtttctaagcaagtgmIX ggactatgctgctgacttgaaagga

qPCRnormalizer

mr-HPRT1_RT_s cagtcccagcgtcgtgattamr-HPRT_RT_as agcaagtctttcagtcctgtc

28

References

Acheson A, Conover JC, Fandl JP, DeChiara TM, Russell M, Thadani A, SquintoSP, Yancopoulos GD, Lindsay RM (1995) A BDNF autocrine loop in adult sensoryneurons prevents cell death. Nature 374:450–3.

Aid T, Kazantseva A, Piirsoo M, Palm K, Timmusk T (2007) Mouse and rat BDNFgene structure and expression revisited. J Neurosci Res 85:525–535.

Alonso M, Bekinschtein P, Cammarota M, Vianna MRM, Izquierdo I, Medina JH(2005) Endogenous BDNF is required for long-term memory formation in the ratparietal cortex. Learning & memory (Cold Spring Harbor, N.Y.) 12:504–10 PMID:16204202.

Alonso M, Vianna MRM, Izquierdo I, Medina JH (2002) Signaling mechanisms medi-ating BDNF modulation of memory formation in vivo in the hippocampus. Cellularand molecular neurobiology 22:663–74 PMID: 12585686.

Altar CA (1999) Neurotrophins and depression. Trends Pharmacol Sci 20:59–61.

Ballas N, Grunseich C, Lu DD, Speh JC, Mandel G (2005) REST and its core-pressors mediate plasticity of neuronal gene chromatin throughout neurogenesis.Cell 121:645–657.

Barde YA, Edgar D, Thoenen H (1982) Purification of a new neurotrophic factor frommammalian brain. EMBO J 1:549–553.

Barton ME, Shannon HE (2005) The seizure-related phenotype of brain-derived neu-rotrophic factor knockdown mice. Neuroscience 136:563–9 PMID: 16198489.

Bibel M, Hoppe E, Barde YA (1999) Biochemical and functional interactions betweenthe neurotrophin receptors trk and p75NTR. EMBO J 18:616–622.

Binder DK, Scharfman HE (2004) Brain-derived neurotrophic factor. Growth Fac-tors 22:123–131.

29

Cabelli RJ, Hohn A, Shatz CJ (1995) Inhibition of ocular dominance column forma-tion by infusion of NT-4/5 or BDNF. Science (New York, N.Y.) 267:1662–6 PMID:7886458.

Chang Q, Khare G, Dani V, Nelson S, Jaenisch R (2006) The disease progression ofMecp2 mutant mice is affected by the level of BDNF expression. Neuron 49:341–348.

Chen B, Dowlatshahi D, MacQueen GM, Wang JF, Young LT (2001) Increased hip-pocampal BDNF immunoreactivity in subjects treated with antidepressant medica-tion. Biol Psychiatry 50:260–265.

Chen WG, Chang Q, Lin Y, Meissner A, West AE, Griffith EC, Jaenisch R, Green-berg ME (2003a) Derepression of BDNF transcription involves calcium-dependentphosphorylation of MeCP2. Science (New York, N.Y.) 302:885–9 PMID: 14593183.

ChenWG,West AE, Tao X, Corfas G, Szentirmay MN, Sawadogo M, Vinson C, Green-berg ME (2003b) Upstream stimulatory factors are mediators of Ca2+-responsivetranscription in neurons. J Neurosci 23:2572–2581.

Connor B, Young D, Yan Q, Faull RL, Synek B, Dragunow M (1997) Brain-derived neurotrophic factor is reduced in Alzheimer’s disease. Brain Res Mol BrainRes 49:71–81.

Dechant G, Barde YA (2002) The neurotrophin receptor p75(NTR): novel functionsand implications for diseases of the nervous system. Nat Neurosci 5:1131–1136.

Dias BG, Banerjee SB, Duman RS, Vaidya VA (2003) Differential regulation of brainderived neurotrophic factor transcripts by antidepressant treatments in the adult ratbrain. Neuropharmacology 45:553–563.

Ernfors P, Bengzon J, Kokaia Z, Persson H, Lindvall O (1991) Increased levels ofmessenger RNAs for neurotrophic factors in the brain during kindling epileptogenesis.Neuron 7:165–176.

Ferrer I, Goutan E, MarÃn C, Rey MJ, Ribalta T (2000) Brain-derived neurotrophicfactor in Huntington disease. Brain Res 866:257–261.

Flavell SW, Kim TK, Gray JM, Harmin DA, Hemberg M, Hong EJ, Markenscoff-Papadimitriou E, Bear DM, Greenberg ME (2008) Genome-wide analysis of MEF2transcriptional program reveals synaptic target genes and neuronal activity-dependentpolyadenylation site selection. Neuron 60:1022–1038.

30

Giraldo P, Montoliu L (2001) Size matters: use of YACs, BACs and PACs in transgenicanimals. Transgenic research 10:83–103.

Gray J, Yeo GSH, Cox JJ, Morton J, Adlam ALR, Keogh JM, Yanovski JA, GharbawyAE, Han JC, Tung YCL, Hodges JR, Raymond FL, O’rahilly S, Farooqi IS (2006)Hyperphagia, severe obesity, impaired cognitive function, and hyperactivity associatedwith functional loss of one copy of the brain-derived neurotrophic factor (BDNF) gene.Diabetes 55:3366–3371.

Guillemot F, Cerutti I, Auffray C, Devignes MD (2007) A transgenic mouse modelengineered to investigate human brain-derived neurotrophic factor in vivo. TransgenicRes 16:223–237.

Hall J, Thomas KL, Everitt BJ (2000) Rapid and selective induction of BDNF ex-pression in the hippocampus during contextual learning. Nature neuroscience 3:533–5PMID: 10816306.

Han JC, Liu QR, Jones M, Levinn RL, Menzie CM, Jefferson-George KS, Adler-Wailes DC, Sanford EL, Lacbawan FL, Uhl GR, Rennert OM, Yanovski JA (2008)Brain-derived neurotrophic factor and obesity in the WAGR syndrome. N Engl JMed 359:918–927.

Hartmann M, Heumann R, Lessmann V (2001) Synaptic secretion of BDNF afterhigh-frequency stimulation of glutamatergic synapses. EMBO J 20:5887–5897.

Haubensak W, Narz F, Heumann R, Lessmann V (1998) BDNF-GFP containingsecretory granules are localized in the vicinity of synaptic junctions of cultured corticalneurons. J Cell Sci 111 ( Pt 11):1483–1493.

Hock C, Heese K, Hulette C, Rosenberg C, Otten U (2000) Region-specific neu-rotrophin imbalances in Alzheimer disease: decreased levels of brain-derived neu-rotrophic factor and increased levels of nerve growth factor in hippocampus and cor-tical areas. Arch Neurol 57:846–851.

Howells DW, Porritt MJ, Wong JY, Batchelor PE, Kalnins R, Hughes AJ, DonnanGA (2000) Reduced BDNF mRNA expression in the Parkinson’s disease substantianigra. Exp Neurol 166:127–135.

Huang EJ, Reichardt LF (2001) Neurotrophins: roles in neuronal development andfunction. Annu Rev Neurosci 24:677–736.

31

Isackson PJ, Huntsman MM, Murray KD, Gall CM (1991) BDNF mRNA expressionis increased in adult rat forebrain after limbic seizures: temporal patterns of inductiondistinct from NGF. Neuron 6:937–948.

Jiang X, Tian F, Du Y, Copeland NG, Jenkins NA, Tessarollo L, Wu X, Pan H,Hu XZ, Xu K, Kenney H, Egan SE, Turley H, Harris AL, Marini AM, Lipsky RH(2008) BHLHB2 controls Bdnf promoter 4 activity and neuronal excitability. J Neu-rosci 28:1118–1130.

Kernie SG, Liebl DJ, Parada LF (2000) BDNF regulates eating behavior and locomo-tor activity in mice. The EMBO journal 19:1290–300 PMID: 10716929.

Kerr BJ, Bradbury EJ, Bennett DL, Trivedi PM, Dassan P, French J, Shelton DB,McMahon SB, Thompson SW (1999) Brain-derived neurotrophic factor modulatesnociceptive sensory inputs and NMDA-evoked responses in the rat spinal cord. JNeurosci 19:5138–5148.

Kohara K, Kitamura A, Morishima M, Tsumoto T (2001) Activity-dependent transferof brain-derived neurotrophic factor to postsynaptic neurons. Science 291:2419–2423.

Kokaia M, Ernfors P, Kokaia Z, Elmér E, Jaenisch R, Lindvall O (1995) Suppressedepileptogenesis in BDNF mutant mice. Experimental neurology 133:215–24 PMID:7649227.

Korte M, Carroll P, Wolf E, Brem G, Thoenen H, Bonhoeffer T (1995) Hippocampallong-term potentiation is impaired in mice lacking brain-derived neurotrophic fac-tor. Proceedings of the National Academy of Sciences of the United States of Amer-ica 92:8856–60.

Krysan PJ, Haase SB, Calos MP (1989) Isolation of human sequences that replicateautonomously in human cells. Mol Cell Biol 9:1026–1033.

Lin Y, Bloodgood BL, Hauser JL, Lapan AD, Koon AC, Kim TK, Hu LS, Malik AN,Greenberg ME (2008) Activity-dependent regulation of inhibitory synapse develop-ment by Npas4. Nature 455:1198–1204.

Lipsky RH, Xu K, Zhu D, Kelly C, Terhakopian A, Novelli A, Marini AM (2001)Nuclear factor kappaB is a critical determinant in N-methyl-D-aspartate receptor-mediated neuroprotection. J Neurochem 78:254–264.

32

Liu QR, Lu L, Zhu XG, Gong JP, Shaham Y, Uhl GR (2006) Rodent BDNF genes,novel promoters, novel splice variants, and regulation by cocaine. Brain Res 1067:1–12.

Liu QR, Walther D, Drgon T, Polesskaya O, Lesnick TG, Strain KJ, de Andrade M,Bower JH, Maraganore DM, Uhl GR (2005) Human brain derived neurotrophic factor(BDNF) genes, splicing patterns, and assessments of associations with substance abuseand Parkinson’s Disease. Am J Med Genet B Neuropsychiatr Genet 134B:93–103.

Lyons WE, Mamounas LA, Ricaurte GA, Coppola V, Reid SW, Bora SH, Wihler C,Koliatsos VE, Tessarollo L (1999) Brain-derived neurotrophic factor-deficient micedevelop aggressiveness and hyperphagia in conjunction with brain serotonergic ab-normalities. Proceedings of the National Academy of Sciences of the United States ofAmerica 96:15239–44 PMID: 10611369.

Macville M, Schröck E, Padilla-Nash H, Keck C, Ghadimi BM, Zimonjic D, PopescuN, Ried T (1999) Comprehensive and definitive molecular cytogenetic characterizationof HeLa cells by spectral karyotyping. Cancer Res 59:141–150.

McAllister AK, Katz LC, Lo DC (1997) Opposing roles for endogenous BDNF andNT-3 in regulating cortical dendritic growth. Neuron 18:767–78 PMID: 9182801.

McAllister AK, Lo DC, Katz LC (1995) Neurotrophins regulate dendritic growth indeveloping visual cortex. Neuron 15:791–803 PMID: 7576629.

Metsis M, Timmusk T, Arenas E, Persson H (1993) Differential usage of multiple brain-derived neurotrophic factor promoters in the rat brain following neuronal activation.Proc Natl Acad Sci U S A 90:8802–8806.

Murray KD, Isackson PJ, Eskin TA, King MA, Montesinos SP, Abraham LA, RoperSN (2000) Altered mRNA expression for brain-derived neurotrophic factor and typeII calcium/calmodulin-dependent protein kinase in the hippocampus of patients withintractable temporal lobe epilepsy. J Comp Neurol 418:411–422.

Nagahara AH, Merrill DA, Coppola G, Tsukada S, Schroeder BE, Shaked GM, WangL, Blesch A, Kim A, Conner JM, Rockenstein E, Chao MV, Koo EH, GeschwindD, Masliah E, Chiba AA, Tuszynski MH (2009) Neuroprotective effects of brain-derived neurotrophic factor in rodent and primate models of Alzheimer’s disease. NatMed 15:331–337.

33

Narisawa-Saito M, Wakabayashi K, Tsuji S, Takahashi H, Nawa H (1996) Regionalspecificity of alterations in NGF, BDNF and NT-3 levels in Alzheimer’s disease. Neu-roreport 7:2925–2928.

Pang PT, Teng HK, Zaitsev E, Woo NT, Sakata K, Zhen S, Teng KK, Yung WH,Hempstead BL, Lu B (2004) Cleavage of proBDNF by tPA/plasmin is essential forlong-term hippocampal plasticity. Science 306:487–491.

Poulsen FR, Lauterborn J, Zimmer J, Gall CM (2004) Differential expression of brain-derived neurotrophic factor transcripts after pilocarpine-induced seizure-like activityis related to mode of Ca2+ entry. Neuroscience 126:665–676.

Pruunsild P, Kazantseva A, Aid T, Palm K, Timmusk T (2007) Dissecting the humanBDNF locus: bidirectional transcription, complex splicing, and multiple promoters.Genomics 90:397–406.

Reichardt LF (2006) Neurotrophin-regulated signalling pathways. Philos Trans R SocLond B Biol Sci 361:1545–1564.

Salehi Z, Mashayekhi F (2009) Brain-derived neurotrophic factor concentrations inthe cerebrospinal fluid of patients with Parkinson’s disease. J Clin Neurosci 16:90–93.

Schwartz PM, Borghesani PR, Levy RL, Pomeroy SL, Segal RA (1997) Abnormalcerebellar development and foliation in BDNF-/- mice reveals a role for neurotrophinsin CNS patterning. Neuron 19:269–81 PMID: 9292718.

Seidah NG, Benjannet S, Pareek S, Savaria D, Hamelin J, Goulet B, Laliberte J, LazureC, Chrétien M, Murphy RA (1996) Cellular processing of the nerve growth factorprecursor by the mammalian pro-protein convertases. Biochem J 314 ( Pt 3):951–960.

Sha H, Xu J, Tang J, Ding J, Gong J, Ge X, Kong D, Gao X (2007) Disruptionof a novel regulatory locus results in decreased Bdnf expression, obesity, and type 2diabetes in mice. Physiol Genomics 31:252–263.

Shimizu N, Miura Y, Sakamoto Y, Tsutsui K (2001) Plasmids with a mammalianreplication origin and a matrix attachment region initiate the event similar to geneamplification. Cancer Res 61:6987–6990.

Spires TL, Grote HE, Varshney NK, Cordery PM, van Dellen A, Blakemore C,Hannan AJ (2004) Environmental enrichment rescues protein deficits in a mouse

34

model of Huntington’s disease, indicating a possible disease mechanism. J Neu-rosci 24:2270–2276.

Tabuchi A, Nakaoka R, Amano K, Yukimine M, Andoh T, Kuraishi Y, Tsuda M (2000)Differential activation of brain-derived neurotrophic factor gene promoters I and III byCa2+ signals evoked via L-type voltage-dependent and N-methyl-D-aspartate receptorCa2+ channels. J Biol Chem 275:17269–17275.

Tabuchi A, Sakaya H, Kisukeda T, Fushiki H, Tsuda M (2002) Involvement of anUpstream Stimulatory Factor as Well as cAMP-responsive Element-binding Proteinin the Activation of Brain-derived Neurotrophic Factor Gene Promoter I. J. Biol.Chem. 277:35920–35931.

Tao X, Finkbeiner S, Arnold DB, Shaywitz AJ, Greenberg ME (1998) Ca2+ in-flux regulates BDNF transcription by a CREB family transcription factor-dependentmechanism. Neuron 20:709–726.

Tao X, West AE, Chen WG, Corfas G, Greenberg ME (2002) A calcium-responsivetranscription factor, CaRF, that regulates neuronal activity-dependent expression ofBDNF. Neuron 33:383–95.

Timmusk T, Lendahl U, Funakoshi H, Arenas E, Persson H, Metsis M (1995) Iden-tification of brain-derived neurotrophic factor promoter regions mediating tissue-specific, axotomy-, and neuronal activity-induced expression in transgenic mice. JCell Biol 128:185–199.

Timmusk T, Palm K, Lendahl U, Metsis M (1999) Brain-derived neurotrophic factorexpression in vivo is under the control of neuron-restrictive silencer element. J BiolChem 274:1078–1084.

Timmusk T, Palm K, Metsis M, Reintam T, Paalme V, Saarma M, Persson H (1993)Multiple promoters direct tissue-specific expression of the rat BDNF gene. Neu-ron 10:475–489.

Tsai SJ (2004) Is mania caused by overactivity of central brain-derived neurotrophicfactor? Med Hypotheses 62:19–22.

Tyler WJ, Alonso M, Bramham CR, Pozzo-Miller LD (2002) From acquisition to con-solidation: on the role of brain-derived neurotrophic factor signaling in hippocampal-dependent learning. Learning & memory (Cold Spring Harbor, N.Y.) 9:224–37 PMID:12359832.

35

Xu B, Goulding EH, Zang K, Cepoi D, Cone RD, Jones KR, Tecott LH, ReichardtLF (2003) Brain-derived neurotrophic factor regulates energy balance downstream ofmelanocortin-4 receptor. Nat Neurosci 6:736–742.

Zafra F, Hengerer B, Leibrock J, Thoenen H, Lindholm D (1990) Activity dependentregulation of BDNF and NGF mRNAs in the rat hippocampus is mediated by non-NMDA glutamate receptors. EMBO J 9:3545–3550.

Zuccato C, Ciammola A, Rigamonti D, Leavitt BR, Goffredo D, Conti L, MacDonaldME, Friedlander RM, Silani V, Hayden MR, Timmusk T, Sipione S, Cattaneo E (2001)Loss of huntingtin-mediated BDNF gene transcription in Huntington’s disease. Science(New York, N.Y.) 293:493–8 PMID: 11408619.

Zuccato C, Liber D, Ramos C, Tarditi A, Rigamonti D, Tartari M, Valenza M, Cat-taneo E (2005) Progressive loss of BDNF in a mouse model of Huntington’s diseaseand rescue by BDNF delivery. Pharmacological research : the official journal of theItalian Pharmacological Society 52:133–9 PMID: 15967378.

Zuccato C, Tartari M, Crotti A, Goffredo D, Valenza M, Conti L, Cataudella T, LeavittBR, Hayden MR, Timmusk T, Rigamonti D, Cattaneo E (2003) Huntingtin interactswith REST/NRSF to modulate the transcription of NRSE-controlled neuronal genes.Nat Genet 35:76–83.

36