Embed Size (px)
Citation preview
Brachyspira hyodysenteriae:
sensibilidad antibiótica y
epidemiología molecular
Brachyspira spp. en perros
Álvaro Hidalgo Uña
Enfermedades Infecciosas y Epidemiología
Departamento de Sanidad Animal
Facultad de Veterinaria
Universidad de León, España
TESIS DOCTORAL
León, primavera de 2011
Resumen
Las espiroquetas del género Brachyspira son bacterias anaerobias
que colonizan el intestino de aves y mamíferos. Una de las especies más
relevantes de este género es Brachyspira hyodysenteriae, agente
etiológico de la disentería porcina. Esta enfermedad afecta especialmente
a los cerdos de cebo y se caracteriza, en su forma clínica más clásica, por
la presencia de diarrea sanguinolenta. La disentería origina elevados
costes económicos en las explotaciones porcinas, derivados sobre todo
del aumento del índice de conversión, de la disminución de la ganancia
media diaria y del incremento en gastos de medicación.
El tratamiento y el control de la disentería porcina se basan
principalmente en la utilización de antibióticos. De todos ellos, los que
más se han empleado en los últimos años son la tilosina, la tiamulina, la
valnemulina y la lincomicina. Recientemente, se ha aprobado el uso de
la tilvalosina en España para tratar esta enfermedad.
Esta tesis doctoral, basada en cinco publicaciones científicas,
describe la sensibilidad de aislados españoles de B. hyodysenteriae a
estos antibióticos durante la última década e investiga la base genética de
sus resistencias. Asimismo, profundiza en la caracterización fenotípica y
molecular de B. hyodysenteriae y en las posibles relaciones
epidemiológicas existentes entre distintos clones, con especial referencia
a los aislados españoles. Además, se estudió la presencia de espiroquetas
del género Brachyspira en perros, tanto por su potencial patógeno en
esta especie como por su posible papel de reservorio epidemiológico.
Los resultados de esta investigación muestran como la práctica
totalidad de los aislados españoles de B. hyodysenteriae son resistentes a
la tilosina. Además, la utilización de un análisis de supervivencia,
adaptado para la comparación de concentraciones mínimas inhibitorias
de aislados pertenecientes a distintos periodos de tiempo, permitió
detectar un descenso progresivo en la sensibilidad a la tiamulina y a la
valnemulina desde el año 2000. Por el contrario, la sensibilidad de B.
hyodysenteriae a la lincomicina no experimentó cambios en los últimos
diez años.
Se investigaron las bases genéticas de la resistencia antibiótica de
B. hyodysenteriae, detectándose que la mutación puntual del nucleótido
en posición 2058 del gen ARNr 23S (numerado en relación a
Escherichia coli) es responsable de la resistencia a la tilosina y del
descenso de sensibilidad a la lincomicina. Además, se asoció la
mutación del nucleótido en posición 2032 con un incremento de la
resistencia a la lincomicina y a las pleuromutilinas, tiamulina y
valnemulina.
La caracterización fenotípica de B. hyodysenteriae mostró la
presencia en España de aislados negativos a la prueba del indol. La
tipificación utilizando polimorfismos de ADN amplificados al azar
(RAPD) y un nuevo protocolo de electroforesis de campo pulsado
(PFGE) permitió relacionarlos con aislados indol negativos descritos por
otros autores en Alemania y en Bélgica con anterioridad.
Durante el curso de esta tesis doctoral se desarrolló una técnica
de tipificación molecular de B. hyodysenteriae basada en el análisis del
número variable de repeticiones en tándem de múltiples loci (MLVA).
Esta técnica resultó ser altamente discriminatoria a la vez que retuvo un
elevado valor filogenético, destacando por su facilidad de
implementación en laboratorios equipados con tecnología de PCR. La
tipificación de aislados mediante MLVA mostró la presencia de un
mismo clon bacteriano en explotaciones de España, Holanda y el
Reino Unido, señalando el importante papel epidemiológico de los
cerdos portadores en la transmisión de esta espiroqueta. Además, esta
herramienta permitió comprobar la gran diversidad genética de
B. hyodysenteriae y evidenció la clonalidad de esta especie bacteriana.
Por último, se investigó la prevalencia de espiroquetas
intestinales en perros urbanos. Aunque no se detectó la presencia de B.
hyodysenteriae, hubo una elevada prevalencia de perros que eliminaron
otras espiroquetas intestinales en heces. “B. canis” fue la más prevalente,
sin embargo, B. pilosicoli se asoció con la presencia de diarrea en perros,
especialmente en animales jóvenes.
A mi familia
ÍNDICE
Apéndice
Lista de abreviaturas
Introducción
1. Phylum Spirochaetes
1.1 Taxonomía y evolución
1.2. Morfología y ultraestructura
2. Género Brachyspira
2.1. Hospedadores
2.2. Interacción con el hospedador
2.2.1. Brachyspira spp. y zoonosis
2.3. Características
2.4. Detección e identificación
2.4.1. Hemólisis beta y clasificación bioquímica
2.4.2. Técnicas moleculares
2.4.3. Otros métodos
2.5. Tipificación
2.5.1. Métodos basados en características fenotípicas
2.5.2. Métodos basados en el análisis del ADN
3. Disentería porcina
3.1. Agente etiológico
3.1.1. Factores de virulencia de B. hyodysenteriae
3.2. Importancia
3.3. Epidemiología
iii
iv
1
3
3
5
7
9
12
14
14
16
17
18
20
22
22
23
26
26
27
28
29
3.4. Patogénesis
3.5. Signos clínicos
3.6. Cuadro lesional
3.6.1. Lesiones macroscópicas
3.6.2. Lesiones microscópicas
3.7. Diagnóstico
3.8. Tratamiento y control
4. B. hyodysenteriae, antibióticos y resistencias
4.1. El ribosoma bacteriano
4.2. Antibióticos y mecanismos de acción
4.2.1. Macrólidos
4.2.2. Lincosamidas
4.2.3. Pleuromutilinas
4.3. Mecanismos de resistencia
Trabajos de investigación
Estudio I
Estudio II
Estudio III
Estudio IV
Estudio V
Discusión
Sensibilidad antibiótica de B. hyodysenteriae en España
Epidemiología molecular de B. hyodysenteriae
Brachyspira spp. en perros
Conclusiones
Referencias
31
33
34
34
35
36
37
38
40
42
42
44
45
45
49
51
59
71
85
117
125
127
135
139
143
147
iii
Apéndice Estudios I-V
I. Hidalgo, Á., Carvajal, A., García-Feliz, C., Osorio, J., Rubio, P., 2009. Antimicrobial susceptibility testing of Spanish field isolates of Brachyspira hyodysenteriae. Research in Veterinary Science 87, 7-12.
II. Hidalgo, Á., Carvajal, A., Pringle, M., Rubio, P., Fellström, C.,
2010. Characterization and epidemiological relationships of Spanish Brachyspira hyodysenteriae field isolates. Epidemiology and Infection 138, 76-85.
III. Hidalgo, Á., Carvajal, A., La, T., Naharro, G., Rubio, P., Phillips,
N.D., Hampson, D.J., 2010. Multiple-locus variable-number tandem-repeat analysis of the swine dysentery pathogen, Brachyspira hyodysenteriae. Journal of Clinical Microbiology 48, 2859-2865.
IV. Hidalgo, Á., Carvajal, A., Vester, B., Pringle, M., Naharro, G.,
Rubio, P. Trends towards lower antimicrobial susceptibility and characterization of acquired resistance among clinical isolates of Brachyspira hyodysenteriae in Spain. Antimicrobial Agents and Chemotherapy, aceptado para su publicación (abril de 2011).
V. Hidalgo, Á., Rubio, P., Osorio, J., Carvajal, A., 2010. Prevalence
of Brachyspira pilosicoli and “Brachyspira canis” in dogs and their association with diarrhoea. Veterinary Microbiology 146, 356-360.
iv
Lista de abreviaturas
ADN ácido desoxirribonucleico
ARN ácido ribonucleico
ARNm ácido ribonucleico mensajero
ARNr ácido ribonucleico ribosómico
ARNt ácido ribonucleico de transferencia
C citosina
CMI concentración mínima inhibitoria
ELISA ensayo inmuno-absorbente ligado a enzimas
G guanina
kb kilobases
kDa kilodalton
MLEE electroforesis de enzimas multi-locus
MLS macrólidos, lincosamidas y estreptograminas
MLST tipificación mediante secuencias multi-locus
MLVA análisis del número variable de repeticiones en
tándem de múltiples loci
µm micrómetro
NADH dinucleótido de nicotinamida adenina
PCR reacción en cadena de la polimerasa
PFGE electroforesis de campo pulsado
RAPD polimorfismos de ADN amplificados al azar
REA análisis mediante endonucleasas de restricción
RFLP polimorfismos en el tamaño de los fragmentos de
restricción
S svedberg, unidad del coeficiente de sedimentación
Sitio-A sitio aminoacil en el ribosoma
Sitio-P sitio peptidil en el ribosoma
ºC grado Celsius
Introducción 3
1. Phylum Spirochaetes
Las espiroquetas (Spirochaetes) integran uno de los veinticinco
filos en los que se divide actualmente el dominio Bacteria
(http://www.bergeys.org), siendo uno de los grandes grupos bacterianos
cuya relación filogenética se manifiesta claramente a través de alguna de
sus características fenotípicas (Paster et al., 1991). De estas, la
ultraestructura celular, caracterizada por la presencia de flagelos que
discurren por el espacio periplasmático, es el mejor ejemplo. De la
misma forma, la resistencia antibiótica a la rifampicina es compartida
por la mayoría de las espiroquetas (Leschine et al., 1986; Kunkle et al.,
1988; Wyss et al., 1996; Stamm et al., 2001).
Estas bacterias quimioheterótrofas se encuentran en la naturaleza
en una gran diversidad de ambientes, existiendo formas tanto de vida
libre como asociadas a hospedadores, con los que establecen distintos
tipos de interacción.
1.1. Taxonomía y evolución
El estudio de la secuencia del gen que codifica el ARNr 16S de las
espiroquetas revela que descienden de un único ancestro, integrando un
linaje monofilético (phylum Spirochaetes) que ha sido clasificado como
clase Spirochaetes y orden Spirochaetales. Este se divide a su vez en
cinco grandes grupos filogenéticos o familias que engloban un total de
trece géneros distintos. La primera familia, Spirochaetaceae, contiene
especies de los géneros Spirochaeta, Borrelia, Cristispira y Treponema.
El género Brachyspira es el único representante de la segunda familia,
Brachyspiraceae, mientras que Brevinema lo es de la tercera,
Brevinemaceae. La cuarta familia, Leptospiraceae, la integran bacterias
de los géneros Leptospira, Leptonema y Turneriella (Figura 1). Una
4 Introducción
última familia (Incertae sedis) agrupa aquellos géneros que no han
podido ser ubicados con precisión al no disponerse de sus secuencias:
Clevelandina, Diplocalyx, Hollandina y Pillotina.
Figura 1. Dendrograma (neighbour-joining) basado en la secuencia del gen ARNr 16S
mostrando las relaciones filogenéticas de las especies más representativas del phylum
Spirochaetes.
Introducción 5
Algunas de las especies de espiroquetas son patógenos humanos
conocidos desde hace tiempo como Borrelia burgdorferi, agente
etiológico de la enfermedad de Lyme, o Treponema pallidum, causante
de la sífilis. Sin embargo, aunque se han descrito más de doscientas
especies de espiroquetas, más de la mitad no se han logrado cultivar en
el laboratorio (Paster et al., 2000).
Desde el punto de vista evolutivo, las espiroquetas fueron uno de
los primeros grupos bacterianos en divergir del resto de las bacterias
(Brown et al., 2001; Daubin et al., 2002). En la actualidad, sus
representantes de vida libre están presentes en algunos de los
ecosistemas más antiguos de la Tierra (Margulis et al., 1993). Además,
se han encontrado en asociación simbiótica con el invertebrado Nautilus
macromphalus, considerado un fósil viviente del periodo Cámbrico
(Pernice et al., 2007), hace 542-488 millones de años, y en el intestino de
termitas preservadas en ámbar de hace 20 millones de años (Wier et al.,
2002).
1.2. Morfología y ultraestructura
Las espiroquetas son bacterias de forma helicoidal, delgadas,
alargadas y flexibles. Su tamaño es variable, con diámetros que oscilan
entre los 0,1 y los 3 µm y longitudes que van desde los 2 a los 500 µm.
Si bien el diámetro suele permanecer constante para una misma especie,
su longitud aumenta cuando existen condiciones fisiológicas que tienden
a inhibir el crecimiento bacteriano (Margulis et al., 1993). Aunque la
mayoría de las espiroquetas responden a esta morfología, también se ha
descrito una variante morfológica cocoide, Spirochaeta coccoides
(Dröge et al., 2006), aislada del tracto digestivo de termitas (Neotermes
castaneus), así como la aparición de cuerpos esféricos en diversas
6 Introducción
especies de los géneros Treponema, Leptospira, Borrelia y Brachyspira
(Wood et al., 2006). Estos cuerpos esféricos se forman bajo condiciones
de crecimiento desfavorables para las espiroquetas y, clásicamente, se
han considerado formas degeneradas e inviables. Sin embargo,
recientemente se ha comprobado que este pleomorfismo es reversible
para al menos doce especies de espiroquetas (Brorson et al., 2009).
El citoplasma y el nucleoide de las espiroquetas se encuentran
delimitados por una membrana celular, integrando el llamado cilindro
protoplasmático (Figura 2). Este se rodea, a su vez, de una segunda
envoltura, la membrana celular externa o vaina flexible, similar en
muchos aspectos a la membrana externa de las bacterias gram-negativas
(Paster et al., 1997). Entre ambas estructuras se define el espacio
periplasmático, por el que discurren los flagelos, que son
estructuralmente similares a los de otras bacterias y que se presentan en
número variable, según la especie. Cada uno de estos endoflagelos,
también llamados fibras axiales, está anclado en su extremo proximal a
uno de los polos del cilindro protoplasmático en una localización
subterminal, permaneciendo el otro extremo libre. Se disponen de
manera simétrica y, en algunas especies, los extremos libres de los
flagelos anclados en un polo de la bacteria pueden llegar a superponerse
con los del otro, hacia el tercio central de la célula. Todo el complejo
recibe el nombre de filamento axial y contribuye tanto a la morfología
como a la motilidad de las espiroquetas, permitiendo a este grupo
bacteriano desplazarse en medios muy viscosos, tipo gel, que impiden el
movimiento de otras bacterias, o sobre superficies sólidas, con
movimientos reptantes o de arrastre (Canale-Parola, 1978; Holt, 1978;
Prescott et al., 1999; Li et al., 2000).
Introducción 7
Figura 2. Esquema de la morfología general de las espiroquetas. Sección longitudinal
(A) y transversal (B).
2. Género Brachyspira
Las espiroquetas del género Brachyspira son bacterias anaerobias,
tolerantes al oxígeno, que colonizan el intestino de mamíferos y aves. En
la actualidad se reconocen siete especies dentro de este género y otras
seis especies, aún no validadas, han sido propuestas como integrantes del
mismo (Tabla 1). La especie tipo del género es B. aalborgi.
A principios de la década de 1970, dos grupos de investigación,
uno en Europa y otro en América, consiguieron aislar simultáneamente
espiroquetas de heces de cerdos con disentería y reproducir la
enfermedad (Taylor et al, 1971; Harris et al., 1972). Treponema
hyodysenteriae (ahora Brachyspira hyodysenteriae) se convirtió así en la
primera especie del actual género Brachyspira en ser identificada,
8 Introducción
conociéndose desde entonces por ser el agente etiológico de la disentería
porcina.
Poco después fue descrita otra espiroqueta intestinal porcina
débilmente beta-hemolítica, T. innocens (Kinyon et al., 1979), en
contraposición a T. hyodysenteriae que producía una hemólisis beta
fuerte. Posteriormente, estas dos especies fueron clasificadas como un
nuevo género, Serpula, distinto del género Treponema según estudios de
homología de ARN, pruebas de reasociación de ADN y perfiles
electroforéticos de proteínas bacterianas (Stanton et al., 1991). Sin
embargo, este nuevo género tuvo que ser renombrado como Serpulina, al
haber sido utilizado antes el nombre de Serpula para un género de
hongos (Stanton, 1992).
A mediados de la década de 1990 se reconoció como especie
dentro de este mismo género a otra espiroqueta débilmente hemolítica,
Serpulina pilosicoli (Trott et al., 1996a). Esta había sido designada como
“Anguillina coli” unos años antes (Lee et al., 1993a).
Tabla 1. Especies que integran el género Brachyspira.
Especies
validadas Referencia
Especies
propuestas Referencia
B. aalborgi Hovind-Hougen et
al., 1982
“B. canis” Duhamel et al., 1998
B. hyodysenteriae Taylor et al., 1971 “B. pulli” Stephens et al., 1999
B. innocens Kinyon, 1979 “B. ibaraki” Tachibana et al., 2003
B. pilosicoli Trott et al., 1996a “B. christiani” Jensen et al., 2001
B. intermedia Stanton et al., 1997 “B. suanatina” Råsbäck et al., 2007a
B. murdochii Stanton et al., 1997 “B. corvi” Jansson et al., 2008a
B. alvinipulli Stanton et al., 1998
Introducción 9
Estudios filogenéticos de la secuencia del gen ARNr 16S revelaron
que estas tres especies estaban relacionadas con otra que había sido
aislada de humanos en la década de 1980 denominada Brachyspira
aalborgi (Hovind-Hougen et al., 1982), por lo que se unificaron bajo el
género actual, Brachyspira (Ochiai et al., 1997). A esto le siguió la
descripción de otras dos espiroquetas intestinales en cerdos, S.
intermedia y S. murdochii (Stanton et al., 1997), a la postre incluidas en
el género Brachyspira (Hampson et al., 2006a). La última especie
validada tras ser descrita fue B. alvinipulli, aislada del intestino de aves
de corral (Stanton et al., 1998).
2.1. Hospedadores
El rango de hospedadores de las distintas especies del género
Brachyspira tiene una marcada variabilidad. Mientras que algunas de
estas espiroquetas intestinales colonizan únicamente una especie animal,
otras muestran una menor especificidad de hospedador (Figura 3). Es
habitual que distintas especies de Brachyspira estén presentes en una
misma especie hospedadora.
El rango de especies hospedadoras de B. hyodysenteriae descritas
hasta el momento lo integran cerdos, ratas, ratones, ñandúes, ánades y
aves de corral (Jensen et al., 1996; Hampson et al., 1997; Jansson et al.,
2004; Nemes et al., 2006; Feberwee et al., 2008). El de B. pilosicoli es
aún más amplio e incluye cerdos, perros, caballos, humanos y primates
no humanos, así como distintas especies de aves de corral y silvestres
(Lee et al., 1994; Duhamel et al., 1995; Trott et al., 1996a; Duhamel et
al., 1997; Webb et al., 1997; Oxberry et al., 1998; Stephens et al., 2001;
Hampson et al., 2006b).
10 Introducción
Figura 3. Hospedadores de las distintas especies del género Brachyspira.
Introducción 11
Asimismo, B. aalborgi puede colonizar personas y primates no
humanos (Duhamel et al., 1997; Mikosza et al., 2001a). B. innocens, B.
intermedia y B. murdochii se encuentran principalmente en cerdos y
aves de corral, aunque B. innocens también ha sido aislada de perros y
B. murdochii de ratas (Kinyon et al., 1979; Stanton et al., 1997; Stephens
et al., 2001).
El rango de hospedadores conocidos de B. alvinipulli lo conforman
distintas especies de aves de corral (Stanton et al., 1998; Nemes et al.,
2006).
“B. pulli” se presenta en aves de corral y perros (Jansson et al.,
2008b), mientras que “B. suanatina” se encuentra en cerdos y ánades y
“B. corvi” en aves del género Corvus (Råsbäck et al., 2007a; Jansson et
al., 2008a).
Las especies de Brachyspira con una mayor especificidad de
hospedador son “B. canis”, aislada únicamente de perros (Duhamel et
al., 1998) y “B. ibaraki” y “B. christiani” aisladas de humanos (Jensen et
al., 2001; Tachibana et al., 2003).
A medida que se ha profundizado en el estudio de este género, el
rango de hospedadores de la mayoría de las especies de Brachyspira se
ha visto incrementado. Del mismo modo, se han aislado recientemente
espiroquetas intestinales no relacionadas con ninguna de las especies
descritas hasta el momento de un ave antártica (Chionis alba) y de
roedores salvajes (Backhans et al., 2009; Jansson et al., 2009a).
12 Introducción
2.2. Interacción con el hospedador
Las especies del género Brachyspira establecen distintas
relaciones con sus hospedadores. Algunas de estas espiroquetas
intestinales son consideradas comensales, sin ninguna capacidad
patógena, mientras que otras se asocian con diversos trastornos y
producen enfermedades tras colonizar a personas o animales.
Una de las especies animales en las que estas relaciones han sido
mejor estudiadas es el cerdo. De las seis especies de Brachyspira que se
han aislado de este animal, solo dos especies han sido asociadas con
enfermedades de forma consistente: B. hyodysenteriae, agente etiológico
de la disentería porcina, y B. pilosicoli, responsable de la espiroquetosis
intestinal porcina (Hampson et al., 2006c y 2006d). En general,
B. innocens y B. murdochii son consideradas como especies comensales
del ganado porcino (Stanton et al., 1991 y 1997). No obstante, se ha
comprobado recientemente que B. murdochii puede producir colitis
catarral en cerdos, particularmente cuando existe una elevada
concentración de estas bacterias (Jensen et al., 2010). Más controvertida
es la capacidad de B. intermedia para producir enfermedad en el cerdo,
habiéndose relacionado con brotes de diarrea (Fellström et al., 1995).
Por otra parte, en un desafío experimental realizado con “B. suanatina”
se demostró su capacidad para infectar cerdos recién destetados y
producir diarrea, si bien los animales que fueron objeto de ese estudio
eliminaron espiroquetas compatibles con B. innocens y B. murdochii
unos días antes del desafío (Råsbäck et al., 2007a).
En avicultura, de las distintas especies de Brachyspira que se
relacionan con enfermedad intestinal y pérdidas productivas, solo tres
cuentan con estudios experimentales que refrenden esta asociación:
Introducción 13
B. pilosicoli, B. intermedia y B. alvinipulli (Swayne et al., 1995;
Hampson et al., 2002; Stephens et al., 2002). Cada una de estas tres
especies puede causar espiroquetosis intestinal aviar, que afecta sobre
todo a gallinas de puesta y a pollos de engorde. Por otra parte,
B. innocens, B. murdochii y “B. pulli” se consideran especies no
patógenas. B. hyodysenteriae se ha aislado recientemente de gallinas
ponedoras, aunque su potencial patógeno aún no ha sido aclarado
(Feberwee et al., 2008).
B. aalbogi y B. pilosicoli son las dos especies que participan en la
etiología de la espiroquetosis intestinal humana, definida
histológicamente por la presencia de espiroquetas adheridas al epitelio
del colon y del recto. Sin embargo, su asociación con alguna enfermedad
ha sido muy discutida a lo largo de los últimos años (Körner et al., 2003;
Peruzzi et al., 2005; Sato et al., 2010). Diversos estudios han señalado el
carácter patógeno de estas espiroquetas, relacionándolas con diarrea
crónica, dolencias abdominales o dermatomiositis (Mikosza et al.,
2001a; Koulaouzidis et al., 2007). Del mismo modo, un voluntario
humano presentó nauseas, molestias abdominales y dolor de cabeza tras
ingerir agua inoculada con B. pilosicoli (Oxberry et al., 1998). Además,
en pacientes inmunodeprimidos o en estado crítico, B. pilosicoli puede
alcanzar el torrente sanguíneo y producir una bacteriemia (Bait-Merabet
et al., 2008; Zeeshan et al., 2009).
Aunque la existencia de espiroquetas intestinales caninas es
conocida desde hace tiempo, el estudio de su relación con algún
trastorno o enfermedad no ha sido concluyente. No obstante, es
comúnmente aceptado que “B. canis” es una bacteria comensal del
intestino de perros, mientras que B. pilosicoli podría estar involucrada en
14 Introducción
afecciones entéricas (Duhamel et al., 1998; Oxberry et al., 2003a;
Johansson et al., 2004).
2.2.1. Brachyspira spp. y zoonosis
De las diversas especies que componen el género Brachyspira,
solamente dos, B. pilosicoli y B. aalborgi, han sido aisladas tanto de
personas como de animales. El carácter zoonótico de B. pilosicoli ha
sido analizado más en profundidad y ya en la década de 1990 varios
estudios sugirieron la posibilidad de transmisión de esta espiroqueta
intestinal entre el hombre y los animales (Koopman et al., 1993; Trott et
al., 1997a, 1998). Más recientemente, mediante el empleo de la
electroforesis de enzimas multilocus (MLEE), se ha comprobado que
aislados de B. pilosicoli procedentes de hospedadores y orígenes
geográficos dispares presentaban perfiles electroforéticos semejantes.
Este hecho apoya la falta de especificad de hospedador de esta bacteria
y, por lo tanto, su capacidad para ser transmitida entre distintas especies,
incluido el hombre, de forma natural (Hampson et al., 2006e).
Asimismo, se ha demostrado experimentalmente la capacidad de
aislados de B. pilosicoli procedentes de humanos para colonizar el
intestino de pollos, cerdos o ratones (Trott et al., 1995, 1996b; Sacco et
al., 1997).
2.3. Características
Las siete especies reconocidas del género Brachyspira son
cultivables en el laboratorio, para lo que se requiere de una atmósfera
anaerobia. Los integrantes de la familia Brachyspiraceae responden
generalmente a la morfología típica de las espiroquetas, con espirales no
demasiado marcadas, aunque se ha observado también la presencia de
Introducción 15
cuerpos esféricos en cultivos de espiroquetas intestinales humanas y de
B. hyodysenteriae (Gebbers et al., 1989; Barber et al., 1995; Wood et al.,
2006). Poseen un cromosoma circular, con un bajo contenido en G+C,
existiendo diferencias morfológicas y estructurales entre especies en
relación a su longitud, diámetro y número de endoflagelos (Tabla 2).
Recientemente se ha confirmado que la cepa de B. hyodysenteriae WA1
alberga un plásmido, con un tamaño de 35,9 kb (Bellgard et al., 2009).
Tabla 2. Características genéticas, morfológicas y ultraestructurales de Brachyspira
spp. (Hovind-Hougen et al., 1982; Trott et al., 1996a; Ochiai et al., 1997; Stanton et al.,
1997, 1998; Zuerner et al., 2004; Liolios et al., 2010).
Especie
Tamaño del
cromosoma
(kb)
Contenido
en G+C
(% mol)
Longitud
(µm)
Diámetro
(µm)
Flagelos
por célula
B. aalborgi - 27,1 2-6 0,2 8
B. hyodysenteriae 3000 25,9 8-10 0,3-0,4 14-28
B. innocens - 26 7,55-11,25 0,33-0,39 20-26
B. pilosicoli 2450 24,6 5,2-7,2 0,25-0,3 8-12
B. intermedia - 25 7,5-10 0,35-0,45 24-28
B. murdochii 3241 27 5-8 0,35-0,4 22-26
B. alvinipulli - 24,6 8-11 0,22-0,34 22-30
El género Brachyspira cuenta con un mecanismo de transferencia
horizontal de información genética por medio de agentes similares a
profagos (Stanton, 2007). De estos, el más estudiado es el VSH-1, que
facilita la transducción de fragmentos aleatorios de ADN de 7,5 kb entre
células de B. hyodysenteriae (Matson et al., 2005). De forma similar, el
estudio del genoma de B. pilosicoli y B. intermedia ha revelado que estas
especies también presentan los genes asociados a este mecanismo de
transmisión, aunque aún no ha sido aclarado si es factible la transmisión
entre distintas especies (Motro el al., 2009).
16 Introducción
2.4. Detección e identificación
A la hora de detectar la presencia de espiroquetas intestinales, el
examen microscópico directo de heces o de raspados de la mucosa
intestinal es una práctica habitual. Sin embargo, la imposibilidad de
distinguir de este modo entre las distintas especies de Brachyspira limita
su valor. En un intento por mejorar la capacidad diagnóstica del examen
microscópico directo se han empleado anticuerpos policlonales
marcados con moléculas fluorescentes para la detección de antígenos de
B. hyodysenteriae (Hunter et al., 1975, 1977). No obstante, la reactividad
cruzada entre las especies de Brachyspira hace que estas técnicas den un
elevado número de falsos positivos. La adsorción de estos anticuerpos
policlonales con antígenos de otras especies tiene como resultado un
bajo título de anticuerpos, lo que disminuye la sensibilidad para la
detección de B. hyodysenteriae (Jensen et al., 1997).
El cultivo en medios selectivos es, por lo general, el primer paso
hacia la detección y posterior identificación de espiroquetas intestinales
a nivel de especie en el laboratorio. Para ello se recomienda el empleo de
medios sólidos, como el agar triptona soja, suplementados con un 5% de
sangre, a los que se añaden antibióticos como la vancomicina, la
colistina, la rifampicina, la espiramicina o la espectinomicina en distintas
concentraciones y combinaciones (Songer et al., 1976; Jenkinson et al.,
1981; Szynkiewicz et al., 1986; Kunkle et al., 1988). Sin embargo,
algunas especies de Brachyspira tienen una sensibilidad moderada a
algunos de esos antibióticos. Así, la adición de espiramicina o
rifampicina no está recomendada en el caso de B. pilosicoli (Trott et al.,
1996a), mientras que se cree que la espectinomicina podría inhibir el
crecimiento de otras espiroquetas intestinales porcinas distintas de B.
hyodysenteriae (Duhamel et al., 1995). Tanto el aislamiento primario
Introducción 17
como la posterior propagación de las bacterias hasta obtener un cultivo
puro se realiza en condiciones de anaerobiosis, con temperaturas de
incubación que van desde los 37 ºC a los 42 ºC (Jensen et al., 1997).
2.4.1. Hemólisis beta y clasificación bioquímica
En general, las diferentes especies del género Brachyspira tienen
propiedades fenotípicas distintas entre sí. Esto ha permitido el desarrollo
de un sistema de identificación de especies basado en el tipo de
hemólisis beta que producen, fuerte o débil, y en unas pocas pruebas
bioquímicas (Tabla 3), entre las que destacan la hidrólisis del hipurato, el
test de indol o la presencia de actividad alfa-galactosidasa y beta-
glucosidasa.
Tabla 3. Propiedades fenotípicas empleadas en la diferenciación de las principales
especies del género Brachyspira (Felltröm et al., 1999; Kraaz et al., 2000; Fossi et al.,
2004; Johansson et al., 2004; Råsbäck et al., 2007a; Jansson et al., 2008a, 2008b).
Especie ß-hemólisis Indol Hipurato α-gal.1 ß-gluc.2 Grupo3
B. aalborgi débil - - - - NA
B. hyodysenteriae fuerte + (-) - - + I
B. innocens débil - - + + IIIbc
B. pilosicoli débil - (+) + (-) + (-) - (+) IV
B. intermedia débil + - - + II
B. murdochii débil - - - + IIIa
B. alvinipulli débil - + - + (-) NA
“B. canis” débil - - - + IIIa
“B. pulli” débil - - + + IIIbc
“B. suanatina” fuerte + - - + I
“B. corvi” débil - - + (-) - (+) NA
Entre paréntesis, reacciones menos frecuentes. 1 α-galactosidasa. 2 ß-glucosidasa. 3 Grupos bioquímicos según Fellström et al. (1995). NA, grupo bioquímico no asignado.
18 Introducción
Inicialmente el sistema de clasificación en grupos bioquímicos se
empleó en la identificación de aislados de espiroquetas de origen porcino
(Fellström et al., 1995, 1999), extendiéndose su uso a aquellas aisladas
de aves o perros, donde ha seguido demostrando su utilidad (Fellström et
al., 2001a; Jansson et al., 2008b). Por ello, en distintos laboratorios de
diagnóstico, a la hora de identificar aislados de Brachyspira spp., se
emplea la caracterización bioquímica junto con el grado de hemólisis
beta. No obstante, la existencia de aislados que presentan perfiles
bioquímicos atípicos o la dificultad para obtener cultivos puros en
determinados casos, hace que sea recomendable su uso en conjunción
con otras técnicas de identificación (Thomson et al., 2001; Feberwee et
al., 2008; Jansson et al., 2008b).
2.4.2. Técnicas moleculares
El estudio del grado de similitud genética mediante pruebas de
reasociación de ADN se ha empleado como uno de los criterios
principales a la hora de establecer los límites entre las distintas especies
de Brachyspira, reclasificarlas o diferenciarlas (Stanton et al., 1991,
1998; Ramanathan et al., 1993; Duhamel et al., 1995; Trott 1996a;
Ochiai et al., 1997). Sin embargo, esta técnica no ha sido incorporada a
la identificación rutinaria de aislados de Brachyspira spp. debido a su
enorme laboriosidad (Jensen et al., 1997). De forma similar, se han
utilizado con éxito distintas sondas de ADN o ARNr (ribotipificación)
para la identificación específica de aislados de B. hyodysenteriae y otras
espiroquetas intestinales, aunque su uso tampoco se ha generalizado por
las dificultades que conllevan estas técnicas (Jensen et al., 1992;
Sotiropoulos et al., 1994; Harel et al., 1995; Duhamel et al., 1998;
Hampson et al., 2006c).
Introducción 19
Además, las sondas de ADN se han empleado directamente en
muestras de tejido para la detección de Brachyspira spp. mediante una
técnica histopatológica de hibridación in situ con fluorescencia. Usando
esta metodología se han logrado identificar B. aalborgi, B. pilosicoli y B.
hyodysenteriae en secciones de intestino fijadas en formalina (Jensen et
al., 1998, 2000, 2001; Schmiedel et al., 2009).
En los últimos años se han desarrollado distintos sistemas para la
identificación de especies de Brachyspira empleando la reacción en
cadena de la polimerasa (PCR). Algunos de ellos se basan en la
amplificación de fragmentos de ADN específicos de género, que son
posteriormente digeridos con enzimas de restricción (PCR-RFLP),
produciendo patrones de bandas de ADN específicos de especie al
resolverlos mediante electroforesis (Barcellos et al., 2000; Rohde et al.,
2002; Townsend et al., 2005; Kim et al., 2006; Ohya et al., 2008).
Por otro lado, otros sistemas de diagnóstico basados en la PCR han
logrado la amplificación de fragmentos de ADN específicos de especie
utilizando como genes diana el nox, el ARNr 23S, el tlyA, el ARNr 16S
o incluso genes cuya función se desconoce (Elder et al., 1994; Harel et
al., 1995; Park et al., 1995; Atyeo et al., 1999a; Fellström et al.,1997,
2001b; Leser et al., 1997; Suriyaarachchi et al., 2000; Mikosza et al.,
2001b). Además, su uso simultáneo en sistemas de PCR dobles o
múltiples permite la detección de varias especies en una misma reacción,
disminuyendo costes y tiempo (La et al., 2006; Råsbäck et al., 2006).
Igualmente, la reciente implementación de la PCR en tiempo real para el
diagnóstico de Brachyspira spp. reduce el tiempo requerido para la
identificación, pudiendo detectar varias especies con una mayor
sensibilidad que la PCR tradicional y cuantificarlas (Song et al., 2009;
Willems et al., 2010). Estos métodos tienen la ventaja de ser compatibles
20 Introducción
con su uso en el diagnóstico rutinario de laboratorio, pudiendo emplearse
a partir de cultivos primarios o en combinación con otras técnicas de
identificación de aislados como la caracterización fenotípica. Otra de las
virtudes que ofrecen es la posibilidad de analizar ADN extraído
directamente de heces, aunque la sensibilidad de la técnica puede ser
inferior al cultivo debido a la presencia en las heces de distintos
inhibidores (Phillips et al., 2006; Råsbäck et al., 2006).
Si bien la secuencia de nucleótidos del gen ARNr 16S es la base de
la filogenia bacteriana, se ha mostrado insuficiente para clasificar
categóricamente algunas especies de Brachyspira (Pettersson et al.,
1996; Stanton et al., 1996). Por ello se ha recurrido a la secuenciación de
genes como el ARNr 23S o el nox que, aunque conservados entre las
distintas especies del género, presentan una mayor variabilidad (Leser et
al., 1997; Atyeo et al., 1999a; Råsbäck et al., 2007a; Jansson et al.,
2008a). De manera similar, la utilización de la tipificación mediante
secuencias multilocus de genes metabólicos (MLST) ha demostrado ser
útil en la identificación de especies de Brachyspira (Råsbäck et al.,
2007b).
2.4.3. Otros métodos
La electroforesis de enzimas multilocus (MLEE) ha sido utilizada
no solo para la diferenciación subespecífica de aislados de Brachyspira
spp. [ver sección 2.5.1.], sino también para la identificación de las
distintas especies que componen el género (McLaren et al., 1997;
Duhamel et al., 1998; Stephens et al., 2005). Este método fenotípico
analiza la movilidad electroforética de quince enzimas constitutivas. Las
diferencias entre aislados para cada enzima son interpretadas como el
Introducción 21
producto de diferentes alelos de un mismo locus, reflejando por tanto la
diferencia genética existente (Lee et al., 1993a).
El uso de anticuerpos monoclonales para la identificación de
espiroquetas intestinales ha sido igualmente explorado. Algunos de los
más prometedores reconocen determinantes antigénicos de una
lipoproteína de 16 kDa (SmpA o Bhlp16) de la membrana celular
externa de B. hyodysenteriae (Thomas et al., 1992a). Sin embargo, esta
proteína ha resultado no estar presente en todos los aislados,
disminuyendo su interés diagnóstico (Thomas et al., 1992b; Holden et
al., 2006). Igualmente, se han producido anticuerpos monoclonales
específicos de lipooligosacárido para B. hyodysenteriae con un gran
potencial diagnóstico, pero limitados por la especificidad de serogrupo
(Achacha et al., 1995; Westerman et al., 1995).
En lo referente a otras especies de Brachyspira, se han empleado
anticuerpos monoclonales para la detección de B. pilosicoli mediante
inmunofluorescencia indirecta (Lee et al., 1995; Tenaya et al., 1998), e
incluso se han utilizado para la detección específica del género
Brachyspira en tejidos incluidos en parafina (Achacha et al., 1996).
Asimismo, para la detección serológica de la exposición a
espiroquetas intestinales se han evaluado una gran diversidad de
técnicas, entre las que se encuentran pruebas de inmunofluorescencia
indirecta, de hemólisis pasiva, de aglutinación, de fijación del
complemento o de tipo ELISA (La et al., 2001). Estas pruebas indirectas
se han utilizado principalmente para detectar anticuerpos frente a B.
hyodysenteriae, encontrándose que su principal desventaja es la
presencia de reacciones cruzadas cuando se emplean como antígenos la
bacteria entera sonicada o extractos de toda la proteína celular (Kent et
22 Introducción
al., 1989; Wright et al., 1989). Por otro lado, la utilización de
lipooligosacáridos resulta específica de serogrupo [ver sección 2.5.1.],
por lo que pueden producirse falsos negativos (Baum et al., 1979). Por lo
tanto, es deseable la utilización de antígenos más específicos que sean
compartidos por los distintos serogrupos de una misma especie.
Recientemente, el empleo de la proteína recombinante Bhlp29.7 ha
demostrado su utilidad en el diagnóstico serológico de la disentería
porcina en grupos de animales (La et al., 2009a).
2.5. Tipificación
Para la discriminación entre aislados pertenecientes a una misma
especie de Brachyspira se han empleado diversas técnicas, habiendo
resultado especialmente útil su aplicación en la realización de estudios
epidemiológicos. Algunos de estos métodos, como la MLEE o la
tipificación serológica, se basan en las diferencias fenotípicas existentes
entre los aislados, mientras que otros analizan directamente las
diferencias genéticas intraespecíficas. La mayoría de estas técnicas se
han aplicado en la caracterización de aislados de B. hyodysenteriae o de
B. pilosicoli.
2.5.1. Métodos basados en características fenotípicas
La tipificación serológica de B. hyodysenteriae permite la
clasificación de aislados en serogrupos y, a su vez, la de estos en
serovariedades, empleando para ello el lipooligosacárido de la pared
celular. En una primera etapa se evalúa su reactividad con antisueros sin
adsorber producidos con las cepas tipo de cada serogrupo, para después
asignar una serovariedad mediante la utilización de antisueros
adsorbidos frente a otros integrantes del mismo serogrupo (Lau et al.,
Introducción 23
1992). Con este sistema se han definido un total de 11 serogrupos (A-K),
algunos de los cuales están compuestos por distintas serovariedades,
expresadas mediante números correlativos para cada serogrupo
(Hampson et al., 1997).
La técnica de MLEE puede utilizarse tanto para la identificación
[ver sección 2.4.3.] como para la tipificación de bacterias, siendo útil a la
hora de estimar la diversidad genética de una especie e inferir la
estructura de las poblaciones bacterianas (Selander et al., 1986). Dentro
del género Brachyspira, se ha empleado como herramienta de
tipificación en la diferenciación de aislados de B. hyodysenteriae (Lee et
al., 1993b; Kim et al., 2005); en la caracterización de aislados de B.
pilosicoli, estudiando también su epidemiología y estructura poblacional
(Trott et al., 1997b, 1998; Oxberry et al., 2003b); y al investigar las
relaciones entre aislados de distintas especies de espiroquetas
intestinales aisladas de gallinas (Stephens et al., 2005). Sin embargo,
tiene el inconveniente de ser una técnica muy laboriosa, por lo que se
utiliza poco en los laboratorios de diagnóstico microbiológico (Råsbäck
et al., 2007b).
2.5.2. Métodos basados en el análisis del ADN
El análisis mediante endonucleasas de restricción (REA) se ha
empleado principalmente en la tipificación de aislados de B.
hyodysenteriae, demostrando un mayor poder de discriminación que la
tipificación serológica y similar al de la MLEE (Combs et al., 1989,
1992; ter Huurne et al., 1992; Lee et al., 1993b). Esta técnica se basa en
la comparación de los patrones electroforéticos del ADN cromosómico
de los aislados tras su digestión con enzimas de restricción de elevada
frecuencia de corte. Sin embargo, debido al gran número de bandas que
24 Introducción
puede presentar cada patrón, resulta una técnica compleja y difícil de
estandarizar (Jensen et al., 1997). Estas dificultades han sido
parcialmente resueltas al combinar el REA con la hibridación de
distintas sondas de ADN (Jensen et al., 1993; Koopman et al., 1993;
Sotiropoulos et al., 1994).
Otro método de tipificación basado en el análisis del ADN es el
estudio del polimorfismo generado al amplificar secuencias aleatorias de
esta molécula mediante la técnica RAPD (Welsh et al., 1990; Williams
et al., 1990). En este caso, se analizan los diferentes patrones
electroforéticos resultantes de la utilización arbitraria de un
oligonucleótido como cebador único de la PCR (Figura 4). El RAPD se
ha utilizado para estudiar la diversidad de aislados de B. hyodysenteriae
pertenecientes a los serogrupos J y K (Dugourd et al., 1996), para
comprobar la identidad de los aislados tras infecciones experimentales
con B. hyodysenteriae y “B. suanatina” (Jansson et al., 2009b) o para
estudiar las relaciones genéticas de aislados de distintas especies de
espiroquetas porcinas (Fellström et al., 2008).
Figura 4. Tipificación de aislados de B. pilosicoli mediante RAPD.
La electroforesis de campo pulsado (PFGE) es una técnica de
tipificación que aplica cambios en la dirección de la corriente eléctrica
durante la electroforesis para conseguir resolver fragmentos de ADN de
Introducción 25
gran tamaño (Schwartz et al., 1984). Consiste básicamente en la
digestión del ADN bacteriano en el seno de una matriz de agarosa con
enzimas de restricción de baja frecuencia de corte para posteriormente
someterlo a la electroforesis de campo pulsado. La migración del ADN
es dependiente del tamaño de los distintos fragmentos generados, dando
como resultado un patrón característico para cada cepa bacteriana
(Figura 5). En un inicio, la PFGE se empleó en estudios epidemiológicos
de B. pilosicoli (Atyeo et al., 1996; Trott et al., 1998; Oxberry et al.,
2003b), habiéndose utilizado también para la diferenciación de aislados
de B. hyodysenteriae (Rayment et al., 1997; Atyeo et al., 1999b;
Fellström et al., 1999). Más recientemente se ha utilizado con éxito para
la discriminación de aislados de B. intermedia procedentes de gallinas
ponedoras (Phillips et al., 2005) o para el estudio de huellas genéticas en
las distintas especies de espiroquetas intestinales porcinas (Fellström et
al., 2008). Sin embargo, se han descrito dificultades en el análisis de
aislados de Brachyspira con hemólisis fuerte (Råsbäck et al., 2007a).
Figura 5. Tipificación de aislados de B. hyodysenteriae mediante electroforesis de
campo pulsado (PFGE).
26 Introducción
La tipificación mediante secuencias multilocus de genes
metabólicos (MLST) se desarrolló a partir de los conceptos de la MLEE
como herramienta de tipificación. Sin embargo, se diferencia de esta en
que la MLST examina las secuencias de los genes que codifican unas
determinadas enzimas y no su movilidad electroforética. De este modo,
se consigue un número mayor de alelos potenciales por locus y los datos
generados se pueden almacenar y comparar fácilmente entre laboratorios
(Maiden et al., 1998). Esta técnica fue adaptada al género Brachyspira
incluyendo un total de ocho genes, cinco de los cuales codifican enzimas
usadas en la MLEE con anterioridad (Råsbäck et al., 2007b).
Posteriormente, el esquema propuesto en un principio se redujo a siete
genes por la falta de polimorfismo de uno de ellos, habiéndose utilizado
para analizar las relaciones entre aislados y la estructura poblacional de
B. hyodysenteriae y de B. intermedia (La et al., 2009b; Phillips et al.,
2010).
3. Disentería porcina
La disentería porcina, producida por B. hyodysenteriae, es una de
las principales enfermedades digestivas del ganado porcino. Afecta sobre
todo a los animales en la fase de cebo, si bien puede aparecer en todas
las etapas productivas. En su forma clínica más grave se caracteriza por
una colitis mucohemorrágica (Hampson et al., 2006c).
3.1. Agente etiológico
La primera descripción de la disentería porcina como una
enfermedad con entidad propia se remonta al año 1921 (Whiting et al.,
1921), si bien la demostración de que una espiroqueta era el agente
causal tardaría en llegar cinco décadas más (Taylor et al, 1971). Ya
Introducción 27
desde un primer momento se descartó la posibilidad de que otros agentes
conocidos productores de diarrea estuvieran involucrados en su
etiología, mientras que resultó relevante la observación de espiroquetas
en las heces de los animales enfermos. Sin embargo, el intento de
reproducir la disentería en cerdos sanos resultó fallido, posiblemente por
el periodo de incubación variable que hoy sabemos que tiene esta
enfermedad. En la década de 1940 se asoció su presencia con la bacteria
Vibrio coli, conociéndose también por ello como disentería vibriónica
(Doyle, 1948). En las dos décadas siguientes, numerosos autores
aceptaron la relación etiológica entre Vibrio coli y la disentería porcina
(Roberts, 1956; Curtis, 1962; Lussier, 1962; Doornenbal, 1965), pese a
que otros la pusieron en duda (Boley et al., 1951; Andress et al., 1968;
Tesouro, 1969; Hughes et al., 1972). La teoría de que una espiroqueta
era el agente causal de la disentería cobró fuerza a finales de la década
de 1960 y, finalmente, se consiguió aislarla, reproducir la enfermedad y
aislarla de nuevo de animales infectados experimentalmente (Taylor et
al, 1971; Harris et al., 1972). Desde entonces, se acepta que
B. hyodysenteriae, designada en aquel primer momento como
Treponema hyodysenteriae, es el agente etiológico de la disentería
porcina.
3.1.1. Factores de virulencia de Brachyspira hyodysenteriae
B. hyodysenteriae posee una serie de características que están
involucradas tanto en su capacidad de colonización y supervivencia en el
intestino grueso del cerdo como en la producción de lesiones. Estas
características se conocen, de forma general, como factores de
virulencia.
28 Introducción
Dos de los factores de virulencia de mayor relevancia son la
motilidad y la quimiotaxis, que permiten a las bacterias patógenas
alcanzar los lugares de colonización (Lux et al., 2000). De este modo,
los aislados de B. hyodysenteriae con una menor motilidad o una
atracción disminuida hacia la mucina resultan menos patógenos (Milner
et al., 1994; Rosey et al., 1996).
Por otro lado, la acción de la enzima NADH oxidasa facilita la
supervivencia de esta bacteria al exponerse al oxígeno presente en el
tejido intestinal, contribuyendo a su capacidad de colonización (Stanton
et al., 1999). Además, toxinas como la hemolisina o el lipooligosacárido
de la membrana celular externa podrían participar en la producción de
lesiones en el intestino del cerdo, estando consideradas como factores de
virulencia de B. hyodysenteriae (Nuessen et al., 1983; Lysons et al.,
1991).
3.2. Importancia
La relevancia de la disentería en la producción porcina se deriva
principalmente de los costes asociados a la misma, que incluyen desde
pérdidas económicas directas por la muerte de los animales en los casos
más graves, a cuantiosas pérdidas indirectas a consecuencia del deterioro
del índice de conversión de alimento y de la disminución de la ganancia
media diaria de los animales. Estas pérdidas indirectas son
habitualmente mucho mayores que las directas.
A todo ello, deben sumarse los gastos veterinarios y de medicación
para el tratamiento y el control de la enfermedad e incluso los asociados
a las diferentes medidas preventivas destinadas a evitar la aparición o la
diseminación de la misma (Hampson et al., 2006c). Además, debe
Introducción 29
considerarse la influencia de esta enfermedad sobre el bienestar de los
animales y el impacto que todo ello tiene en el ánimo de los productores
y técnicos porcinos.
En una explotación con disentería porcina endémica se comprobó
un aumento de más de medio punto en el índice de conversión asociado
a esta enfermedad, lo que supuso un incremento de los costes de
producción de más de diez dólares por cerdo cebado (Wood et al., 1988).
A su vez, diversos estudios realizados en la década de 1990 señalaron
unos costes de medicación por cada cerdo llevado al matadero en torno a
ocho dólares (Hampson et al., 1997). En 1994, las pérdidas económicas
ocasionadas por la disentería porcina en Estados Unidos se estimaron en
115,2 millones de dólares (Duhamel et al., 1994).
3.3. Epidemiología
Desde que la disentería porcina se describió clínicamente por
primera vez en Estados Unidos en el año 1921 (Whiting et al., 1921),
numerosas publicaciones han dado cuenta de brotes de esta enfermedad
en diversas regiones, considerándose en la actualidad que está presente
en la mayoría de los países con una producción porcina relevante
(Hampson et al., 2006c).
En España, segundo productor europeo de carne de cerdo (fuente:
Eurostat), la disentería porcina es una de las principales causas de
diarrea en cerdos destetados. En un estudio reciente se comprobó que
B. hyodysenteriae estuvo presente en más del 30% de las explotaciones
con problemas de diarrea en animales adultos o de cebo y en el 12% de
las muestras de heces (Carvajal et al., 2006). De forma similar, se han
detectado anticuerpos contra B. hyodysenteriae en más del 30% de las
30 Introducción
explotaciones australianas al examinar sueros porcinos obtenidos en el
matadero (Mhoma et al., 1992). En el Reino Unido, en un estudio
realizado para determinar los agentes involucrados en brotes de diarrea,
B. hyodysenteriae fue aislada como agente único en el 13% de las
explotaciones estudiadas y formando parte de infecciones mixtas en el
16% de las mismas (Thomson et al., 2001).
La disentería porcina afecta a cerdos de todas las edades, aunque
se observa más frecuentemente en animales de cebo, entre los 15 y los
70 kilos de peso (Hampson et al., 2006c). Su transmisión es horizontal,
por vía fecal-oral, produciéndose generalmente al ingerir heces
contaminadas procedentes de cerdos clínicamente enfermos o de cerdos
portadores, que eliminan el agente sin manifestaciones clínicas
aparentes. De este modo, la principal fuente de infección para las
explotaciones libres de disentería porcina son estos cerdos portadores.
Sin embargo, en áreas geográficas donde las explotaciones
porcinas se localizan próximas entre sí, los roedores y las aves pueden
desempeñar un papel importante en la transmisión, especialmente si las
medidas de bioseguridad no son adecuadas. B. hyodysenteriae sobrevive
hasta dos meses en balsas de purines y ambientes húmedos, lo que
facilita la transmisión indirecta de la infección mediante vectores
mecánicos y fómites (Hampson et al., 1997; Råsbäck et al., 2007a).
El periodo de incubación de la enfermedad es variable, pudiendo
ser tan solo de cinco días o alargarse hasta las cuatro semanas, pero por
lo general se sitúa entre los diez y los catorce días (Olson, 1974;
Jacobson et al., 2004). Al aparecer por primera vez en una piara, B.
hyodysenteriae se propaga de forma gradual y si no se instaura un
tratamiento adecuado, la morbilidad puede alcanzar el 90% y la
Introducción 31
mortalidad el 50%. Cuando la disentería porcina se cronifica en una
granja, la gravedad de los signos clínicos disminuye, llegando incluso a
no ser evidentes, aunque se mantiene el grave deterioro de los índices
productivos (Hampson et al., 2006c).
3.4. Patogénesis
A pesar de que la disentería porcina es una de las enfermedades
producidas por espiroquetas del género Brachyspira que ha sido
estudiada más en profundidad, aún se desconocen muchos aspectos
relacionados con los mecanismos por los cuales se desarrolla. Su
patogenia es compleja y en ella podrían participar otros
microorganismos presentes habitualmente en el ciego y en el colon de
los cerdos (Hampson et al., 2006c).
La infección se produce mediante la ingestión de heces que
contienen B. hyodysenteriae por parte de cerdos receptivos. Tras pasar la
barrera ácida que supone el estómago, presumiblemente protegida por
las heces, la bacteria atraviesa el intestino delgado y llega al ciego y al
colon, donde se asienta. B. hyodysenteriae posee ciertas ventajas
selectivas a la hora de colonizar este tramo del intestino grueso, entre las
que destaca no solo su capacidad para multiplicarse en condiciones de
anaerobiosis, sino también para soportar la toxicidad del oxígeno de la
superficie de la mucosa o para desplazarse a través del moco intestinal
(Hampson et al., 2006c). Sin embargo, esta colonización puede verse
influenciada por diversos factores como la dieta, disminuyendo
especialmente en aquellas que reducen la actividad fermentativa del
intestino grueso, o por la flora intestinal presente (Pluske et al., 1996,
1998; Jacobson et al., 2004; Mølbak et al., 2007).
32 Introducción
B. hyodysenteriae tiene un carácter invasivo muy limitado. Antes
de la aparición de las primeras lesiones, la presencia de la bacteria se
restringe a la luz intestinal. A medida que las lesiones progresan, se
observa también en las criptas intestinales y entre los enterocitos
adyacentes a las mismas, llegando a invadir el interior de las células
caliciformes, secretoras de moco, y de los enterocitos. El deterioro de las
células intestinales puede llegar a causar necrosis, quedando los
capilares subyacentes expuestos, lo que produce una hemorragia de
intensidad variable. Los mecanismos de destrucción tisular no son
conocidos, aunque se cree que tanto la hemolisina como los
lipooligosacáridos de la membrana bacteriana externa actúan a nivel
local, favoreciendo la disgregación de los enterocitos. No obstante, la
invasión no supera la lámina propia y no se considera esencial para la
producción de lesiones (Glock et al., 1974; Hampson et al., 1997).
La presencia de diarrea es el resultado de la supresión del sistema
de absorción de iones de sodio y cloro desde la luz intestinal del colon a
la sangre, mientras que la permeabilidad de la mucosa y el transporte
desde la sangre a la luz intestinal permanecen inalterados a pesar de las
lesiones. Del mismo modo, se ha comprobado que el desarrollo de
diarrea es independiente de los niveles de adenosín y guanosín
monofosfato cíclicos, diferenciándose así de los mecanismos que
emplean otros patógenos entéricos como Escherichia coli
enterotoxigénico o Salmonella spp. para producir diarrea (Argenzio et
al., 1980a; Schmall et al., 1983). Por otro lado, el intestino delgado
permanece funcional, con su capacidad de absorción íntegra y sin un
aumento de la actividad secretora (Argenzio, 1980b). Es, por tanto, la
falta de funcionalidad del colon para reabsorber fluidos la que
desencadena una deshidratación progresiva, pudiendo desembocar, en
los casos más graves, en la muerte del animal.
Introducción 33
3.5. Signos clínicos
La presentación clínica más característica de la disentería porcina
cursa con diarrea mucohemorrágica, si bien no es la única, ya que la
gravedad de la enfermedad y sus signos clínicos varían tanto entre
animales de una misma explotación como entre explotaciones. Entre los
factores que influyen en su presentación se encuentran la virulencia de la
cepa de B. hyodysenteriae implicada, el grado de inmunidad de los
cerdos, el empleo de sustancias antimicrobianas, la concurrencia de otras
enfermedades y la dieta. No obstante, el signo clínico más consistente es
la presencia de diarrea.
Inicialmente, las heces se presentan con una consistencia
disminuida y con cambios en su coloración, adquiriendo tonos
amarillentos o grisáceos. Algunos animales pueden padecer anorexia,
que no llega a ser total, o sufrir un aumento de la temperatura corporal
(40-40,5 ºC). De manera progresiva, aparecen restos de moco y fibrina
en las heces, que se acompañan de estrías de sangre sin digerir. La
pérdida de consistencia de las heces aumenta y pasan a ser acuosas, de
color oscuro, achocolatadas, conteniendo cada vez mayor cantidad de
moco y sangre. Los animales adelgazan y con frecuencia aparecen con la
espalda arqueada, los flancos hundidos y visiblemente deprimidos.
Aunque se recuperen de la enfermedad, su ganancia de peso media diaria
y el índice de conversión de alimento permanecen afectados.
En aquellos casos en los que la diarrea persiste, los animales se
muestran sedientos y débiles, mostrando signos de incoordinación y
emaciación. Si sobreviene la muerte, está asociada a la deshidratación,
acidosis e hiperpotasemia (Hampson et al., 1997, 2006c).
34 Introducción
3.6. Cuadro lesional
3.6.1. Lesiones macroscópicas
Las lesiones asociadas a la disentería porcina se restringen al
intestino grueso, localizándose sobre todo en el colon, que puede verse
afectado en su totalidad o de forma parcial. En la fase aguda de la
enfermedad existe hiperemia y edema de la pared intestinal, claramente
visible entre espirales adyacentes del colon (Weiss, 1989). Los ganglios
linfáticos mesentéricos pueden estar aumentados de tamaño y puede
existir ascitis. En ocasiones, son visibles pequeñas elevaciones
redondeadas en la superficie de la serosa del colon, resultado de la
proliferación de linfocitos en la submucosa (Figura 6). En el interior del
colon, la mucosa se cubre de moco y fibrina, pudiendo aparecer
pequeñas hemorragias.
Figura 6. Colon de un cerdo de veinticinco kilos con disentería porcina.
Introducción 35
A medida que la enfermedad se cronifica, el edema de la pared del
colon se hace menos evidente, las lesiones de la mucosa se hacen más
difusas y aumenta la exudación de fibrina, que llega a formar
pseudomembranas que contienen moco y sangre (Hampson et al., 1997).
3.6.2. Lesiones microscópicas
Las lesiones microscópicas se localizan, al igual que los hallazgos
de necropsia, exclusivamente en el intestino grueso, preferentemente en
el colon. En las primeras fases de la enfermedad, el estudio
histopatológico revela un engrosamiento de la capa mucosa y
submucosa, debido a la congestión vascular, extravasación de fluidos y
acúmulo de glóbulos blancos (Hampson et al., 1997). Se acompaña de
hiperplasia de células caliciformes. Puede observarse como B.
hyodysenteriae aparece en el fondo de las criptas intestinales, en el
interior de las células caliciformes o incluso entre las paredes laterales de
los enterocitos (Weiss, 1989). A medida que la enfermedad progresa, los
enterocitos pierden cohesión, degeneran, se necrosan y se desprenden de
la superficie del epitelio intestinal. La mucosa erosionada puede ser
invadida por distintos microorganismos e incluso algún capilar puede
verse afectado, mezclándose la sangre extravasada con el moco que
recubre la superficie de la luz intestinal. Algunas espiroquetas alcanzan
el interior de los enterocitos, así como la lámina propia, dónde se
produce un aumento del número de glóbulos blancos, especialmente
neutrófilos.
En las lesiones crónicas se evidencia una acumulación de moco,
fibrina y restos de células descamadas de la mucosa en el fondo de las
criptas intestinales, pudiendo llegar a observarse una gruesa
pseudomembrana fibrinosa sobre la superficie lesionada. Aunque la
36 Introducción
erosión de la mucosa puede ser difusa, no avanza en profundidad, siendo
rara la aparición de úlceras (Hampson et al., 2006c). El incremento de
neutrófilos en la lámina propia es notable.
3.7. Diagnóstico
Los signos clínicos y los hallazgos de necropsia son orientativos de
la enfermedad causada por B. hyodysenteriae. Sin embargo, existen otras
afecciones que cursan con un cuadro clínico similar a la disentería
porcina y que pueden ser confundidas con esta. Entre ellas destacan la
forma aguda de la enteritis proliferativa, producida por Lawsonia
intracellularis; la espiroquetosis intestinal porcina, por B. pilosicoli; la
salmonelosis y la infestación por Trichuris suis. Además,
B. hyodysenteriae puede presentarse asociada a estos u otros agentes,
haciendo que el diagnóstico basado en el cuadro clínico y lesional sea
aún más confuso (Møller et al., 1998; Thomson et al., 2001; La et al.,
2006; Nathues et al., 2007). Las úlceras gástricas u otras enfermedades
que cursen con la presencia de sangre en las heces también pueden ser
confundidas con disentería (Hampson et al., 2006c). A todo esto hay que
añadir que el ganado porcino puede ser colonizado por otras especies de
espiroquetas intestinales. Por ello, la identificación en el laboratorio del
agente etiológico a nivel de especie es indispensable para un diagnóstico
exacto de la disentería porcina.
El empleo de medios selectivos para la siembra de muestras, tanto
de heces como de raspados de mucosa intestinal, y la posterior
identificación mediante PCR o pruebas bioquímicas es el método más
empleado en los procedimientos rutinarios de diagnóstico directo de la
disentería porcina [ver sección 2.4.].
Introducción 37
A día de hoy no existen herramientas comerciales para el
diagnóstico indirecto de esta enfermedad. Sin embargo, se han realizado
numerosos esfuerzos para lograr un diagnóstico serológico (La et al.,
2001) con algunos resultados prometedores para la detección de las
granjas infectadas (La et al., 2009a).
3.8. Tratamiento y control
En la actualidad, las opciones para el tratamiento y el control de la
disentería porcina son escasas e implican, casi necesariamente, el empleo
de sustancias antibióticas. Entre los principios activos que han sido más
utilizados en los últimos años se encuentran la tilosina, la tiamulina, la
valnemulina y la lincomicina. Más recientemente se ha sumado a esta
lista un nuevo compuesto macrólido, la tilvalosina.
Junto a la elección del antibiótico, debe de ser considerada la ruta
de administración del mismo. En casos agudos es recomendable
administrar el fármaco por vía parenteral durante tres días, aunque la
medicación en agua de bebida durante un mínimo de diez días puede ser
igualmente útil. Si se opta por el tratamiento mediante pienso medicado,
la duración del tratamiento será de un mínimo de catorce días,
debiéndose considerar el riesgo de no alcanzar la dosis terapéutica como
consecuencia del descenso en la ingesta de pienso. Tras este primer
tratamiento, es habitual medicar el pienso durante dos o cuatro semanas
a dosis inferiores para prevenir la reinfección. Es importante garantizar
el acceso de los animales al agua de bebida, a la que puede adicionarse
electrolitos.
Unas buenas prácticas de manejo dirigidas a disminuir el riesgo de
reinfección y el avance de la enfermedad en la explotación deben de
38 Introducción
acompañar siempre al tratamiento antibiótico. Entre ellas destacan el
manejo de animales “todo dentro-todo fuera” y una limpieza y
desinfección cuidadosa de las instalaciones. De igual modo, han de
controlarse posibles vectores de transmisión de la enfermedad, siendo
necesario aplicar un programa de control de roedores o revisar el
vigente.
Aunque en la actualidad no existe una vacuna registrada contra la
disentería porcina, el empleo de bacterinas ha demostrado ser útil en el
control de la enfermedad (Fernie et al., 1983; Diego et al., 1995; Waters
et al., 1999). Estas vacunas inactivadas confieren un cierto grado de
protección y minimizan el cuadro clínico, aunque tienden a ser
específicas de serogrupo (Hampson et al., 2006c).
Otras medidas que pueden ayudar a controlar la enfermedad son
las relacionadas con la dieta. La adición de carbohidratos altamente
fermentables, como la inulina de la achicoria, tiene un efecto protector
(Thomsen et al., 2007; Hansen et al., 2010), así como las dietas
altamente digestibles (Pluske et al., 1996; Siba et al., 1996).
4. B. hyodysenteriae, antibióticos y resistencias
A lo largo de los últimos veinte años el arsenal antimicrobiano
disponible para la prevención, tratamiento y control de la disentería
porcina se ha visto disminuido drásticamente por diversas razones.
Por un lado, algunas de las sustancias farmacológicas empleadas
comúnmente en Europa en el pasado han sido incluidas en listas
negativas, no permitiéndose actualmente su utilización en animales o
productos de origen animal destinados al consumo humano por el riesgo
que entrañan para la salud. Este es el caso del dimetridazol y del
Introducción 39
ronidazol, dos nitroimidazoles que han sido prohibidos por su potencial
mutagénico y carcinogénico no solo en Europa (CEE Nº 2377/90), sino
también en otros países como Estados Unidos (21 CFR 530.41) o
Canadá (SOR/2003-292). De forma similar, tanto el carbadox como el
olaquindox, que se han mostrado muy eficaces en la profilaxis de la
disentería porcina (Raynaud et al., 1981; Kitai et al., 1987; Messier et
al., 1990), han sido prohibidos en Europa por sus posibles efectos
adversos en la salud humana (CE Nº 2788/98).
Por otro lado, la regulación europea sobre el uso de antibióticos
como aditivos en la alimentación animal, surgida como respuesta a la
creciente preocupación por el riesgo de aparición de resistencias
cruzadas a antibióticos utilizados en medicina humana, ha resultado en la
prohibición total del uso de fármacos como promotores del crecimiento a
partir del 1 de enero de 2006 (CE N° 1831/2003). Algunos de ellos,
como la virginiamicina o la tilosina, habían sido empleados con distinto
éxito en el control de B. hyodysenteriae (Olson et al., 1976; Rønne et al.,
1992). Se ha sugerido que la exclusión del uso de antibióticos como
promotores del crecimiento ha desencadenado un aumento de la
patología entérica en los animales de abasto que, hasta entonces,
posiblemente estaba enmascarada por la acción profiláctica de estas
sustancias (Casewell et al., 2003).
Al mismo tiempo, la eficacia de algunos de los fármacos indicados
para el tratamiento y control de la disentería porcina ha disminuido,
apareciendo aislados de B. hyodysenteriae resistentes a una o varias de
estas sustancias antimicrobianas (Buller et al., 1994; Molnár, 1996;
Gresham et al., 1998; Fellström et al., 1999; Lobová et al., 2004). Este
hecho, sumado a la escasa lista de principios activos disponibles en la
actualidad para el tratamiento, hace que el éxito terapéutico en las
40 Introducción
explotaciones ganaderas afectadas se vea comprometido. Además, la
posible diseminación de estas cepas resistentes debe de ser considerada
como una amenaza para la industria porcina (Karlsson et al., 2002).
En la actualidad, los fármacos disponibles para el tratamiento de la
disentería porcina pertenecen a un número muy limitado de familias de
antibióticos, usándose principalmente macrólidos, lincosamidas y
pleuromutilinas. Todos ellos tienen una diana terapéutica común, el
ribosoma bacteriano, dónde interfieren con la síntesis proteica.
4.1. El ribosoma bacteriano
El ribosoma bacteriano, con un tamaño de 70S, es una estructura
supramolecular que está compuesta a su vez por dos subunidades. La
subunidad mayor, de 50S, está integrada por dos tipos de ARNr, uno de
5S y otro de 23S, y por 34 proteínas ribosómicas (L1-L34). Por su parte,
la subunidad menor, de 30S, se compone de ARNr 16S y de 21 proteínas
(S1-S21) (Kaltschmidt et al., 1970). En total, el contenido de ARN
supera al de proteínas en el ribosoma en una relación de tres a dos.
Los ribosomas son estructuras clave en la biosíntesis de proteínas.
Actúan como traductores de la información genética, convirtiendo la
secuencia de nucleótidos del ARNm en cadenas de aminoácidos. Este
proceso se conoce como traducción del material genético, pudiendo ser
dividido en tres fases. En la fase de inicio las dos subunidadades del
ribosoma se acoplan al ARNm y al ARNt que porta el aminoácido
correspondiente al primer codón, constituyendo el complejo de inicio.
Este paso está facilitado por los factores de inicio, IF-1, IF-2 e IF-3.
Introducción 41
Figura 7. Fase de elongación de la síntesis de proteínas en el ribosoma bacteriano.
Seguidamente sobreviene la fase de elongación, que abarca desde
la formación del primer enlace peptídico hasta la adición del último
aminoácido codificado en el ARNm. Esta fase se desarrolla en el seno de
la subunidad 50S, en la que se definen el sitio-A y el sitio-P
(Figura 7, A). El peptidil-ARNt ocupa el sitio-P, mientras que el sitio-A
es ocupado por el aminoacil-ARNt, determinado por el codón
correspondiente del ARNm. A continuación se forma un enlace
peptídico entre el grupo carboxilo del péptido en formación, ubicado en
el sitio-P, y el grupo amino libre del aminoácido en el sitio-A. El centro
peptidil transferasa, correspondiente al dominio V del ARNr 23S,
cataliza la formación de esta unión (Figura 7, B). Además, diversos
factores de elongación (EF-Tu, EF-Ts y EF-G) participan en esta etapa.
La incipiente cadena de aminoácidos permanece unida al ARNt del
42 Introducción
último aminoácido adicionado, en el sitio-A, liberándose el ARNt que
ocupaba el sitio-P (Figura 7, C). En este momento se produce la
translocación del peptidil-ARNt, que ya cuenta con un aminoácido más,
desde el sitio-A al sitio-P, quedando el primero libre. El ribosoma se
desplaza sobre el ARNm en dirección 5’→3’ y el ciclo comienza de
nuevo con el siguiente codón (Figura 7, D). En la fase de terminación se
libera la cadena polipeptídica recién formada y el ARNm se separa del
ribosoma. Existen factores de terminación que colaboran en este último
paso.
4.2. Antibióticos y mecanismos de acción
4.2.1. Macrólidos
El grupo de los macrólidos incluye antibióticos naturales,
semisintéticos y sintéticos que tienen en común una estructura química
formada por un gran anillo lactónico al que se unen dos o tres restos de
desoxiazúcares. Este anillo hace que se comporten como bases débiles,
absorbiéndose mejor a pH alcalino, y que tengan una baja solubilidad en
agua. Además, los macrólidos pueden dividirse en función del número
de átomos de carbono que tiene el anillo lactónico, siendo aquellos
compuestos con 14, 15 y 16 átomos los más relevantes clínicamente. Por
lo general, ejercen una acción bacteriostática, actuando sobre la
subunidad 50S del ribosoma. Son particularmente eficaces frente a
microorganismos gram-positivos, aunque también actúan sobre algún
gram-negativo.
El primer antibiótico de este grupo en ser descubierto fue la
eritromicina, aislada en 1952 a partir de una cepa de Streptomyces
erythreus (McGuire et al., 1952), actualmente denominado
Introducción 43
Saccharopolyspora erythraea (Labeda, 1987). La eritromicina cuenta
con un anillo lactónico de 14 átomos de carbono, siendo el arquetipo del
grupo de los macrólidos y uno de los antibióticos más estudiados.
Existen otros muchos antibióticos que se incluyen en este grupo, como la
espiramicina, la josamicina, la claritromicina o los quetólidos,
macrólidos de tercera generación. Sin embargo, solamente la tilosina y la
tilvalosina, dos macrólidos de 16 átomos de carbono, tienen importancia
en el tratamiento de la disentería porcina. La tilosina es un antibiótico de
origen natural, producido por Streptomyces fradiae, para uso exclusivo
veterinario (McGuire et al., 1961). Streptomyces thermotolerans es
capaz de transformar la tilosina en tilvalosina, también conocida como
aivlosin o acetil-isovaleril tilosina, que alcanza mayores concentraciones
en sangre (Okamoto et al., 1980a, 1980b).
El mecanismo de acción de los macrólidos se basa en la inhibición
de la síntesis proteica mediante el bloqueo de la entrada del túnel por el
que sale el péptido del ribosoma, forzando de este modo la disociación
prematura del peptidil-ARNt (Andersson et al., 1987; Menninger, 1995;
Schlünzen et al., 2001). Para ello interaccionan en las proximidades del
nucleótido en posición 2058 (numerado en relación a Escherichia coli)
del domino V del ARNr 23S, pudiendo algunos macrólidos de 16
átomos de carbono interaccionar también con el domino II (Poulsen et
al., 2000; Hansen et al., 2002). Además, impiden el ensamblaje de la
subunidad 50S, necesaria para la síntesis proteica (Chittum et al., 1995;
Champney et al., 1998). Aunque la tilosina comparte los anteriores
puntos de unión con otros macrólidos, también es capaz de interaccionar
con el nucleótido en posición 2506 (numerado en relación a E. coli) del
domino V del ARNr 23S. Esta mayor afinidad por el centro peptidil
transferasa hace que su mecanismo de acción difiera ligeramente, siendo
capaz de inhibir la formación del enlace peptídico (Poulsen et al., 2000).
44 Introducción
4.2.2. Lincosamidas
Las lincosamidas son un grupo de antibióticos que junto con los
macrólidos y las estreptograminas integran una superfamilia conocida
como MLS. Los tres comparten mecanismos de acción, espectro
antibacteriano y propiedades farmacológicas, aunque presentan
estructuras químicas diferentes.
La lincomicina, producida por Streptomyces lincolnensis, es un
monoglucósido con una cadena lateral aminoacídica y fue el primer
integrante del grupo de las lincosamidas en ser descubierto (Mason et al.,
1963). Posteriores modificaciones sobre este compuesto dieron lugar a
otros antibióticos semisintéticos del grupo, como la clindamicina o su
análogo, la pirlimicina. La lincomicina se emplea en el tratamiento de la
disentería porcina.
Al igual que los macrólidos, las lincosamidas inhiben la síntesis
proteica al interaccionar con la unidad 50S del ribosoma bacteriano.
Ambos grupos comparten sitios de unión con el dominio V del ARNr
23S, como el nucleótido 2058 y el 2059. Asimismo, las lincosamidas
interaccionan con el nucleótido en posición 2505 (numerado en relación
a E. coli). La disposición espacial de las lincosamidas al unirse a la
subunidad mayor del ribosoma, superponiéndose al sitio-A y al sitio-P,
hace que interfieran con el posicionamiento normal del aminoacil-ARNt
y del peptidil-ARNt, bloqueando la formación del enlace peptídico
(Schlünzen et al., 2001).
Introducción 45
4.2.3. Pleuromutilinas
Las pleuromutilinas son un grupo de antibióticos naturales y
semisintéticos que se derivan de la pleuromutilina, un compuesto de
origen natural producido por el hongo Pleurotus mutilus, ahora conocido
como Clitopilus scyphoides (Kavanagh et al., 1951). Todas ellas
presentan un núcleo común de mutilina, un diterpeno tricíclico, al que se
añaden diversos radicales en la posición 14. Su espectro de acción es
amplio, aunque su biodisponibilidad oral es limitada, al metabolizarse
rápidamente (Brooks et al., 2001). Entre los integrantes de este grupo se
encuentran la azamulina, la retapamulina, la tiamulina y la valnemulina,
estas dos últimas empleadas exclusivamente en veterinaria.
Las pleuromutilinas establecen uniones mediante puentes de
hidrógeno e interacciones hidrofóbicas con una gran variedad de
nucleótidos del dominio V del ARNr 23S, como el 2061, el 2452, el
2505 o el 2585 (numerados en relación a E. coli). Una vez unidas,
interfieren con los sustratos del sitio-A y el sitio-P, inhibiendo la
formación del enlace peptídico y con ello la síntesis proteica (Poulsen et
al., 2001; Schlünzen et al., 2004; Gürel et al., 2009).
4.3. Mecanismos de resistencia
Los mecanismos moleculares por los que las bacterias eluden la
acción de los antibióticos son muy variados, pero de manera general,
responden a alguno de los siguientes casos: modificación del antibiótico,
alteración de su lugar de actuación o dificultad para alcanzar la diana
terapéutica, ya sea por una escasa permeabilidad o por una expulsión
activa.
46 Introducción
El descenso de la sensibilidad de aislados de B. hyodysenteriae a
los escasos antibióticos disponibles para tratar la disentería porcina se ha
relacionado con alteraciones en el lugar de acción. Esta bacteria posee
un único operón de ARNr (Zuerner et al., 1994), facilitando que
mutaciones puntuales del mismo puedan conferir resistencia a los
antibióticos que tienen como diana su transcrito (Vester et al., 2001).
Además, varios de los antibióticos que se emplean contra esta bacteria
comparten no solo diana terapéutica, sino también nucleótidos de unión.
De este modo, se ha descrito que tanto la transversión de la adenina en
posición 2058 del dominio V del ARNr 23S (numerado en relación a E.
coli) a timina, como su transición a guanina (Figura 8), producen
resistencia a los macrólidos y a las lincosamidas en B. hyodysenteriae
(Karlsson et al., 1999). Por otro lado, la resistencia a las pleuromutilinas
podría estar causada por diversas mutaciones puntuales que afectan a los
sitios de unión de manera indirecta, alterando la flexibilidad del centro
peptidil transferasa (Long et al., 2009). Así, se han encontrado
mutaciones de los nucleótidos en las posiciones 2032, 2055, 2447, 2499,
2504 y 2572 (numerados en relación a E. coli) del dominio V del ARNr
23S de B. hyodysenteriae que se asocian con resistencia a las
pleuromutilinas (Figura 8). Además, se cree que cambios en los
aminoácidos en las posiciones 148 y 149 de la proteína ribosómica L3
(numerados en relación a B. pilosicoli), cercanos al centro peptidil
transferasa, son capaces de producir resistencia a la tiamulina en
Brachyspira spp. (Pringle et al., 2004).
La resistencia in vitro a los macrólidos y a las lincosamidas se
desarrolla de forma rápida, siendo necesarias menos de dos semanas para
obtener cepas resistentes mediante cultivo en medios suplementados con
tilosina (Karlsson et al., 1999). Esto contrasta con el desarrollo de la
resistencia a la tiamulina, mucho más lento y gradual, donde una única
Introducción 47
mutación no es suficiente para alcanzar altos niveles de resistencia
(Karlsson et al., 2001; Pringle et al., 2004). Ambas observaciones están
en concordancia con los mecanismos moleculares de resistencia
subyacentes.
Figura 8. Estructura secundaria de la región central del dominio V del ARNr 23S de
Escherichia coli (J01695). Los círculos negros indican posiciones relevantes para la
resistencia a macrólidos, lincosamidas o pleuromutilinas en B. hyodysenteriae (Ver
texto).
Trabajos de investigación 51
ESTUDIO I
Antimicrobial susceptibility testing of Spanish field isolates of Brachyspira hyodysenteriae.
Hidalgo, Á., Carvajal, A., García-Feliz, C.,
Osorio, J., Rubio, P.
Research in Veterinary Science 87, 7-12 (2009).
I
Research in Veterinary Science 87 (2009) 7–12
Contents lists available at ScienceDirect
Research in Veterinary Science
journal homepage: www.elsevier .com/locate / rvsc
Antimicrobial susceptibility testing of Spanish field isolatesof Brachyspira hyodysenteriae
Á. Hidalgo *, A. Carvajal, C. García-Feliz, J. Osorio, P. RubioDepartment of Animal Health (Infectious Diseases and Epidemiology), Veterinary Faculty, University of León, Spain
a r t i c l e i n f o a b s t r a c t
Article history:Accepted 31 October 2008
Keywords:Brachyspira hyodysenteriaeAntimicrobial susceptibility testingSwine dysentery
0034-5288/$ - see front matter � 2008 Elsevier Ltd. Adoi:10.1016/j.rvsc.2008.10.017
* Corresponding author. Tel.: +34 987 291306; fax:E-mail address: [email protected] (Á. Hida
This study is the first conducted in Spain to evaluate antimicrobial susceptibility of field isolates ofBrachyspira hyodysenteriae. One hundred and eight isolates of the bacterium, recovered from differentSpanish swine farms between 2000 and 2007, were investigated. The minimum inhibitory concentrations(MIC) of erythromycin, tylosin, tiamulin, valnemulin, clindamycin and lincomycin were determined usinga broth microdilution technique. Most of the isolates showed poor susceptibility to erythromycin(MIC90 > 256 lg/ml), tylosin (MIC90 > 256 lg/ml), clindamycin (MIC90 > 4 lg/ml) and lincomycin(MIC90 = 128 lg/ml). Reduced susceptibility to tiamulin and valnemulin was observed with aMIC > 2 lg/ml in 17.6% and 7.41% of the B. hyodysenteriae isolates, respectively. Moreover, a survival anal-ysis permitted the detection of an increasing trend in the MIC values for almost all the antimicrobialsused in the treatment of swine dysentery when comparing recent isolates (from 2006 to 2007) with thoserecovered in earlier years (between 2000 and 2004).
� 2008 Elsevier Ltd. All rights reserved.
1. Introduction
Swine dysentery (SD) is a severe muco-haemorrhagic colitisarising from colonization of the large intestine of pigs by Brachyspirahyodysenteriae (formerly Serpulina hyodysenteriae), a strongly b-hae-molytic spirochaete (Hampson et al., 2006). The condition is seenmainly in grower or finisher pigs and less commonly in weaners,and it is characterized by obvious, wet, porridge-like diarrhoea thatleads to dehydration, weight loss and, in extreme cases, death. Thefaeces are grey to chocolate-brown in colour and may contain plugsof mucus or flecks of fresh blood (Hampson et al., 2006). Althoughthis condition is quite variable in its severity, SD is considered to beone of the most significant production-limiting porcine infections(Hampson et al., 1997), and it causes considerable financial lossesarising from mortality, decreased growth rates, poor feed conversion,and treatment expenses (Hampson et al., 2006).
Due to the lack of commercial vaccines, the control and treat-ment of SD involves the use of antimicrobials, with tiamulin, val-nemulin, tylosin and lincomycin as the drugs most commonlyused for this purpose in the European Union (EU) (Hampsonet al., 2006). However, the control of SD has been complicatednowadays by the emergence of strains of B. hyodysenteriae with re-duced susceptibility to one or more of these antimicrobials re-cently reported in several countries (Molnar, 1996; Karlssonet al., 2001, 2003; Lobova et al., 2004; Rohde et al., 2004). As a con-sequence, careful use of the limited range of effective drugs cur-
ll rights reserved.
+34 987 291304.lgo).
rently available is now recommended (Karlsson et al., 2002a),and the monitoring of resistance in clinical isolates of B. hyody-senteriae has become highly desirable (Karlsson et al., 2002a;Rohde et al., 2004).
The development of pig production in Spain has been spectacu-lar. It reached 3.3 million Tm in 2006, which is the second highestoutput in the EU (data from the Ministry of Agriculture and Live-stock). A recent study concluded that SD is a major cause of diar-rhoea among pigs of all ages that are raised on commercial farmsin Spain (Carvajal et al., 2006). B. hyodysenteriae was identified in32% of the farms and 12% of the faecal specimens collected fromcommercial pig farms with clinical signs of diarrhoea. In spite oftheir clinical importance, there are no previous data regardingthe susceptibility of B. hyodysenteriae field isolates from Spain toantimicrobial agents.
The research reported here reports on the in vitro susceptibilityof Spanish field isolates of B. hyodysenteriae to several of the drugscommonly used in the treatment and control of SD. A second aimwas to determine whether the activity profile of any of these anti-microbial agents diminished over time.
2. Materials and methods
2.1. Bacterial strains and growth conditions
One hundred and eight field isolates of B. hyodysenteriae, ob-tained from faecal samples of pigs suffering from diarrhoea andsubmitted to the Laboratory of Infectious diseases in the Veterinary
8 Á. Hidalgo et al. / Research in Veterinary Science 87 (2009) 7–12
Faculty at the University of Leon between January 2000 andNovember 2007 for diagnostic examination, were investigated.One single B. hyodysenteriae isolate was tested per farm. The sam-pled farms were distributed all over the country.
For primary isolation, faecal samples were cultured on tryptosesoy agar (TSA) medium supplemented with 5% ovine blood andantibiotics, as previously described by Jenkinson and Wingar(1981). Plates were incubated in an anaerobic atmosphere (10%hydrogen, 10% carbon dioxide and 80% nitrogen) at 39 �C. The bac-teria were identified as B. hyodysenteriae according to their strongb-haemolysis and using a species-specific PCR based on the 23SrRNA gene (Leser et al., 1997). PCR, specific for Brachyspira pilosicoli(Muniappa et al., 1997), was performed on all the isolates to ex-clude the concomitance of this Brachyspira specie. Thereafter,plates positive for B. hyodysenteriae were subcultured until thepure state was reached on the TSA plates supplemented with 5%ovine blood (TSA-blood) in an anaerobic atmosphere, as mentionedabove. The purity of all isolates was checked by phase-contrastmicroscopy. These isolates were stored in liquid nitrogen at theDepartment of Animal Health of the University of Leon, Spain.
The reference and type strains, B204 (ATCC 31212) and B78T
(ATCC 27164T), were used as controls.
2.2. Antimicrobial agents and antibiotic panel
A susceptibility testing panel was designed using the followingsix antimicrobial agents: tiamulin hydrogen fumarate, valnemulinhydrochloride (Novartis Animal Health), tylosin tartrate, erythro-mycin (Sigma–Aldrich), clindamycin hydrochloride (Upjohn AB),and lincomycin hydrochloride (Pharmacia Animal Health).
Stock solutions of each of the antimicrobials were preparedwith appropriate solvents according to the manufacturers’ recom-mendations and stored at 4 �C. Five microliters of twofold serialdilutions in sterile Milli-Q water (Millipore) of each of the antimi-crobials tested (for the range of final concentrations, see Fig. 1)were poured into 48-well tissue culture trays (IWAKI). Two wellswere left empty and served as positive and negative growth con-trols. Plates were prepared immediately before using in a safetycabinet to prevent contamination.
2.3. Broth dilution procedure
Broth dilution was performed as described by Karlsson et al.(2002a, 2003). Briefly, bacteria harvested from TSA-blood plateswere suspended in brain-heart infusion (BHI) broth to an estimatedconcentration (absorbance measuring) of 1–5 � 108 CFU/ml. Threehundred microliters of the bacterial suspension were diluted in30 ml of BHI supplemented with 10% foetal calf serum and 0.5 mlof the final suspension was dispensed per well. The panels wereincubated in anaerobic jars (GENbox, BioMerieux with AnaeroGensachets, Oxoid) for 3–5 days on a rotary agitator at 38 �C. The min-imal inhibitory concentration (MIC) was determined as the lowestconcentration of antimicrobial agent that prevented visible growth.All the isolates were tested in duplicate and one dilution step differ-ence was allowed for each antimicrobial agent between the twopanels. When this difference existed, the highest MIC value waschosen for each drug. The reference and type strains, B204 (ATCC31212) and B78T (ATCC 27164T), were also tested in duplicate atthe start and at the end of the study as quality controls of the anti-biotic panels. Aliquots (10 ll) of the positive growth control werechecked by phase-contrast microscopy to confirm pure growth.
2.4. Data processing and analysis
The strains and data yielded by the B. hyodysenteriae isolateswere divided into two groups, according to the year of isolation,
in order to study trends in antimicrobial susceptibility over time.The first group was composed of 50 strains recovered between2000 and 2004, whereas 58 isolates from 2006 and 2007 composedthe second group. The lowest concentrations that completelyinhibited the growth of 50% and 90% of the isolates, MIC50 andMIC90, respectively, were calculated for each of the antimicrobials.All data were stored and analysed using SPSS for Windows�
.
A survival analysis was employed for comparing the resistanceduring the study period, as previously described (Stegeman et al.,2006). The inhibition of bacterial growth was the event, and theconcentration of antibiotic to the event was used instead of timeto the event. This type of analysis allows for the detection ofchanges over the entire range of concentrations. Growth or growthinhibition of B. hyodysenteriae, at each antimicrobial concentrationtested, was recorded, and the data were censored when there wasno inhibition at the highest concentration level. Moreover, 2 logtransformations of the antimicrobial twofold serial dilutions wereperformed and adjusted to whole numbers starting from zero fora clearer graphical representation. Survival curves were comparedusing the Log Rank test at a = 0.05.
3. Results
3.1. Antimicrobial susceptibility testing
The MICs of the six antimicrobial agents studied for the B. hyo-dysenteriae reference and type strains, B204 (ATCC 31212) andB78T (ATCC 27164T), obtained in the present and previous studiesare shown in Table 1.
No differences higher than one dilution step for each antimicro-bial agent were found between the two panels tested for any of thefield or reference strains.
The distribution of the MICs of the six antimicrobial agents forthe Spanish field isolates of B. hyodysenteriae is presented inFig. 1. A clear unimodal population distribution was obtained forboth the macrolides tested. The MICs for erythromycin were higherthan the range of concentrations used (>256 lg/ml) for 96.3% ofthe isolates (104 out of 108). Similar results were recorded for tyl-osin, with MIC values equal to or greater than 256 lg/ml for 83.3%of the isolates (90 out of 108). In contrast, MICs for tiamulin exhib-ited a trend towards a bimodal distribution. One peak stood at0.125 lg/ml (18.5% of the isolates), with a second at values above2 lg/ml (17.6% of the isolates). For valnemulin, about one-thirdof the total population (29.6%) showed a MIC below 0.016 lg/ml,while another third (34.25%) was in the range from 0.125 to0.5 lg/ml. In the case of clindamycin, a cluster of isolates (96.3%)with MICs in the region of 4 lg/ml was evident, whereas lincomy-cin showed a considerable population (74.1% of the isolates) withMICs of around 16 lg/ml.
3.2. Changes in antimicrobial susceptibility over time
The distribution of antimicrobial resistance in the B. hyodysente-riae isolates recovered from clinical submissions in Spain from2000 to 2004 and 2006 to 2007 is summarized in Table 2. The val-ues of MIC50 and MIC90 for erythromycin, tylosin and tiamulinwere identical in both time periods. However, the MIC50 of linco-mycin and clindamycin increased by one dilution step as timeelapsed, although the MIC90 did not change. Both the MIC50 andMIC90 values increased for valnemulin in the 2006–2007 period.
To investigate trends in the activity of the antimicrobial agentsover time, a survival analysis was performed. The survival curves ofthe six antimicrobials for both periods are shown in Fig. 2. Survivalcurves for erythromycin, tylosin and clindamycin showed that alarge proportion of the isolates were able to survive at the highest
Fig. 1. Distribution of MICs of six antimicrobial agents for 108 Spanish field isolates of B. hyodysenteriae recovered between 2000 and 2007.
Table 1MICs (lg/ml) of six antimicrobial agents for type and reference strains (B78T and B204) of B. hyodysenteriae obtained in the present study and in previous studies.
MIC (lg/ml)
Erythromycin Tylosin Tiamulin Valnemulin Clindamycin Lincomycin
B78T ATCC 27164T
Fellström et al. (1999) 4 4 0.031 NT 0.063 NTKarlsson et al. (2001) NT NT 0.063 0.063 NT NTKarlsson et al. (2002a) 8 4 0.031 60.016 60.125 61Karlsson et al. (2003) 4–32 4–8 0.03–0.06 NT 0.06–0.125 NTKarlsson et al. (2004) NT 4 0.063 NT NT NTPringle et al. (2006) NT 2–16 0.016–0.063 0.008–0.031 NT 0.125–1Present study 64 8 0.031 60.016 0.063 61
B204 ATCC 31212Fellström et al. (1999) >256 >256 0.063 NT >4 NTKarlsson et al. (2001) NT NT 0.063 0.031 NT NTKarlsson et al. (2002b) NT NT 0.031–0.063 NT NT NTKarlsson et al. (2003) >256 64–>256 0.03–0.06 NT 1–>4 NTRohde et al. (2004) NT NT 0.031–0.063 0.031 NT NTPresent study >256 >256 0.063 60.016 4 32
NT: not tested.
Á. Hidalgo et al. / Research in Veterinary Science 87 (2009) 7–12 9
antimicrobial concentration used and were consequently censored.The results of the Log Rank test comparing the two periods (2000–
2004 and 2006–2007) indicated that the differences observed werestatistically significant for erythromycin (p = 0.029) and tylosin
Table 2MICs (lg/ml) of six antimicrobial agents for 108 Spanish field isolates of B.hyodysenteriae recovered between 2000 and 2007.
Year of isolation 2000–2004 (n = 50) 2006–2007 (n = 58) Total (n = 108)
ErythromycinMIC50 >256 >256 >256MIC90 >256 >256 >256Range 16–>256 >256 16–>256
TylosinMIC50 >256 >256 >256MIC90 >256 >256 >256Range 64–>256 64–>256 64–>256
TiamulinMIC50 0.25 0.25 0.25MIC90 >2 >2 >2Range 60.016–>2 60.016–>2 60.016–>2
ValnemulinMIC50 0.125 0.25 0.125MIC90 1 >2 2Range 60.016–>2 60.016–>2 60.016–>2
ClindamycinMIC50 4 >4 4MIC90 >4 >4 >4Range 0.5–>4 0.5–>4 0.5–>4
LincomycinMIC50 16 32 16MIC90 128 128 128Range 2–>128 2–>128 2–>128
10 Á. Hidalgo et al. / Research in Veterinary Science 87 (2009) 7–12
(p = 0.001). Differences did not reach but were close to statisticalsignificance for tiamulin (p = 0.091), valnemulin (p = 0.08) and clin-damycin (p = 0.071). No statistical significant differences were ob-served for lincomycin between the two studied periods (p = 0.302).
4. Discussion
The present study was the first ever performed in Spain to eval-uate MICs for the main antimicrobial agents used in the treatmentof SD. For this purpose, a set of 108 field isolates of B. hyodysente-riae recovered between 2000 and 2007 from 108 different farmsdistributed all over the country was used.
Currently, the drugs available for the treatment of SD in Spainare tiamulin, valnemulin, tylosin, lincomycin and tylvalosin (for-merly acetilisovaleryltylosin). Tiamulin, tylosin and lincomycinhave been used for treating SD for more than 20 years in Spain,whereas valnemulin was introduced later (approved in September1998, but its use was not permitted between November 1999 andDecember 2002). All of these drugs were included in this research.Clindamycin was also incorporated because it is an antimicrobialagent with MIC ranges for antimicrobial susceptibility acceptedby the CLSI, formerly known as the National Council for ClinicalLaboratory Standardization (National Committee for Clinical Labo-ratory Standards, 1997), and it represents the lincosamide group.Erythromycin was chosen as the archetypal antibiotic of the mac-rolide group. However, tylvalosin was not included in the study, asit was only recently approved for treating SD (2004).
There is no accepted or standardized method for susceptibilitytesting of B. hyodysenteriae. The disc diffusion method cannot berecommended for testing Brachyspira species (Rasback et al.,2005) or in general for anaerobic bacteria (National Committeefor Clinical Laboratory Standards, 2004). In the present study, themicro-broth dilution test, proposed by Karlsson et al. (2002a,2003), was used. Our data within this study suggests that thismethod provides reliable and repeatable results. In a first step to-wards the standardization of this test, the MIC quality controlranges for four of the antimicrobial agents used in the present
study have been proposed recently for the B. hyodysenteriae typestrain B78T (Pringle et al., 2006). The MICs obtained in the presentstudy for the B78T strain fit perfectly into the control ranges sug-gested for tylosin, tiamulin, valnemulin and lincomycin. Moreover,the results for both the reference strains tested, B204 and B78T,were very similar to those reported previously (Fellström et al.,1999; Karlsson et al., 2001, 2002a,b, 2003, 2004; Rohde et al.,2004).
The MIC50 and MIC90 values for erythromycin, tylosin and boththe lincosamides tested were similar to those reported for Austra-lian (Karlsson et al., 2002a) or Swedish isolates of the bacteria (Kar-lsson et al., 2003) by previous studies using a similar approach,while the MIC50 and MIC90 for tiamulin and valnemulin wereslightly higher among Spanish isolates. However, Rohde et al.(2004) reported higher MIC50 values than those reported here forboth pleuromutilins in 71, 40, and 102 German isolates of B. hyody-senteriae from 2000, 2001, and 2002, respectively.
Clinical breakpoints for resistance to dimetridazole, lincomycin,tiamulin and tylosin were proposed on the basis of an agar dilu-tion method for B. hyodysenteriae isolates in 1990 by Rønne andSzancer (1990). Although new and interesting data have been gen-erated with regard to the colonic content concentrations of some ofthe antimicrobial agents commonly used in the treatment of SD(Burch, 2005), Rønne and Szancer’s criteria are still used for rea-sons of comparability. However, it has been established that brothdilution tests may yield MIC values twofold lower than thosefrom the agar dilution tests (National Committee for Clinical Labo-ratory Standards, 1997; Karlsson et al., 2002a, 2003; Rohde et al.,2004).
Taking into account Rønne and Szancer’s criteria, almost all theisolates tested (99.1%) were resistant to tylosin (MIC > 4 lg/ml),and 20% of the isolates were resistant to lincomycin(MIC > 36 lg/ml). However, one-third presented MIC values of32 lg/ml, almost reaching the clinical breakpoint for lincomycinand another third of the isolates were clustered in the previousdilution step (MIC = 16 lg/ml). Hence, according to our results,there were a number of isolates with a reduced susceptibility tolincosamides, although resistance was not as widespread as resis-tance to macrolides. Poor susceptibility to macrolides among B.hyodysenteriae isolates has been shown in previous studies in othercountries (Rønne and Szancer, 1990; Karlsson et al., 2002a, 2003;Uezato et al., 2004). It is well known that macrolide and lincosa-mide antibiotics share a resistance pattern with streptogramin B,called MLSB, in several genera of bacteria (Weisblum, 1995; Vesterand Douthwaite, 2001). This is caused by the same point mutationor methylation that occurs at position 2058 (Escherichia coli num-bering) in the 23S RNA gene. MLSB resistance patterns have beenprobed successfully in Swedish field isolates of B. hyodysenteriae,although the streptogramin B association has not yet been directlydemonstrated (Karlsson et al., 1999). In accordance with this pat-tern, all isolates but one showing high MIC values for lincomycinsimultaneously presented high MIC levels for both the macrolidesbeing tested.
Pleuromutilin resistance in B. hyodysenteriae has been reportedin several countries (Molnar, 1996; Gresham et al., 1998; Karlssonet al., 2002a,b; Lobova et al., 2004; Rohde et al., 2004). According toRønne and Szancer’s criteria, isolates with MIC values higher than4 lg/ml for tiamulin should be considered as resistant. Althoughthis breakpoint exceeds the range of concentration tested, a break-point of 0.5 lg/ml was recommended for monitoring decreases insusceptibility to this drug (Karlsson et al., 2003). On this basis, al-most 30% of the Spanish field isolates of the bacteria should be re-ported as having reduced susceptibility to tiamulin, from which17.6% of the Spanish B. hyodysenteriae isolates had MICs higherthan 2 lg/ml for tiamulin. The frequency distribution of the MICvalues of tiamulin showed slight differences between each antimi-
Fig. 2. Survival curves of the log2 (MIC) values of six antimicrobial agents for 108 Spanish field isolates of B. hyodysenteriae recovered between 2000 and 2004 (� � � �) & 2006and 2007 (----).
Á. Hidalgo et al. / Research in Veterinary Science 87 (2009) 7–12 11
crobial dilution tested and those preceding and following it, prob-ably due to the slow development of tiamulin resistance both
in vivo and in vitro, as suggested by Karlsson et al. (2001). This com-plicates the setting of breakpoints.
12 Á. Hidalgo et al. / Research in Veterinary Science 87 (2009) 7–12
On the other hand, a limited number of isolates (7.4%) had MICvalues higher than 2 lg/ml for valnemulin. This percentage shouldbe expected to include isolates that are resistant or have reducedsusceptibility, according to the Novartis product information (val-nemulin break points: susceptible 61 lg/ml; resistant >5 lg/ml).Moreover, all of them had MIC values higher than 2 lg/ml for tiam-ulin. About one-third (29.6%) of the Spanish field isolates of B. hyo-dysenteriae showed MIC values lower than 0.016 lg/ml forvalnemulin, and all of them displayed MICs lower than 0.5 lg/mlfor tiamulin. The existence of cross-resistance within a class ofan antimicrobial agent is a problem that is often encounteredand has been proposed for the two pleuromutilins in B. hyodysente-riae isolates (Lobova et al., 2004). In contrast, the lack of cross-resistance for tiamulin and valnemulin in a L3 mutant strain ofE. coli has also recently been described (Long et al., 2006).
The second aim of this study was to monitor the trend in MICvalues of Spanish field isolates of B. hyodysenteriae over recentyears. Antimicrobial resistance has become a major public healthissue, and the EU has recently initiated several actions, includingthe removal of all antimicrobials used as growth promoters fromanimal husbandry with effect from January 2006 (Regulation EC1831/2003) in an effort to decrease the development of antimicro-bial resistance. This new framework has considerably complicatedthe control of gastro-intestinal diseases of swine, such as SD. Thefield isolates of B. hyodysenteriae were divided into two groupsby period of isolation, 2000–2004 or 2006 and 2007.
Survival analysis showed that resistance to erythromycin andtylosin increased significantly during the study period. Moreover,differences also came close to statistical significance for tiamulin,valnemulin, and clindamycin. For all the antimicrobials tested, sur-vival curves showed that a larger percentage of B. hyodysenteriaeisolates from 2006 and 2007 were able to survive at the highestconcentration, as compared with those from 2000 to 2004.
In conclusion, the results of the present study confirmed thepresence of resistance to the main antimicrobials used in the treat-ment of SD, as well as a trend toward a decrease in antimicrobialsusceptibility over time among Spanish field isolates of B. hyody-senteriae. Taking into consideration the limited number of antibiot-ics available for the control of this disease, in vitro susceptibilitytests must be strongly recommended before the establishment ofany specific treatment, while resistance monitoring should bedeveloped in order to detect new and emerging resistance trends.Moreover, survival analysis revealed itself to be a very useful toolfor studying trends in antimicrobial resistance in these bacteria,allowing the detection of significant differences not evident whencomparing MIC50 and MIC90 values and getting around the lack ofreliable breakpoints.
Acknowledgements
The authors wish to express their thanks to G.F. Bayón for provid-ing excellent technical assistance. This work was funded by the Min-isterio de Educación y Ciencia [Spanish Ministry of Education andScience] and co-financed by the European Regional DevelopmentFunds (ERDF) as Project AGL2005-01976/GAN (January 2006).
References
Burch, D.G.S., 2005. Pharmacokinetic, pharmacodynamic and clinical correlationsrelating to the therapy of colonic infections in the pig and breakpointdeterminations. The Pig Journal 56, 8–24.
Carvajal, A., de Arriba, M.L., Rodríguez, H., Vidal, A.B., Duhamel, G.E., Rubio, P., 2006.Prevalence of Brachyspira species in pigs with diarrhoea in Spain. VeterinaryRecord 158, 700–701.
Fellström, C., Karlsson, M., Pettersson, B., Zimmerman, U., Gunnarsson, A., Aspan, A.,1999. Emended descriptions of indole-negative and indole-positive isolates ofBrachyspira (Serpulina) hyodysenteriae. Veterinary Microbiology 70, 225–238.
Gresham, A.C., Hunt, B.W., Dalziel, R.W., 1998. Treatment of swine dysentery –problems of antibiotic resistance and concurrent salmonellosis. VeterinaryRecord 143, 619.
Hampson, D.J., Atyeo, R.F., Combs, B.G., 1997. Swine dysentery. In: Hampson, D.J.,Stanton, T.B. (Eds.), Intestinal Spirochaetes in Domestic Animals and Humans.CAB International, Wallingford, UK, pp. 175–209.
Hampson, D.J., Fellstrom, C., Thomson, J.R., 2006. Swine dysentery. In: Straw, B.E.,Zimmerman, J.J., D’Allaire, S., et al. (Eds.), Diseases of Swine, ninth ed. BlackwellPublishing Professional, Ames, IA, USA, pp. 785–805.
Jenkinson, S.R., Wingar, C.R., 1981. Selective medium for the isolation of Treponemahyodysenteriae. Veterinary Record 109, 384–385.
Karlsson, M., Fellstrom, C., Heldtander, M.U., Johansson, K.E., Franklin, A., 1999.Genetic basis of macrolide and lincosamide resistance in Brachyspira (Serpulina)hyodysenteriae. FEMS Microbiology Letters 172, 255–260.
Karlsson, M., Gunnarsson, A., Franklin, A., 2001. Susceptibility to pleuromutilins inBrachyspira (Serpulina) hyodysenteriae. Animal Health Research Reviews 2, 59–65.
Karlsson, M., Oxberry, S.L., Hampson, D.J., 2002a. Antimicrobial susceptibilitytesting of Australian isolates of Brachyspira hyodysenteriae using a new brothdilution method. Veterinary Microbiology 84, 123–133.
Karlsson, M., Rohde, J., Kessler, M., Franklin, A., 2002b. Decreased susceptibility totiamulin in German isolates of Brachyspira hyodysenteriae. In: Proceedings,International Pig Veterinary Society, 17th Congress, Ames, IA, USA, p. 189.
Karlsson, M., Fellstrom, C., Gunnarsson, A., Landen, A., Franklin, A., 2003.Antimicrobial susceptibility testing of porcine Brachyspira (Serpulina) speciesisolates. Journal of Clinical Microbiology 41, 2596–2604.
Karlsson, M., Aspan, A., Landen, A., Franklin, A., 2004. Further characterization ofporcine Brachyspira hyodysenteriae isolates with decreased susceptibility totiamulin. Journal of Medical Microbiology 53, 281–285.
Leser, T.D., Moller, K., Jensen, T.K., Jorsal, S.E., 1997. Specific detection of Serpulinahyodysenteriae and potentially pathogenic weakly beta-haemolytic porcineintestinal spirochaetes by polymerase chain reaction targeting 23S rDNA.Molecular and Cellular Probes 11, 363–372.
Lobova, D., Smola, J., Cizek, A., 2004. Decreased susceptibility to tiamulin andvalnemulin among Czech isolates of Brachyspira hyodysenteriae. Journal ofMedical Microbiology 53, 287–291.
Long, K.S., Hansen, L.H., Jakobsen, L., Vester, B., 2006. Interaction of pleuromutilinderivatives with the ribosomal peptidyl transferase center. AntimicrobialAgents and Chemotherapy 50, 1458–1462.
Molnar, L., 1996. Sensitivity of strains of Serpulina hyodysenteriae isolated inHungary to chemotherapeutic drugs. Veterinary Record 138, 158–160.
Muniappa, N., Mathiesen, M.R., Duhamel, G.E., 1997. Laboratory identification andenteropathogenicity testing of Serpulina pilosicoli associated with porcinecolonic spirochetosis. Journal of Veterinary Diagnostic Investigation 9, 165–171.
National Committee for Clinical Laboratory Standards, 1997. Methods forantimicrobial susceptibility testing of anaerobic bacteria. Approved StandardM11-A4.
National Committee for Clinical Laboratory Standards, 2004. Methods forantimicrobial susceptibility testing of anaerobic bacteria. Approved StandardM11-A6.
Pringle, M., Aarestrup, F.M., Bergsjo, B., Fossi, M., Jouy, E., Landen, A., Mevius, D.,Perry, K., Teale, C., Thomson, J., Skrzypczak, T., Veldman, K., Franklin, A., 2006.Quality-control ranges for antimicrobial susceptibility testing by broth dilutionof the Brachyspira hyodysenteriae type strain (ATCC 27164T). Microbial DrugResistance 12, 219–221.
Rasback, T., Fellstrom, C., Bergsjo, B., Cizek, A., Collin, K., Gunnarsson, A., Jensen,S.M., Mars, A., Thomson, J., Vyt, P., Pringle, M., 2005. Assessment of diagnosticsand antimicrobial susceptibility testing of Brachyspira species using a ring test.Veterinary Microbiology 109, 229–243.
Rohde, J., Kessler, M., Baums, C.G., Amtsberg, G., 2004. Comparison of methods forantimicrobial susceptibility testing and MIC values for pleuromutilin drugs forBrachyspira hyodysenteriae isolated in Germany. Veterinary Microbiology 102,25–32.
Rønne, H., Szancer, J., 1990. In vitro susceptibility of Danish field isolates ofTreponema hyodysenteriae to chemotherapeutics in swine dysentery (SD)therapy. Interpretation of MIC results based on the pharmacokineticproperties of the antibacterial agents. In: Proceedings, International PigVeterinary Society, 11th Congress, Lausanne, Switzerland, p. 126.
Stegeman, J.A., Vernooij, J.C., Khalifa, O.A., Van den Broek, J., Mevius, D.J., 2006.Establishing the change in antibiotic resistance of Enterococcus faecium strainsisolated from Dutch broilers by logistic regression and survival analysis.Preventive Veterinary Medicine 74, 56–66.
Uezato, K., Kinjo, E., Adachi, Y., 2004. In vitro susceptibility of 21 antimicrobialagents to 37 isolates of Brachyspira hyodysenteriae isolated from pigs inOkinawa prefecture. Journal of Veterinary Medical Science 66, 307–309.
Vester, B., Douthwaite, S., 2001. Macrolide resistance conferred by basesubstitutions in 23S rRNA. Antimicrobial Agents and Chemotherapy 45, 1–12.
Weisblum, B., 1995. Erythromycin resistance by ribosome modification.Antimicrobial Agents and Chemotherapy 39, 577–585.
Trabajos de investigación 59
ESTUDIO II
Characterization and epidemiological relationships of Spanish Brachyspira hyodysenteriae field
isolates.
Hidalgo, Á., Carvajal, A., Pringle, M., Rubio, P., Fellström, C.
Epidemiology and Infection 138, 76-85 (2010).
II
Characterization and epidemiological relationships of
Spanish Brachyspira hyodysenteriae field isolates
A. HIDALGO 1*, A. CARVAJAL1, M. PRINGLE2, P. RUBIO 1AND C. FELLSTROM3
1 Department of Animal Health, Infectious Diseases and Epidemiology, Faculty of Veterinary Science,University of Leon, Leon, Spain2 Department of Biomedical Sciences and Veterinary Public Health, Faculty of Veterinary Medicine and
Animal Science, Swedish University of Agricultural Sciences, Uppsala, Sweden3 Department of Clinical Sciences, Faculty of Veterinary Medicine and Animal Science, Swedish University ofAgricultural Sciences, Uppsala, Sweden
(Accepted 29 April 2009; first published online 1 June 2009)
SUMMARY
This research aimed to describe the genetic and phenotypic diversity of 74 Spanish Brachyspira
hyodysenteriae field isolates, to establish epidemiological relationships between the isolates and to
confirm the presence of tiamulin-resistant isolates in Spain. For these purposes, we performed
biochemical tests in combination with diagnostic PCR analysis for the identification of
Brachyspira spp. and for detection of the smpA/smpB gene. We also used antimicrobial
susceptibility tests, random amplified polymorphic DNA (RAPD) and a new pulsed-field gel
electrophoresis (PFGE) protocol. The combination of RAPD and PFGE allowed the study of
epidemiological relationships. Both indole-negative and tiamulin-resistant isolates of
B. hyodysenteriae are reported in Spain for the first time. The genetic analyses indicated a
relationship between these Spanish isolates and indole-negative isolates previously obtained from
Germany and Belgium.
Key words: Brachyspira hyodysenteriae, characterization, indole negative, PFGE, RAPD.
INTRODUCTION
Brachyspira hyodysenteriae causes swine dysentery
(SD), a severe mucohaemorrhagic diarrhoeal disease
that primarily affects pigs during the growing-
finishing period [1].
With 15% of the total European Union (EU)
output, Spain ranked second in terms of EU pork
production in 2007 (source: Eurostat). Spanish swine
production has grown significantly in recent years,
increasing the number of large swine production units
raising white commercial breeds under intensive con-
ditions. Moreover, 10% of the sows in Spain belong
to an autochthonous breed designated as Iberian pig
(source: Spanish Ministry of Environment and Rural
and Marine Affairs). This local breed is characterized
by its rusticity and has been traditionally reared in
extensive units. In recent years, Iberian pigs have also
been reared in semi-intensive units in order to make
their production more profitable.
SD has been described in all countries with a swine
industry and is considered one of the most significant
production-limiting porcine infections [2]. In Spain,
the importance of SD as a cause of diarrhoea among
growers, finishers and sows has been investigated [3],
with more than 30% of Spanish farms and 12% of
* Author for correspondence : DVM A. Hidalgo, Department ofAnimal Health (Infectious Diseases and Epidemiology), Faculty ofVeterinary Science, University of Leon, Leon, Spain, C.P. 24071.(Email : [email protected])
Epidemiol. Infect. (2010), 138, 76–85. f Cambridge University Press 2009
doi:10.1017/S0950268809002817 Printed in the United Kingdom
Table 1. Isolate designation, herd, date of isolation, geographical origin, RAPD and PFGE patterns and other
relevant information, when available, for 74 Spanish B. hyodysenteriae field isolates included in the current study
Isolate Herd Date Origin RAPD PFGE Other information
1/H40* 1 3/2007 MurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaMurciaC. ValencianaNot knownCataluñaCataluñaCataluñaCataluñaCataluñaCataluñaCataluñaCataluñaCataluñaCataluñaCataluñaAragónAragónAragónAragónAragónCataluñaCataluñaCataluñaCastilla y LeónCastilla y LeónCastilla y LeónCastilla y LeónCastilla y LeónCastilla y LeónCastilla y LeónCastilla y LeónCastilla y LeónCastilla y LeónAndalucíaAndalucíaAndalucía
1 NT Supplies sows to herd 2
3* 2 3/2007 1 $ Sows replaced from herd 14/H87 2 9/2007 1 NT Vaccination with an autologous vaccine5/H92* 2 9/2007 1 NT started in May 2007#
6/H103 2 10/2007 1 NT7/H124 2 11/2007 1 NT8/H140 2 12/2007 1 NT
2e/H35* 2 3/2007 1 NT2e/H36* 2 3/2007 1 NT2e/H37* 2 3/2007 1 NT
9/H167 2 1/2008 1 NT10* 2 2/2008 2 D
11/H196 2 2/2008 2 NT12/H150 3 1/2008 1 NT
13* 4 1/2008 28 E
14/H153* 5 1/2008 3 NT15/H155 6 1/2008 3 NT
17* 7 6/2007 4 B
19 8 1/2008 3 $
20 9 2/2008 5 B
21/H112 10 11/2007 5 NT79/H79* 11 7/2007 5 NT78* 12 2/2008 6 D
23* 13 10/2007 7 E Iberian pigs. Multiplier herd
26/H191 13 2/2008 7 NT Iberian pigs. Multiplier herd84/H213 13 3/2008 7 NT Iberian pigs. Multiplier herd25/H185 13 2/2008 7 NT Grower Iberian pigs
24/H183 13 2/2008 7 NT Finisher Iberian pigs85/H212 13 3/2008 7 NT Iberian gilts36* 14 12/2006 8 C
37/H2* 15 12/2006 8 NT38/H71* 16 6/2007 8 NT40*· 17 1/2007 9 F
43/H170· 18 1/2008 9 NT44/H137· 19 12/2007 9 NT Commercial white pigs. Multiplier herd46/H181· 19 2/2008 9 NT Commercial white pigs. Multiplier herd45/H138· 20 12/2007 9 NT
50/3140· 21 10/2002 9 NT51/H3*· 22 12/2006 9 NT41* 23 2/2007 10 A
92* 24 2/2008 11 E
94* 25 1/2008 12 C
H227* 26 3/2008 13 B
52/H12* 27 2/2007 14 NT Iberian pigs53* 27 6/2007 14 B Iberian pigs55* 28 10/2007 15 B Iberian pigs. Autologous vaccination implemented#56/H168 28 1/2008 15 NT Iberian pigs. Autologous vaccination implemented#
88* 28 2/2008 16 $ Iberian pigs. Autologous vaccination implemented#58/E1090 29 7/2001 17 NT59* 30 6/2007 17 B
60*· 31 1/2008 18 $
96* 32 11/2007 19 E
62/1502 33 1/2002 20 NT Iberian pigs
63/H5* 34 1/2007 20 NT64* 35 7/2007 20 A Iberian pigs
B. hyodysenteriae characterization 77
faecal specimens testing positive for B. hyodysenter-
iae. Moreover, decreased susceptibility to the main
antimicrobials used in the treatment of SD has been
detected in Spanish B. hyodysenteriae isolates [4].
Diverse methodologies, such as serotyping [5], re-
striction endonuclease analysis (REA) [6], multilocus
enzyme electrophoresis (MLEE) [7], pulsed-field gel
electrophoresis (PFGE) [8], random amplified poly-
morphic DNA (RAPD) [9], biochemical character-
ization [10], DNA restriction fragment polymorphism
analysis [11] and multilocus sequence typing (MLST)
[12], have been used to characterize and analyse the
diversity of Brachyspira spp. isolates.
The research reported herein was performed to
describe the genetic and phenotypic diversity of
Spanish B. hyodysenteriae field isolates and to inves-
tigate epidemiological relationships between them.
Moreover, we attempted to confirm the presence
of tiamulin-resistant isolates and to investigate their
common or independent origin.
METHODS
Bacterial strains and growth conditions
A set of 74 Spanish isolates of strongly b-haemolytic
intestinal spirochaetes recovered from pigs and class-
ified as B. hyodysenteriae according to species-specific
PCR [13] was used in the current study. Isolates were
selected in order to include samples representing the
most important pig production regions of the coun-
try. All isolates were obtained from faecal samples
from growers, finishers or sows submitted for routine
diagnostics to the Laboratory of Infectious Diseases
in the Veterinary Faculty at the University of
Leon, Spain, and stored in liquid nitrogen. A list
depicting isolate designation, herd, date of isolation,
geographical origin and other relevant information, if
available, is presented in Table 1. The isolates were
sent in Amies medium to the National Veterinary
Institute (SVA), Uppsala, Sweden, where they were
tested using duplex PCR [14], based on the tlyA and
Table 1 (cont.)
Isolate Herd Date Origin RAPD PFGE Other information
65/H173 36 2/2008 AndalucíaAndalucíaAndalucíaExtremaduraExtremaduraExtremaduraCastilla-La ManchaCastilla-La ManchaAndalucíaNot knownAragónAragónCataluñaCataluñaCataluñaMurciaExtremaduraExtremaduraExtremadura
20 NT Iberian pigs
66/H57* 37 5/2007 20 NT Iberian pigs97/H88 41 9/2007 20 NT Iberian pigs69/H13* 38 2/2007 20 NT Iberian pigs70/H21* 38 2/2007 20 NT Iberian pigs
95/H141 40 12/2007 20 NT Iberian pigs71/H44* 39 4/2007 20 NT73* 42 10/2007 21 A
89/H203 43 2/2008 21 NT ½Iberian pigsr½Duroc81* 44 10/2001 22 A
93* 45 1/2008 23 C
98* 46 4/2007 24 E
H9*· 47 1/2007 25 F
H19* 48 2/2007 26 $
H72* 49 6/2007 27 C
87/H208 51 2/2008 NT NT B. hyodysenteriae and B. innocens mixed culture90/H197 50 2/2008 NT NT B. hyodysenteriae and B. murdochii mixed culture67/E1697 52 2/2002 NT NT B. hyodysenteriae and B. pilosicoli mixed culture
68/H23 53 2/2007 NT NT B. hyodysenteriae and B. pilosicoli mixed culture
Date : Month and year of isolation ; Origin : administrative region, coloured according tothe map (right), where the farm was located; RAPD : pattern assigned in the RAPD study
(RAPD patterns in red type are shared by isolates from different herds) ; PFGE : pulsed-field gel electrophoresis cluster for MluI, according to groups (A–F) established inFigure 2.
NT, Not tested.* Isolates tested with smpA/smpB PCR.# Autologous B. hyodysenteriae vaccination programme consisting of a whole-herdvaccination repeated each 4 months.
$ PFGE tested and not clustered with an 80% cut-off value.· Indol-negative Spanish B. hyodysenteriae field isolates.
78 A. Hidalgo and others
the 16S rRNA genes, for detection of B. hyodysen-
teriae and B. pilosicoli, respectively.
We also investigated two German indole-negative
B. hyodysenteriae isolates, designated 5677/96 and
T4 [12] from the Swedish collection at SVA and the
B. hyodysenteriae reference strain B204 (ATCC 31212),
B. hyodysenteriae type strain B78T (ATCC 27164T),
and B. pilosicoli type strain P43/6/78T (ATCC 51139)
were used as controls for PCR and biochemical
characterization.
Bacteria were grown on fastidious anaerobe agar
(FAA, SVA, Sweden) at 42 xC in anaerobic jars
[GENbox (bioMerieux, France) with AnaeroGen
sachets (Oxoid, UK)].
Biochemical tests and b-haemolysis
Biochemical characterization was performed as pre-
viously described by Fellstrom & Gunnarsson [15].
In brief, 3-day-old cultures were tested for weak
or strong b-haemolysis on trypticase soy agar
supplemented with 5% ovine blood. Indole pro-
duction was investigated using the spot indole test ;
a-galactosidase activity was determined using diag-
nostic tablets (Rosco Diagnostica, Denmark) and
hippurate hydrolysis as described by Rubsamen &
Rubsamen [16].
Testing antimicrobial susceptibility
Eleven Spanish B. hyodysenteriae isolates (for ref-
erence see Table 2), selected on the basis of
their reduced susceptibility to tiamulin (o2 mg/ml)
determined in a previous investigation [4], were tested
for antimicrobial susceptibility using VetMICTM
Brachy QCR high panels (SVA, Sweden) according
to the manufacturer’s protocol. The antimicrobial
agents tested were tiamulin, valnemulin, doxycycline,
lincomycin, tylosin, and tylvalosin. The minimum
inhibitory concentration (MIC) was determined as the
lowest concentration of antimicrobial agent that pre-
vented visible growth. Absence of contamination was
checked by phase contrast microscopy.
RAPD
Seventy B. hyodysenteriae isolates confirmed by
duplex PCR [14] and biochemical tests [15] as well as
the reference and type strains of B. hyodysenteriae
(B204 and B78T) were typed by RAPD following the
technique described by Quednau et al. [17], slightly
modified. DNA samples were prepared from 3-day-
old pure cultures grown on FAA. Two filled 1-ml
loops of the bacteria were washed twice in phosphate
buffered saline (pH 7.3), boiled in nuclease-free water
(Sigma-Aldrich, USA) and centrifuged. The super-
natant was transferred to a sterile microtube. Extrac-
ted DNA samples were adjusted to a concentration
of 20 ng/ml. RAPD fingerprints were generated with
primer P73 (5k-ACGCGCCCT-3k) and primer P1254
(5k-CCGCAGCCAA-3k), resulting in two different
pattern sets that were visually analysed. Results were
interpreted with strict criteria and isolates which dif-
fered in at least one fragment (including weak, barely
visible and broad bands) were assigned to different
RAPD types. In order to ensure reproducibility, this
Table 2. Minimum inhibitory concentrations (mg/ml) of six antimicrobial agents for 11 Spanish B. hyodysenteriae
field isolates selected on the basis of their reduced susceptibility to tiamulin (o2 mg/ml) determined in a previous
investigation [4]
Isolate Herd
MIC (mg/ml)
Tiamulin Valnemulin Tylosin Tylvalosin Lincomycin Doxycycline
1/H40 1 32 4 2048 8 128 23 2 16 2 1024 8 128 210 2 4 4 2048 16 16 12e/H35 2 16 4 2048 8 64 1
2e/H36 2 16 4 2048 16 128 12e/H37 2 16 4 2048 16 128 136 14 2 1 256 2 64 f0.25
H227 26 32 >32 2048 16 64 264 35 2 1 2048 16 16 0.5H9 47 2 4 2048 8 32 2
H72 49 32 8 2048 8 256 1
B. hyodysenteriae characterization 79
technique was repeated at least three times for each
isolate.
PFGE
Thirty-one B. hyodysenteriae isolates were typed by
PFGE, including 28 Spanish field isolates represent-
ing the different RAPD patterns (see Table 1), the
reference and type strains of B. hyodysenteriae (B204
and B78T), and one German indole-negative isolate
(5677/96).
The DNA preparation procedure for PFGE was
adapted from a previous protocol described for
Treponema spp. [18]. For each isolate, bacterial cells
from two FAA plates were harvested, suspended in
10 ml TE buffer (10 mM Tris, 1 mM EDTA) and
washed three times in 5 ml TE buffer. The cells were
then suspended in 1.5 ml Pett IV buffer (10 mM Tris–
HCl, 1 M NaCl), adjusted to an optical density of
0.800 at 405 nm and mixed 1:1 (v:v) with 1.5%
low melting temperature agarose (NA agarose, GE
Healthcare, UK). The agarose plugs were incubated
in ESP (0.5 M EDTA, 1% N-lauroyl sarcosine, 0.2%
pronase E) at 50 xC for 24 h, restoring the liquid
after 1.5 h. Gel plugs were then washed six times in
TE buffer. Digestion with restriction enzymes MluI
(5k-A›CGCGT) and SalI (5k-G›TCGAC) and pulsed-
field electrophoresis were performed as described by
Fellstrom et al. [10], using a CHEF-DR1 III pulsed
field electrophoresis system (Bio-Rad Laboratories
AB, Sweden) at 6 V/cm2 with an included angle of
120x. Initial and final switch times were 5 s and 70 s,
respectively. The gels were run for 24 h in 0.5rTBE
buffer (44.5 mM Tris, 44.5 mM boric acid, 1 mM
EDTA) at 14 xC and subsequently stained with
ethidium bromide. A lambda marker (New England,
Biolabs, USA) was included to normalize the PFGE
banding patterns that were used for producing den-
drograms, following calculation of the Dice coef-
ficient and analysis with the unweighted pair-group
method by arithmetic averages (UPGMA) clustering
fusion strategy, performed with the GelCompar pro-
gram (Applied Maths, Belgium).
SmpA/smpB-specific PCR
A PCR assay for specific detection of smpA or smpB
genes was performed on 42 Spanish B. hyodysenteriae
field isolates (listed in Table 1) as described by Holden
et al. [19]. Genomic DNA was prepared by the CTAB
extraction method and at least one isolate per RAPD
pattern was included. Reference strain B204 was in-
cluded as smpA-positive control.
RESULTS
PCR identification and biochemical characterization
Duplex PCR analysis for the detection of B. hyodys-
enteriae and B. pilosicoli, resulted in the tlyA gene
fragment being amplified for all 74 isolates ; the 16S
rRNA gene fragment specific for B. pilosicoli was
amplified for two isolates (67/E1697 and 68/H28).
These latter two isolates were considered to be
B. hyodysenteriae and B. pilosicoli mixed cultures.
In addition, the biochemical tests placed 70 of the
72 presumptive B. hyodysenteriae isolates (according
to the duplex PCR) in group I (B. hyodysenteriae)
[20]. However, isolates 90/H197 and 87/H208 were
classified as group III, B. innocens and B. murdochii,
respectively, and considered as mixed cultures. Sixty-
one group I isolates (87.1%) were recorded as indole
positive in the spot indole test, while nine group
I isolates (12.9%; 40, 43/H170, 44/H137, 46/H181,
45/H138, 50/3140, 51/H3, 60 and H9), were indole
negative.
MIC determinations
The MICs of the six antimicrobial agents studied for
the 11 selected Spanish B. hyodysenteriae isolates are
shown in Table 2.
RAPD analysis
Twenty-eight dissimilar RAPD patterns were ob-
tained for the 70 Spanish B. hyodysenteriae field iso-
lates. A different figure was given for each RAPD
pattern (Table 1). German indole-negative isolates,
5677/96 and T4, were assigned to RAPD pattern
number 9. Reference and type strains B204 and B78T
did not share any RAPD pattern with the studied field
isolates.
PFGE
Digestion of B. hyodysenteriae DNA produced 7–18
and 4–9 fragments for MluI and SalI, respectively.
The quality of the gels obtained was high, with clearly
defined bands (Fig. 1). All tested isolates yielded
a PFGE pattern with at least one of the enzymes,
although isolate H19 did not generate any visible
80 A. Hidalgo and others
pattern when MluI was used. The dendrogram for
MluI is shown in Figure 2, with the percentage of
similarity ranging from 25 to 100. Reference and type
strains B204 and B78T grouped separately for both
enzymes.
SmpA/smpB analysis
All Spanish B. hyodysenteriae isolates tested were
smpA-positive, as revealed by PCR analysis.
DISCUSSION
The combination of strong b-haemolysis and 23S
rRNA PCR [13] has been used in the Laboratory of
Infectious Diseases in the Veterinary Faculty at the
University of Leon to identify B. hyodysenteriae in
spirochaete isolates from swine. In addition, duplex
PCR based on the tlyA and 16S rRNA genes [14]
confirmed the identification of 70 B. hyodysenteriae
isolates which were later studied in detail. This
analysis revealed two cultures mixed with B. pilosicoli
that were not used in the following procedures.
Biochemical tests allowed the further detection of
two other mixed Brachyspira spp. cultures that were
excluded from the study. These data emphasize the
importance of using biochemical tests together with
PCR techniques for routine diagnostics, as previously
proposed [20, 21].
Several techniques have been applied to character-
ize B. hyodysenteriae isolates. In the current study we
used a combination of RAPD and PFGE for this
purpose. This methodology has been previously re-
commended for other bacteria [22]. It combines the
simplicity and promptness of RAPD for establishing
groups of closely related isolates with the potency of
PFGE as a confirmatory technique for the previously
established groups.
In general, RAPD was useful as an initial screening
technique for the characterization of B. hyodysen-
teriae isolates. RAPD patterns were stable and re-
producible although the interpretation was sometimes
hampered by slight changes in band brightness in-
tensities in the replicates performed for each isolate.
Moreover, the use of PFGE allowed us to establish
epidemiological connections and to study phylogen-
etic relationships between isolates. Both restriction
enzymes MluI and SalI showed a similar ability to
discriminate between isolates and produced anal-
ogous clusters when dendrograms were examined.
Although it has been reported that PFGE is not
always feasible for strongly haemolytic Brachyspira
spp. [21], the protocol described in this study, adapted
from a protocol for Treponema spp. [18], produced
good quality pulsed-field gels which were suitable for
computer processing.
RAPD permitted us to classify 70 Spanish field
isolates of B. hyodysenteriae into 28 different patterns.
Twenty out of 28 RAPD patterns (71%) belonged
to isolates recovered from single herds. However,
eight out of the 28 RAPD fingerprints (29%) were
shared by isolates from different herds. Isolates with
a common RAPD pattern shared geographical origin,
e.g. isolates with RAPD patterns 1 and 3 originated
fromMurcia, and RAPD patterns 8 and 17 originated
from Cataluna and Castilla y Leon, respectively.
Other isolates originated from neighbouring regions
of Spain: RAPD pattern 5 from Murcia and
C. Valenciana; RAPD pattern 20 from Andalucıa,
Castilla-La Mancha and Extremadura; RAPD pat-
tern 9 from Cataluna and Aragon; RAPD pattern
21 from Castilla-LaMancha and Andalucıa (Table 1).
As previously proposed [7, 10], movements of infected
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28
(a)
(b)
Fig. 1. PFGE patterns of 24 Spanish B. hyodysenteriae field
isolates obtained with (a) MluI and (b) SalI. Lanes 1, 10, 19and 28 show lambda markers (size range 50–1000 kb).Isolates in lanes 2–9 are 78, 53, 5677/96, 55, 88, 94, 23 and
92. Isolates in lanes 11–18 are 20, 19, 13, 17, 10, 60, 59 and93. Isolates in lanes 20–27 are 98, 96, 36, H227, H72, H9,H19 and 40.
B. hyodysenteriae characterization 81
pigs between herds could have facilitated the spread
of particular strains within a region. However, where
farms are placed in close proximity, infected rodents
and drainage effluent might also play a potential role
in transmission [2].
A specific PCR for differentiation of smpA/smpB
B. hyodysenteriae isolates was designed and performed
by Holden et al. [19], who reported a similar distri-
bution of both genes (50% smpA and 50% smpB)
in eight B. hyodysenteriae strains from Australia,
Canada, UK and USA. Only the smpA gene was de-
tected in the isolates investigated in the current study.
According to this result, SmpA, a lipoprotein that has
been demonstrated to be a highly immunogenic outer
membrane component of B. hyodysenteriae [23, 24]
should be considered when designing subunit vaccines
against SD in Spain. Moreover, this result could have
implications in other fields such as serological diag-
nosis of SD in Spanish farms.
Biochemical characterization confirmed the pres-
ence of indole-negative isolates in Spain. Atypical
indole-negative B. hyodysenteriae have only been re-
ported previously in Belgium, Germany and Canada
[10, 25]. Further characterization of these isolates
with RAPD showed two different banding patterns.
One of these patterns was represented by a single
isolate, identified as isolate 60, which was recovered in
January 2008 in a farm located in the northwest of the
country (Castilla y Leon). The second RAPD pattern
was shared by the other eight indole-negative isolates :
40, 43/H170, 44/H137, 46/H181, 45/H138, 50/3140,
51/H3 and H9. These isolates were recovered from
seven different farms located in two neighbouring
regions in the northeast of Spain, i.e. Cataluna and
25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100
B78B204
81
6473
41
53
59
17
55
H227
20
88
94H729336
78
103
6023
13
98
9692
H9405677/96
19
A
B
C
D
E
F
Fig. 2. Dendrogram based on PFGE patterns for MluI clustered by UPGMA strategy and depicting genetic similarity for 31B. hyodysenteriae isolates, including 28 Spanish field isolates, the reference and type strains of B. hyodysenteriae (B204 andB78T), and one German indole-negative isolate (5677/96). An 80% cut-off value (thick vertical grey line) has been used for
establishing groups of related isolates (A–F).
82 A. Hidalgo and others
Aragon, between 2002 and 2008. Surprisingly, this
RAPD pattern was also shared by the two indole-
negative German isolates, T4 and 5677/96. For fur-
ther investigation of this relationship, the German
isolate 5677/96 together with two Spanish indole-
negative isolates, H9 and 40, were analysed by PFGE.
The three isolates grouped together markedly sep-
arated from other clusters, with a high percentage of
similarity (94% for MluI). Moreover, Belgian indole-
negative isolates have been previously shown to be
indistinguishable from isolate 5677/96 [10]. The rare
occurrence of indole-negative isolates combined with
the results of RAPD and PFGE procedures strongly
indicates an epidemiological relationship between
these isolates, although our epidemiological records
do not allow an absolute confirmation of this fact.
Nevertheless, the trade of pigs from these countries
to Spain supports this possibility, with more than
207000 animals sold in 2000 and 135000 in 2001
(source: Spanish Ministry of Environment and Rural
and Marine Affairs). Migratory birds may also be
considered as a risk for transmission of Brachyspira
isolates between countries [21]. The national, seem-
ingly clonal, spread of this indole-negative strain
could have been the result of frequent movements
and trade of animals in the northeast area of Spain
and the presence of this RAPD type (isolates 44/H137
and 46/H181) in one Spanish multiplier herd (no. 19).
The RAPD fingerprints of 20 Spanish B. hyodys-
enteriae field isolates recovered from Iberian pigs were
divided into six different RAPD patterns, designated
as 7, 14, 15, 16, 20 and 21. Subsequent analysis by
PFGE grouped RAPD type 14 (isolate 53) together
with RAPD type 15 (isolate 55) and RAPD type 20
(isolate 64) together with RAPD type 21 (isolate 73).
The spread of RAPD type 20, detected in eight
Iberian pig units located in the southwest of Spain
(Andalucıa and Extremadura), is probably a conse-
quence of trade with carriers or diseased pigs. The
particular conditions of the Iberian pig market, which
is characterized by high demand for a limited number
of available pigs and entirely lacking or deficient
herd health programmes, could have facilitated this
fact.
The key role of carrier swine in within-herd spread
of infection [2] was evident in herd no. 13, a semi-
intensive Iberian pig unit where SD appeared and was
subsequently disseminated to four productive units
situated at different locations.
When more than one isolate per herd were analysed
by RAPD, we found identical isolates in four herds
(nos. 13, 19, 27 and 38). However, slight variations
among isolates were recorded in two other herds (nos.
2 and 28). These isolates were subsequently confirmed
by PFGE as closely related. Interestingly, vaccination
with an inactivated autologous vaccine of B. hyo-
dysenteriae had been implemented in both herds.
Herd no. 2 was analysed further, including 12 isolates
recovered from March 2007 to February 2008.
Vaccination started in May 2007. The RAPD pattern
was stable from February 2007 to January 2008,
but slight differences were recorded for two isolates
recovered in February 2008. This difference was
subsequently confirmed by PFGE. Moreover, the
antimicrobial susceptibility pattern also changed.
MIC values yielded by isolates from March 2007 (3,
2e/H35, 2e/H36, 2e/H37) were compared with those
displayed by one isolate from February 2008 (isolate
10). An increase in the sensitivity of two dilution steps
(from 16 mg/ml to 4 mg/ml) was observed for the MIC
of tiamulin and of three dilution steps (from 128 mg/
ml to 16 mg/ml) for the MIC of lincomycin. This new
closely related isolate had not been recovered on the
farm previously. One explanation for the isolation of
new variants of B. hyodysenteriae in the herd may be
the introduction of sows from herd no. 1 (Table 1).
However, the minor genetic differences recorded
could be the result of adaptive advantages, first, by the
selective pressure caused by vaccination or second, by
the changes in the antibiotic therapy protocols in the
farm subsequent to the success of the immunological
treatment. A similar result was reported by Atyeo
et al. [8] in Australian herds and the microevolution
theory was also proposed as the most plausible ex-
planation.
On the other hand, genetic stability over time for
four Spanish B. hyodysenteriae field isolates was also
demonstrated. Isolate 50/3140, an indole-negative
isolate, was recovered in October 2002 and yielded an
identical RAPD pattern to the indole-negative isolate
46/H181, from February 2008. Similar results were
obtained for isolates 58/E1090 and 59 recovered in
July 2001 and June 2007, respectively, and isolates
62/1502 and 65/H173, recovered from January 2002
and February 2008, respectively. Similarly, using
PFGE, isolate 81 from October 2001 was identical to
isolate 73, from October 2007. Hence, stability in
some Spanish field isolates of B. hyodysenteriae was
registered for up to 6 years, in agreement with a pre-
vious report on Swedish isolates [10].
According to Rønne & Szancer [26], B. hyodys-
enteriae isolates with MICs >4 mg/ml for tiamulin
B. hyodysenteriae characterization 83
should be considered as resistant isolates. In the cur-
rent study, 7/11 B. hyodysenteriae isolates selected on
the basis of their reduced susceptibility to tiamulin [4]
were classified as resistant. The tiamulin-resistant
isolates 1/H40, 3, 2e/H35, 2e/H36 and 2e/H37 shared
the same RAPD pattern. The RAPD patterns for the
other two tiamulin-resistant isolates were unique;
thus three different RAPD and PFGE types of
tiamulin-resistant B. hyodysenteriae (MIC 32 mg/ml)
were confirmed. Valnemulin decreased susceptibility
was present in all tested isolates. Subsequent analysis
of the geographical distribution of the herds where the
resistant isolates had been collected showed that they
were from three different and distant areas of the
country: Murcia, Castilla y Leon and Cataluna. The
tiamulin-resistant isolates should be considered as a
risk to the swine industry.
In conclusion, the results from RAPD and PFGE
demonstrated the presence of diverse B. hyodysenter-
iae field isolates in Spain and allowed the investi-
gation of epidemiological relationships between these
isolates. Furthermore, this is the first report of
Spanish indole-negative B. hyodysenteriae isolates
and the clonal spread of one of these. Moreover, the
existence of tiamulin-resistant B. hyodysenteriae iso-
lates, which have emerged independently in Spain,
was also demonstrated.
ACKNOWLEDGEMENTS
The authors express their thanks to Marih Jonsson
and Gloria Fernandez Bayon for excellent technical
assistance. Alvaro Hidalgo is supported by a grant
from Consejerıa de Educacion of the Junta de Castilla
y Leon and the European Social Fund. This work was
funded by the Ministerio de Educacion y Ciencia
(Spanish Ministry of Education and Science) and
co-financed by the European Regional Development
Funds (ERDF) as Project AGL2005-01976/GAN
(January 2006).
DECLARATION OF INTEREST
None.
REFERENCES
1. Hampson DJ, Fellstrom C, Thomson JR. Swine dys-
entery. In : Straw BE, Zimmerman JJ, D’Allaire S,Taylor DJ, eds.Diseases of Swine, 9th edn. Ames, Iowa:Blackwell Publishing Professional, 2006, pp. 785–805.
2. Hampson DJ, Atyeo RF, Combs BG. Swine dysentery.In : Hampson DJ, Stanton TB, eds. Intestinal Spiro-
chaetes in Domestic Animals and Humans. Wallingford,England: CAB International, 1997, pp. 175–209.
3. Carvajal A, et al. Prevalence of Brachyspira species in
pigs with diarrhoea in Spain. Veterinary Record 2006;158 : 700–701.
4. Hidalgo A, et al. Antimicrobial susceptibility testing ofSpanish field isolates of Brachyspira hyodysenteriae.
Research in Veterinary Science 2009; 87 : 7–12.5. Hampson DJ, et al. Proposed revisions to the sero-
logical typing system for Treponema hyodysenteriae.
Epidemiology and Infection 1989; 102 : 75–84.6. Combs BG, Hampson DJ, Harders SJ. Typing of
Australian isolates of Treponema hyodysenteriae by
serology and by DNA restriction endonuclease analysis.Veterinary Microbiology 1992; 31 : 273–285.
7. Trott DJ, Oxberry SL, Hampson DJ. Evidence for
Serpulina hyodysenteriae being recombinant, with anepidemic population structure.Microbiology 1997; 143 :3357–3365.
8. Atyeo RF, Oxberry SL, Hampson DJ. Analysis of
Serpulina hyodysenteriae strain variation and its mol-ecular epidemiology using pulsed-field gel electrophor-esis. Epidemiology and Infection 1999; 123 : 133–138.
9. Dugourd D, et al. Characterization of Serpulina hyo-dysenteriae isolates of serotypes 8 and 9 by randomamplification of polymorphic DNA analysis. Veterinary
Microbiology 1996; 48 : 305–314.10. Fellstrom C, et al. Emended descriptions of indole-
negative and indole positive isolates of Brachyspira
(Serpulina) hyodysenteriae. Veterinary Microbiology1999; 70 : 225–238.
11. Jensen NS, Casey TA, Stanton TB. Characterization ofSerpulina (Treponema) hyodysenteriae and related in-
testinal spirochetes by ribosomal RNA gene restrictionpatterns. FEMSMicrobiology Letters 1992; 72 : 235–241.
12. Rasback T, et al.Development of a multilocus sequence
typing scheme for intestinal spirochaetes within thegenus Brachyspira.Microbiology 2007; 153 : 4074–4087.
13. Leser TD, et al. Specific detection of Serpulina hyo-
dysenteriae and potentially pathogenic weakly beta-haemolytic porcine intestinal spirochetes by polymerasechain reaction targeting 23S rDNA. Molecular andCellular Probes 1997; 11 : 363–372.
14. Rasback T, et al. Comparison of culture and bio-chemical tests with PCR for detection of Brachyspirahyodysenteriae and Brachyspira pilosicoli. Journal of
Microbiological Methods 2006; 66 : 347–353.15. Fellstrom C, Gunnarsson A. Phenotypical characteris-
ation of intestinal spirochaetes isolated from pigs. Re-
search in Veterinary Science 1995; 59 : 1–4.16. Rubsamen S, Rubsamen S. Hippurate hydrolysis : a ra-
pid test for differentiation of Treponema hyodysenteriae
and Treponema innocens [in German]. TierarztlicheUmschau 1986; 41 : 673–677.
17. Quednau M, et al. Identification of clinically importantspecies of Enterococcus within 1 day with randomly
amplified polymorphic DNA (RAPD). Current Micro-biology 1998; 36 : 332–336.
84 A. Hidalgo and others
18. Pringle M, et al. Isolation and characterization ofTreponema phagedenis-like spirochetes from digital
dermatitis lesions in Swedish dairy cattle. Acta Veter-inaria Scandinavica 2008; 50, 40.
19. Holden J, et al. SmpB: a novel outer membrane protein
present in some Brachyspira hyodysenteriae strains.Veterinary Microbiology 2006; 113 : 109–116.
20. Fellstrom C, et al. Identification and genetic finger-printing of Brachyspira species. Journal of Micro-
biological Methods 2008; 72 : 133–140.21. Rasback T, et al. A novel enteropathogenic, strongly
haemolytic spirochaete isolated from pig and mallard,
provisionally designated ‘Brachyspira suanatina ’ sp.nov. Environmental Microbiology 2007; 9 : 983–991.
22. Gori A, et al. Comparison of pulsed-field gel electro-
phoresis and randomly amplified DNA polymorphismanalysis for typing extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae. Journal of Clinical
Microbiology 1996; 34 : 2448–2453.
23. Sellwood R, et al. Antibodies to a common outerenvelope antigen of Treponema hyodysenteriae with
antibacterial activity. Journal of General Microbiology1989; 135 : 2249–2257.
24. Thomas W, Sellwood R. Monoclonal antibodies to a
16-kDa antigen of Serpulina (Treponema) hyodysen-teriae. Journal of Medical Microbiology 1992; 37 : 214–220.
25. Hommez J, et al. Identification of porcine Serpulina
strains in routine diagnostic bacteriology. VeterinaryMicrobiology 1998; 62 : 163–169.
26. Rønne H, Szancer J. In vitro susceptibility of Danish
field isolates of Treponema hyodysenteriae to chemo-therapeutics in swine dysentery (SD) therapy. Inter-pretation of MIC results based on the pharmacokinetic
properties of the antibacterial agents. In : Proceedings ofthe 11th International Pig Veterinary Society Congress.Lausanne, Switzerland: International Pig Veterinary
Society, 1990, pp. 126.
B. hyodysenteriae characterization 85
Trabajos de investigación 71
ESTUDIO III
Multiple-locus variable-number tandem-repeat analysis of the swine dysentery pathogen,
Brachyspira hyodysenteriae.
Hidalgo, Á., Carvajal, A., La, T., Naharro, G., Rubio, P., Phillips, N.D., Hampson, D.J.
Journal of Clinical Microbiology 48, 2859-2865
(2010).
III
JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 2010, p. 2859–2865 Vol. 48, No. 80095-1137/10/$12.00 doi:10.1128/JCM.00348-10Copyright © 2010, American Society for Microbiology. All Rights Reserved.
Multiple-Locus Variable-Number Tandem-Repeat Analysis of theSwine Dysentery Pathogen, Brachyspira hyodysenteriae�†
Alvaro Hidalgo,1* Ana Carvajal,1 Tom La,2 German Naharro,1 Pedro Rubio,1Nyree D. Phillips,2 and David J. Hampson2
Department of Animal Health, Faculty of Veterinary Science, University of Leon, Leon 24071, Spain,1 and Animal Research Institute,School of Veterinary and Biomedical Science, Murdoch University, Murdoch, Western Australia 6150, Australia2
Received 20 February 2010/Returned for modification 14 May 2010/Accepted 9 June 2010
The spirochete Brachyspira hyodysenteriae is the causative agent of swine dysentery, a severe colonic infectionof pigs that has a considerable economic impact in many swine-producing countries. In spite of its importance,knowledge about the global epidemiology and population structure of B. hyodysenteriae is limited. Progress inthis area has been hampered by the lack of a low-cost, portable, and discriminatory method for strain typing.The aim of the current study was to develop and test a multiple-locus variable-number tandem-repeat analysis(MLVA) method that could be used in basic veterinary diagnostic microbiology laboratories equipped withPCR technology or in more advanced laboratories with access to capillary electrophoresis. Based on eight loci,and when performed on isolates from different farms in different countries, as well as type and referencestrains, the MLVA technique developed was highly discriminatory (Hunter and Gaston discriminatory index,0.938 [95% confidence interval, 0.9175 to 0.9584]) while retaining a high phylogenetic value. Using thetechnique, the species was shown to be diverse (44 MLVA types from 172 isolates and strains), althoughisolates were stable in herds over time. The population structure appeared to be clonal. The finding of B.hyodysenteriae MLVA type 3 in piggeries in three European countries, as well as other, related, strains indifferent countries, suggests that spreading of the pathogen via carrier pigs is likely. MLVA overcame draw-backs associated with previous typing techniques for B. hyodysenteriae and was a powerful method for epide-miologic and population structure studies on this important pathogenic spirochete.
Brachyspira hyodysenteriae is a Gram-negative, oxygen-toler-ant, anaerobic spirochete that colonizes the porcine large in-testine to cause swine dysentery. This condition is character-ized by a severe mucohemorrhagic diarrhea that primarilyaffects animals during the growing-finishing period and hasbeen reported from all major pig-rearing countries. The enzo-otic nature of swine dysentery increases the economic impactof the disease, which arises from decreased rates of growth,poor feed conversion, deaths, costs of medication and treat-ments, preventive measures, and restrictions on movements ofstock (16, 17).
Carrier pigs play a main role in the epidemiology of swinedysentery and are considered the major source of transmissionbetween herds (16). Moreover, B. hyodysenteriae survives in theenvironment for long periods, especially in liquid feces con-tained in pits and lagoons, where it may remain infective for upto 60 days (16). This spirochete also can naturally colonizemice, rheas, chickens, and mallards (9, 30), and together withmechanical vectors or fomites, this increases the ways in whichB. hyodysenteriae may be spread within and between herds.
Different typing tools have been developed to discriminatebetween B. hyodysenteriae field isolates and provide a betterunderstanding of the molecular epidemiology of the pathogen.
The methods used have included serotyping (3), DNA restric-tion endonuclease analysis (REA) (6), random amplification ofpolymorphic DNA (RAPD) (8), restriction fragment lengthpolymorphism of DNA (21), pulsed-field gel electrophoresis(PFGE) (2), multilocus enzyme electrophoresis (MLEE) (25),and multilocus sequence typing (MLST) (24). These tech-niques provide different levels of discrimination between iso-lates, and those that are highly discriminating present associ-ated drawbacks such as difficulties in comparing resultsbetween laboratories (for example, RAPD and PFGE). On theother hand, MLEE is extremely time-consuming while MLSThas high associated costs that are not compatible with routineuse in veterinary clinical diagnostic laboratories. Hence, ahighly discriminatory method that is time- and cost-effectiveand yields portable results which allow interlaboratory com-parison is still lacking for the typing of B. hyodysenteriae iso-lates.
In the last few years, multiple-locus variable-number tan-dem-repeat analysis (MLVA) has been developed as an im-portant epidemiologic tool for strain typing of pathogenic mi-croorganism (26). MLVA is based on PCR amplification ofmultiple loci of minisatellites called variable numbers of tan-dem repeats (VNTRs). This sort of minisatellite consists ofunique direct head-to-tail DNA repeats which can be found inall bacterial genomes and can be used to define specific isolatesof bacterial species (35). In addition, VNTRs have been usedto infer the bacterial population structure and phylogeny ofdiverse bacteria species (22, 29, 33). MLVA has the potentialto be a highly discriminatory typing technique, being fast, cost-effective, and easy to implement in laboratories with PCR
* Corresponding author. Mailing address: Facultad de Veterinaria(Enfermedades Infecciosas), Campus de Vegazana, 24071 Leon,Spain. Phone: 34 987 291306. Fax: 34 987 291304. E-mail: [email protected].
† Supplemental material for this article may be found at http://jcm.asm.org/.
� Published ahead of print on 16 June 2010.
2859
technology. Moreover, multiplexing the PCR in combinationwith capillary electrophoresis of fluorescently labeled primersmay allow a higher sample throughput.
In this study, we aimed to develop a simple and reproducibleMLVA typing method for use in veterinary clinical microbiol-ogy laboratories equipped with either basic PCR technology ormore sophisticated capillary electrophoresis equipment. Wethen applied the method to analyze an international collectionof isolates to provide new information about the molecularepidemiology and population structure of this importantpathogenic spirochete.
MATERIALS AND METHODS
Bacterial strains and DNA preparation. A set of 172 porcine B. hyodysenteriaeisolates and strains was used in this study, including the three reference strainsB204R (ATCC 31212), B234R (ATCC 31287), and WA1R (ATCC 49526) and thetype strain B78T (ATCC 27164). Duplicates of the B204R and B78T strains wereobtained from the bacterial collections held at the University of Leon andMurdoch University. The strains and field isolates were from Spain (n � 115),Australia (n � 36), Canada (n � 3), the United States (n � 7), the UnitedKingdom (n � 4), and Netherlands (n � 7) and had been recovered from the1970s to 2009 (see Table S1 in the supplemental material). Twenty-three isolateswere recovered from Iberian pigs, a local Spanish breed. These pigs contribute tothe preservation of the “dehesa,” a specific Mediterranean ecosystem located inthe western regions of the country (Castilla y Leon, Extremadura, and Anda-lucía), where they are traditionally reared in extensive units. The field isolateswere recovered from different herds, except for 26 Spanish isolates that wereadditionally isolated from 11 herds on different sampling occasions. B. hyodys-enteriae isolates from the University of Leon and Murdoch University bacterialcollections were identified and cultured, and DNA was extracted in eachsupplying laboratory by previously reported methods (19, 24). Working dilu-tions of extracted DNA were prepared by adjusting them to 1 to 20 ng/�lusing a NanoDrop 1000 UV-Vis spectrophotometer (Thermo Scientific, Wil-mington, DE).
Identification of tandem repeats and primer design. The chromosomal DNAsequence of B. hyodysenteriae WA1R was retrieved from GenBank (accession no.NC_012225) and investigated for potential tandem repeats using the defaultparameters of the Tandem Repeat Finder program (5), available as a Web
service (http://tandem.bu.edu/). The selected tandem-repeat loci were ranked byconsensus length, and those with lengths between 25 and 300 bp were used todesign primers within the flanking regions. Loci were named Bhyo, followed bythe repeat length ranking number (from 1 to 23), separated by an underscore.
Tandem-repeat screening and MLVA setup. In a preliminary step, DNA ex-tracted from B. hyodysenteriae strain B204R was used to estimate the empiricalannealing temperature of the 23 selected primer pairs in a gradient PCR. ThePCR was run in a Mastercycler Gradient (Eppendorf Scientific Inc., Westbury,NY) with an initial step of 95°C for 5 min, followed by 30 cycles of a three-stepcycle protocol consisting of 94°C for 30 s, 56 � 8°C for 30 s, and 72°C for 1 minand a final extension step of 72°C for 10 min.
To screen the usefulness of the 23 selected loci as epidemiological markers,DNA samples of B. hyodysenteriae strains B204R and B78T and isolates 3, 19, 23,53, 64, H9, and H72, which have been shown to have genetic differences by PFGEand RAPD in a previous investigation (19), were used. In addition, tandem-repeat data generated for B. hyodysenteriae strain WA1R were taken into ac-count. Each locus was amplified individually, and the length of the product wasanalyzed by conventional agarose gel electrophoresis using a 100-bp DNA ladder(Invitrogen, Carlsbad, CA). Loci were selected according to their length poly-morphism and their ability to generate amplicons for most of the DNA samplestested. To confirm the length of the PCR product, as well as the number ofrepeats, the consensus patterns, and the sizes of the flanking regions, ampliconswere purified using the AxyPrep PCR Cleanup kit (Axygen Biosciences, UnionCity, CA) and sequenced by using fluorescently labeled dideoxynucleotide tech-nology according to the manufacturer’s recommendations (Applied Biosystems,Foster City, CA). On this basis, eight VNTR loci were selected to be used in thefinal typing tool.
PCR amplifications for MLVA. The isolates obtained with the bacterial col-lection selected for this study were analyzed by independently amplifying theeight selected VNTR loci in a Mastercycler apparatus (Eppendorf). The ther-mocycling conditions and primers used are described in Table 1. PCR mixtureswere prepared using 0.2-ml sterile tubes containing 1� PCR buffer (20 mM TrisHCl [pH 8.4], 50 mM KCl), 5 mM MgCl2, 1 U of Platinum Taq DNA polymerase(Invitrogen), 200 �M deoxynucleoside triphosphate mix (Invitrogen), 0.2 �Meach forward and reverse primers, 2 �l of the DNA working dilution, and steriledistilled water up to a final volume of 50 �l. PCR products were resolved inagarose gels, and their allelic sizes were estimated using a 100-bp DNA ladder(Invitrogen). Amplicons of alleles not detected in the setup step were sequencedas described above. In addition, in order to ensure the repeatability of thetechnique, 28 DNA samples were randomly selected and tested again. Repro-ducibility between laboratories was assessed by independent determination of
TABLE 1. Primers and thermocycling programs used for MLVA of B. hyodysenteriae
Locus Primer direction,a sequence (5�33�) Thermocycling programb
Bhyo_6 F, AAATATAACTCATATTCATAACAAG 30 � (94°C for 20 s, 52°C for 20 s, 72°C for 30 s), 72°C for 5 minR, AGAGAACTTCAAAAAACTTC
Bhyo_7 F, AAGTAATAAATTAAAAAATCTCTAGGGTGG 30 � (94°C for 20 s, 59.5°C for 20 s, 72°C for 30 s), 72°C for 5 minR, GGTTTGGTAGAACAATCTGC
Bhyo_12 F, CGTATGATTATTTTACTTGTCAG 30 � (94°C for 30 s, 59°C for 30 s, 74°C for 40 s)R, TTTTATTACAGCAACTTTACTC
Bhyo_17 F, TTTTTGCCATAAATATCTCTC 30 � (94°C for 30 s, 59°C for 30 s, 74°C for 40 s)R, GAAATGCCGTCCTTCTTAG
Bhyo_21 F, AAAATAATGATGAAGTATCTAATG 30 � (94°C for 20 s, 52°C for 20 s, 72°C for 30 s), 72°C for 5 minR, AAGTATCAGGTAAAGGTAAATC
Bhyo_22 F, AGATTAAAAACTGACGGAG 30 � (94°C for 30 s, 55°C for 30 s, 72°C for 60 s), 72°C for 5 minR, AGCACAAGAACCTTCAAAC
Bhyo_10 F, CTCTCTTTTATATTTTTTATTATAGTTG 30 � (94°C for 30 s, 55°C for 30 s, 72°C for 40 s), 72°C for 5 minR, TTGATGAAATTAGACCATTC
Bhyo_23 F, CACCCTTTAGACTTATTATTTTATTTTG 30 � (94°C for 30 s, 55°C for 30 s, 72°C for 40 s), 72°C for 5 minR, TTGTTCTGCGTGCGTGTAG
a F, forward; R, reverse.b Thermocycling programs included a first step of 5 min at 95°C and 30 cycles under the conditions show in parentheses.
2860 HIDALGO ET AL. J. CLIN. MICROBIOL.
the VNTR types of 14 isolates at the University of Leon and Murdoch Univer-sity.
Multiplexing and capillary electrophoresis. Thirty-six Australian B. hyodysen-teriae isolates and the type strain B78T were used to develop a capillary electro-phoresis-based tool for MLVA. For this purpose, the eight primer pairs used inthe individual PCRs were grouped into two sets (set 1 and set 2); labeledfluorescently with 6-carboxyfluorescein (6-FAM), VIC, PET, or NED (AppliedBiosystems) at the 5� end of the forward primers; and pooled as indicated belowprior to performing a multiplex PCR using the Qiagen Multiplex PCR kit ac-cording to the manufacturer’s recommendations (Qiagen, Germantown, MD).Primer set 1 was composed of Bhyo_7 (6-FAM), Bhyo_12 (VIC), Bhyo_17(NED), and Bhyo_22 (PET) primer pairs at final concentrations of 0.25 �M, 0.25�M, 0.15 �M, and 0.15 �M, respectively. Primer set 2 was pooled at final primerconcentrations of 0.25 �M for Bhyo_6 (6-FAM), 0.25 �M for Bhyo_10 (PET),0.15 �M for Bhyo_21 (VIC), and 0.15 �M for Bhyo_23 (NED). A 25-�l volumewas used for multiplex PCR amplification with a thermal cycling protocol of 95°Cfor 15 min; 30 three-step cycles of 94°C for 30 s, 55/53°C (set 1/set 2) for 90 s, and72°C for 90 s; and a final extension step of 72°C for 10 min. Multiplex PCRproducts were diluted 1:10 in distilled water before 1 �l of this dilution was mixedwith 0.5 �l of 1200 LIZ Size Standard (Applied Biosystems) and 10.5 �l offormamide. After the mixture was heated for 3 min at 96°C and rapidly cooledon ice, GeneScan analysis was performed using an ABI 3730 DNA analyzer(Applied Biosystems). The freely available program Peak Scanner Software v1.0(Applied Biosystems) was used to size the PCR fragments for each locus.
Analysis of data. The number of repeats was calculated according to thefollowing formula: Number of repeats � [Fragment size (bp) � Flanking regions(bp)]/Repeat size (bp). The results were approximated to the nearest lowerinteger and sequentially scored (Bhyo_6, Bhyo_7, Bhyo_12, Bhyo_17, Bhyo_21,Bhyo_22, Bhyo_10, and Bhyo_23) to create a numerical profile that defined eachstrain. When PCR amplification was undetectable, the assigned number of re-peats was 99. MLVA profiles were ascribed to MLVA types by assigning a wholenumber. Isolates were considered genetically identical when the numerical pro-files for all eight loci matched.
The Hunter-Gaston diversity index was used to measure the polymorphism ofindividual loci and the index of discrimination of the MLVA typing method forthe eight combined VNTR loci (20). Approximate 95% confidence intervals (CI)were calculated as described by Grundmann et al. (14). Redundant isolates (n �26) were removed prior to calculating the previous indexes. The Sequence TypeAnalysis and Recombinational Tests (START2) program (23), available for freeat http://pubmlst.org/software/analysis/start2/, was used to analyze the MLVAprofiles and types of the spirochetes tested. A phylogenetic tree of the MLVAtypes was constructed based on the unweighted-pair group method using averagelinkages (UPGMA) clustering strategy. A bootstrap analysis for 1,000 replicateswas undertaken using FreeTree (15) at http://web.natur.cuni.cz/flegr/programs/freetree.htm. The goeBURST algorithm (12), available at http://goeburst.phyloviz.net/#Software, a global implementation of the eBURST algorithm(10), was used to identify groups of related genotypes of B. hyodysenteriae atsingle-, double-, and triple-locus variant levels.
Population structure was tested as proposed by Smith et al. (32), taking intoaccount the modifications proposed by Haubold et al. (18) for the calculation ofthe critical value (LMC) of the distribution of the variance of the pairwisedifferences (VD), and expressed as a standardized index of association (ISA).
RESULTS
Identification of VNTR markers. Investigation of the chro-mosomal sequence of B. hyodysenteriae WA1R with the Tan-dem Repeat Finder program identified 404 repeats in tandemthrough the whole chromosome, with 135 repeats/Mbp. Sub-sequent selection of the most suitable tandem-repeat markersdecreased the number to be included in the MLVA to 23,which were consecutively named Bhyo_1 to Bhyo_23 and usedto design primers within the flanking regions. Fifteen loci thatwere monomorphic or failed to amplify all or most of the nineselected isolates with the specific primers were discarded. Theremaining eight loci were polymorphic, with different allelesizes. Sequencing of the PCR products confirmed that thelength polymorphism was due to differences in the copy num-ber of tandem repeats and that the consensus pattern, its
period size, and the flanking regions were stable (Table 2).Therefore, eight loci (Bhyo_6, Bhyo_7, Bhyo_12, Bhyo_17,Bhyo_21, Bhyo_22, Bhyo_10, and Bhyo_23) were included inthe MLVA scheme for B. hyodysenteriae. These loci were dis-tributed from position 1236667 to position 2949421 of theWA1R genome (Table 2). Four loci, Bhyo_6, Bhyo_10,Bhyo_21, and Bhyo_22, were placed in open reading framesencoding hypothetical proteins, while the other four were lo-cated in intergenic regions. Bhyo_7 was placed between thegenes for methyl-accepting chemotaxis protein McpA and ahypothetical protein. Bhyo_12 was between the genes for aputative glycosyltransferase family 2 protein and a hypotheticalprotein. Bhyo_17 was between the genes for glycerol 3-phos-phate dehydrogenase and ferredoxin. Bhyo_23 was betweenthe genes for a hypothetical protein and putative RarR, pre-dicted to be a permease.
MLVA typing. The set of eight VNTR markers was used totype the full collection of 174 B. hyodysenteriae strains andisolates recovered from pigs in several countries (including theduplicates of B78T and B204R). The strains and isolates wereefficiently amplified, and the lengths of the PCR products wereconverted into numbers of repeats. Sequencing of new allelesthat were identified at this stage confirmed that the lengthdifferences represented variations in the number of the previ-ously detected repeat motifs.
The marker Bhyo_10 was the most diverse VNTR, witheight different numbers of repeats (99, 2, 3, 5, 6, 7, 8, and 10),with an assigned number of repeats of 99 because of a lack ofamplification. Seven numbers of repeats were detected forlocus Bhyo_17, while markers Bhyo_6, Bhyo_7, and Bhyo_21each presented six numbers of repeats. Loci Bhyo_12 andBhyo_22 showed a discontinuous distribution of four numbersof repeats. VNTR marker Bhyo_23 showed less diversity, withonly two different numbers of repeats, 1 and 2, detected (seeTable S2 in the supplemental material).
An accurate estimation of the degree of polymorphism ofthe loci was achieved by means of the Hunter-Gaston diversityindex, with the discrimination powers of the loci ranging from0.141 to 0.764. Locus Bhyo_10 was the most discriminatory,with a value of 0.764, followed by loci Bhyo_7, Bhyo_6,Bhyo_17, and Bhyo_21, with values of 0.761, 0.718, 0.71, and0.699, respectively. Loci Bhyo_12 and Bhyo_23 had diversityindexes of 0.472 and 0.318, respectively, while the most con-served locus was Bhyo_22, with a polymorphism index of 0.141.
TABLE 2. Features of the loci included in the MLVA
Locus
Size (bp) of:
Positiona
Repeat Flankingregion
Bhyo_6 156 78 1236667–1237672Bhyo_7 135 177 1818959–1819765Bhyo_10 111 88 1754196–1755095Bhyo_12 105 59 2949083–2949421Bhyo_17 76 175 1690628–1691034Bhyo_21 33 195 1396843–1397034Bhyo_22 30 153 2597474–2597543Bhyo_23 26 102 1838685–1838736
a Location of the VNTR loci in the chromosome of the reference strain B.hyodysenteriae WA1R.
VOL. 48, 2010 MLVA TYPING OF BRACHYSPIRA HYODYSENTERIAE 2861
The Hunter-Gaston discriminatory index of the MLVA typingmethod at eight loci for 146 strains and isolates from differentherds was 0.938 (95% CI, 0.9175 to 0.9584).
Analysis of the combination of the eight VNTR loci for all ofthe B. hyodysenteriae isolates and strains showed 44 MLVAtypes (see Table S2 in the supplemental material), which dif-fered by at least one repeat for one of the eight loci among twodifferent types. The MLVA types of the reference strains weretype 35 for WA1R, type 23 for B204R, and type 10 for B234R,while the type strain B78T was assigned to MLVA type 28.Analysis of the different MLVA types in each country showedthe existence of considerable diversity. There were 15 types (1,2, 3, 5, 9, 11, 12, 13, 14, 18, 19, 20, 22, 24, and 37) found amongthe 89 Spanish isolates from different herds, 16 types (15, 16,17, 25, 26, 31, 32, 33, 34, 35, 36, 38, 39, 42, 43, and 44) amongthe 36 Australian isolates, 2 types (21 and 27) for the threeCanadian isolates, 3 types (3, 6 and 41) for the seven fromNetherlands, 4 types (3, 8, 29, and 30) for the four strains fromthe United Kingdom, and 6 types (4, 7, 10, 23, 28, and 40) forthe seven isolates and strains from the United States. MLVAtype 3 was shared by isolates from Spain, the United Kingdom,and Netherlands. The MLVA types were stable for the herdswhere more than one isolate was recovered on different sam-pling occasions.
B. hyodysenteriae strain WA1R showed a mismatch for locusBhyo_6 between the length of the PCR product, 780 bp (fournumbers of repeats), and the data derived from the sequencedgenome, 1,092 bp (six numbers of repeats).
Isolates and strains included in the repeatability and repro-ducibility tests had the same MLVA types at the differenttesting times. Moreover, each of the duplicates of the B. hyo-dysenteriae type and reference strains, B78T and B204R, fromthe University of Leon and Murdoch University collections,generated the same MLVA patterns.
Capillary electrophoresis of multiplexed VNTR markers.GeneScan analysis to determine the lengths of the VNTRmarkers included in set 1 and set 2 worked satisfactorily (re-sults not shown). Different loci were clearly distinguished bycolor in the electropherograms, and use of the internal ladderallowed accurate measurement of their sizes. Differences inallele lengths for all of the loci were recorded compared toallele sizes obtained by sequencing. Loci Bhyo_7, Bhyo_23,and Bhyo_10 were 4 bp shorter and Bhyo_21, Bhyo_17, andBhyo_12 were 1 to 2 bp shorter by capillary electrophoresisthan the expected sizes based on sequencing. Peak sizes forlocus Bhyo_22 were 1 bp longer, while the Bhyo_6 locus con-tained an additional 6 bp. No corrections were needed tocalculate the numbers of repeats for loci Bhyo_6, Bhyo_10,Bhyo_12, Bhyo_17, Bhyo_21, and Bhyo_22 because they hadincomplete repeats, which made the number of repeats invari-able after rounding. As Bhyo_7 and Bhyo_23 were composedof exact copy numbers of repeats, 4 bp were added in order tocalculate the number of repeats. MLVA types for all of thebacterial samples typed by GeneScan analysis were congruentwith the previously established types.
MLVA types and bacterial population analysis. An evolu-tionary tree based on MLVA profiles and constructed accord-ing to the UPGMA clustering strategy for the 44 MLVA typesof B. hyodysenteriae determined in this study is shown in Fig. 1.
MLVA type relationships at the single-, double-, and triple-
locus variant levels depicted with the goeBURST algorithm areshown in Fig. 2. Six clonal complexes (I to VI) were establishedat the single-locus variant level. Three new groups appearedwhen investigating double-locus variants, while three single-locus variant groups (II, III, and IV) were clustered together atthis level. When high-level edges were displayed to study re-lationships at the triple-locus variant level, a large cluster ap-peared which included groups I to IV, and group V was ex-panded by two more types. MLVA types 4, 5, 10, and 15 werenot linked with any of the other types detected at any of thelevels studied. Population linkage disequilibrium was detectedfor the 146 isolates from different herds (ISA � 0.1359; P �0.001) and for the different MLVA types (ISA � 0.0336; P �0.005).
DISCUSSION
In this study, we established and used MLVA as a noveltyping method for the pathogenic spirochete B. hyodysenteriae.Many of the MLVA tools for pathogenic bacteria are based onshort repeats (26), whereas the current technique was based onrepeats of greater than 25 bp. These long repeats are unlikelyto exist alone by chance, and hence, they could have an im-portant effect on the biology of B. hyodysenteriae (31). The
FIG. 1. Dendrogram of the 44 B. hyodysenteriae MLVA typesfound in the present study and clustered using UPGMA. Romannumerals I to VI indicate clonal complexes defined at the single-locusvariant level. The scale bar represents genetic distance as the absolutenumber of differences in marker alleles among genotypes. Bootstrapvalues of �40% are shown.
2862 HIDALGO ET AL. J. CLIN. MICROBIOL.
tandem-repeat loci included in this study were placed in inter-genic regions or in regions encoding hypothetical proteins;thus, their functions are unknown and deserve further investi-gation. Long repeats have the potential to be resolved andaccurately sized by agarose gel electrophoresis, not requiringthe use of sophisticated technology to measuring the differ-ences in length, as is required for short repeats. The use ofcapillary electrophoresis with the technique, however, enablesmore rapid throughput. Mismatches between the length incapillary electrophoresis and the size obtained by sequencinghave been reported for other bacteria and have been explainedby the fact that electrophoretic mobility of DNA is sequencedependent (28). In the current study, the use of long repeatsminimized their impact and they were easily corrected and didnot affect the general performance of the technique.
The MLVA technique distinguished 94 of 100 isolates cho-sen at random, exceeding the Hunter-Gaston diversity indexacceptance level of 0.9 previously proposed when developingnew typing schemes (20). There are few published Hunter-Gaston diversity index results for other typing techniques usinglarge nonlocal collections of B. hyodysenteriae strains. How-ever, a recent study by MLST reported a diversity index of0.974 for 111 strains (24), and a previous MLEE study per-formed on 231 isolates gave a haplotypic diversity of 0.94 (34).Although no confidence limits were defined in the previousstudies to enable an accurate evaluation of the techniques (14),MLST seems to be slightly more discriminatory than MLVA.In general, MLVA clustering also was in agreement with thegroups defined by MLST, MLEE, REA, and PFGE, demon-strating the consistency of this new typing technique.
The index of diversity at individual loci indirectly reflects themutation rate and homoplasy. Accordingly, markers withhigher homoplasy have a lower phylogenetic value (13). AHunter-Gaston diversity index cutoff value of 0.9 has beenused for other bacteria to detect hypervariable loci (1, 13).However, none of the loci selected for the B. hyodysenteriae
MLVA exceeded this value, indicating that the technique issufficiently robust to perform phylogenetic studies.
In spite of the strict biosecurity measures that are observed inmodern European piggeries, in this study, one newly definedclone of B. hyodysenteriae (MLVA type 3) was found in Spain,Netherlands, and the United Kingdom. This clone was differentfrom the clone of unusual indole-negative B. hyodysenteriae iso-lates that previously has been detected in pigs from Spain, Ger-many, and Belgium (11, 19) and which were located in MLVAtypes 19, 20, and 22 in clonal complex I in the current study. TheEuropean spread of clones like this could have been the result ofpast movements of carrier pigs of high genetic value, particularlywithin the larger commercial pig-producing companies.
The links at the single-locus variant level were sufficientlystrong to establish epidemiologic connections between strainsand define clonal complexes that were in agreement withthe clusters found in the evolutionary study. However, thegoeBURST higher-level definitions (double- and triple-locusvariant levels) should be considered together with epidemio-logic data before linking isolates. Consequently, the combina-tion of the data produced in the phylogenetic analysis togetherwith the established relationships at different locus variantsallowed the study of associations between strains. This analysisrevealed several international connections between strains,based on a common ancestry. For example, four Spanish types(18, 19, 20, and 22) had the same origin as Canadian isolateFMV89.3323 (type 21) from the late 1980s. Isolates from theUnited Kingdom and the United States were strongly linked(clonal complex III) and were likely related to Dutch strain B5(type 6). As mentioned above, these findings could be ex-plained by the past movement of carrier pigs, particularly thoseof high genetic value. In agreement with this, an isolate fromthe United Kingdom was included in clonal complex IV, com-posed mainly of Australian isolates. The within-country spreadof clonal complexes II and V in Spain and clonal complex VIin Australia is probably the result of adaptive responses of acommon ancestral strain to specific herd conditions in thesecountries, resulting in the current different detectable types.
It is relatively rare for two different strains of B. hyodysen-teriae to be present in the same herd (7). However, a micro-evolution phenomenon resulting in minor changes betweenisolates has been reported for B. hyodysenteriae isolates withinherds when more than one per herd were tested by PFGE orMLST (2, 19, 24). It is not known if these minor changes reflectthe true status of the bacterial population in the herd or are aresult of an inherent variability of the techniques that candepend on a single nucleotide change. On the other hand, thestability of the MLVA types within herds could indicate thattandem repeats are less susceptible to undergoing these minorchanges that can negatively affect the epidemiologic follow-upof strains between herds. Some of the Spanish field isolates hadstable MLVA types over 8 years (types 3 and 13), and thischronologic stability is in agreement with previous observa-tions based on PFGE and RAPD (11, 19). The stability of B.hyodysenteriae under field conditions could reflect the way thispathogen has adapted to survive in the specialized ecologicalniche represented by the hindgut of the pig (4).
A previous study based on MLEE data concluded that B.hyodysenteriae is a recombinant species with an epidemic struc-ture (34). In contrast, another study using MLST analysis
FIG. 2. MLVA types (circled) and relationships found among themaccording to the goeBURST algorithm. Solid lines show the single-locus variant level, dashed lines show the double-locus variant level,and dotted lines show the triple-locus variant level. Groups at thesingle-locus variant level are indicated by roman numerals I to VI.
VOL. 48, 2010 MLVA TYPING OF BRACHYSPIRA HYODYSENTERIAE 2863
found that the population structure appeared clonal (24). Bothstudies were based on the index of association proposed bySmith et al. (32), which was later improved by Haubold et al.(18) and used for the current study. The analysis of the datagenerated by MLVA indicated that the population was in link-age disequilibrium, consistent with a clonal population. Evenwhen analysis of MLVA types and subgroups based on phylo-genetic analysis was performed, the population was clonal at alllevels. However, there are two situations which are likely tobias the clonality of a population: the spatial isolation of lin-eages and the existence of mechanism for recombination (32).Modern pig farming uses spatial isolation to protect pigs fromdiseases and avoid their spread. We attempted to circumventthis by examining isolates from Iberian pigs reared in extensiveunits with limited biosecurity measures. In this system, geo-graphic isolation is minimized while the production character-istics, with access to open field areas and regular movements ofanimals of uncertain sanitary status between farms, enhanceopportunities for transmission. However, linkage disequilib-rium persisted under these circumstances, further supportingthe clonality of the species. It is known that B. hyodysenteriae isable to horizontally transfer genetic information in vitro byusing a prophage-like mechanism (27), but under field condi-tions, this mechanism does not seem to be sufficient to destroylinkage disequilibrium.
In conclusion, MLVA is a low-cost and simple epidemio-logic tool for typing and tracking B. hyodysenteriae isolates.It has a high phylogenetic value and can be used with othertechniques such as MLST if more strain discrimination isneeded.
ACKNOWLEDGMENTS
The work conducted in Spain was funded by the Ministerio deEducacion y Ciencia (Spanish Ministry of Education and Science) andcofinanced by the European Regional Development Funds (ERDF) asprojects AGL2005-01976/GAN (January 2006) and PET 2006–0008.The work in Australia was supported by funds from the AustralianCooperative Research Centre for an Internationally Competitive PorkIndustry (the Pork CRC). Alvaro Hidalgo is supported by a grant fromConsejería de Educacion of the Junta de Castilla y Leon and theEuropean Social Fund.
We thank Gloria Fernandez Bayon and Frances Brigg for excellenttechnical assistance.
REFERENCES
1. Al Dahouk, S., P. Le Fleche, K. Nockler, I. Jacques, M. Grayon, H. C.Scholz, H. Tomaso, G. Vergnaud, and H. Neubauer. 2007. Evaluation ofBrucella MLVA typing for human brucellosis. J. Microbiol. Methods69:137–145.
2. Atyeo, R. F., S. L. Oxberry, and D. J. Hampson. 1999. Analysis of Serpulinahyodysenteriae strain variation and its molecular epidemiology using pulsed-field gel electrophoresis. Epidemiol. Infect. 123:133–138.
3. Baum, D. H., and L. A. Joens. 1979. Serotypes of beta-haemolytic Treponemahyodysenteriae. Infect. Immun. 25:792–796.
4. Bellgard, M. I., P. Wanchanthuek, T. La, K. Ryan, P. Moolhuijzen, Z.Albertyn, B. Shaban, Y. Motro, D. S. Dunn, D. Schibeci, A. Hunter, R.Barrero, N. D. Phillips, and D. J. Hampson. 2009. Genome sequence of thepathogenic intestinal spirochete Brachyspira hyodysenteriae reveals adapta-tions to its lifestyle in the porcine large intestine. PLoS One 4:e4641.
5. Benson, G. 1999. Tandem repeats finder: a program to analyze DNA se-quences. Nucleic Acids Res. 27:573–580.
6. Combs, B., D. J. Hampson, J. R. Mhoma, and J. R. Buddle. 1989. Typing ofTreponema hyodysenteriae by restriction endonuclease analysis. Vet. Micro-biol. 19:351–359.
7. Combs, B. G., D. J. Hampson, and S. J. Harders. 1992. Typing of Australianisolates of Treponema hyodysenteriae by serology and by DNA restrictionendonuclease analysis. Vet. Microbiol. 31:273–285.
8. Dugourd, D., M. Jacques, M. Bigras-Poulin, and J. Harel. 1996. Char-
acterization of Serpulina hyodysenteriae isolates of serotypes 8 and 9 byrandom amplification of polymorphic DNA analysis. Vet. Microbiol. 48:305–314.
9. Feberwee, A., D. J. Hampson, N. D. Phillips, T. La, H. M. van der Heijden,G. J. Wellenberg, R. M. Dwars, and W. J. Landman. 2008. Identification ofBrachyspira hyodysenteriae and other pathogenic Brachyspira species in chick-ens from laying flocks with diarrhea or reduced production or both. J. Clin.Microbiol. 46:593–600.
10. Feil, E. J., B. C. Li, D. M. Aanensen, W. P. Hanage, and B. G. Spratt. 2004.eBURST: inferring patterns of evolutionary descent among clusters of re-lated bacterial genotypes from multilocus sequence typing data. J. Bacteriol.186:1518–1530.
11. Fellstrom, C., M. Karlsson, B. Pettersson, U. Zimmerman, A. Gunnarsson,and A. Aspan. 1999. Emended descriptions of indole negative and indolepositive isolates of Brachyspira (Serpulina) hyodysenteriae. Vet. Microbiol.70:225–238.
12. Francisco, A. P., M. Bugalho, M. Ramirez, and J. A. Carrico. 2009. Globaloptimal eBURST analysis of multilocus typing data using a graphic matroidapproach. BMC Bioinformatics 10:152.
13. Gorge, O., S. Lopez, V. Hilaire, O. Lisanti, V. Ramisse, and G. Vergnaud. 2008.Selection and validation of a multilocus variable-number tandem-repeat analysispanel for typing Shigella spp. J. Clin. Microbiol. 46:1026–1036.
14. Grundmann, H., S. Hori, and G. Tanner. 2001. Determining confidenceintervals when measuring genetic diversity and the discriminatory abilities oftyping methods for microorganisms. J. Clin. Microbiol. 39:4190–4192.
15. Hampl, V., A. Pavlícek, and J. Flegr. 2001. Construction and bootstrapanalysis of DNA fingerprinting-based phylogenetic trees with the freewareprogram FreeTree: application to trichomonad parasites. Int. J. Syst. Evol.Microbiol. 51:731–735.
16. Hampson, D. J., R. F. Atyeo, and B. G. Combs. 1997. Swine dysentery, p.175–209. In D. J. Hampson and T. B. Stanton (ed.), Intestinal spirochaetesin domestic animals and humans. CAB International, Wallingford, UnitedKingdom.
17. Hampson, D. J., C. Fellstrom, and J. R. Thomson. 2006. Swine dysentery, p.785–805. In B. E. Straw, J. J. Zimmerman, S. D’Allaire, and D. J. Taylor(ed.), Diseases of swine, 9th ed. Blackwell Publishing, Ames, IA.
18. Haubold, B., M. Travisano, P. B. Rainey, and R. R. Hudson. 1998. Detectinglinkage disequilibrium in bacterial populations. Genetics 150:1341–1348.
19. Hidalgo, A., A. Carvajal, M. Pringle, P. Rubio, and C. Fellstrom. 2010.Characterization and epidemiological relationships of Spanish Brachyspirahyodysenteriae field isolates. Epidemiol. Infect. 138:76–85.
20. Hunter, P. R., and M. A. Gaston. 1988. Numerical index of the discrimina-tory ability of typing systems: an application of Simpson’s index of diversity.J. Clin. Microbiol. 26:2465–2466.
21. Jensen, N. S., and T. B. Stanton. 1993. Comparison of Serpulina hyodysen-teriae B78, the type strain of the species, with other S. hyodysenteriae strainsusing enteropathogenicity studies and restriction fragment length polymor-phism analysis. Vet. Microbiol. 36:221–231.
22. Johansson, A., J. Farlow, P. Larsson, M. Dukerich, E. Chambers, M. By-strom, J. Fox, M. Chu, M. Forsman, A. Sjostedt, and P. Keim. 2004. World-wide genetic relationships among Francisella tularensis isolates determinedby multiple-locus variable-number tandem repeat analysis. J. Bacteriol. 186:5808–5818.
23. Jolley, K. A., E. J. Feil, M. S. Chan, and M. C. Maiden. 2001. Sequencetype analysis and recombinational tests (START). Bioinformatics 17:1230–1231.
24. La, T., N. D. Phillips, B. L. Harland, P. Wanchanthuek, M. I. Bellgard, andD. J. Hampson. 2009. Multilocus sequence typing as a tool for studying themolecular epidemiology and population structure of Brachyspira hyodysen-teriae. Vet. Microbiol. 138:330–338.
25. Lee, J. I., D. J. Hampson, B. G. Combs, and A. J. Lymbery. 1993. Geneticrelationships between isolates of Serpulina (Treponema) hyodysenteriae, andcomparison of methods for their subspecific differentiation. Vet. Microbiol.34:35–46.
26. Lindstedt, B. A. 2005. Multiple-locus variable number tandem repeats anal-ysis for genetic fingerprinting of pathogenic bacteria. Electrophoresis 26:2567–2582.
27. Matson, E. G., R. L. Zuerner, and T. B. Stanton. 2007. Induction andtranscription of VSH-1, a prophage-like gene transfer agent of Brachyspirahyodysenteriae. Anaerobe 13:89–97.
28. Pasqualotto, A. C., D. W. Denning, and M. J. Anderson. 2007. A cautionarytale: lack of consistency in allele sizes between two laboratories for a pub-lished multilocus microsatellite typing system. J. Clin. Microbiol. 45:522–528.
29. Pourcel, C., F. Andre-Mazeaud, H. Neubauer, F. Ramisse, and G. Vergnaud.2004. Tandem repeats analysis for the high resolution phylogenetic analysisof Yersinia pestis. BMC Microbiol. 4:22.
30. Råsback, T., D. S. Jansson, K. E. Johansson, and C. Fellstrom. 2007. A novelenteropathogenic, strongly haemolytic spirochaete isolated from pig andmallard, provisionally designated “Brachyspira suanatina” sp. nov. Environ.Microbiol. 9:983–991.
31. Rocha, E. P., A. Danchin, and A. Viari. 1999. Functional and evolutionaryroles of long repeats in prokaryotes. Res. Microbiol. 150:725–733.
2864 HIDALGO ET AL. J. CLIN. MICROBIOL.
32. Smith, J. M., N. H. Smith, M. O’Rourke, and B. G. Spratt. 1993. How clonalare bacteria? Proc. Natl. Acad. Sci. U. S. A. 90:4384–4388.
33. Supply, P., R. M. Warren, A. L. Banuls, S. Lesjean, G. D. Van Der Spuy, L. A.Lewis, M. Tibayrenc, P. D. Van Helden, and C. Locht. 2003. Linkage disequi-librium between minisatellite loci supports clonal evolution of Mycobacteriumtuberculosis in a high tuberculosis incidence area. Mol. Microbiol. 47:529–538.
34. Trott, D. J., S. L. Oxberry, and D. J. Hampson. 1997. Evidence for Serpulinahyodysenteriae being recombinant, with an epidemic population structure.Microbiology 143:3357–3365.
35. van Belkum, A. 2007. Tracing isolates of bacterial species by multilocusvariable number of tandem repeat analysis (MLVA). FEMS Immunol. Med.Microbiol. 49:22–27.
VOL. 48, 2010 MLVA TYPING OF BRACHYSPIRA HYODYSENTERIAE 2865
TABLE S1. Description of the 174 B. hyodysenteriae isolates and strains used in the study
Origin Strain or Isolate Countrya Sourceb Date Herd Information
MLVAType
62/1502 Andalucía, Spain León 1/2002 Iberian pigs 3 63/H5 Andalucía, Spain León 1/2007 3 64 Andalucía, Spain León 7/2007 Iberian pigs 3 66/H57 Andalucía, Spain León 5/2007 Iberian pigs 3 97/H88 Andalucía, Spain León 9/2007 Iberian pigs 3 89/H203 Andalucía, Spain León 2/2008 Iberian x duroc 3 Sp5 Andalucía, Spain León 2/2008 Iberian pigs 11 Sp16 Andalucía, Spain León 4/2008 Fattening unit 24 Sp17 Andalucía, Spain León 3/2008 Fattening unit 14 Sp25 Andalucía, Spain León 4/2008 Iberian pigs 3 Sp42 Andalucía, Spain León 6/2009 24 Sp43 Andalucía, Spain León 6/2009 Farrowing to finish 24 Sp46 Andalucía, Spain León 7/2009 24 44/H137 Aragón, Spain León 12/2007 A Multiplier herd 20 46/H181 Aragón, Spain León 2/2008 A Multiplier herd 20 45/H138 Aragón, Spain León 12/2007 20 50/3140 Aragón, Spain León 10/2002 22 51/H3 Aragón, Spain León 12/2006 19 93 Aragón, Spain León 1/2008 18 98 Aragón, Spain León 4/2007 14 Sp10 Aragón, Spain León 3/2008 Farrowing to finish 18 Sp11 Aragón, Spain León 1/2008 Sows 18 Sp24 Aragón, Spain León 4/2008 Sows 14 Sp28 Aragón, Spain León 5/2008 Sows 14 H227 C y L, Spain León 3/2008 3 53 C y L, Spain León 6/2007 B Iberian pigs 1 52/H12 C y L, Spain León 2/2007 B Iberian pigs 1 55 C y L, Spain León 10/2007 C Iberian pigs 3 88 C y L, Spain León 2/2008 C Iberian pigs 3 56/H168 C y L, Spain León 1/2008 C Iberian pigs 3 58/E1090 C y L, Spain León 7/2001 3 59 C y L, Spain León 6/2007 1 96 C y L, Spain León 11/2007 14 Sp13 C y L, Spain León 3/2008 3 Sp14 C y L, Spain León 3/2008 Fattening unit 14 Sp22 C y L, Spain León 5/2008 Sows 22 Sp31 C y L, Spain León 6/2008 3 Sp39 C y L, Spain León 2/2009 Fattening unit 9 Sp49 C y L, Spain León 7/2009 Fattening unit 22 79/H79 C. Val., Spain León 7/2007 2 Sp27 C. Val., Spain León 3/2008 Sows 14 23 Cataluña, Spain León 10/2007 D Iberian pigs. Multiplier 14 24/H183 Cataluña, Spain León 2/2008 D Iberian pigs. Finishers 14 25/H185 Cataluña, Spain León 2/2008 D Iberian pigs. Growers 14 26/H191 Cataluña, Spain León 2/2008 D Iberian pigs. Multiplier 14 84/H213 Cataluña, Spain León 3/2008 D Iberian pigs. Multiplier 14 85/H212 Cataluña, Spain León 3/2008 D Iberian gilts 14 36 Cataluña, Spain León 12/2006 12 37/H2 Cataluña, Spain León 12/2006 12 38/H71 Cataluña, Spain León 6/2007 12 40 Cataluña, Spain León 1/2007 19 43/H170 Cataluña, Spain León 1/2008 E 20 Sp6 Cataluña, Spain León 2/2008 E 20 41 Cataluña, Spain León 2/2007 3 92 Cataluña, Spain León 2/2008 9 94 Cataluña, Spain León 1/2008 12 H9 Cataluña, Spain León 1/2007 20 H19 Cataluña, Spain León 2/2007 9 H72 Cataluña, Spain León 6/2007 12
Sp2 Cataluña, Spain León 1/2008 Sows 20 Sp3 Cataluña, Spain León 1/2008 9 Sp4 Cataluña, Spain León 1/2008 9 Sp8 Cataluña, Spain León 2/2008 5 Sp15 Cataluña, Spain León 3/2008 Sows 9 Sp18 Cataluña, Spain León 4/2008 Iberian pigs 22 Sp19 Cataluña, Spain León 4/2008 37 Sp23 Cataluña, Spain León 4/2008 Farrowing to finish 12 Sp29 Cataluña, Spain León 6/2009 20 Sp33 Cataluña, Spain León 6/2009 Fattening unit 9 Sp34 Cataluña, Spain León 6/2009 Fattening unit 20 Sp35 Cataluña, Spain León 6/2008 Fattening unit 20 Sp36 Cataluña, Spain León 9/2008 Fattening unit 14 Sp45 Cataluña, Spain León 7/2009 Fattening unit 9 71/H44 C-LM, Spain León 3/2007 3 73 C-LM, Spain León 10/2007 3 Sp20 C-LM, Spain León 5/2008 24 Sp38 C-LM, Spain León 1/2009 Fattening unit 9 69/H13 Ext., Spain León 2/2007 F Iberian pigs 3 70/H21 Ext., Spain León 2/2007 F Iberian pigs 3 95/H141 Ext., Spain León 12/2007 Iberian pigs 3 Sp30 Ext., Spain León 6/2009 Iberian pigs 14 Sp44 Ext., Spain León 6/2009 G Fattening unit 14 Sp48 Ext., Spain León 7/2009 G Sows 14 Sp41 Galicia, Spain León 7/2008 3 1/H40 Murcia, Spain León 3/2007 Multiplier herd 13 3 Murcia, Spain León 3/2007 H Sows 13 10 Murcia, Spain León 2/2008 H Sows 13 11/H196 Murcia, Spain León 2/2008 H Sows 13 2e/H35 Murcia, Spain León 3/2007 H Sows 13 2e/H36 Murcia, Spain León 3/2007 H Sows 13 2e/H37 Murcia, Spain León 3/2007 H Sows 13 4/H87 Murcia, Spain León 9/2007 H Sows 13 5/H92 Murcia, Spain León 9/2007 H Sows 13 6/H103 Murcia, Spain León 10/2007 H Sows 13 7/H124 Murcia, Spain León 11/2007 H Sows 13 9/H167 Murcia, Spain León 1/2008 H Sows 13 Sp32 Murcia, Spain León 6/2009 H Sows 13 12/H150 Murcia, Spain León 1/2008 24 13 Murcia, Spain León 1/2008 14 14/H153 Murcia, Spain León 1/2008 I Sows 24 Sp9 Murcia, Spain León 1/2008 I Sows 24 15/H155 Murcia, Spain León 1/2007 24 17 Murcia, Spain León 6/2007 3 19 Murcia, Spain León 1/2008 24 20 Murcia, Spain León 2/2008 J Fattening unit 3 Sp7 Murcia, Spain León 2/2008 J Fattening unit 3 21/H112 Murcia, Spain León 11/2007 3 Sp1 Murcia, Spain León 1/2008 Fattening unit 24 Sp12 Murcia, Spain León 2/2008 K 24 Sp40 Murcia, Spain León 2/2009 K 24 Sp21 Murcia, Spain León 6/2008 Farrowing to finish 24 Sp26 Murcia, Spain León 4/2008 Farrowing to finish 24 78 Spain León 10/2001 13 Sp37 Spain León 5/2009 3 Sp47 Spain León 7/2009 13 NSW2 NSW, Australia Murdoch 1990s 38 NSW3 NSW, Australia Murdoch 1990s 33 Q1 Q, Australia Murdoch 1980s 43 Q10 Q, Australia Murdoch 1980s 32 Q11 Q, Australia Murdoch 1980s 32 Q14 Q, Australia Murdoch 1988 32 Q17 Q, Australia Murdoch 1990s 35 Q18 Q, Australia Murdoch 1990s 16 Q22 Q, Australia Murdoch 1990s 35
Q3 Q, Australia Murdoch 1980s 43 Q8 Q, Australia Murdoch 1980s 42 Q9 Q, Australia Murdoch 1980s 42 SA1 SA, Australia Murdoch 1980s 39 SA2 SA, Australia Murdoch 1980s 39 Vic2 VIC, Australia Murdoch 1987 35 Vic23 VIC, Australia Murdoch 1988 44 Vic24 VIC, Australia Murdoch 1988 44 Vic25 VIC, Australia Murdoch 1980s 44 Vic30 VIC, Australia Murdoch 1980s 31 Vic31 VIC, Australia Murdoch 1980s 32 Vic32 VIC, Australia Murdoch 1980s 31 Vic33 VIC, Australia Murdoch 1980s 44 Vic35 VIC, Australia Murdoch 1980s 36 Vic36 VIC, Australia Murdoch 1991 17 Vic38 VIC, Australia Murdoch 1990 15 WA1R WA, Australia Murdoch 1980s 35 WA14 WA, Australia Murdoch 1980 25 WA2 WA, Australia Murdoch 1980s 35 WA26 WA, Australia Murdoch 1980s 34 WA27 WA, Australia Murdoch 1980s 26 WA28 WA, Australia Murdoch 1980s 35 WA4 WA, Australia Murdoch 1980s 35 WA5 WA, Australia Murdoch 1980s 35 WA6 WA, Australia Murdoch 1980s 16 WA8 WA, Australia Murdoch 1980s 35 WA9 WA, Australia Murdoch 1980s 35 B169 Canada Murdoch 1970s 27 FM88.90 Canada Murdoch 1990 27 FMV89.3323 Canada Murdoch 1989 21 B3 The Netherlands Murdoch - 41 B5 The Netherlands Murdoch - 6 B8 The Netherlands Murdoch - 3 D1 The Netherlands Murdoch - 41 D5 The Netherlands Murdoch - 3 D8 The Netherlands Murdoch - 3 V10 The Netherlands Murdoch - 3 KF9 UK Murdoch 1970 29 P18A UK Murdoch 1970s 30 P19/6/91 UK Murdoch - 3 P35/2 UK Murdoch - 8 ACK300/8 USA Murdoch 1970s 7 B204R USA León, Murdoch 1970s 23 B234R USA Murdoch 1970s 10 B6933 USA Murdoch 1980s 4 B78T USA León, Murdoch 1970s 28 B8044 USA Murdoch 1980s 40 T91/1664B USA Murdoch - 23
a For most of the Spanish and Australian isolates, the administrative region is specified before the country. Abbreviations used for regions are: C y L, Castilla y León; C. Val., Comunidad Valenciana; C-LM, Castilla-La Mancha; Ext., Extremadura; NSW, New South Wales; Q, Queensland; SA, South Australia; VIC, Victoria; WA, Western Australia. b Source León includes isolates from Laboratory of Infectious Diseases in the Veterinary Faculty at the University of León, Spain. Source Murdoch includes isolates from Reference Centre for Intestinal Spirochaetes at Murdoch University, Western Australia.
TABLE S2. The MLVA type definitions used and their frequencies
MLVA Number of repeats for the MLVA types at individual loci Frequencya
type Bhyo_6 Bhyo_7 Bhyo_12 Bhyo_17 Bhyo_21 Bhyo_22 Bhyo_10 Bhyo_23 (%) 1 1 1 2 1 8 2 8 1 2 (1.37) 2 1 1 3 1 8 2 5 1 1 (0.68) 3 1 1 3 1 8 2 8 1 27 (18.49) 4 1 4 2 2 7 2 99 2 1 (0.68) 5 1 5 2 3 4 1 5 1 1 (0.68) 6 1 5 3 5 5 2 99 1 1 (0.68) 7 1 6 3 5 8 2 8 1 1 (0.68) 8 1 6 3 5 8 2 99 1 1 (0.68) 9 2 2 2 1 5 2 6 1 9 (6.16) 10 2 4 2 2 5 6 7 1 1 (0.68) 11 2 5 2 1 5 2 6 1 1 (0.68) 12 2 5 3 2 8 2 10 1 6 (4.11) 13 2 5 3 2 9 2 7 1 4 (2.74) 14 2 6 2 1 5 2 6 1 12 (8.22) 15 3 1 99 99 4 1 99 1 1 (0.68) 16 3 2 3 2 6 2 7 1 2 (1.37) 17 3 6 2 7 5 2 2 1 1 (0.68) 18 4 1 2 2 5 2 3 1 3 (2.05) 19 4 1 3 1 5 2 10 1 2 (1.37) 20 4 1 3 1 5 2 99 1 8 (5.48) 21 4 1 3 2 5 2 7 1 1 (0.68) 22 4 1 3 2 5 2 99 1 4 (2.74) 23 4 4 2 5 7 2 8 1 2 (1.37) 24 4 4 3 2 6 2 99 1 13 (8.9) 25 4 4 3 4 7 1 7 1 1 (0.68) 26 4 4 3 4 8 1 7 1 1 (0.68) 27 4 5 3 2 5 2 3 2 2 (1.37) 28 4 6 3 2 6 3 7 1 1 (0.68) 29 4 6 3 1 5 2 3 2 1 (0.68) 30 4 6 3 2 5 2 6 2 1 (0.68) 31 4 6 3 3 7 2 7 2 2 (1.37) 32 4 6 3 5 5 1 8 2 4 (2.74) 33 4 6 3 5 5 2 6 2 1 (0.68) 34 4 6 3 5 5 2 8 1 1 (0.68) 35 4 6 3 5 5 2 8 2 10 (6.85) 36 4 6 3 5 6 2 8 2 1 (0.68) 37 5 6 2 4 7 2 6 1 1 (0.68) 38 99 3 99 3 7 2 7 1 1 (0.68) 39 99 4 99 3 5 2 7 1 2 (1.37) 40 99 5 3 3 7 3 7 1 1 (0.68) 41 99 5 3 4 4 2 8 2 2 (1.37) 42 99 5 4 4 5 2 3 2 2 (1.37) 43 99 5 4 4 6 2 8 2 2 (1.37) 44 99 5 99 3 5 2 8 1 4 (2.74)
Number of repeats 99 was assigned to non-detectable PCR amplification. a Frequency based on 146 isolates from different herds used in this study.
Trabajos de investigación 85
ESTUDIO IV
Trends towards lower antimicrobial susceptibility and characterization of acquired resistance among clinical isolates of Brachyspira hyodysenteriae in
Spain.
Hidalgo, Á., Carvajal, A., Vester, B., Pringle, M., Naharro, G., Rubio, P.
Antimicrobial Agents and Chemotherapy,
aceptado para su publicación (abril de 2011).
IV
Estudio IV 87
Trends towards Lower Antimicrobial Susceptibility and
Characterization of Acquired Resistance among Clinical Isolates of
Brachyspira hyodysenteriae in Spain
Brachyspira hyodysenteriae ACQUIRED RESISTANCE
Álvaro Hidalgo1*, Ana Carvajal1, Birte Vester2, Märit Pringle3, Germán
Naharro1, Pedro Rubio1
Department of Animal Health, Faculty of Veterinary Science, University
of León, León, Spain1; Department of Biochemistry and Molecular
Biology, University of Southern Denmark, Odense, Denmark2;
Department of Biomedical Sciences and Veterinary Public Health,
Faculty of Veterinary Medicine and Animal Science, Swedish University
of Agricultural Sciences, Uppsala, Sweden3.
*Corresponding author
Facultad de Veterinaria (Enfermedades Infecciosas)
Campus de Vegazana
24071 León, Spain
Phone + 34 987 291306
Fax + 34 987 291304
E-mail: [email protected]
88 Estudio IV
ABSTRACT
The antimicrobial susceptibility of clinical isolates of Brachyspira
hyodysenteriae in Spain was monitored and the underlying molecular
mechanisms of resistance were investigated. Minimal inhibitory
concentrations of tylosin, tiamulin, valnemulin, lincomycin and
tylvalosin were determined for 87 B. hyodysenteriae isolates recovered
from 2008 to 2009 by broth dilution. Domain V of the 23S rRNA gene
and the ribosomal protein L3 gene were sequenced in 20 isolates with
tiamulin MIC ≥4 μg/ml, presenting decreased susceptibility, and in 18
tiamulin susceptible isolates with MIC ≤0.125 μg/ml and all isolates
were typed by multiple-locus variable-number tandem-repeats analysis.
A comparison with antimicrobial susceptibility data from 2000-2007
showed an increase in pleuromutilin resistance over time, doubling the
number of isolates with decreased susceptibility to tiamulin. No
alteration in susceptibility was detected for lincomycin and the MIC of
tylosin remained high (MIC50 >128 µg/ml). The decreased susceptibility
to tylosin and lincomycin can be explained by mutations at position
A2058 of the 23S rRNA gene (Escherichia coli numbering). A2058T
was the predominant mutation but A2058G was also found together with
a change of the neighboring base pair at positions 2057-2611. The role
of additional point mutations in the vicinity of the peptidyl transferase
center and mutations in the L3 at amino acids 148 and 149 and their
possible involvement in antimicrobial susceptibility are considered. An
association between G2032A and high levels of tiamulin and lincomycin
MICs was found, suggesting an increasing importance of this mutation
in antimicrobial resistance of clinical isolates of B. hyodysenteriae.
Estudio IV 89
INTRODUCTION
Brachyspira hyodysenteriae is the etiological agent of swine
dysentery, a severe muco-hemorrhagic colitis that affects pigs primarily
during the grow-finish period and has a significant economic impact
(15). Treatment and control of swine dysentery are mainly based on the
use of antimicrobials, as no commercial vaccine against B.
hyodysenteriae is available.
In Spain, swine dysentery is involved in more than 30% of
diarrhea outbreaks in commercial pig farms (7). A trend towards
antimicrobial resistance has been detected in B. hyodysenteriae isolates
from 2000 to 2007 (17), and Spanish isolates with reduced susceptibility
to several antimicrobial products registered against swine dysentery have
recently been reported (18). Such isolates have been detected in many
pig producer countries (25, 27, 37), and represent a serious threat to the
pig industry (15). Accordingly, antimicrobial susceptibility testing of
clinical isolates of B. hyodysenteriae has become essential to assist
practitioners in selecting swine dysentery treatment strategies. Moreover,
a monitoring program may help to detect new resistance trends and to
evaluate the usefulness of the few available drugs on a national level.
The genetic basis of resistance in clinical isolates of B.
hyodysenteriae to macrolides and lincosamides has been explained by an
A→T transversion mutation at position 2058 of the 23S rRNA gene
(Escherichia coli numbering) (22). Moreover, Pringle et al. (34) related
resistance to tiamulin in laboratory-selected mutants of B.
hyodysenteriae to point mutations in domain V of 23S rRNA gene
and/or the ribosomal protein L3 gene. In that study, two or more point
mutations were frequently detected after in vitro selection with tiamulin,
although they were not proved by genetic evidence to be the cause of
resistance. The corresponding domain V 23S rRNA mutations have later
90 Estudio IV
been investigated individually in Mycobacterium smegmatis and the
genetic basis of resistance to pleuromutilins were confirmed (28, 29).
Three clinical isolates of B. hyodysenteriae with reduced susceptibility
to tiamulin, probably linked to an Asn148Ser change in ribosomal
protein L3 (B. pilosicoli numbering), have been described (34).
Mutations in the L3 gene after in vitro selection with tiamulin have also
been detected in Staphylococcus aureus (13, 30) and in Escherichia coli
(4).
This study was performed to monitor resistance to tylosin,
tiamulin, valnemulin and lincomycin in clinical isolates of
B. hyodysenteriae recovered in 2008 and 2009, and to report on
antimicrobial susceptibility to tylvalosin, which has recently been
registered for treatment of swine dysentery in Spain. In addition, the
mechanisms of resistance in B. hyodysenteriae field isolates to tylosin,
tiamulin, valnemulin, lincomycin and tylvalosin were investigated by
relating mutational changes in the domain V part of the 23S rRNA gene
and the L3 gene to changes in MICs.
MATERIALS AND METHODS
Bacterial strains. A set of 87 Spanish isolates of B.
hyodysenteriae from the bacterial collection held at the Animal Health
Department at the University of León was used in this study. Isolates had
been recovered from fecal samples of pigs suffering from diarrhea
submitted for diagnostic examination between January 2008 and
December 2009, following the methodology described previously (17).
Subsequently, pure cultures of strongly beta hemolytic intestinal
spirochetes were confirmed as B. hyodysenteriae using a species-specific
PCR based on the tlyA gene (36). Isolates were selected in order to
Estudio IV 91
represent the main Spanish pig-producing regions of the country and one
single B. hyodysenteriae isolate was included per farm (n=87).
Antimicrobial agents and broth dilution procedure at the
monitoring stage. Susceptibility testing was performed by broth dilution
(24) using VetMICTM Brachy antibiotic panels (SVA, Sweden)
according to the manufacturer’s recommendations. The antibiotic panels
consisted of 48-well tissue culture trays with dried antimicrobial agents,
including one well without drug as positive growth control. Two-fold
serial dilutions of the following antimicrobial agents were tested:
tiamulin (0.063-8 µg/ml), valnemulin (0.031-4 µg/ml), tylosin (2-128
µg/ml), lincomycin (0.5-64 µg/ml) and tylvalosin (0.25-32 µg/ml). The
MIC was determined as the lowest concentration of antimicrobial agent
that prevented visible growth. Absence of contamination was confirmed
by phase contrast microscopy. The B. hyodysenteriae type strain B78T
(ATCC 27164) was used as a quality control strain as previously
proposed (35).
Detecting changes in antimicrobial susceptibility patterns over
time. Trends in antimicrobial susceptibility of Spanish B. hyodysenteriae
field isolates to tiamulin, valnemulin, tylosin and lincomycin were
studied using a survival analysis. This approach relates the proportion of
the isolates that are not inhibited to the concentration of antibiotic
present, resulting in a survival curve for a particular drug. Thereby
changes in bacterial growth inhibition for a given antimicrobial agent
can be tested over the entire range of concentrations and the use of cut-
off values for resistance is avoided (38). Survival curves were plotted
using the non-parametric Kaplan-Meier method. Curves were right-
censored when there was no growth inhibition at the highest
concentration of antimicrobial tested. A detailed description of this
methodology has been reported previously (17). Moreover, Log Rank
92 Estudio IV
test (α=0.05) was performed in order to compare survival curves from
2008-2009 (this study) with those from 2000-2004 and 2006-2007 (17),
which had been obtained from MICs of 50 and 58 Spanish clinical
isolates of B. hyodysenteriae, respectively. All estimations were done
using the statistical package SPSS for Windows version 17.0 (SPSS,
Chicago, IL, USA). MICs from other studies (17, 23, 25, 37) which have
been used for comparison were obtained by the broth dilution method
used in this study.
Study of in vivo acquired resistance mechanisms. Two groups of
B. hyodysenteriae field isolates were defined according to their
particularly high or low tiamulin MICs. One group, subset A (Table 1),
comprised 20 isolates with reduced susceptibility to tiamulin (MIC ≥4
µg/ml), and a second group, subset B (Table 2), included 18 field
isolates with an MIC ≤0.125 µg/ml. DNA was extracted from all isolates
after boiling and used for PCR amplification of part of the genes for 23S
rRNA (domain V) and ribosomal protein L3. PCR reactions contained
1X PCR buffer (20 mM Tris HCl [pH 8.4], 50 mM KCl), 3 mM MgCl2,
1 U of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), 200
µM deoxynucleoside triphosphate mix (Invitrogen), 0.25 µM each
forward and reverse primers, 2 µl of extracted DNA (5-20 ng/µl), and
sterile distilled water to a final volume of 50 µl. The primer pairs
described by Pringle et al. (34) were used for PCR in a Mastercycler
apparatus (Eppendorf Scientific Inc., Westbury, NY) with an initial step
of 95°C for 5 min, followed by 30 cycles of a three-step cycle protocol
consisting of 95°C for 20 s, 68/58°C (domain V/L3 amplification) for 20
s, and 72°C for 1 min and a final extension step of 72°C for 5 min. The
resulting fragments were subsequently sequenced in both directions.
Nucleotide positions of the 23S rRNA gene were numbered according to
E. coli, whereas translated sequences of ribosomal protein L3 were
Estudio IV 93
numbered according to B. pilosicoli, enabling comparison with other
studies. The E. coli 23S rRNA gene (J01695) and B. pilosicoli ribosomal
protein L3 gene (AF114845) sequences were retrieved from GenBank
and aligned with the homologous B. hyodysenteriae sequences.
Ribosomal protein L3 gene sequences were translated using CLC
Sequence Viewer (www.clcbio.com). 23S rRNA analyses were
performed on the nucleotide level and protein L3 analyses on the amino
acid level.
Those isolates that had not been inhibited by the highest
concentration of tiamulin at the monitoring stage (8 µg/ml) were tested
for higher antimicrobial concentrations using VetMICTM Brachy QCR
high panels (SVA, Sweden) as described above. Antimicrobial ranges
were 1-128 µg/ml for tiamulin, 0.25-32 µg/ml for valnemulin, 16-2048
µg/ml for tylosin and 2-256 µg/ml for lincomycin.
Finally, the 38 selected B. hyodysenteriae field isolates were typed
by multiple-locus variable-number tandem-repeats analysis (MLVA) as
previously described (19). Reference and type strains of
B. hyodysenteriae, B204R (ATCC 31212) and B78T (ATCC 27164),
were included as typing controls. The Hunter-Gaston diversity index
(HGDI) (21) was used to measure the degree of discrimination of the
MLVA typing method in the 38 selected isolates of B. hyodysenteriae.
The VMD program (20) and PDB file: 3OFZ was used to visualize
E. coli 23S RNA and L3 to obtain distances between mutated positions
and L3.
Nucleotide sequence accession numbers. The nucleotide
sequences of partial 23S rRNA (domain V) and protein L3 genes have
been deposited in GenBank under accession numbers JF412548-
JF412585 and JF412586-JF412623, respectively.
TABLE 1. MICs (µg/ml), MLVA types and point mutations of partial sequences of 23S rRNA and ribosomal protein L3
genes for 20 isolates with tiamulin MIC ≥4 µg/ml (Subset A) of B. hyodysenteriae recovered in Spain between 2008 and
2009.
TABLE 2. MICs (µg/ml), MLVA types and point mutations of partial sequences of 23S rRNA and ribosomal protein L3
genes for 18 isolates with tiamulin MIC ≤0.125 µg/ml (Subset B) of B. hyodysenteriae recovered in Spain between 2008
and 2009.
96 Estudio IV
RESULTS AND DISCUSSION
Antimicrobial susceptibility of pathogenic B. hyodysenteriae
isolates. An initial study on MICs of tylosin, tiamulin, valnemulin,
lincomycin and tylvalosin was performed for 87 B. hyodysenteriae
isolates recovered between 2008 and 2009 from fecal samples of pigs
suffering from diarrhea. The values of the lowest concentration of
tiamulin, valnemulin, tylosin, lincomycin and tylvalosin that completely
inhibited the growth of 50% and 90% of the B. hyodysenteriae isolates,
MIC50 and MIC90 respectively, are shown in Table 3. The corresponding
MIC distributions of the antimicrobial agents are presented in Figure 1.
TABLE 3. MIC50, MIC90 and ranges (µg/ml) of five antimicrobial agents
for 87 Spanish field isolates of B. hyodysenteriae recovered between
2008 and 2009.
The pleuromutilins, tiamulin and valnemulin, demonstrated similar
distributions, in which approximately 30% of the isolates tested had
MICs below 0.5 µg/ml, while another 30% had a MIC value of 1 µg/ml.
The 2008-2009 data showed a marked decrease in susceptibility to
valnemulin and tiamulin compared to previous years. The MIC90 reached
8 µg/ml for tiamulin and 4 µg/ml for valnemulin, while MIC50 for both
µg/ml
MIC50 MIC90 Range
Tiamulin 1 8 ≤0.063->8
Valnemulin 1 4 ≤0.031->4
Tylosin >128 >128 16->128
Lincomycin 16 >64 1->64
Tylvalosin 4 16 0.5->32
Estudio IV 97
drugs were 1 µg/ml, showing an increase of at least four-fold when
compared to their respective MIC50 from 2000 to 2007 (17). Similar
results were reported in Germany for 71 and 40 B. hyodysenteriae field
isolates recovered in 2000 and 2001, respectively (37). However, several
of the Spanish field isolates had higher tiamulin and valnemulin MICs
than those reported by Rohde et al. (37), being similar to German and
British isolates with particularly high tiamulin MICs reported by
Karlsson et al. (25).
The MIC of tylosin was ≥128 µg/ml for 98% of the isolates,
showing that decreased susceptibility of Spanish B. hyodysenteriae
isolates to this macrolide is widespread. Although tylvalosin is a
derivative of tylosin it showed a much more susceptible distribution than
tylosin, which was unimodal with a peak at 2 µg/ml. In accordance with
suggested clinical breakpoints (6), tylvalosin can be useful in the
treatment of swine dysentery in Spain, while the use of tylosin is clearly
not advisable. Use of tylosin might even worsen the situation by
providing a pressure to keep the high resistance level. As shown in the
present study, tylosin MICs for Spanish B. hyodysenteriae isolates have
been consistently high over the last decade, with MIC50 exceeding 128
µg/ml.
The distribution for lincomycin showed one large peak at a
concentration of 16 µg/ml, accounting for 38% of the isolates, whilst
20% had a lower MIC. There were no remarkable changes in lincomycin
MIC distribution from 2008 to 2009 when compared to 2000 to 2007
(17). However, comparison with lincomycin MIC distribution of 76
Australian isolates (23) revealed that Spanish isolates were less
susceptible to lincomycin, lacking a significant subpopulation below 4
µg/ml.
98 Estudio IV
FIG. 1. Distribution of MICs of five antimicrobials for 87 Spanish field
isolates of B. hyodysenteriae recovered between 2008 and 2009.
Estudio IV 99
Monitoring antimicrobial susceptibility of pathogenic B.
hyodysenteriae isolates over time by survival analysis. Changes in
antimicrobial susceptibility were monitored by a survival analysis
approach that tests changes in bacterial growth inhibition for a given
antimicrobial agent over the entire range of tested concentrations. The
survival curves for each antimicrobial agent in different periods of time
(Figure 2) were compared using the Log Rank test at α=0.05. As a result,
no statistically significant differences for lincomycin were detected over
the last decade when any of the studied periods were compared. On the
other hand, statistically significant differences for MIC distributions of
tiamulin (p<0.001), valnemulin (p<0.001) and tylosin (p=0.001) were
found between isolates collected in 2008-2009 relative to those collected
in 2000-2004. When survival curves from 2008-2009 were compared
with survival curves from 2006-2007, only valnemulin showed a
statistical significant difference (p=0.038). In all cases, the survival
curves from 2008-2009 were above survival curves from previous
periods of time. Tylosin differences have been reported previously
between isolates from 2000-2004 and those from 2006-2007 (17).
Hence, this study confirms that tylosin resistance has persisted since
2006. The survival analysis for tiamulin and valnemulin MICs showed
an increase in resistance to the pleuromutilins in Spanish isolates within
the last years, as suggested previously (17). It is remarkable that the
tiamulin MICs for more than 60% of the isolates from 2008-2009
exceeded the microbiological breakpoint of 0.5 µg/ml proposed for
monitoring decreased susceptibility to tiamulin by Karlsson et al. (24),
thus doubling this percentage compared to preceding years (17). In
agreement with Lobová et al. (27), cross-resistance between the two
pleuromutilins was encountered for most of the isolates, with valnemulin
MICs one to two dilutions lower than tiamulin MICs for 85% (74 out of
87) of the isolates.
100 Estudio IV
FIG. 2. Survival curves of the log2 (MIC) values of tiamulin, valnemulin,
lincomycin and tylosin for 87 Spanish field isolates of B. hyodysenteriae
recovered between 2008 and 2009 (solid lines). Survival curves for 50
isolates from 2000 to 2004 (dotted lines) and 58 isolates from 2006-2007
(dashed lines), obtained in a previous investigation (17), have been
included for comparison.
Estudio IV 101
Investigation of the molecular basis of the in vivo acquired
resistances. Two groups of the B. hyodysenteriae field isolates were
defined according to their high or low tiamulin MICs. Subset A
comprised 20 isolates with a reduced susceptibility to tiamulin (MIC ≥4
µg/ml), while subset B comprised 18 field isolates with an MIC ≤0.125
µg/ml. Isolates that were not inhibited by tiamulin at the monitoring
stage (8 µg/ml) were tested for concentrations up to 128 µg/ml tiamulin,
32 µg/ml valnemulin, 2048 µg/ml tylosin and 256 µg/ml lincomycin.
MICs for all isolates in the two groups are presented in Table 1 (subset
A) and Table 2 (subset B).
MLVA typing of the two groups demonstrated that the 20 isolates
included in subset A comprised eight different types, including the new
MLVA type 45 (Numerical profile: 1, 1, 4, 2, 5, 2, 99, 1) and that subset
B comprised seven different MLVA types. Three of the MLVA types (3,
9 and 14) were shared by isolates of both subsets (Table 1 and 2).
MLVA was chosen because it is a low-cost, portable, and highly
discriminatory method for strain typing of B. hyodysenteriae which
retains a high phylogenetic value (19). A diversity index (HGDI) of
0.847 was obtained for the 38 selected isolates using MLVA. The HGDI
calculated from data obtained in a previous diversity study of Spanish B.
hyodysenteriae isolates using multilocus sequence typing was 0.749
(31). This suggests that MLVA is a more discriminatory technique than
multilocus sequence typing when applied to the Spanish B.
hyodysenteriae population.
All the tested antimicrobial agents bind to the large ribosomal
subunit at or close to the so-called peptidyl transferase center (PTC) and
thereby inhibit protein synthesis. Numerous studies have shown that
ribosomal mutations can exhibit resistance to the tested drugs although
other resistance mechanisms also can play a role. Especially in
102 Estudio IV
organisms with few (one or two) rrn operons, 23S rRNA mutations are
often found as antimicrobial resistance determinants (41). As previous
studies of Brachyspira have shown or strongly indicated the involvement
of mutations in domain V of 23S rRNA and possibly L3 mutations in
resistance to macrolides, lincosamides and pleuromutilins (22, 34), the
relevant regions of the 23S rRNA and the L3 genes were sequenced
from all the 38 isolates in subset A and B. The mutations are shown in
Table 1 and 2 together with the MICs and MLVA typing and are
depicted on a secondary structure model of domain V 23S rRNA in
Figure 3.
Mutations observed in 23S rRNA and their role in resistance to
tiamulin and other antimicrobial agents. We report MICs from five
antibiotics authorized for treatment of swine dysentery in Spain, which
are members of three different groups: pleuromutilins, macrolides and
lincosamides. The exact binding of candidates from each group of
antimicrobial agents to the 50S bacterial ribosomal subunit has been
determined by x-ray structures (5, 9, 12, 14, 40). Pleuromutilins and
lincosamides have essential overlapping sites at the PTC and the
macrolides bind at an adjacent site with the larger macrolides (such as
tylosin and tylvalosin) reaching slightly into the PTC. It is thus not
surprising that single mutations in the PTC area can confer resistance to
more than one group of antibiotics. Dealing with the presence of several
mutations makes the cross-resistance pattern complex, especially as
these mutations can also act synergistically (29).
Nucleotide A2058 of the 23S rRNA gene was mutated in all
isolates tested. In 35 out of 38 isolates an A→T mutation was found in
this position, while three isolates showed an A→G mutation. Thus, in
agreement with a previous report on Swedish isolates (22), Spanish B.
hyodysenteriae isolates presented mainly an A2058T transversion. Our
Estudio IV 103
detection of A2058G mutations is the first observation of this mutation
in clinical isolates of B. hyodysenteriae, although it has been induced in
vitro (22). It is well known that base substitutions at position 2058 of
23S rRNA gene gives resistance to some or all of the macrolide-
lincosamide-streptogramin B antibiotics (41). Therefore, the decreased
susceptibility to tylosin in all our clinical isolates of B. hyodysenteriae is
likely to be explained by the presence of the A2058 point mutations. In
five isolates, four in subset A (RSp9, RSp15, RSp18, and RSp19) and
one in subset B (RSp22), the 2058 mutation was the only point mutation
detected, so the resistance to tiamulin and valnemulin in RSp9, RSp15,
RSp18, and RSp19 must be caused by mechanisms of resistance not
detectable in this survey. These could be mutations in other regions of
the ribosome or methylations of ribosomal RNA or effects on efflux or
influx.
It has been suggested that binding of tylvalosin is affected by point
mutations at position 2058 of the 23S rRNA gene (22, 25). However, our
data do not fully support such cross-resistance between tylosin and
tylvalosin in B. hyodysenteriae, as MICs as low as 1 µg/ml for tylvalosin
were found in isolates with high MICs for tylosin and presence of the
A2058T mutation (Table 1 and 2).
Isolate RSp7 belonging to MLVA type 3 (subset A) contained both
the A2058T and an A2059G mutation in the 23S rRNA gene. Both 2058
and 2059 mutations have previously been associated with both macrolide
and lincosamide resistance (33, 41). Therefore, we inferred that the
increased MICs for lincomycin and tylvalosin in isolate RSp7, compared
to those isolates with only the 2058 mutation, were due to the 2059
mutation. In addition, a decrease in pleuromutilin susceptibility has been
associated with an A2059G plus A2503T change relative to the single
A2503T change in Mycoplasma gallisepticum (26).
104 Estudio IV
FIG. 3. Secondary structure model of domain V 23S rRNA showing
locations of point mutations detected (arrows) in the present study.
Macrolide (M), lincosamide (L) and pleuromutilin (P) resistance
associated to a particular position has been indicated. Distances from
position 2032 to the nearest ribosomal protein L3 amino acids are
included. E.c., Escherichia coli. B.h., Brachyspira hyodysenteriae.
Estudio IV 105
Isolates RSp4, RSp10 and RSp20 belonging to MLVA type 12
(subset A) presented the A2058G together with G2057A plus C2611T
mutations at the adjacent base pair (Figure 3). In Mycobacterium
smegmatis, such a change of the 2057-2611 base pair is thought to
alleviate the fitness cost caused by A2058G (32). The fitness cost for the
A2058G alone has been considered for Helicobacter pylori (3, 10). In
the present study, the low rate of A2058G (3 out of 38) compared to
A2058T (35 out of 38) could reflect an associated biological cost of
A2058G in B. hyodysenteriae that could be ameliorated by the 2057 and
2611 point mutations. In general, there were no clear indications that
2057-2611 mutations influenced pleuromutilin or macrolide
susceptibility, since the resistance pattern of these isolates was not
considerably different from the patterns of the isolates that only have
A2058 mutations as described above. However, lincomycin MICs of
RSp4, RSp10 and RSp20 were in the higher end. Interestingly, mutations
at position 2611 have previously been related to moderate resistance to
lincomycin and clindamycin in chloroplasts of Chlamydomonas
reinhardtii, a green alga (16).
Point mutations detected in field isolates belonging to the same
MLVA type but classified in different groups according to their
susceptibility to tiamulin might be good indicators of the mechanism of
in vivo acquired resistance. On contrary, single nucleotide point
mutations occurring in a given MLVA type in both susceptible and
resistant clones, are likely not involved in the resistance mechanism
although some synergistic effect on resistance cannot completely be
ruled out. On this basis G2087T for type 14, C2146T, G2365C and
G2535A, for type 3 and C2362T for type 9 are considered irrelevant for
the observed difference in resistance. All these nucleotides are also
positioned 50-120Å away from the tiamulin binding site in the ribosomal
106 Estudio IV
50S subunit. Methylation of G2535 (39) and the G2535A mutation (1, 2)
have previously been shown to confer resistance to the orthosomycin
antibiotics avilamycin and evernimicin. Therefore, we infer that the
G2535A mutation might have been selected by a previous exposure to
avilamycin, which have been extensively used for animal growth
promotion in Europe.
Five 23S rRNA mutations were found in subset A but not in subset
B. The basepair change A2057G plus C2611T and the A2059G were
discussed above. Then there were two isolates RSp11 and RSP14 with
MLVA type 24 that contained A2031T mutations. To our knowledge
this mutation has not been related to any resistance phenotype in any
bacteria. Comparison with the other isolates from the same MLVA type
did not point to any specific effects from this mutation and it might just
be a random mutation but it should be noted that it was present together
with a L3 mutation (discussed below). The fifth mutation was G2032A
that will be discussed separately in the next paragraph.
The G2032A mutation occurs frequently in the tiamulin
resistant isolates. Eight out of the twenty isolates in subset A (40%)
presented a G→A transition mutation at position 2032, whereas no
isolate in subset B contained this mutation. Besides the all-over present
A2058 mutation, the additional 23S rRNA mutations found in these
eight isolates were G2535A, C2362T, and A2031G which were
concluded above not to present any major effect on the resistance
investigated. By examining Table 1 it is very clear that all the isolates
with the G2032A mutation have a high lincomycin MIC (≥64 µg/ml).
This is in agreement with other studies linking 2032 mutations to
lincosamide resistance (8, 11). Moreover, two of the eight isolates with
G2032A mutations (RSp3 and RSp12) presented markedly high MICs
for tiamulin (32 and 64 µg/ml, respectively) and the 2032 mutation could
Estudio IV 107
be a candidate for the MIC differences between RSp12 and RSp13 (both
MLVA type 9) affecting tiamulin, valnemulin and lincomycin. On the
other hand the MLVA type 24 and 45 with the 2032 mutation did not
show increased tiamulin MICs of that level, thus it must be more
complicated than this single change. The G2032A mutation was initially
reported to appear together with other mutations after in vitro selection
for tiamulin resistance in B. hyodysenteriae (34). The individual
contribution to resistance from each of these 23S rRNA mutations (as
well as other mutations) has later been investigated in Mycobacterium
smegmatis and also some of the mutant combinations have been
investigated (28, 29). In M. smegmatis both G2032A and G2032C
showed a four-fold reduced susceptibility to valnemulin but the G2032C
mutation resulted in a considerably higher MIC for clindamycin (a
lincosamide) than G2032A (29). These studies also showed that
combination of single mutations can cause synergistic effects on
antibiotic susceptibility and that positions distant from an antibiotic
binding site can perturb local flexibility and structure of the drug binding
pocket.
Are L3 mutations in Brachyspira spp. resistance determinants?
Bacterial resistance to pleuromutilins in laboratory induced resistant
isolates has been associated with mutations in ribosomal protein L3
genes (4, 13, 30, 34). Therefore the L3 gene was sequenced for all
isolates from subset A and B to search for further correlation and six
isolates showed changes. An Asn→Ser substitution in amino acid
position 148 in protein L3 was detected in three isolates from subset B
and one isolate from subset A (Table 1 and 2). As this mutation was in
subset B, it does not appear to provide any reduced susceptibility to
tiamulin on its own. The two additional 23S rRNA mutations at 2146
and 2365 in isolate RSp2 (subset A) are not likely to act synergistically
108 Estudio IV
with the L3 mutation as these 23S rRNA positions are far away from the
antibiotic binding site. Thus, our data do not support a direct
involvement of this mutation in development of tiamulin resistance. The
same mutation was also found previously in three isolates of B.
hyodysenteriae with reduced tiamulin susceptibility and in laboratory
strains selected for tiamulin resistance (34), although without genetic
proof of correlation. The only genetic proofs of involvement of L3
mutations in reduced tiamulin resistance is from a N149D mutation
(equivalent to position 148 in Brachyspira) on a plasmid borne L3 gene
in E. coli (4) and a triple L3 mutation in Staphylococcus aureus (13).
A Ser→Thr substitution was found at position 149 in two isolates
from subset A (RSp11 and RSp14). Ser149 is close to 23S RNA position
G3032 (3-4 Å). However, these isolates did not show higher
pleuromutilin resistance than the other isolates from the same MLVA
type, so again there was no clear indication of relevance for resistance. A
S149I change was also observed in a B. hyodysenteriae laboratory
strains selected for tiamulin resistance (34) but with no genetic proof of
correlation. More than 10 different L3 mutations and various
combinations of these mutations have been reported in Staphylococcus
and associated with tiamulin resistance (13, 30). These mutations were at
positions equivalent to or relative close to amino acids 148 and 149 in
L3 from Brachyspira spp. It remains to be established whether there is a
clear link between all these L3 mutations and pleuromutilin resistance or
if the L3 mutations appear for some other reason. They might be related
to some compensatory adaptations or work in concert with unidentified
mutations elsewhere. In some isolates they may have been selected by
pressure from other antibiotics binding in the peptidyl transferase center.
Estudio IV 109
CONCLUSION
In summary, antimicrobial resistance to the main drugs used
against B. hyodysenteriae is widespread in Spain. Moreover, the
existence of several multi-resistant isolates, which are genetically
diverse, is reported herein. While mutations at nucleotide position 2058
are involved in tylosin resistance and lincomycin decreased
susceptibility, nucleotide 2032 seems to be a key position in the advance
towards pleuromutilin resistance and higher lincomycin MICs. A2058G
and G2032A mutations had been observed previously by in vitro
selection approaches, and now also occur in clinical isolates of B.
hyodysenteriae, underlining the importance of in vitro selection studies.
Acknowledgements
The authors express their thanks to Gloria Fernández Bayón and
Idoia Portillo Arias for excellent technical assistance. Álvaro Hidalgo is
supported by a grant from Consejería de Educación of the Junta de
Castilla y León and the European Social Fund. This work was funded by
the Ministerio de Educación y Ciencia (Spanish Ministry of Education
and Science) and co-financed by the European Regional Development
Funds (ERDF) as Projects AGL2005-01976/GAN (January 2006),
AGL2010-18804 and PET 2006-0008.
REFERENCES
1. Adrian, P. V., C. Mendrick, D. Loebenberg, P. McNicholas, K.
J. Shaw, K. P. Klugman, R. S. Hare and T. A. Black. 2000.
Evernimicin (SCH27899) inhibits a novel ribosome target site:
analysis of 23S ribosomal DNA mutants. Antimicrob. Agents
Chemother. 44:3101-3106.
110 Estudio IV
2. Belova, L., T. Tenson, L. Xiong, P. M. McNicholas and A. S.
Mankin. 2001. A novel site of antibiotic action in the ribosome:
interaction of evernimicin with the large ribosomal subunit. Proc.
Natl. Acad. Sci. U. S. A. 98:3726-3731.
3. Björkholm, B., M. Sjölund, P. G. Falk, O. G. Berg, L.
Engstrand and D. I. Andersson. 2001. Mutation frequency and
biological cost of antibiotic resistance in Helicobacter pylori. Proc.
Natl. Acad. Sci. U. S. A. 98:14607-14612.
4. Bøsling, J., S. M. Poulsen, B. Vester and K. S. Long. 2003.
Resistance to the peptidyl transferase inhibitor tiamulin caused by
mutation of ribosomal protein L3. Antimicrob. Agents Chemother.
47:2892-2896.
5. Bulkley, D. P., C. A. Innis, G. Blaha and T. A. Steitz. 2010.
Revisiting the structures of several antibiotics bound to the
bacterial ribosome. Proc. Natl. Acad. Sci. U. S. A. 107:17158-
17163.
6. Burch, D. G. S. 2005. Pharmacokinetic, pharmacodynamic and
clinical correlations relating to the therapy of colonic infections in
the pig and breakpoint determinations. The Pig Journal 56:8-24.
7. Carvajal, A., M. L. de Arriba, H. Rodríguez, A. B. Vidal, G. E.
Duhamel and P. Rubio. 2006. Prevalence of Brachyspira species
in pigs with diarrhoea in Spain. Vet. Rec. 158:700-701.
8. Cseplö, A., T. Etzold, J. Schell and P. H. Schreier. 1988. Point
mutations in the 23S rRNA genes of four lincomycin resistant
Nicotiana plumbaginifolia mutants could provide new selectable
markers for chloroplast transformation. Mol. Gen. Genet. 214:295-
299.
9. Davidovich, C., A. Bashan, T. Auerbach-Nevo and A. Yonath.
2007. Induced-fit tightens pleuromutilins binding to ribosomes and
Estudio IV 111
remote interactions enable their selectivity. Proc. Natl. Acad. Sci.
U. S. A. 104:4291-4296.
10. Debets-Ossenkopp, Y. J., A. B. Brinkman, E. J. Kuipers, C. M.
Vandenbroucke-Grauls and J.G. Kusters. 1998. Explaining the
bias in the 23S rRNA gene mutations associated with
clarithromycin resistance in clinical isolates of Helicobacter
pylori. Antimicrob. Agents Chemother. 42:2749-2751.
11. Douthwaite, S. 1992. Functional interactions within 23S rRNA
involving the peptidyltransferase center. J. Bacteriol. 174:1333-
1338.
12. Dunkle, J. A., L. Xiong, A. S. Mankin and J. H. D. Cate. 2010.
Structures of the Escherichia coli ribosome with antibiotics bound
near the peptidyl transferase center explain spectra of drug action.
Proc. Natl. Acad. Sci. U. S. A. 107:17152-17157.
13. Gentry, D. R., S. F. Rittenhouse, L. McCloskey and D. J.
Holmes. 2007. Stepwise exposure of Staphylococcus aureus to
pleuromutilins is associated with stepwise acquisition of mutations
in rplC and minimally affects susceptibility to retapamulin.
Antimicrob. Agents Chemother. 51:2048-2052.
14. Gurel, G., G. Blaha, P. B. Moore and T. A. Steitz. 2009. U2504
determines the species specificity of the A-site cleft antibiotics: the
structures of tiamulin, homoharringtonine, and bruceantin bound to
the ribosome. J. Mol. Biol. 389:146-156.
15. Hampson, D. J., C. Fellström, and J. R Thomson. 2006. Swine
dysentery, p. 785-805. In B. E. Straw, J. J. Zimmerman, S.
D’Allaire, and D. J. Taylor (ed.), Diseases of swine, 9th ed.
Blackwell Publishing, Ames, Iowa.
16. Harris, E. H., B. D. Burkhart, N. W. Gillham and J. E.
Boynton. 1989. Antibiotic resistance mutations in the chloroplast
16S and 23S rRNA genes of Chlamydomonas reinhardtii:
112 Estudio IV
correlation of genetic and physical maps of the chloroplast
genome. Genetics 123:281-292.
17. Hidalgo, Á., A. Carvajal, C. García-Feliz, J. Osorio and P.
Rubio. 2009. Antimicrobial susceptibility testing of Spanish field
isolates of Brachyspira hyodysenteriae. Res. Vet. Sci. 87:7-12.
18. Hidalgo, Á., A. Carvajal, M. Pringle, P. Rubio and C.
Fellström. 2010. Characterization and epidemiological
relationships of Spanish Brachyspira hyodysenteriae field isolates.
Epidemiol. Infect. 138:76-85.
19. Hidalgo, Á., A. Carvajal, T. La, G. Naharro, P. Rubio, N. D.
Phillips and D. J. Hampson. 2010. Multiple-locus variable-
number tandem repeats analysis of the swine dysentery pathogen,
Brachyspira hyodysenteriae. J. Clin. Microbiol. 48:2859-2865.
20. Humphrey, W., A. Dalke, and K. Schulten. 1996. VMD - Visual
Molecular Dynamics. J. Molec. Graphics. 14:33-38.
21. Hunter, P. R., and M. A. Gaston. 1988. Numerical index of the
discriminatory ability of typing systems: an application of
Simpson's index of diversity. J. Clin. Microbiol. 26:2465-2466.
22. Karlsson, M., C. Fellström, M. U. Heldtander, K. E. Johansson
and A. Franklin. 1999. Genetic basis of macrolide and
lincosamide resistance in Brachyspira (Serpulina) hyodysenteriae.
FEMS Microbiol. Lett. 172:255-260.
23. Karlsson, M., S. L. Oxberry and D. J. Hampson. 2002.
Antimicrobial susceptibility testing of Australian isolates of
Brachyspira hyodysenteriae using a new broth dilution method.
Vet. Microbiol. 84:123-133.
24. Karlsson, M., C. Fellström, A. Gunnarsson, A. Landén and A.
Franklin. 2003. Antimicrobial susceptibility testing of porcine
Brachyspira (Serpulina) species isolates. J. Clin. Microbiol.
41:2596-2604.
Estudio IV 113
25. Karlsson, M., A. Aspán, A. Landén and A. Franklin. 2004.
Further characterization of porcine Brachyspira hyodysenteriae
isolates with decreased susceptibility to tiamulin. J. Med.
Microbiol. 53:281-285.
26. Li, B. B., J. Z. Shen, X. Y. Cao, Y. Wang, L. Dai, S. Y. Huang
and C. M. Wu. 2010. Mutations in 23S rRNA gene associated
with decreased susceptibility to tiamulin and valnemulin in
Mycoplasma gallisepticum. FEMS Microbiol. Lett. 308:144-119.
27. Lobová, D., J. Smola and A. Cizek. 2004. Decreased
susceptibility to tiamulin and valnemulin among Czech isolates of
Brachyspira hyodysenteriae. J. Med. Microbiol. 53:287-291.
28. Long, K. S., J. Poehlsgaard, L. H. Hansen, S. N. Hobbie, E. C.
Böttger and B. Vester. 2009. Single 23S rRNA mutations at the
ribosomal peptidyl transferase centre confer resistance to
valnemulin and other antibiotics in Mycobacterium smegmatis by
perturbation of the drug binding pocket. Mol. Microbiol. 71:1218-
1227.
29. Long, K. S., C. Munck, T. Andersen, M. Schaub, S. N. Hobbie,
E. C. Böttger and B. Vester. 2010. Mutations in 23S rRNA at the
peptidyl transferase center and their relationship to linezolid
binding and cross resistance. Antimicrob. Agent Chemother.
54:4705-4713.
30. Miller, K., C. J. Dunsmore, C. W. Fishwick and I. Chopra.
2008. Linezolid and tiamulin cross-resistance in Staphylococcus
aureus mediated by point mutations in the peptidyl transferase
center. Antimicrob. Agents Chemother. 52:1737-1742.
31. Osorio, J., A. Carvajal, Á. Hidalgo, H. Argüello, G. Naharro,
T. La, D. J. Hampson and P. Rubio. 2010. Genetic diversity and
population structure of B. hyodysenteriae in Spain, p. 125. In E.
grosse Beilage and T. Blaha (ed.). Proceedings of the 2nd European
114 Estudio IV
Symposium in Porcine Health Management. European College of
Porcine Health Management, Hannover, Germany.
32. Pfister, P., N. Corti, S. Hobbie, C. Bruell, R. Zarivach, A.
Yonath and E. C., Böttger. 2005. 23S rRNA base pair 2057-2611
determines ketolide susceptibility and fitness cost of the macrolide
resistance mutation 2058A → G. Proc. Natl. Acad. Sci. U. S. A.
102:5180-5185.
33. Poehlsgaard, J., P. Pfister, E. C. Böttger and S. Douthwaite.
2005. Molecular mechanisms by which rRNA mutations confer
resistance to clindamycin. Antimicrob. Agents Chemother.
49:1553-1555.
34. Pringle, M., J. Poehlsgaard, B. Vester and K. S. Long. 2004.
Mutations in ribosomal protein L3 and 23S ribosomal RNA at the
peptidyl transferase centre are associated with reduced
susceptibility to tiamulin in Brachyspira spp. isolates. Mol.
Microbiol. 54:1295-1306.
35. Pringle, M., F. M. Aarestrup, B. Bergsjø, M. Fossi, E. Jouy, A.
Landén, D. Mevius, K. Perry, C. Teale, J. Thomson, T.
Skrzypczak, K. Veldman and A. Franklin. 2006. Quality-control
ranges for antimicrobial susceptibility testing by broth dilution of
the Brachyspira hyodysenteriae type strain (ATCC 27164T).
Microb. Drug Resist. 12:219-221.
36. Råsbäck, T., C. Fellström, A. Gunnarsson and A. Aspán. 2006.
Comparison of culture and biochemical tests with PCR for
detection of Brachyspira hyodysenteriae and Brachyspira
pilosicoli. J. Microbiol. Methods. 66:347-353.
37. Rohde, J., M. Kessler, C. G. Baums and G. Amtsberg. 2004.
Comparison of methods for antimicrobial susceptibility testing and
MIC values for pleuromutilin drugs for Brachyspira
hyodysenteriae isolated in Germany. Vet. Microbiol. 102:25-32.
Estudio IV 115
38. Stegeman, J. A., J. C. Vernooij, O. A. Khalifa, J. Van den
Broek and D. J. Mevius. 2006. Establishing the change in
antibiotic resistance of Enterococcus faecium strains isolated from
Dutch broilers by logistic regression and survival analysis. Prev.
Vet. Med. 74:56-66.
39. Treede, I., L. Jacobsen, F. Kirpekar, B. Vester, G. Weitnauer,
A. Bechthold and S. Douthwaite. 2003. The avilamycin
resistance determinants AviRa and AviRb methylate 23S rRNA at
the guanosine 2535 base and the uridine 2479 ribose. Mol. Micro.
49:309-318.
40. Tu, D., G. Blaha, P. B. Moore and T. A. Steitz. 2005. Structures
of MLSBK antibiotics bound to mutated large ribosomal subunits
provide a structural explanation for resistance. Cell. 121:257-270.
41. Vester, B. and S. Douthwaite. 2001. Macrolide resistance
conferred by base substitutions in 23S rRNA. Antimicrob. Agents
Chemother. 45:1-12.
Trabajos de investigación 117
ESTUDIO V
Prevalence of Brachyspira pilosicoli and “Brachyspira canis” in dogs and their association
with diarrhoea.
Hidalgo, Á., Rubio, P., Osorio, J., Carvajal, A
Veterinary Microbiology 146, 356-360 (2010).
V
Veterinary Microbiology 146 (2010) 356–360
Short communication
Prevalence of Brachyspira pilosicoli and ‘‘Brachyspira canis’’ in dogs andtheir association with diarrhoea
Alvaro Hidalgo *, Pedro Rubio, Jesus Osorio, Ana Carvajal
Department of Animal Health, Infectious Diseases and Epidemiology, Faculty of Veterinary Science, University of Leon, Leon, Spain
A R T I C L E I N F O
Article history:
Received 5 February 2010
Received in revised form 30 April 2010
Accepted 5 May 2010
Keywords:
Brachyspira pilosicoli
‘‘Brachyspira canis’’
Prevalence
Intestinal spirochaetosis
Dog
Diarrhoea
A B S T R A C T
The aims of this study were to investigate the prevalence of colonization with intestinal
spirochaetes in dogs, and to assess their association with diarrhoea. To achieve this, faecal
samples from 311 dogs were obtained between November 2008 and April 2009 and
cultured for Brachyspira species. A total of 41 Brachyspira spp. isolates were recovered, and
these were classified into species according to their biochemical properties, and results of
a B. pilosicoli species-specific PCR, and partial amplification of the nox gene with
sequencing of the product. An overall Brachyspira spp. prevalence of 13.2% (41/311) was
obtained. The prevalence of Brachyspira pilosicoli faecal shedding was 4.8% (15/311) while
‘‘Brachyspira canis’’ was identified in 8.0% (25/311) of the sampled dogs. One dog shed an
isolate tentatively identified as B. intermedia. A statistically significant association
between the shedding of B. pilosicoli and the presence of diarrhoea in dogs was
demonstrated (P< 0.001). Risk factors for shedding of Brachyspira spp. were investigated.
Using the odds ratio, the risk of B. pilosicoli shedding was five times higher among dogs up
to 1 year of age as compared with adult dogs (older than 1 year). These findings may have
practical implications in the public and animal health fields.
� 2010 Elsevier B.V. All rights reserved.
Contents lists available at ScienceDirect
Veterinary Microbiology
journal homepage: www.elsev ier .com/ locate /vetmic
1. Introduction
The genus Brachyspira is comprised of oxygen tolerantanaerobic spirochaetes that colonize the large intestine ofanimals and humans (Hampson et al., 1997). Two differentBrachyspira spp. have been commonly isolated from dogs:‘‘B. canis’’, considered to be non-pathogenic, and B. pilosicoli,which has been proposed as a possible cause of diarrhoea indogs (Duhamel et al., 1998; Oxberry and Hampson, 2003;Johansson et al., 2004). Interestingly, B. pilosicoli is the onlyBrachypira species that has been isolated from a wide rangeof species, including humans, non-human primates, pigs,chickens, other birds, horses, rheas and dogs—and has beenassociated with disease (‘‘intestinal spirochaetosis’’) inseveral of these hosts. A number of investigations havesuggested the possible transmission of B. pilosicoli between
* Corresponding author at: Facultad de Veterinaria (Enfermedades
Infecciosas), Campus de Vegazana, 24071 Leon, Spain.
Tel.: +34 987 291306; fax: +34 987 291304.
E-mail address: [email protected] (A. Hidalgo).
0378-1135/$ – see front matter � 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetmic.2010.05.016
animals and human beings (Koopman et al., 1993; Trottet al., 1997, 1998; Hampson et al., 2006).
As dogs live in close contact with human beings, theyare a potential source of B. pilosicoli infection and this mayrepresent a public health risk. However, little is knownabout the prevalence of B. pilosicoli in dogs, or even aboutits association with diarrhoea. Similarly information aboutthe prevalence of ‘‘B. canis’’, the other major Brachyspira
species isolated from dogs, is sparse. Accordingly, thisstudy was undertaken to clarify the prevalence of canineintestinal spirochaetal infection, to assess risk factors forBrachyspira spp. shedding in dogs, and to investigate theassociation between the detection of Brachyspira spp. andthe occurrence of diarrhoea.
2. Materials and methods
2.1. Sampling and epidemiological survey
The number of dogs to be sampled was calculated withthe WIN EPISCOPE 2.0 computer package. Sample size was
A. Hidalgo et al. / Veterinary Microbiology 146 (2010) 356–360 357
estimated to be enough to predict the prevalence ofintestinal spirochaete shedding in dogs with an absoluteerror of �5% and a 95% confidence level. For an expectedBrachypira spp. prevalence of 18.7% (Lee and Hampson,1996) a total of 234 dogs should be included.
As part of a diagnostic exercise, clinicians from 10veterinary clinics located in the town of Leon and itssuburbs randomly sampled dogs attending for anyconsultation during the period November 2008–April2009. Faecal samples were collected directly from therectum of dogs using sterile alginate bacteriology swabs.Each faecal sample was labelled and accompanied by aquestionnaire filled in by the practitioner, including date ofbirth, gender and breed of the dog. Dogs presented to theclinics with any recent history of diarrhoea (multiple loosebowel movements per day) were confirmed through thedetection of loose stool at the sampling time. In addition, toevaluate potential risk factors for the shedding ofBrachyspira spp., clinicians also scored the origin of thedog (breeder/pet shop/private owner/animal shelter), thehousing (indoor/outdoor), the task or work (company/guard/hunting/miscellaneous), contact with other dogs(low/medium/high) and current drug treatments, if any.
2.2. Culture, biochemical characterization and diagnostic PCR
Faecal specimens were streaked on selective agar(Jenkinson and Wingar, 1981), and incubated in ananaerobic atmosphere at 39 8C for 10 days. Plates showinghaemolysis were checked for spirochaetal presence bymicroscopy and subsequently propagated until pure.Biochemical characterization was performed as previouslydescribed by Fellstrom and Gunnarsson (1995). Species-specific PCR (Rasback et al., 2006) was used to identify B.
pilosicoli isolates. B. hyodysenteriae B78T (ATCC 27164T),and B. pilosicoli P43/6/78T (ATCC 51139) were used ascontrols.
2.3. PCR amplification and sequencing of the nox gene
DNA samples obtained by the boiling method wereused to amplify Brachyspira spp. specific 939 bp DNAfragments of the nox gene as previously described (Rohdeet al., 2002). Amplicons were subsequently purified andsequenced. PHYLIP v3.6 was used to construct a dendro-gram, including nox sequences of Brachyspira spp. refer-
Table 1
Biochemical reactions and PCR identification using a species-specific PCR for the d
intestinal spirochaetes isolated from dogs. Biochemical groups were defined acco
reactions are indicated in parentheses.
Group No. of isolates Indole Hippurate
II n = 1 + �
IIIa n = 22 � �n = 3 � �
IV n = 6 � +
n = 3 � (+)
n = 3 + (+)
n = 1 � +
n = 1 + +
n = 1 + (+)
ence and type strains retrieved from GenBank: B. murdochii
56-150T (AF060813), B. innocens B256T (AF060804), B.
pilosicoli P43T (AF060807), B. alvinipulli C1T (AF060814), ‘‘B.
suanatina’’ (DQ487119), B. hyodysenteriae B204R (U19610),B. hyodysenteriae B78T (AF060800), B. intermedia PWS/AT
(AF060811), ‘‘B. canis’’ Dog A2R (EU819071) and B. alborgii
513AT (AF060816).
2.4. Statistical analysis
A univariate analysis using Yates’ Chi-square test(a = 0.05) was used to investigate the association betweenthe presence of B. pilosicoli or ‘‘B. canis’’ and the occurrenceof diarrhoea in dogs. Risk factors for Brachyspira spp., B.
pilosicoli and ‘‘B. canis’’ shedding were also assessed by theYates’ Chi-square test (a = 0.05). Fisher’s exact test waschosen when any expected value was lower than 5.Additionally, to study age as a possible confounding factorfor the shedding of B. pilosicoli or ‘‘B. canis’’ and thepresence of diarrhoea, a stratified analysis was performed.The variable ‘‘age’’ was taken as a categorical variable withtwo levels: dogs older than 1 year/dogs 1 year or younger.The programme Epi Info, version 3.5.1 (CDC, USA) was usedfor the calculations.
3. Results
3.1. Culture, biochemical characterization and diagnostic PCR
A total of 311 faecal samples were collected through thestudy. Of these, 41 (13.2%) were confirmed to containspirochaetes on primary cultures and were subcultured topurity. All the spirochaetes recovered showed weak beta-haemolysis. Subsequent determination of their biochemi-cal properties (Table 1) classified 15 out of 41 (36.6%)isolates as group IV (B. pilosicoli), 25 (61.0%) as group IIIa(‘‘B. canis’’) and one (2.4%) as group II (B. intermedia). Thespecies-specific PCR amplified a 16S rDNA fragmentspecific for B. pilosicoli in 15 DNA samples from 41 ofthe isolates (36.6%).
3.2. Phylogenetic analysis
In an evolutionary tree based on partial sequences ofthe nox, 15 canine isolates grouped together with the B.
pilosicoli type strain P43T, 25 isolates with the reference
etection of B. pilosicoli (Rasback et al., 2006) of 41 weakly beta-haemolytic
rding to Fellstrom et al. (2008) and Johansson et al. (2004). Weak positive
a-Galatosidase b-Glucosidase PCR identification
� + None
� + None
� (+) None
+ � B. pilosicoli
+ � B. pilosicoli
� � B. pilosicoli
� � B. pilosicoli
+ � B. pilosicoli
(+) � B. pilosicoli
Table 2
Faecal shedding of B. pilosicoli and ‘‘B. canis’’ among 311 dogs according to the presence of diarrhoea at the time of the sampling, age, origin, housing, task and
degree of contact with other dogs.
No. of dogs (%) No. of positive dogs (%) P-Value OR (95% CI)
B. pilosicoli
Diarrhoea
Presence 44 (14.1) 8 (18.2) <0.001 8.25 (2.53–27.25)
Absence 267 (85.9) 7 (2.6)
Age
�1 year 71 (22.8) 9 (12.7) 0.002 5.66 (1.76–18.73)
>1 year 240 (77.2) 6 (2.5)
Origin
Breeder 30 (9.6) 3 (10) 0.047
Pet shop 13 (4.2) 0 (0)
Private owner 258 (83) 10 (3.9)
Animal shelter 10 (3.2) 2 (20)
Housing
Indoor 170 (54.7) 5 (2.9) 0.151 0.4 (0.11–1.30)
Outdoor 141 (45.3) 10 (7.1)
Task/work
Company 287 (92.3) 12 (4.2) <0.001
Guard 7 (2.3) 0 (0)
Hunting 11 (3.5) 0 (0)
Miscellaneous 6 (1.9) 3 (50)
Degree of contact with other dogs
Low 58 (18.6) 2 (3.4) 0.738
Medium 173 (55.7) 8 (4.6)
High 80 (25.7) 5 (6.3)
‘‘B. canis’’
Diarrhoea
Presence 44 (14.1) 4 (9.1) 0.765 1.17 (0.32–3.87)
Absence 267 (85.9) 21 (7.9)
Age
�1 year 71 (22.8) 8 (11.3) 0.373 1.67 (0.63–4.33)
>1 year 240 (77.2) 17 (7.1)
Origin
Breeder 30 (9.6) 5 (16.7) 0.167
Pet shop 13 (4.2) 0 (0)
Private owner 258 (83) 20 (7.8)
Animal shelter 10 (3.2) 0 (0)
Housing
Indoor 170 (54.7) 11 (6.5) 0.364 0.63 (0.26–1.53)
Outdoor 141 (45.3) 14 (9.9)
Task/work
Company 287 (92.3) 21 (7.3) 0.086
Guard 7 (2.3) 1 (14.3)
Hunting 11 (3.5) 3 (27.3)
Miscellaneous 6 (1.9) 0 (0)
Degree of contact with other dogs
Low 58 (18.6) 5 (8.6) 0.792
Medium 173 (55.7) 15 (8.7)
High 80 (25.7) 5 (6.3)
A. Hidalgo et al. / Veterinary Microbiology 146 (2010) 356–360358
strain of ‘‘B. canis’’, Dog A2R, and one isolate with the typestrain of B. intermedia, PWS/AT.
3.3. Prevalence and risk factors for faecal shedding of
intestinal spirochaetes
A prevalence of 13.2% (41 out of 311) was obtained forfaecal shedding of Brachyspira spp. The prevalence of B.
pilosicoli shedding dogs was 4.8% (15 out of 311), while ‘‘B.
canis’’ was detected in faecal samples from 25 dogs (8.0%).A single B. intermedia isolate was recovered (0.3%).
Data and statistical analysis regarding shedding andrisk factors for B. pilosicoli and ‘‘B. canis’’ are presented inTable 2. Isolation of B. pilosicoli was more frequent in dogs 1year or younger (12.7%) than in older dogs (2.5%). Inaddition, the prevalence of B. pilosicoli shedding wassignificantly higher among animals with diarrhoea at thetime of the sampling (P< 0.001). The stratified analysis
A. Hidalgo et al. / Veterinary Microbiology 146 (2010) 356–360 359
using Chi-square for homogeneity of the odds ratios bystratum showed that the results were similar between thetwo categories defined by the age (x2 = 0.032, P = 0.858).Significant associations were identified between theshedding of B. pilosicoli and the origin of the dog(P = 0.047) and the task or work it performed (P< 0.001),but no statistical association was detected between any ofthe studied variables and ‘‘B. canis’’ colonization.
4. Discussion
Routine identification of canine Brachyspira spp.isolates has been mainly based on their phenotypicproperties and species-specific PCR results, when avail-able (Fellstrom et al., 2001; Oxberry and Hampson, 2003;Johansson et al., 2004). In the present work, thebiochemical pattern for Spanish ‘‘B. canis’’ isolates wasstable, although the B. pilosicoli isolates presented moreheterogeneous results. Similar atypical patterns for B.
pilosicoli recovered from dogs have been reportedpreviously (Fellstrom et al., 2001; Johansson et al.,2004). However, the shortened diagnostic scheme pro-posed by Johansson et al. (2004) for rapid identification ofcanine Brachyspira spp. strains using two biochemicaltests was found to be inadequate for accurately classifyingour isolates, and this required a complete description oftheir phenotypic properties.
To the authors’ knowledge, there are no availablespecies-specific PCR assays for identification of ‘‘B. canis’’.Therefore, to confirm suspicious isolates, we sequencedthe nox gene, which is suitable for discriminating betweenBrachyspira species (Rohde et al., 2002; Rasback et al.,2007; Fellstrom et al., 2008). Nox sequences of the canineBrachyspira spp. isolates were in agreement with previousclassifications based on phenotypes and species-specificPCR.
The prevalence of Brachyspira spp. faecal shedding(13.2%) reported here among Spanish dogs is slightlylower than the 18.7% of positive animals previouslyreported in dogs from Australia (Lee and Hampson,1996). In Sweden, 21 out of 32 dogs (65.6%) in a beaglecolony and 3 out of 17 pet dogs (17.6%) were colonizedby Brachyspira spp., but in both cases, animals weresuffering acute or chronic diarrhoea problems (Fellstromet al., 2001).
B. pilosicoli was recovered from 4.8% of the sampleddogs. This prevalence is similar to that reported previouslyin dogs from Papua New Guinea (5.3%) (Trott et al., 1997).Colonization with B. pilosicoli was more frequent amongpups or young dogs (1 year or less) than in older dogs.Moreover, the prevalence detected in our study amongdogs 1 year or younger (12.7%) was very similar to thatreported among pet shop puppies in Australia (14.2%)(Oxberry and Hampson, 2003). On the other hand, ‘‘B.
canis’’ was identified in 8.0% of the Spanish dogs.Interestingly, no dogs were found harbouring more thanone Brachyspira species.
To the best of our knowledge, the present study is thefirst confirmation of a statistically significant associationbetween the shedding of B. pilosicoli and the presence ofdiarrhoea in dogs. In recent reports, Fellstrom et al. (2001)
were not able to confirm a causal relationship betweendiarrhoea and isolation of spirochaetes from dogs, whilstOxberry and Hampson (2003) failed to statisticallydemonstrate this relationship due to a small sample size.No association between the shedding of ‘‘B. canis’’ and thepresence of diarrhoea was identified in our study,supporting the likelihood that this species is a commensal.Moreover, this fact further supports the idea of anassociation between B. pilosicoli colonization and diarrhoeasince it excludes the possibility of a passive shedding ofspirochaetes in dogs suffering from diarrhoea caused byother aetiologies, as previously proposed (Leach et al.,1973). However, the confirmation of the role of B. pilosicoli
as a primary or concurrent aetiological agent in dogsrequires further studies, including examining biopsies orundertaking necropsies of naturally or experimentallyinfected dogs. Although in the present study it was notpossible to obtain any colorectal biopsies to studypathological changes, B. pilosicoli attachment to themucosa of dogs, consistent with intestinal spirochaetosis,has been previously reported (Duhamel et al., 1996), andmacro- and micro-scopic changes have been observed indogs that were likely to be associated with B. pilosicoli
infection (Fellstrom et al., 2001).Two significant risk factors were found in the univariate
analysis for the shedding of B. pilosicoli. The first was theorigin, with dogs from animal shelters having a higher risk,following by those that came from breeders. A high densityof dogs, together with a lack of knowledge about control ofB. pilosicoli compared to other pathogens, could favour itsspread in these animals. The second risk factor was thetask/work of the dog, with a higher prevalence of B.
pilosicoli shedding among dogs classified as miscellaneous.However, no differences were found among company,guard and hunting dogs.
In summary, shedding of Brachyspira spp. in faeces iscommon among Spanish dogs. Although ‘‘B. canis’’ ismore prevalent, B. pilosicoli was detected in 4.8% of dogsof all ages, being associated with diarrhoea. In addition,the prevalence of B. pilosicoli shedding among dogs 1year or younger was 12.7%. Hence, dogs should beconsidered as a likely reservoir of B. pilosicoli, which mayhave practical implications in the public and animalhealth fields.
Acknowledgements
The authors express their thanks to Gloria FernandezBayon and Idoia Portillo Arias for excellent technicalassistance as well as to all the clinicians who contributedduring the sampling. Alvaro Hidalgo is supported by agrant from Consejerıa de Educacion of the Junta deCastilla y Leon and the European Social Fund. This workwas funded by the Ministerio de Educacion y Ciencia(Spanish Ministry of Education and Science) and co-financed by the European Regional Development Funds(ERDF) as Project AGL2005-01976/GAN (January 2006).We acknowledge Professor David Hampson of MurdochUniversity for assistance with English grammar andorthography.
A. Hidalgo et al. / Veterinary Microbiology 146 (2010) 356–360360
References
Duhamel, G.E., Hunsaker, B.D., Mathiesen, M.R., Moxley, R.A., 1996.Intestinal spirochetosis and giardiasis in a beagle pup with diarrhea.Vet. Pathol. 33, 360–362.
Duhamel, G.E., Trott, D.J., Muniappa, N., Mathiesen, M.R., Tarasiuk, K., Lee,J.I., Hampson, D.J., 1998. Canine intestinal spirochetes consist ofSerpulina pilosicoli and a newly identified group provisionally desig-nated ‘‘Serpulina canis’’ sp. nov. J. Clin. Microbiol. 36, 2264–2270.
Fellstrom, C., Gunnarsson, A., 1995. Phenotypical characterisation ofintestinal spirochaetes isolated from pigs. Res. Vet. Sci. 59, 1–4.
Fellstrom, C., Pettersson, B., Zimmerman, U., Gunnarsson, A., Feinstein, R.,2001. Classification of Brachyspira spp. isolated from Swedish dogs.Anim. Health Res. Rev. 2, 75–82.
Fellstrom, C., Rasback, T., Johansson, K.E., Olofsson, T., Aspan, A., 2008.Identification and genetic fingerprinting of Brachyspira species. J.Microbiol. Methods 72, 133–140.
Hampson, D.J., Atyeo, R.F., Combs, B.G., 1997. Swine dysentery. In:Hampson, D.J., Stanton, T.B. (Eds.), Intestinal Spirochaetes in DomesticAnimals and Humans. CAB International, Wallingford, UK, pp. 175–209.
Hampson, D.J., Oxberry, S.L., La, T., 2006. Potential for zoonotic transmis-sion of Brachyspira pilosicoli. Emerg. Infect. Dis. 12, 869–870.
Jenkinson, S.R., Wingar, C.R., 1981. Selective medium for the isolation ofTreponema hyodysenteriae. Vet. Rec. 109, 384–385.
Johansson, K.E., Duhamel, G.E., Bergsjo, B., Engvall, E.O., Persson, M.,Pettersson, B., Fellstrom, C., 2004. Identification of three clusters ofcanine intestinal spirochaetes by biochemical and 16S rDNA sequenceanalysis. J. Med. Microbiol. 53, 345–350.
Koopman, M.B., Kasbohrer, A., Beckmann, G., van der Zeijst, B.A., Kusters,J.G., 1993. Genetic similarity of intestinal spirochetes from humansand various animal species. J. Clin. Microbiol. 31, 711–716.
Leach, W.D., Lee, A., Stubbs, R.P., 1973. Localization of bacteria in thegastrointestinal tract: a possible explanation of intestinal spirochae-tosis. Infect. Immun. 7, 961–972.
Lee, J.I., Hampson, D.J., 1996. The prevalence of intestinal spirochaetes indogs. Aust. Vet. J. 74, 466–467.
Oxberry, S.L., Hampson, D.J., 2003. Colonisation of pet shop puppies withBrachyspira pilosicoli. Vet. Microbiol. 93, 167–174.
Rasback, T., Fellstrom, C., Gunnarsson, A., Aspan, A., 2006. Comparison ofculture and biochemical tests with PCR for detection of Brachyspirahyodysenteriae and Brachyspira pilosicoli. J. Microbiol. 66, 347–353.
Rasback, T., Jansson, D.S., Johansson, K.E., Fellstrom, C., 2007. A novelenteropathogenic, strongly haemolytic spirochaete isolated from pigand mallard, provisionally designated ‘Brachyspira suanatina’ sp. nov.Environ. Microbiol. 9, 983–991.
Rohde, J., Rothkamp, A., Gerlach, G.F., 2002. Differentiation of porcineBrachyspira species by a novel nox PCR-based restriction fragmentlength polymorphism analysis. J. Clin. Microbiol. 40, 2598–2600.
Trott, D.J., Combs, B.G., Mikosza, A.S., Oxberry, S.L., Robertson, I.D., Passey,M., Taime, J., Sehuko, R., Alpers, M.P., Hampson, D.J., 1997. Theprevalence of Serpulina pilosicoli in humans and domestic animalsin the Eastern Highlands of Papua New Guinea. Epidemiol. Infect. 119,369–379.
Trott, D.J., Mikosza, A.S., Combs, B.G., Oxberry, S.L., Hampson, D.J., 1998.Population genetic analysis of Serpulina pilosicoli and its molecularepidemiology in villages in the Eastern Highlands of Papua NewGuinea. Int. J. Syst. Bacteriol. 48, 659–668.
Discusión 127
Sensibilidad antibiótica de B. hyodysenteriae en España
El impacto que la disentería porcina tiene en la producción de
cerdos junto al escaso número de antibióticos disponibles para
combatirla hacen que el seguimiento de la sensibilidad antibiótica de B.
hyodysenteriae sea de gran importancia. Esta vigilancia a lo largo del
tiempo es esencial para la detección precoz de resistencias y la adopción
de las consiguientes medidas encaminadas a evitar la propagación de
aislados resistentes (Karlsson et al., 2003).
Nuestra investigación constituye el primer estudio de
monitorización de la sensibilidad de aislados españoles de B.
hyodysenteriae a los principales antibióticos utilizados para el
tratamiento y el control de la disentería porcina.
Los resultados obtenidos en los estudios I y IV del presente
trabajo nos permiten señalar que durante la última década la sensibilidad
de aislados de campo de B. hyodysenteriae a las pleuromutilinas ha
experimentado un descenso notable en España.
En el caso de la tiamulina, un buen indicador de este hecho lo
constituye la proporción de aislados cuya concentración mínima
inhibitoria (CMI) fue superior a 0,5 µg/ml en cada periodo de años
estudiado (Karlsson et al., 2003). Este porcentaje fue del 28% en los
aislados del periodo 2000-2004, ascendiendo hasta el 37% en los años
2006-2007 y alcanzando el 62% en los años 2008-2009 (Figura 9).
En lo que se refiere a la valnemulina, no se ha propuesto un punto
de corte microbiológico para realizar este seguimiento. Sin embargo, las
distribuciones de las CMI de este antibiótico en distintos estudios
(Karlsson et al., 2002; Lobová et al., 2004; Rohde et al., 2004) indican
128 Discusión
que aquellos aislados con una CMI superior a 0,25 µg/ml presentan una
sensibilidad disminuida a la valnemulina respecto a la población natural
o sensible. En este sentido, y al igual que sucede en el caso de la
tiamulina, hay una disminución de la sensibilidad a la valnemulina de los
aislados españoles de B. hyodysenteriae que va aumentando con el paso
del tiempo. De este modo, el 32% de aislados en el periodo 2000-2004 y
el 46% en los años 2006-2007 mostraron un descenso de su sensibilidad
a la valnemulina. Este porcentaje se elevó hasta el 68% en el periodo
2008-2009 (Figura 9).
Por el contrario, nuestros resultados indican que la sensibilidad de
los aislados españoles de B. hyodysenteriae a la lincomina no ha
experimentado cambios detectables desde el año 2000 al 2009. Sin
embargo, es reseñable la ausencia de una subpoblación representativa de
aislados con CMI menores a 4 µg/ml para este antibiótico (Figura 10),
en contraposición a las observaciones de Karlsson et al. (2002) para
aislados australianos. Esto sitúa a la práctica totalidad de los aislados
españoles de B. hyodysenteriae por encima de las CMI de la población
natural.
Los valores de las CMI de la tilosina de estos aislados españoles se
han mantenido altos en los últimos años (Figura 10), de manera similar a
lo sucedido en otros países en años anteriores (Kitai et al., 1987; Rønne
et al., 1990; Buller et al., 1994; Molnár, 1996). La distribución de las
CMI de la eritromicina, otro de los antibióticos macrólidos valorados en
el estudio I, fue similar a la de la tilosina. Por otro lado, las CMI de la
tilvalosina, incluida en el estudio IV, mostraron una distribución
marcadamente distinta. Esto nos hace sugerir que, en B. hyodysenteriae,
la resistencia cruzada entre antibióticos del grupo de los macrólidos no
afecta a todos sus integrantes, en contraposición a lo propuesto por
Karlsson et al. (1999, 2004).
Discusión 129
Figura 9. Distribuciones de las concentraciones mínimas inhibitorias (CMI) de
tiamulina y valnemulina para 195 aislados españoles de B. hyodysenteriae. Aislados del
periodo 2000-2004 (n=50) en color gris, aislados del periodo 2006-2007 (n=58) en
color amarillo y aislados del periodo 2008-2009 (n=87) en color azul.
Tiamulina
0%
10%
20%
30%
40%
≤0,063 0,125 0,25 0,5 1 2 >2
CMI (µg/ml)
Valnemulina
0%
10%
20%
30%
40%
≤0,031 0,063 0,125 0,25 0,5 1 2 >2
CMI (µg/ml)
130 Discusión
Figura 10. Distribuciones de las concentraciones mínimas inhibitorias (CMI) de
lincomicina y tilosina para 195 aislados españoles de B. hyodysenteriae. Aislados del
periodo 2000-2004 (n=50) en color gris, aislados del periodo 2006-2007 (n=58) en
color amarillo y aislados del periodo 2008-2009 (n=87) en color azul.
Lincomicina
0%
10%
20%
30%
40%
≤1 2 4 8 16 32 64 >64
CMI (µg/ml)
Tilosina
0%
25%
50%
75%
100%
≤4 8 16 32 64 128 >128
CMI (µg/ml)
Discusión 131
Son varias las circunstancias que podrían haber contribuido al
descenso de la sensibilidad antibiótica de aislados españoles de B.
hyodysenteriae. Por un lado, la utilización del fosfato de tilosina como
promotor del crecimiento en la alimentación porcina, permitido hasta el
1 de enero de 1999 (CE Nº 2821/98), podría haber favorecido la
selección de resistencias a este macrólido. En Suecia, donde la tilosina se
ha empleado únicamente como sustancia terapéutica, el porcentaje de
aislados sensibles a este antibiótico a principios de la década de 1990
estaba cercano al 70%, disminuyendo al 30% al final de la misma
(Karlsson et al., 2003). Por otro lado, la resistencia a la tilosina en B.
hyodysenteriae se acompaña de un descenso en la sensibilidad a las
lincosamidas, al compartir la misma base genética (Karlsson et al.,
1999). La menor eficacia terapéutica de todos estos antibióticos habría
contribuido a una mayor utilización de las pleuromutilinas en los últimos
años, especialmente de la tiamulina, favoreciendo la aparición de
aislados resistentes (Rohde et al., 2004).
En este contexto cabe mencionar la hipótesis de la ventana de
selección de mutantes (Zhao et al., 2001, 2002; Drlica et al., 2007),
aplicable a las resistencias genéticas que se desarrollan de forma gradual
(de novo) y no por la adquisición de elementos genéticos móviles. Esta
hipótesis defiende la existencia de un rango de concentraciones de
antibiótico, por encima de la CMI, para el cual se enriquece de manera
selectiva la subpoblación de mutantes resistentes. Ese rango es
característico para cada combinación de microorganismo y antibiótico, si
bien no ha sido aún investigado en Brachyspira spp.
Ante esta situación de descenso generalizado de la sensibilidad
antibiótica en aislados de campo de B. hyodysenteriae, adquiere una
mayor relevancia el estudio de los mecanismos por los cuales se originan
132 Discusión
las resistencias. El conocimiento de estos mecanismos debería contribuir
a la adopción de nuevas estrategias terapéuticas y al diseño de
antibióticos capaces de eludir las resistencias.
En este sentido, el análisis de las secuencias del gen ARNr 23S y
del gen que codifica la proteína ribosómica L3 realizado en el curso del
presente trabajo nos ha permitido identificar mutaciones puntuales
asociadas con la resistencia a distintos antibióticos, entre las que destaca
la mutación de la adenina en posición 2058 (numerado en relación a
Escherichia coli). Esta fue una de las primeras mutaciones en asociarse a
un fenotipo resistente en el género Brachyspira, en concreto a un
aumento de la resistencia a la tilosina y a la clindamicina (Karlsson et
al., 1999). La detección de esta mutación en todos los aislados
analizados indica que está presente en la gran mayoría, sino en la
totalidad, de aislados clínicos de B. hyodysenteriae en España.
Hemos comprobado que en el descenso de la sensibilidad a la
lincomicina participan varias mutaciones del gen ARNr 23S de B.
hyodysenteriae. Por un lado se involucra la mutación de A2058,
inducida o no como consecuencia de la resistencia cruzada a los
macrólidos. Además, hemos observado que la concurrencia de la
mutación G2032A, A2059G o C2611T con la anterior se corresponde
con fenotipos de menor sensibilidad que la que proporciona la mutación
A2058 por sí sola. Estos resultados sugieren un desarrollo gradual de la
resistencia a la lincomicina en condiciones de campo, en el que la
presencia de una segunda mutación aliviaría la presión de selección
ejercida sobre la primera subpoblación de mutantes.
La mutación de los nucleótidos G2032 y A2059 se asoció a su vez
con un descenso de la sensibilidad a las pleuromutilinas en los aislados
clínicos de B. hyodysenteriae analizados en este estudio. La combinación
Discusión 133
de distintas mutaciones puntuales del ARNr 23S puede conllevar un
descenso de la sensibilidad a este grupo antibiótico aunque se encuentren
distantes del lugar de unión, al alterar su flexibilidad y estructura (Long
et al., 2009). Además, según nuestros resultados, el nucleótido en
posición 2032 parece ser especialmente relevante en la evolución hacia
la resistencia a las pleuromutilinas en los aislados de campo de B.
hyodysenteriae. Este hallazgo cobra una mayor importancia tras la
aprobación de la primera pleuromutilina para su uso en medicina
humana, la retapamulina. Por otra parte, hemos comprobado que la
participación de los cambios en la secuencia de aminoácidos de la
proteína L3 en la resistencia a las pleuromutilinas no es tan evidente, al
menos en B. hyodysenteriae.
Las mutaciones descritas en la secuencia del cromosoma
bacteriano clarifican gran parte de los mecanismos por los cuales B.
hyodysenteriae desarrolla la capacidad de sobrevivir a la acción de
distintos grupos antibióticos utilizados en las explotaciones porcinas. No
obstante, otros mecanismos distintos a estos podrían estar también
involucrados, siendo necesarias más investigaciones para dilucidar esta
cuestión.
Por otra parte, este trabajo muestra como la acumulación de
resistencias a antibióticos de distintos grupos en un mismo aislado de B.
hyodysenteriae es un hallazgo cada vez más frecuente desde el año 2007
en España. De manera similar se ha comunicado la presencia de aislados
con resistencias múltiples en Holanda (Duinhof et al., 2008), siendo muy
probable que también se encuentren en otros países europeos como
Alemania, el Reino Unido o la República Checa (Karlsson et al., 2004;
Lobová et al., 2004; Rohde et al., 2004). Además, en el caso español,
hemos demostrado que no corresponden únicamente a la diseminación
134 Discusión
de un clon bacteriano por distintas explotaciones porcinas, sino que este
conjunto de resistencias es común a aislados genéticamente distintos.
Discusión 135
Epidemiología molecular de B. hyodysenteriae
La discriminación de manera precisa entre clones de B.
hyodysenteriae es indispensable a la hora de estudiar las posibles
conexiones epidemiológicas de las explotaciones con disentería porcina
o el origen de nuevos focos de esta enfermedad. Además, permite
analizar la diversidad de esta especie bacteriana en un determinado
territorio e incluso inferir su estructura poblacional. Sin embargo, las
herramientas adaptadas para la caracterización molecular de aislados de
B. hyodysenteriae son más bien escasas y, en general, su uso en los
laboratorios de microbiología veterinaria presenta diversos
inconvenientes.
En nuestra experiencia, la aplicación secuencial del RAPD y de la
PFGE en la caracterización de aislados de B. hyodysenteriae resultó de
utilidad, al combinar las ventajas de ambas técnicas. No obstante, la
comparación entre laboratorios de los distintos patrones electroforéticos
generados con esta metodología puede resultar compleja.
Consecuentemente, desarrollamos una herramienta de tipificación
basada en el análisis del número variable de repeticiones en tándem de
múltiples loci (MLVA), que facilita la comparación de resultados entre
laboratorios. Esta es la primera técnica de MLVA que se ha utilizado en
B. hyodysenteriae, destacando por su elevado poder de discriminación
entre aislados y por poder ser utilizada en laboratorios equipados
simplemente con tecnología de PCR.
Empleando el MLVA hemos comprobado que la diversidad de B.
hyodysenteriae es considerable, detectándose dieciséis tipos distintos de
este microorganismo en las granjas porcinas españolas. En Australia, el
otro país en el que hemos investigado una población representativa de
136 Discusión
aislados de B. hyodysenteriae mediante esta técnica, encontramos el
mismo número de tipos, aunque ninguno en común con los españoles.
Figura 11. Distribución geográfica de los diferentes tipos de MLVA de B.
hyodysenteriae detectados en España durante este trabajo.
Discusión 137
Esta investigación muestra que la distribución geográfica de los
tipos de MLVA en España es heterogénea. Hemos detectado la presencia
de algunos de estos tipos en una única región o en unas pocas regiones
limítrofes, mientras que otros están presentes en áreas más extensas del
país (Figura 11). Al agrupar aquellos tipos de MLVA que provienen de
un ancestro común se delimitan complejos clonales. En el estudio III
identificamos la presencia de tres de ellos en España, los cuales
engloban a nueve de los dieciséis tipos detectados. De este modo, los
tipos 19, 20 y 22, que forman parte del complejo clonal I, se extienden
por la mitad norte del país, desde Cataluña a Castilla y León, pasando
por Aragón, habiéndose detectado también en Extremadura. Tanto el
complejo clonal II (tipos 1, 2 y 3) como el complejo clonal V (tipos 9, 11
y 14) están presentes en la mayoría de las regiones españolas. De todos
ellos destacan por su difusión el tipo 3 y el tipo 14, presentes ambos en
siete comunidades autónomas. Es habitual la detección en una misma
región de aislados genéticamente distintos, destacando la presencia de
diez tipos diferentes en Cataluña (tipos 3, 5, 9, 12, 14, 19, 20, 22, 37 y
45), cinco en Castilla y León (tipos 1, 3, 9, 14 y 22) o en Aragón (tipos
14, 18, 19, 20 y 22) y cuatro en Murcia (tipos 3, 13, 14 y 24).
La variabilidad genética que presentan los aislados de B.
hyodysenteriae (Atyeo et al., 1999; La et al., 2009b) podría ser una
constante del género, habida cuenta de la diversidad demostrada,
igualmente, en otras especies como B. intermedia o B. pilosicoli (Trott et
al., 1998; Phillips et al., 2010). Todo ello se traduce en una expresión
fenotípica variada, en la que no son infrecuentes los hallazgos de
aislados de Brachyspira spp. con características atípicas. Entre estos
destacan aislados de B. pilosicoli que no son capaces de hidrolizar el
hipurato (Fossi et al., 2004) o de B. hyodysenteriae negativos a la prueba
del indol. Estos últimos, que solamente habían sido detectados en
138 Discusión
Canadá, Bélgica y Alemania (Bélanger et al., 1991; Hommez et al.,
1998; Felltröm et al., 1999), también han sido identificados en España
durante este trabajo. Además, las pruebas de caracterización molecular
nos han permitido comprobar que los aislados españoles de B.
hyodysenteriae indol negativos tienen un origen común con los
centroeuropeos. Este no es el único caso que muestra la presencia de un
mismo tipo de B. hyodysenteriae en distintos países europeos, ya que
utilizando la técnica MLVA hemos encontrado que España, el Reino
Unido y Holanda también comparten aislados del mismo tipo.
Discusión 139
Brachyspira spp. en perros
La relación entre trastornos digestivos caracterizados por diarrea y
la presencia de espiroquetas intestinales en perros ha sido objeto de
estudio en las últimas décadas. Estas investigaciones han obtenido
resultados dispares, señalándose en algunos casos la asociación existente
entre estas bacterias y la diarrea en perros (Craige, 1948; Pindak et al.,
1965; Zymet, 1969), mientras que en otros casos se destaca su carácter
comensal (Leach et al., 1973; Kinyon et al., 1977; Turek et al., 1977). El
origen de esta discrepancia entre estudios podría radicar en la asunción
de que todas las espiroquetas intestinales caninas débilmente hemolíticas
formaban parte de una misma especie, poseyendo el mismo potencial
patógeno. Sin embargo, tras la descripción de “B. canis” (Duhamel et al.,
1998) y su diferenciación de B. pilosicoli, han sido menos numerosos los
estudios que se han llevado a cabo para clarificar la prevalencia de estas
especies bacterianas y su relación con la diarrea en perros. Dada la
experiencia alcanzada, y con el fin de ampliar nuestro conocimiento de
las infecciones por bacterias del género Brachyspira en otros
hospedadores, hemos investigado la prevalencia de estas bacterias en
perros y su asociación con la presencia de diarrea.
La prevalencia de perros que eliminan Brachyspira spp. en heces
en el área metropolitana de León fue del 13,2%, indicando que estos
animales están frecuentemente colonizados por espiroquetas intestinales.
Además, nuestro estudio confirma la existencia de dos especies
mayoritarias de bacterias del género Brachyspira en perros, “B. canis” y
B. pilosicoli, en concordancia con lo observado por Duhamel et al.
(1998), Oxberry et al. (2003a) y Johansson et al. (2004).
Por especies, “B. canis” fue identificada en el 8% de los perros
muestreados, mientras que B. pilosicoli fue menos prevalente,
140 Discusión
detectándose en el 4,8% de los mismos. Además, uno de los aislados de
espiroquetas intestinales caninas fue identificado como B. intermedia. El
hallazgo esporádico en heces de perros de otras especies de espiroquetas
intestinales débilmente hemolíticas, tales como B. intermedia o “B.
pulli” (Jansson et al., 2008b; Prapasarakul et al., 2011), es
probablemente el resultado de la ingestión de agua o de alimentos
contaminados. En este caso, las aves, tanto silvestres como de corral,
podrían tener un papel importante. Por otra parte, no hemos detectado la
presencia de ninguna espiroqueta fuertemente hemolítica como B.
hyodysenteriae. Esta especie ha sido aislada en ocasiones de perros
presentes en granjas con disentería porcina (Songer et al., 1978), si bien,
en nuestro caso, la procedencia urbana de los perros muestreados podría
explicar su ausencia.
La identificación específica de los aislados de Brachyspira hizo
posible el estudio de la asociación entre una especie concreta de
espiroqueta intestinal y la presencia de diarrea en perros. De este modo,
B. pilosicoli se aisló más frecuentemente de perros con diarrea,
alcanzando esta diferencia la significación estadística. Además, esta
bacteria fue cinco veces más prevalente en perros menores de un año que
en los de más edad. Por otro lado, “B. canis” estuvo presente por igual
en animales jóvenes y adultos, no encontrándose relación entre su
eliminación en heces y la presencia de diarrea. Este hecho refuerza la
hipótesis de que esta especie sea una bacteria comensal (Duhamel et al.,
1998).
El elevado porcentaje de perros, especialmente aquellos menores
de un año, que eliminan B. pilosicoli en heces hace que debamos tener
en cuenta que esta especie animal puede ser un reservorio relevante de
esta espiroqueta. Además, B. pilosicoli puede sobrevivir largos periodos
Discusión 141
de tiempo en pequeños lagos o charcas (Oxberry et al., 1998),
aumentando la probabilidad de que se propague entre perros o a otros
mamíferos y aves. Esta bacteria causa espiroquetosis intestinal en cerdos
(Trott et al., 1996a) y en aves de corral (Swayne et al., 1995; Stephens et
al., 2002), por lo que los perros podrían participar en su transmisión en
aquellas explotaciones avícolas o de ganado porcino en las que no se
practiquen unas medidas adecuadas de bioseguridad. Por último, el
probable carácter zoonótico de B. pilosicoli (Hampson et al., 2006e)
hace que la importancia de los perros en su transmisión no se limite al
ámbito de la sanidad animal, sino que trascienda al de la salud pública.
Conclusiones 145
Primera:
El seguimiento de la resistencia antibiótica de B. hyodysenteriae en
España desde el año 2000 hasta el 2009 mostró que la gran mayoría de
aislados de esta bacteria son resistentes a la tilosina. Además, se
evidenció un descenso progresivo de la sensibilidad de B.
hyodysenteriae a las pleuromutilinas. Las concentraciones mínimas
inhibitorias de lincomicina durante este periodo no experimentaron
ninguna variación detectable. La eficacia de estos antibióticos para el
control y el tratamiento de la disentería porcina en España es cada vez
más limitada, aunque otras sustancias como la tilvalosina podrían
resultar de interés.
Segunda:
La base genética de la resistencia a las pleuromutilinas, macrólidos
y lincosamidas en aislados clínicos de B. hyodysenteriae consistió
principalmente en mutaciones puntuales del gen ARNr 23S. De todas
ellas, tuvieron una especial relevancia la mutación de los nucleótidos
A2058 y G2032, aunque es posible que otros mecanismos de resistencia
puedan estar también involucrados. Estas mutaciones han surgido de
manera independiente en los diversos clones bacterianos.
Tercera:
La técnica de análisis del número variable de repeticiones en
tándem de múltiples loci desarrollada para la tipificación de
B. hyodysenteriae resultó ser altamente discriminatoria a la vez que
retuvo un elevado valor filogenético. Asimismo, el nuevo protocolo de
electroforesis de campo pulsado que hemos descrito para la
caracterización de B. hyodysenteriae permite obtener resultados de
elevada calidad, compatibles con su procesamiento informático.
146 Conclusiones
Cuarta:
Las técnicas de caracterización fenotípica y genética empleadas en
este estudio mostraron que los aislados españoles de B. hyodysenteriae
integran una población heterogénea. En ella destacó el hallazgo de
aislados negativos a la prueba del indol, relacionados con los
encontrados en Alemania y en Bélgica en años anteriores. Además, se
comprobó la diseminación de un clon de esta bacteria en explotaciones
porcinas de España, Holanda y el Reino Unido.
Quinta:
La estructura poblacional de B. hyodysenteriae es de tipo clonal y,
en condiciones de campo, no se ve afectada por la existencia de
mecanismos de recombinación genética. Asimismo, los distintos clones
de B. hyodysenteriae permanecen estables a lo largo del tiempo en las
explotaciones porcinas españolas, siendo infrecuente la detección de más
de un clon en una misma granja.
Sexta:
Es habitual que las espiroquetas del género Brachyspira colonicen
el intestino de los perros, siendo “B. canis” y B. pilosicoli las especies
más prevalentes. Además, B. pilosicoli fue hasta cinco veces más
frecuente en animales menores de un año y se asoció con la presencia de
diarrea en perros de todas las edades.
Referencias 149
Achacha, M., Mittal, K.R., 1995. Production and characterization of monoclonal antibodies against Serpulina hyodysenteriae and S. innocens and their use in serotyping. J. Clin. Microbiol. 33, 2519-2521.
Achacha, M., Mittal, K.R., 1996. Identification and characterization of genus-specific epitopes of Serpulina species using monoclonal antibodies. Vet. Microbiol. 48, 73-85.
Andersson, S., Kurland, C.G., 1987. Elongating ribosomes in vivo are refractory to erythromycin. Biochimie 69, 901-904.
Andress, C.E., Barnum, D.A., Thomson, R.G., 1968. Pathogenicity of Vibrio coli for swine. I. Experimental infection of gnotobiotic pigs with Vibrio coli. Can. J. Comp. Med. 32, 522-528.
Argenzio, R.A., Whipp, S.C., Glock, R.D., 1980a. Pathophysiology of swine dysentery: colonic transport and permeability studies. J. Infect. Dis. 142, 676-684.
Argenzio, R.A., 1980b. Glucose-stimulated fluid absorption in the pig small intestine during the early stage of swine dysentery. Am. J. Vet. Res. 41, 2000-2006.
Atyeo, R.F., Oxberry, S.L., Hampson, D.J., 1996. Pulsed-field gel electrophoresis for sub-specific differentiation of Serpulina pilosicoli (formerly 'Anguillina coli'). FEMS Microbiol. Lett. 141, 77-81.
Atyeo, R.F., Stanton, T.B., Jensen, N.S., Suriyaarachichi, D.S., Hampson, D.J., 1999a. Differentiation of Serpulina species by NADH oxidase gene (nox) sequence comparisons and nox-based polymerase chain reaction tests. Vet. Microbiol. 67, 47-60.
Atyeo, R.F., Oxberry, S.L., Hampson, D.J., 1999b. Analysis of Serpulina hyodysenteriae strain variation and its molecular epidemiology using pulsed-field gel electrophoresis. Epidemiol. Infect. 123, 133-138.
Backhans, A., Johansson, K.E., Fellström, C., 2009. Spirochaetes isolated from wild rodents. Abstract 23. En: Proceedings of the Fifth International Conference on Colonic Spirochaetal Infections in Animals and Humans, June 8-10, León, Spain.
150 Referencias
Bait-Merabet, L., Thille, A., Legrand, P., Brun-Buisson, C., Cattoir, V., 2008. Brachyspira pilosicoli bloodstream infections: case report and review of the literature. Ann. Clin. Microbiol. Antimicrob. 25, 7-19.
Barber, P.M., Lewis, G.M., Barrett, S.P., 1995. Localization of carbohydrate and DNA in cyst-like structures from a human intestinal spirochaete. Anaerobe 1, 329-334.
Barcellos, D.E., de Uzeda, M., Ikuta, N., Lunge, V.R., Fonseca, A.S., Kader, I.I., Duhamel, G.E., 2000. Identification of porcine intestinal spirochetes by PCR-restriction fragment length polymorphism analysis of ribosomal DNA encoding 23S rRNA. Vet. Microbiol. 75, 189-198.
Baum, D.H., Joens, L.A., 1979. Serotypes of beta-hemolytic Treponema hyodysenteriae. Infect. Immun. 25, 792-796.
Bélanger, M., Jacques, M., 1991. Evaluation of the An-Ident system and an indole spot test for the rapid differentiation of porcine treponemes. J. Clin. Microbiol. 29, 1727-1729.
Bellgard, M.I., Wanchanthuek, P., La, T., Ryan, K., Moolhuijzen, P., Albertyn, Z., Shaban, B., Motro, Y., Dunn, D.S., Schibeci, D., Hunter, A., Barrero, R., Phillips, N.D., Hampson, D.J., 2009. Genome sequence of the pathogenic intestinal spirochete Brachyspira hyodysenteriae reveals adaptations to its lifestyle in the porcine large intestine. PLoS One 4, 4641.
Boley L.E., Woods, G.T., Hatch, R.D., Graham, R., 1951. Studies on porcine enteritis. II. Experimental therapy with sulfathalidine, sulfamethazine, sodium arsanilate, and bacitracin in a natural outbreak of swine dysentery. Cornell Vet. 41, 231-235.
Brooks, G., Burgess, W., Colthurst, D., Hinks, J.D., Hunt, E., Pearson, M.J., Shea, B., Takle, A.K., Wilson, J.M., Woodnutt, G., 2001. Pleuromutilins. Part 1. The identification of novel mutilin 14-carbamates. Bioorg. Med. Chem. 9, 1221-1231.
Brorson, Ø., Brorson, S.H, Scythes, J., MacAllister, J., Wier, A., Margulis, L., 2009. Destruction of spirochete Borrelia burgdorferi round-body propagules (RBs) by the antibiotic tigecycline. Proc. Natl. Acad. Sci. U. S. A. 106, 18656-18661.
Referencias 151
Brown, J.R., Douady, C.J., Italia, M.J., Marshall, W.E., Stanhope, M.J., 2001. Universal trees based on large combined protein sequence data sets. Nat. Genet. 28, 281-285.
Buller, N.B., Hampson, D.J., 1994. Antimicrobial susceptibility testing of Serpulina hyodysenteriae. Aust. Vet. J. 71, 211-214.
Canale-Parola, E., 1978. Motility and chemotaxis of spirochetes. Annu. Rev. Microbiol. 32, 69-99.
Carvajal, A., de Arriba, M.L., Rodríguez, H., Vidal, A.B., Duhamel, G.E., Rubio, P., 2006. Prevalence of Brachyspira species in pigs with diarrhoea in Spain. Vet. Rec. 158, 700-701.
Casewell, M., Friis, C., Marco, E., McMullin, P., Phillips, I., 2003. The European ban on growth-promoting antibiotics and emerging consequences for human and animal health. J. Antimicrob. Chemother. 52, 159-161.
Champney, W.S., Burdine, R., 1998. Macrolide antibiotic inhibition of translation and 50S ribosomal subunit assembly in methicillin-resistant Staphylococcus aureus cells. Microb. Drug Resist. 4, 169-174.
Chittum, H.S., Champney, W.S., 1995. Erythromycin inhibits the assembly of the large ribosomal subunit in growing Escherichia coli cells. Curr. Microbiol. 30, 273-279.
Combs, B., Hampson, D.J., Mhoma, J.R., Buddle, J.R., 1989. Typing of Treponema hyodysenteriae by restriction endonuclease analysis. Vet. Microbiol. 19, 351-359.
Combs, B.G., Hampson, D.J., Harders, S.J., 1992. Typing of Australian isolates of Treponema hyodysenteriae by serology and by DNA restriction endonuclease analysis. Vet. Microbiol. 31, 273-285.
Craige, J.E. 1948. Spirochetes associated with dysentery in dogs. J. Am. Vet. Med. Assoc. 113, 247-249.
Curtis, R.A., 1962. Clinical observations on the use of tylosin in the treatment of vibrionic swine dysentery. Can. Vet. J. 3, 285-288.
Daubin, V., Gouy, M., Perrière, G., 2002. A phylogenomic approach to bacterial phylogeny: evidence of a core of genes sharing a common history. Genome. Res. 12, 1080-1090.
152 Referencias
Diego, R., Lanza, I., Carvajal, A., Rubio, P., Cármenes, P., 1995. Serpulina hyodysenteriae challenge of fattening pigs vaccinated with an adjuvanted bivalent bacterin against swine dysentery. Vaccine 13, 663-667.
Doornenbal, H., 1965. Clinical evaluation of tylosin as a treatment of vibrionic dysentery in swine. Can. J. Comp. Med. Vet. Sci. 29, 179-182.
Doyle, L.P., 1948. The etiology of swine dysentery. Am. J. Vet. Res. 9, 50-51.
Drlica, K., Zhao, X. 2007. Mutant selection window hypothesis updated. Clin. Infect. Dis. 44, 681-688.
Dröge, S., Fröhlich, J., Radek, R., König, H., 2006. Spirochaeta coccoides sp. nov., a novel coccoid spirochete from the hindgut of the termite Neotermes castaneus. Appl. Environ. Microbiol. 72, 392-397.
Dugourd, D., Jacques, M., Bigras-Poulin, M., Harel, J., 1996. Characterization of Serpulina hyodysenteriae isolates of serotypes 8 and 9 by random amplification of polymorphic DNA analysis. Vet. Microbiol. 48, 305-314.
Duhamel, G.E., Joens, L.A., 1994. Laboratory procedures for diagnosis of swine dysentery. Report to the committee on swine dysentery. American association of veterinary laboratory diagnosticians, Madison, Wisconsin, U. S. A.
Duhamel, G.E., Muniappa, N., Mathiesen, M.R., Johnson, J.L., Toth, J., Elder, R.O., Doster, A.R., 1995. Certain canine weakly beta-hemolytic intestinal spirochetes are phenotypically and genotypically related to spirochetes associated with human and porcine intestinal spirochetosis. J. Clin. Microbiol. 33, 2212-2215.
Duhamel, G.E., Elder, R.O., Muniappa, N., Mathiesen, M.R., Wong, V.J., Tarara, R.P., 1997. Colonic spirochetal infections in nonhuman primates that were associated with Brachyspira aalborgi, Serpulina pilosicoli, and unclassified flagellated bacteria. Clin. Infect. Dis. 25, 186-188.
Duhamel, G.E., Trott, D.J., Muniappa, N., Mathiesen, M.R., Tarasiuk, K., Lee, J.I., Hampson, D.J., 1998. Canine intestinal spirochetes
Referencias 153
consist of Serpulina pilosicoli and a newly identified group provisionally designated "Serpulina canis" sp. nov. J. Clin. Microbiol. 36, 2264-2270.
Duinhof, T.F., Dierikx, C.M., Koene, M.G., van Bergen, M.A., Mevius, D.J., Veldman, K.T., van Beers-Schreurs, H.M., de Winne, R.T., 2008. Multiresistant Brachyspira hyodysenteriae in a Dutch sow herd. Tijdschr. Diergeneeskd. 133, 604-608.
Elder, R.O., Duhamel, G.E., Schafer, R.W., Mathiesen, M.R., Ramanathan, M., 1994. Rapid detection of Serpulina hyodysenteriae in diagnostic specimens by PCR. J. Clin. Microbiol. 32, 1497-1502.
Feberwee, A., Hampson, D.J., Phillips, N.D., La, T., van der Heijden, H.M., Wellenberg, G.J., Dwars, R.M., Landman, W.J., 2008. Identification of Brachyspira hyodysenteriae and other pathogenic Brachyspira species in chickens from laying flocks with diarrhea or reduced production or both. J. Clin. Microbiol. 46, 593-600.
Fellström, C., Gunnarsson, A., 1995. Phenotypical characterisation of intestinal spirochaetes isolated from pigs. Res. Vet. Sci. 59, 1-4.
Fellström, C., Pettersson, B., Thomson, J., Gunnarsson, A., Persson, M., Johansson, K.E., 1997. Identification of Serpulina species associated with porcine colitis by biochemical analysis and PCR. J. Clin. Microbiol. 35, 462-467.
Fellström, C., Karlsson, M., Pettersson, B., Zimmerman, U., Gunnarsson, A., Aspan, A., 1999. Emended descriptions of indole negative and indole positive isolates of Brachyspira (Serpulina) hyodysenteriae. Vet. Microbiol. 70, 225-238.
Fellström, C., Pettersson, B., Zimmerman, U., Gunnarsson, A., Feinstein, R., 2001a. Classification of Brachyspira spp. isolated from Swedish dogs. Anim. Health Res. Rev. 2, 75-82.
Fellström, C., Zimmerman, U., Aspan, A., Gunnarsson, A., 2001b. The use of culture, pooled samples and PCR for identification of herds infected with Brachyspira hyodysenteriae. Anim. Health Res. Rev. 2, 37-43.
154 Referencias
Fellström, C., Råsbäck, T., Johansson, K.E., Olofsson, T., Aspán, A., 2008. Identification and genetic fingerprinting of Brachyspira species. J. Microbiol. Methods 72, 133-140.
Fernie, D.S., Ripley, P.H., Walker, P.D., 1983. Swine dysentery: protection against experimental challenge following single dose parenteral immunisation with inactivated Treponema hyodysenteriae. Res. Vet. Sci. 35, 217-221.
Fossi, M., Pohjanvirta, T., Sukura, A., Heinikainen, S., Lindecrona, R., Pelkonen, S., 2004. Molecular and ultrastructural characterization of porcine hippurate-negative Brachyspira pilosicoli. J. Clin. Microbiol. 42, 3153-3158.
Gebbers, J.O., Marder, H.P., 1989. Unusual in vitro formation of cyst-like structures associated with human intestinal spirochaetosis. Eur. J. Clin. Microbiol. Infect. Dis. 8, 302-306.
Glock, R.D., Harris, D.L., Kluge, J.P., 1974. Localization of spirochetes with the structural characteristics of Treponema hyodysenteriae in the lesions of swine dysentery. Infect. Immun. 9, 167-178.
Gresham, A.C., Hunt, B.W., Dalziel, R.W., 1998. Treatment of swine dysentery-problems of antibiotic resistance and concurrent salmonellosis. Vet. Rec. 143, 619.
Gürel, G., Blaha, G., Moore, P.B., Steitz, T.A., 2009. U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome. J. Mol. Biol. 389, 146-156.
Hampson, D.J., Atyeo, R.F., Combs, B.G., 1997. Swine dysentery. En: Hampson, D.J., Stanton, T.B. (Eds.), Intestinal spirochaetes in domestic animals and humans. CAB International, Wallingford, U. K., pp. 175-209.
Hampson, D.J., Phillips, N.D., Pluske, J.R., 2002. Dietary enzyme and zinc bacitracin reduce colonisation of layer hens by the intestinal spirochaete Brachyspira intermedia. Vet. Microbiol. 24, 351-360.
Hampson, D.J., La, T., 2006a. Reclassification of Serpulina intermedia and Serpulina murdochii in the genus Brachyspira as Brachyspira intermedia comb. nov. and Brachyspira murdochii comb. nov. Int. J. Syst. Evol. Microbiol. 56, 1009-1012.
Referencias 155
Hampson, D.J., Lester, G.D., Phillips, N.D., La, T., 2006b. Isolation of Brachyspira pilosicoli from weanling horses with chronic diarrhoea. Vet. Rec. 158, 661-662.
Hampson, D.J., Fellstrom, C., Thomson, J.R., 2006c. Swine Dysentery. En: Straw, B.E., Zimmerman, J.J., D’Allaire, S. et al (Eds.), Diseases of Swine. Novena Edición. Blackwell Publishing Professional, Ames, Iowa, U. S. A., pp. 785-805.
Hampson, D.J., Duhamel, G.E., 2006d. Porcine colonic spirochaetosis/Intestinal spirochaetosis. En: Straw, B.E., Zimmerman, J.J., D’Allaire, S. et al (Eds.), Diseases of Swine. Novena Edición. Blackwell Publishing Professional, Ames, Iowa, U. S. A., pp. 755-767.
Hampson, D.J., Oxberry, S.L., La, T., 2006e. Potential for zoonotic transmission of Brachyspira pilosicoli. Emerg. Infect. Dis. 12, 869-870.
Hansen, C.F., Phillips, N.D., La, T., Hernández, A., Mansfield, J., Kim, J.C., Mullan, B.P., Hampson, D.J., Pluske, J.R., 2010. Diets containing inulin but not lupins help to prevent swine dysentery in experimentally challenged pigs. J. Anim. Sci. 88, 3327-3336.
Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B., Steitz, T.A., 2002. The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol. Cell 10, 117-128.
Harel, J., Forget, C., 1995. DNA probe and polymerase chain reaction procedure for the specific detection of Serpulina hyodysenteriae. Mol. Cell. Probes. 9, 111-119.
Harris, D.L., Glock, R.D., Christensen, C.R., Kinyon, J.M., 1972. Inoculation of pigs with Treponema hyodysenteriae (new species) and reproduction of the disease. Vet. Med. Small. Anim. Clin. 67, 61-64.
Holden, J., Moutafis, G., Istivan, T., Coloe, P.J., Smooker, P.M., 2006. SmpB: a novel outer membrane protein present in some Brachyspira hyodysenteriae strains. Vet. Microbiol. 113, 109-116.
Holt, S.C., 1978. Anatomy and chemistry of spirochetes. Microbiol. Rev. 42, 114-160.
156 Referencias
Hommez, J., Castryck, F., Haesebrouck, F., Devriese, L.A., 1998. Identification of porcine Serpulina strains in routine diagnostic bacteriology. Vet. Microbiol. 62, 163-169.
Hovind-Hougen, K., Birch-Andersen, A., Henrik-Nielsen, R., Orholm, M., Pedersen, J.O., Teglbjaerg, P.S., Thaysen, E.H., 1982. Intestinal spirochetosis: morphological characterization and cultivation of the spirochete Brachyspira aalborgi gen. nov., sp. nov. J. Clin. Microbiol. 16, 1127-1136.
Hughes, R., Olander, H.J., Gallina, A.M., Morrow, M.E., 1972. Swine dysentery: Induction and characterization in isolated colonic loops. Vet. Pathol. 9, 22-37.
Hunter, D., Clark, A., 1975. The direct fluorescent antibody test for the detection of Treponema hyodysenteria in pigs. Res. Vet. Sci. 19, 98-99.
Hunter, D., Saunders, C.N., 1977. Diagnosis of swine dysentery using an absorbed fluorescent antiserum. Vet. Rec. 101, 303-304.
Jacobson, M., Fellström, C., Lindberg, R., Wallgren, P., Jensen-Waern, M., 2004. Experimental swine dysentery: comparison between infection models. J. Med. Microbiol. 53, 273-280.
Jansson, D.S., Johansson, K.E., Olofsson, T., Råsbäck, T., Vågsholm, I., Pettersson, B., Gunnarsson, A., Fellström, C., 2004. Brachyspira hyodysenteriae and other strongly ß-haemolytic and indole-positive spirochaetes isolated from mallards (Anas platyrhynchos). J. Med. Microbiol. 53, 293-300.
Jansson, D.S., Fellström, C., Johansson, K.E., 2008a. Intestinal spirochetes isolated from wild-living jackdaws, hooded crows and rooks (genus Corvus): provisionally designated "Brachyspira corvi" sp. nov. Anaerobe 14, 287-295.
Jansson, D.S., Fellström, C., Råsbäck, T., Vågsholm, I., Gunnarsson, A., Ingermaa, F., Johansson, K.E., 2008b. Phenotypic and molecular characterization of Brachyspira spp. isolated from laying hens in different housing systems. Vet. Microbiol. 25, 348-362.
Jansson, D. S., Broman, T.,Waldenström, J., Bonnedal, J., Olsen, B., Johansson, K.E., 2009a. Intestinal spirochaete isolated from a snowy sheathbill (Chionis alba) in Antarctica. Abstract 29. En:
Referencias 157
Proceedings of the Fifth International Conference on Colonic Spirochaetal Infections in Animals and Humans, June 8-10, León, Spain.
Jansson, D.S., Råsbäck, T., Fellström, C., Feinstein, R., 2009b. Experimental challenge of mallards (Anas platyrhynchos) with Brachyspira hyodysenteriae and "Brachyspira suanatina" isolated from pigs and mallards. J. Comp. Pathol. 141, 211-222.
Jenkinson, S.R., Wingar, C.R., 1981. Selective medium for the isolation of Treponema hyodysenteriae. Vet. Rec. 109, 384-385.
Jensen, N.S., Casey, T.A., Stanton, T.B., 1992. Characterization of Serpulina (Treponema) hyodysenteriae and related intestinal spirochetes by ribosomal RNA gene restriction patterns. FEMS Microbiol. Lett. 72, 235-241.
Jensen, N.S., Stanton, T.B., 1993. Comparison of Serpulina hyodysenteriae B78, the type strain of the species, with other S. hyodysenteriae strains using enteropathogenicity studies and restriction fragment length polymorphism analysis. Vet. Microbiol. 36, 221-231.
Jensen, N.S., Stanton T.B., Swayne, D.E., 1996. Identification of the swine pathogen Serpulina hyodysenteriae in rheas (Rhea americana). Vet. Microbiol. 52, 259-269.
Jensen, N.S., 1997. Detection, identification and subspecific differentiation of intestinal spirochaetes. En: Hampson, D.J., Stanton, T.B. (Eds.), Intestinal spirochaetes in domestic animals and humans. CAB International, Wallingford, U. K., pp. 323-341.
Jensen, T.K., Boye, M., Møller, K., Leser, T.D., Jorsal, S.E., 1998. Association of Serpulina hyodysenteriae with the colonic mucosa in experimental swine dysentery studied by fluorescent in situ hybridization. A. P. M. I. S. 106, 1061-1068.
Jensen, T.K., Møller, K., Boye, M., Leser, T.D., Jorsal, S.E., 2000. Scanning electron microscopy and fluorescent in situ hybridization of experimental Brachyspira (Serpulina) pilosicoli infection in growing pigs. Vet. Pathol. 37, 22-32.
Jensen, T.K., Boye, M., Ahrens, P., Korsager, B., Teglbjaerg, P.S., Lindboe, C.F., Møller, K., 2001. Diagnostic examination of human
158 Referencias
intestinal spirochetosis by fluorescent in situ hybridization for Brachyspira aalborgi, Brachyspira pilosicoli, and other species of the genus Brachyspira (Serpulina). J. Clin. Microbiol. 39, 4111-4118.
Jensen, T.K., Christensen, A.S., Boye, M., 2010. Brachyspira murdochii colitis in pigs. Vet. Pathol. 47, 334-338.
Johansson, K.E., Duhamel, G.E., Bergsjö, B., Engvall, E.O., Persson, M., Pettersson, B., Fellström, C., 2004. Identification of three clusters of canine intestinal spirochaetes by biochemical and 16S rDNA sequence analysis. J. Med. Microbiol. 53, 345-350.
Kaltschmidt, E., Wittmann, H.G., 1970. Ribosomal proteins. XII. Number of proteins in small and large ribosomal subunits of Escherichia coli as determined by two-dimensional gel electrophoresis. Proc. Natl. Acad. Sci. U. S. A. 67, 1276-1282.
Karlsson, M., Fellström, C., Heldtander, M.U., Johansson, K.E., Franklin, A., 1999. Genetic basis of macrolide and lincosamide resistance in Brachyspira (Serpulina) hyodysenteriae. FEMS Microbiol. Lett. 172, 255-260.
Karlsson, M., Gunnarsson, A., Franklin, A., 2001. Susceptibility to pleuromutilins in Brachyspira (Serpulina) hyodysenteriae. Anim. Health Res. Rev. 2, 59-65.
Karlsson, M., Oxberry, S.L., Hampson, D.J., 2002. Antimicrobial susceptibility testing of Australian isolates of Brachyspira hyodysenteriae using a new broth dilution method. Vet. Microbiol. 84, 123-133.
Karlsson, M., Fellström, C., Gunnarsson, A., Landén, A., Franklin, A. 2003. Antimicrobial susceptibility testing of porcine Brachyspira (Serpulina) species isolates. J. Clin. Microbiol. 41, 2596-2604
Karlsson, M., Aspán, A., Landén, A., Franklin, A. 2004. Further characterization of porcine Brachyspira hyodysenteriae isolates with decreased susceptibility to tiamulin. J. Med. Microbiol. 53, 281-285.
Kavanagh, F., Hervey, A., Robbins, W.J., 1951. Antibiotic substances from Basidiomycetes: VIII. Pleurotus multilus (Fr.) Sacc. and
Referencias 159
Pleurotus passeckerianus Pilat. Proc. Natl. Acad. Sci. U. S. A. 37, 570-574.
Kent, K.A., Sellwood, R., Lemcke, R.M., Burrows, M.R., Lysons, R.J., 1989. Analysis of the axial filaments of Treponema hyodysenteriae by SDS-PAGE and immunoblotting. J. Gen. Microbiol. 135, 1625-1632.
Kim, T.J., Jung, S.C., Lee, J.I., 2005. Characterization of Brachyspira hyodysenteriae isolates from Korea. J. Vet. Sci. 6, 335-339.
Kim, T.J., Lee, J.I., 2006. The 23S rRNA gene PCR-RFLP used for characterization of porcine intestinal spirochete isolates. J. Vet. Sci. 7, 277-280.
Kinyon, J.M., Harris, D.L., Glock, R.D., 1977. Enteropathogenicity of various isolates of Treponema hyodysenteriae. Infect. Immun. 15, 638-46.
Kinyon, J.M., Harris, D.L., 1979. Treponema innocens, a new species of intestinal bacteria, and emended description of the type strain of Treponema hyodysenteriae. Int. J. Syst. Bacteriol. 29, 102-109.
Kitai, K., Kashiwazaki, M., Adachi, Y., Kunugita, K., Arakawa, A., 1987. In vitro antimicrobial activity against reference strains and field isolates of Treponema hyodysenteriae. Antimicrob. Agents Chemother. 31, 1935-1938.
Koopman, M.B., Käsbohrer, A., Beckmann, G., van der Zeijst, B.A., Kusters, J.G., 1993. Genetic similarity of intestinal spirochetes from humans and various animal species. J. Clin. Microbiol. 31, 711-716.
Koulaouzidis, A., Campbell, S., Ahmed, S., Prados, S., Tan, W.C., 2007. Colonic spirochetosis associated with dermatomyositis. Endoscopy. 39, 30-31.
Körner, M., Gebbers, J.O., 2003. Clinical significance of human intestinal spirochetosis - a morphologic approach. Infection 31, 341-349.
Kraaz, W., Pettersson, B., Thunberg, U., Engstrand, L., Fellström, C., 2000. Brachyspira aalborgi infection diagnosed by culture and 16S ribosomal DNA sequencing using human colonic biopsy specimens. J. Clin. Microbiol. 38, 3555-3560.
160 Referencias
Kunkle, R.A., Kinyon, J.M., 1988. Improved selective medium for the isolation of Treponema hyodysenteriae. J. Clin. Microbiol. 26, 2357-2360.
La, T., Hampson, D.J., 2001. Serologic detection of Brachyspira (Serpulina) hyodysenteriae infections. Anim. Health Res. Rev. 2, 45-52.
La, T., Collins, A.M., Phillips, N.D., Oksa, A., Hampson, D.J., 2006. Development of a multiplex-PCR for rapid detection of the enteric pathogens Lawsonia intracellularis, Brachyspira hyodysenteriae, and Brachyspira pilosicoli in porcine faeces. Lett. Appl. Microbiol. 42, 284-288.
La, T., Phillips, N.D., Hampson, D.J., 2009a. Evaluation of recombinant Bhlp29.7 as an ELISA antigen for detecting pig herds with swine dysentery. Vet. Microbiol. 133, 98-104.
La, T., Phillips, N.D., Harland, B.L., Wanchanthuek, P., Bellgard, M.I., Hampson, D.J., 2009b. Multilocus sequence typing as a tool for studying the molecular epidemiology and population structure of Brachyspira hyodysenteriae. Vet. Microbiol. 138, 330-338.
Labeda, D.P., 1987. Transfer of the type strain of Streptomyces erythraeus (Waksman 1923) Waksman and Henrici 1948 to the genus Saccharopolyspora Lacey and Goodfellow 1975 as Saccharopolyspora erythraea sp. nov., and designation of a neotype strain for Streptomyces erythraeus. Int. J. Syst. Bacteriol. 37, 19-22.
Lau, T.T., Hampson, D.J., 1992. The serological grouping system for Serpulina (Treponema) hyodysenteriae. Epidemiol. Infect. 109, 255-263.
Leach, W.D., Lee, A., Stubbs, R.P., 1973. Localization of bacteria in the gastrointestinal tract: a possible explanation of intestinal spirochaetosis. Infect. Immun. 7, 961-972.
Lee, J.I., Hampson, D.J., Lymbery, A.J., Harders, S.J., 1993a. The porcine intestinal spirochaetes: identification of new genetic groups. Vet. Microbiol. 34, 273-285.
Lee, J.I., Hampson, D.J., Combs, B.G., Lymbery, A.J., 1993b. Genetic relationships between isolates of Serpulina (Treponema)
Referencias 161
hyodysenteriae, and comparison of methods for their subspecific differentiation. Vet. Microbiol. 34, 35-46.
Lee, J.I., Hampson, D.J., 1994. Genetic characterisation of intestinal spirochaetes and their association with disease. J. Med. Microbiol. 40, 365-371.
Lee, B.J., Hampson, D.J., 1995. A monoclonal antibody reacting with the cell envelope of spirochaetes isolated from cases of intestinal spirochaetosis in pigs and humans. FEMS Microbiol. Lett. 131, 179-184.
Leschine, S.B., Canale-Parola, E., 1986. Rifampin-resistant RNA polymerase in spirochetes. FEMS Microbiol. Lett. 35, 199-204.
Leser, T.D., Møller, K., Jensen, T.K., Jorsal, S.E., 1997. Specific detection of Serpulina hyodysenteriae and potentially pathogenic weakly beta-haemolytic porcine intestinal spirochetes by polymerase chain reaction targeting 23S rDNA. Mol. Cell. Probes. 11, 363-372.
Li, C., Motaleb, A., Sal, M., Goldstein, S.F., Charon, N.W., 2000. Spirochete periplasmic flagella and motility. J. Mol. Microbiol. Biotechnol. 2, 345-354.
Liolios, K., Chen, I.M., Mavromatis, K., Tavernarakis, N., Hugenholtz, P., Markowitz, V.M., Kyrpides, N.C., 2010. The Genomes On Line Database (GOLD) in 2009: status of genomic and metagenomic projects and their associated metadata. Nucleic Acids Res. 38, 346-354.
Lobová, D., Smola, J., Cizek, A., 2004; Decreased susceptibility to tiamulin and valnemulin among Czech isolates of Brachyspira hyodysenteriae. J. Med. Microbiol. 53, 287-291.
Long, K.S., Poehlsgaard, J., Hansen, L.H., Hobbie, S.N., Böttger, E.C., Vester, B., 2009. Single 23S rRNA mutations at the ribosomal peptidyl transferase centre confer resistance to valnemulin and other antibiotics in Mycobacterium smegmatis by perturbation of the drug binding pocket. Mol. Microbiol. 71, 1218-1227.
Lussier G., 1962. Vibrionic dysentery of swine in Ontario-Part I: 1. Clinical Aspects and Pathology. Can. Vet. J. 3, 228-237.
162 Referencias
Lux, R., Moter, A., Shi, W., 2000. Chemotaxis in pathogenic spirochetes: directed movement toward targeting tissues? J. Mol. Microbiol. Biotechnol. 2, 355-364.
Lysons, R.J., Kent, K.A., Bland, A.P., Sellwood, R., Robinson, W.F., Frost, A.J., 1991. A cytotoxic haemolysin from Treponema hyodysenteriae - a probable virulence determinant in swine dysentery. J. Med. Microbiol. 34, 97-102.
Maiden, M.C., Bygraves, J.A., Feil, E., Morelli, G., Russell, J.E., Urwin, R., Zhang, Q., Zhou, J., Zurth, K., Caugant, D.A., Feavers, I.M., Achtman, M., Spratt, B.G., 1998. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc. Natl. Acad. Sci. U. S. A. 95, 3140-3145.
Margulis, L., Ashen, J.B., Solé, M., Guerrero, R., 1993. Composite, large spirochetes from microbial mats: spirochete structure review. Proc. Natl. Acad. Sci. U. S. A. 90, 6966-6970.
Mason, D. J., Dietz, A., DeBoer, C., 1963. Lincomycin, a new antibiotic. I. Discovery and biological properties. Antimicrob. Agents Chemother. 554-559.
Matson, E.G., Thompson, M.G., Humphrey, S.B., Zuerner, R.L., Stanton, T.B., 2005. Identification of genes of VSH-1, a prophage-like gene transfer agent of Brachyspira hyodysenteriae. J. Bacteriol. 187, 5885-5892.
McGuire, J.M., 1952. Ilotycin, a new antibiotic. Antibiot. and Chemother. 2, 281.
McGuire, J.M., Boniece, W.S., Higgins, C.E., Hoehn, M.M., Stark, W.M., Westhead, J., Wolfe, R.N., 1961. Tylosin a new antibiotic. J. Antibiot. Chemother. 11, 320-327.
McLaren, A.J., Trott, D.J., Swayne, D.E., Oxberry, S.L., Hampson, D.J., 1997. Genetic and phenotypic characterization of intestinal spirochetes colonizing chickens and allocation of known pathogenic isolates to three distinct genetic groups. J. Clin. Microbiol. 35, 412-417.
Referencias 163
Menninger, J.R., 1995. Mechanism of inhibition of protein synthesis by macrolide and lincosamide antibiotics. J. Basic Clin. Physiol. Pharmacol. 6, 229-250.
Messier, S., Higgins, R., Moore, C., 1990. Minimal inhibitory concentrations of five antimicrobials against Treponema hyodysenteriae and Treponema innocens. J. Vet. Diagn. Invest. 2, 330-333.
Mhoma, J.R., Hampson, D.J., Robertson, I.D., 1992. A serological survey to determine the prevalence of infection with Treponema hyodysenteriae in Western Australia. Aust. Vet. J. 69, 81-84.
Mikosza, A.S., Hampson, D.J., 2001a. Human intestinal spirochetosis: Brachyspira aalborgi and/or Brachyspira pilosicoli? Anim. Health Res. Rev. 2, 101-110.
Mikosza, A.S., La, T., Margawani, K.R., Brooke, C.J., Hampson, D.J., 2001b. PCR detection of Brachyspira aalborgi and Brachyspira pilosicoli in human faeces. FEMS Microbiol. Lett. 197, 167-170.
Milner, J.A., Sellwood, R., 1994. Chemotactic response to mucin by Serpulina hyodysenteriae and other porcine spirochetes: potential role in intestinal colonization. Infect. Immun. 62, 4095-4099.
Molnár, L., 1996. Sensitivity of strains of Serpulina hyodysenteriae isolated in Hungary to chemotherapeutic drugs. Vet. Rec. 138, 158-160.
Motro, Y., La, T., Bellgard, M.I., Dunn, D.S., Phillips, N.D., Hampson, D.J., 2009. Identification of genes associated with prophage-like gene transfer agents in the pathogenic intestinal spirochaetes Brachyspira hyodysenteriae, Brachyspira pilosicoli and Brachyspira intermedia. Vet. Microbiol. 134, 340-345.
Mølbak, L., Thomsen, L.E., Jensen, T.K., Bach Knudsen, K.E., Boye, M., 2007. Increased amount of Bifidobacterium thermacidophilum and Megasphaera elsdenii in the colonic microbiota of pigs fed a swine dysentery preventive diet containing chicory roots and sweet lupine. J. Appl. Microbiol. 103, 1853-1867.
Møller, K., Jensen, T.K., Jorsal, S.E., Leser, T.D., Carstensen, B., 1998. Detection of Lawsonia intracellularis, Serpulina hyodysenteriae, weakly beta-haemolytic intestinal spirochaetes, Salmonella
164 Referencias
enterica, and haemolytic Escherichia coli from swine herds with and without diarrhoea among growing pigs. Vet. Microbiol. 62, 59-72.
Nathues, H., Oliveira, C.J., Wurm, M., Grosse Beilage, E., Givisiez, P.E., 2007. Simultaneous detection of Brachyspira hyodysenteriae, Brachyspira pilosicoli and Lawsonia intracellularis in porcine faeces and tissue samples by multiplex-PCR. J. Vet. Med. A. Physiol. Pathol. Clin. Med. 54, 532-538.
Nemes, C. S., Glávits, R., Dobos-Kovács, M., Ivanics, E., Kaszanyitzky, E., Beregszászi, A., Szeredi, L., Dencsõ, L., 2006. Typhlocolitis associated with spirochaetes in goose flocks. Avian Pathol. 35, 4-11.
Nuessen, M.E., Joens, L.A., Glock, R.D., 1983. Involvement of lipopolysaccharide in the pathogenicity of Treponema hyodysenteriae. J. Immunol. 131, 997-999.
Ochiai, S., Adachi, Y., Mori, K., 1997. Unification of the genera Serpulina and Brachyspira, and proposals of Brachyspira hyodysenteriae Comb. Nov., Brachyspira innocens Comb. Nov. and Brachyspira pilosicoli Comb. Nov. Microbiol. Immunol. 41, 445-452.
Ohya, T., Araki, H., Sueyoshi, M., 2008. Identification of weakly beta-hemolytic porcine spirochetes by biochemical reactions, PCR-based restriction fragment length polymorphism analysis and species-specific PCR. J. Vet. Med. Sci. 70, 837-840.
Okamoto, R., Fukumoto, T., Nomura, H., Kiyoshima, K., Nakamura, K., Takamatsu, A., Naganawa, H., Takeuchi, T., Umezawa, H., 1980a. Physico-chemical properties of new acyl derivatives of tylosin produced by microbial transformation. J. Antibiot. 33, 1300-1308.
Okamoto, R., Tsuchiya, M., Nomura, H., Iguchi, H., Kiyoshima, K., Hori, S., Inui, T., Sawa, T., Takeuchi, T., Umezawa, H., 1980b. Biological properties of new acyl derivatives of tylosin. J. Antibiot. 33, 1309-1315.
Olson L.D., 1974. Clinical and pathological observations on the experimental passage of swine dysentery. Can. J. Comp. Med. 38, 7-13.
Referencias 165
Olson, L.D., Rodabaugh, D.E., 1976. Prevention of swine dysentery with a combination of lincomycin and spectinomycin and resistance of swine dysentery to tylosin and sodium arsanilate. Am. J. Vet. Res. 37, 769-773.
Oxberry, S.L., Trott, D.J., Hampson, D.J., 1998. Serpulina pilosicoli, waterbirds and water: potential sources of infection for humans and other animals. Epidemiol. Infect. 121, 219-225.
Oxberry, S.L., Hampson, D.J., 2003a. Colonisation of pet shop puppies with Brachyspira pilosicoli. Vet. Microbiol. 93, 167-174.
Oxberry, S.L., Hampson, D.J., 2003b. Epidemiological studies of Brachyspira pilosicoli in two Australian piggeries. Vet. Microbiol. 93, 109-120.
Park, N.Y., Chung, C.Y., McLaren, A.J., Atyeo, R.F., Hampson, D.J., 1995. Polymerase chain reaction for identification of human and porcine spirochaetes recovered from cases of intestinal spirochaetosis. FEMS Microbiol. Lett. 125, 225-229.
Paster, B.J., Dewhirst, F.E., Weisburg, W.G., Tordoff, L.A., Fraser, G.J., Hespell, R.B., Stanton, T.B., Zablen, L., Mandelco, L., Woese, C.R., 1991. Phylogenetic analysis of the spirochetes. J. Bacteriol. 173, 6101-6109.
Paster, B.J., Dewhirst, F.E., 1997. Taxonomy and phylogeny of intestinal spirochaetes. En: Hampson, D.J., Stanton, T.B. (Eds.), Intestinal spirochaetes in domestic animals and humans. CAB International, Wallingford, U. K., pp. 175-209.
Paster, B.J., Dewhirst, F.E., 2000. Phylogenetic foundation of spirochetes. J. Mol. Microbiol. Biotechnol. 2, 341-344.
Pernice, M., Wetzel, S., Gros, O., Boucher-Rodoni, R., Dubilier, N., 2007. Enigmatic dual symbiosis in the excretory organ of Nautilus macromphalus (Cephalopoda: Nautiloidea). Proc. Biol. Sci. 274, 1143-1152.
Peruzzi, S., Gorrini, C., Piccolo, G., Calderaro, A., Dettori, G., Chezzi, C., 2005. Human intestinal spirochaetosis in Parma: a focus on a selected population during 2002-2005. Acta Biomed. 78, 128-132.
Pettersson, B., Fellström, C., Andersson, A., Uhlén, M., Gunnarsson, A., Johansson, K.E., 1996. The phylogeny of intestinal porcine
166 Referencias
spirochetes (Serpulina species) based on sequence analysis of the 16S rRNA gene. J. Bacteriol. 178, 4189-4199.
Phillips, N.D., La, T., Hampson, D.J., 2005. A cross-sectional study to investigate the occurrence and distribution of intestinal spirochaetes (Brachyspira spp.) in three flocks of laying hens. Vet. Microbiol. 105, 189-198.
Phillips, N.D., La, T., Hampson, D.J., 2006. Development of a two-step nested duplex PCR assay for the rapid detection of Brachyspira pilosicoli and Brachyspira intermedia in chicken faeces. Vet. Microbiol. 116, 239-245.
Phillips, N.D., La, T., Amin, M.M., Hampson, D.J., 2010. Brachyspira intermedia strain diversity and relationships to the other indole-positive Brachyspira species. Vet. Microbiol. 143, 246-254.
Pindak, F.F., Clapper, W.E., Sherrod, J.H., 1965. Incidence and distribution of spirochetes in the digestive tract of dogs. Am. J. Vet. Res. 26, 1391-1402.
Pluske, J.R., Siba, P.M., Pethick, D.W., Durmic, Z., Mullan, B.P., Hampson, D.J., 1996. The incidence of swine dysentery in pigs can be reduced by feeding diets that limit the amount of fermentable substrate entering the large intestine. J. Nutr. 126, 2920-2933.
Pluske, J.R., Durmic, Z., Pethick, D.W., Mullan, B.P., Hampson, D.J., 1998. Confirmation of the role of rapidly fermentable carbohydrates in the expression of swine dysentery in pigs after experimental infection. J. Nutr. 128, 1737-1744.
Poulsen, S.M., Kofoed, C., Vester, B., 2000. Inhibition of the ribosomal peptidyl transferase reaction by the mycarose moiety of the antibiotics carbomycin, spiramycin and tylosin. J. Mol. Biol. 304, 471-481.
Poulsen, S.M., Karlsson, M., Johansson, L.B., Vester, B., 2001. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome. Mol. Microbiol. 41, 1091-1099.
Prapasarakul, N., Lugsomya, K., Disatian, S., Lekdumrongsak, T., Banlunara, W., Chetanachan, P., Hampson, D.J., 2011. Faecal
Referencias 167
excretion of intestinal spirochaetes by urban dogs, and their pathogenicity in a chick model of intestinal spirochaetosis. Res. Vet. Sci., doi:10.1016/j.rvsc.2011.01.015.
Prescott, L.M., Harley, J.P., Klein, D.A., 1999. Bacteria: Deinococos y gramnegativas no proteobacterias. En: Prescott, L.M., Harley, J.P., Klein, D.A. (Eds.), Microbiología. Cuarta edición. Mc Graw-Hill Interamericana, Madrid, España, pp. 454-473.
Pringle, M., Poehlsgaard, J., Vester, B., Long, K.S., 2004. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates. Mol. Microbiol. 54, 1295-1306.
Ramanathan, M., Duhamel, G.E., Mathiesen, M.R., Messier, S., 1993. Identification and partial characterization of a group of weakly beta-hemolytic intestinal spirochetes of swine distinct from Serpulina innocens isolate B256. Vet. Microbiol. 37, 53-64.
Råsbäck, T., Fellström, C., Gunnarsson, A., Aspán, A., 2006. Comparison of culture and biochemical tests with PCR for detection of Brachyspira hyodysenteriae and Brachyspira pilosicoli. J. Microbiol. Methods. 66, 347-353.
Råsbäck, T., Jansson, D.S., Johansson, K.E., Fellström, C., 2007a. A novel enteropathogenic, strongly haemolytic spirochaete isolated from pig and mallard, provisionally designated “Brachyspira suanatina” sp. nov. Environ. Microbiol. 9, 983-991.
Råsbäck, T., Johansson, K.E., Jansson, D.S., Fellström, C., Alikhani, M.Y., La, T., Dunn, D.S., Hampson, D.J., 2007b. Development of a multilocus sequence typing scheme for intestinal spirochaetes within the genus Brachyspira. Microbiology 153, 4074-4087.
Rayment, S.J., Barrett, S.P., Livesley, M.A., 1997. Sub-specific differentiation of intestinal spirochaete isolates by macrorestriction fragment profiling. Microbiology 143, 2923-2929.
Raynaud, J.P., Brunault, G., Patterson, E.B., 1981. A swine dysentery model for evaluation of drug prophylaxis: efficacy of various drugs in the control of swine dysentery. Am. J. Vet. Res. 42, 51-53.
168 Referencias
Roberts, D.S., 1956. Studies on vibrionic dysentery in swine. Aus. Vet. J. 32, 114-118.
Rohde, J., Rothkamp, A., Gerlach, G.F., 2002. Differentiation of porcine Brachyspira species by a novel nox PCR-based restriction fragment length polymorphism analysis. J. Clin. Microbiol. 40, 2598-2600.
Rohde, J., Kessler, M., Baums, C.G., Amtsberg, G., 2004. Comparison of methods for antimicrobial susceptibility testing and MIC values for pleuromutilin drugs for Brachyspira hyodysenteriae isolated in Germany. Vet. Microbiol. 102, 25-32.
Rosey, E.L., Kennedy, M.J., Yancey, R.J. Jr., 1996. Dual flaA1 flaB1 mutant of Serpulina hyodysenteriae expressing periplasmic flagella is severely attenuated in a murine model of swine dysentery. Infect. Immun. 64, 4154-4162.
Rønne, H., Szancer, J. 1990. In vitro susceptibility of Danish field isolates of Treponema hyodysenteriae to chemotherapeutics in swine dysentery (SD) therapy. Interpretation of MIC results based on the pharmacokinetic properties of the antibacterial agents. En: Proceedings, International Pig Veterinary Society, 11th Congress, Lausanne, Switzerland, p. 126.
Rønne, H., Jensen, J.C., 1992. Virginiamycin susceptibility of Serpulina hyodysenteriae, in vitro and in vivo. Vet. Rec. 131, 239-240.
Sacco, R.E., Trampel, D.W., Wannemuehler, M.J., 1997. Experimental infection of C3H mice with avian, porcine, or human isolates of Serpulina pilosicoli. Infect. Immun. 65, 5349-5353.
Sato, H., Nakamura, S.I., Habano, W., Wakabayashi, G., Adachi, Y., 2010. Human intestinal spirochetosis in northern Japan. J. Med. Microbiol. 59, 791-796.
Schlünzen, F., Zarivach, R., Harms, J., Bashan, A., Tocilj, A., Albrecht, R., Yonath, A., Franceschi, F., 2001. Structural basis for the interaction of antibiotics with the peptidyl transferase centre in eubacteria. Nature. 413, 814-821.
Schlünzen, F., Pyetan, E., Fucini, P., Yonath, A., Harms, J.M., 2004. Inhibition of peptide bond formation by pleuromutilins: the structure of the 50S ribosomal subunit from Deinococcus
Referencias 169
radiodurans in complex with tiamulin. Mol. Microbiol. 54, 1287-1294.
Schmall, L.M., Argenzio, R.A., Whipp, S.C., 1983. Pathophysiologic features of swine dysentery: cyclic nucleotide-independent production of diarrhea. Am. J. Vet. Res. 44, 1309-1316.
Schmiedel, D., Epple, H.J., Loddenkemper, C., Ignatius, R., Wagner, J., Hammer, B., Petrich, A., Stein, H., Göbel, U.B., Schneider, T., Moter, A., 2009. Rapid and accurate diagnosis of human intestinal spirochetosis by fluorescence in situ hybridization. J. Clin. Microbiol. 47, 1393-1401.
Schwartz, D.C., Cantor, C.R., 1984. Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37, 67-75.
Selander, R.K., Caugant, D.A., Ochman, H., Musser, J.M., Gilmour, M.N., Whittam, T.S., 1986. Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics. Appl. Environ. Microbiol. 51, 873-884.
Siba, P.M., Pethick, D.W., Hampson, D.J., 1996. Pigs experimentally infected with Serpulina hyodysenteriae can be protected from developing swine dysentery by feeding them a highly digestible diet. Epidemiol. Infect. 116, 207-216.
Song, Y., Hampson, D.J., 2009. Development of a multiplex qPCR for detection and quantitation of pathogenic intestinal spirochaetes in the faeces of pigs and chickens. Vet. Microbiol. 137, 129-136.
Songer, J.G., Kinyon, J.M., Harris, D.L., 1976. Selective medium for isolation of Treponema hyodysenteriae. J. Clin. Microbiol. 4, 57-60.
Sotiropoulos, C., Coloe, P.J., Smith, S.C., 1994. Identification and characterization of Serpulina hyodysenteriae by restriction enzyme analysis and Southern blot analysis. J. Clin. Microbiol. 32, 1397-1401.
Stamm, L.V., Bergen, H.L., Shangraw, K.A., 2001. Natural rifampin resistance in Treponema spp. correlates with presence of N531 in RpoB rif cluster i. Antimicrob. Agents Chemother. 45, 2973-2974.
170 Referencias
Stanton, T.B., Jensen, N.S., Casey, T.A., Tordoff, L.A., Dewhirst, F.E., Paster, B.J., 1991. Reclassification of Treponema hyodysenteriae and Treponema innocens in a new genus, Serpula gen. nov., as Serpula hyodysenteriae comb. nov. and Serpula innocens comb. nov. Int. J. Syst. Bacteriol. 41, 50-58.
Stanton T.B., 1992. Proposal to change the genus designation Serpula to Serpulina gen. nov. containing the species Serpulina hyodysenteriae comb. nov. and Serpulina innocens comb. nov. Int. J. Syst. Bacteriol. 42, 189-190.
Stanton, T.B., Trott, D.J., Lee, J.I., McLaren, A.J., Hampson, D.J., Paster, B.J., Jensen, N.S., 1996. Differentiation of intestinal spirochaetes by multilocus enzyme electrophoresis analysis and 16S rRNA sequence comparisons. FEMS Microbiol. Lett. 136, 181-186.
Stanton, T.B., Fournié-Amazouz, E., Postic, D., Trott, D.J., Grimont, P.A., Baranton, G., Hampson, D.J., Saint Girons, I., 1997. Recognition of two new species of intestinal spirochetes: Serpulina intermedia sp. nov. and Serpulina murdochii sp. nov. Int. J. Syst. Bacteriol. 47, 1007-1012.
Stanton, T.B., Postic, D., Jensen, N.S., 1998. Serpulina alvinipulli sp. nov., a new Serpulina species that is enteropathogenic for chickens. Int. J. Syst. Bacteriol. 48, 669-676.
Stanton, T.B., Rosey, E.L., Kennedy, M.J., Jensen, N.S., Bosworth, B.T., 1999. Isolation, oxygen sensitivity, and virulence of NADH oxidase mutants of the anaerobic spirochete Brachyspira (Serpulina) hyodysenteriae, etiologic agent of swine dysentery. Appl. Environ. Microbiol. 65, 5028-5034.
Stanton, T.B., 2007. Prophage-like gene transfer agents-novel mechanisms of gene exchange for Methanococcus, Desulfovibrio, Brachyspira, and Rhodobacter species. Anaerobe 13, 43-49.
Stephens, C.P., Hampson, D.J., 1999. Prevalence and disease association of intestinal spirochaetes in chickens in eastern Australia. Avian Pathol. 28, 447-454.
Referencias 171
Stephens, C.P., Hampson, D.J., 2001. Intestinal spirochete infections of chickens: a review of disease associations, epidemiology and control. Anim. Health Res. Rev. 2, 83-91.
Stephens, C.P., Hampson, D.J., 2002. Experimental infection of broiler breeder hens with the intestinal spirochaete Brachyspira (Serpulina) pilosicoli causes reduced egg production. Avian Pathol. 31, 169-175.
Stephens, C.P., Oxberry, S.L., Phillips, N.D., La, T., Hampson, D.J., 2005. The use of multilocus enzyme electrophoresis to characterise intestinal spirochaetes (Brachyspira spp.) colonising hens in commercial flocks. Vet. Microbiol. 107, 149-157.
Suriyaarachchi, D.S., Mikosza, A.S., Atyeo, R.F., Hampson, D.J., 2000. Evaluation of a 23S rDNA polymerase chain reaction assay for identification of Serpulina intermedia, and strain typing using pulsed-field gel electrophoresis. Vet. Microbiol. 71, 139-148.
Swayne, D.E., Eaton, K.A., Stoutenburg, J., Trott, D.J., Hampson, D.J., Jensen, N.S., 1995. Identification of a new intestinal spirochete with pathogenicity for chickens. Infect. Immun. 63, 430-436.
Szynkiewicz, Z.M., Binek, M., 1986. Evaluation of selective media for primary isolation of Treponema hyodysenteriae and Treponema innocens. Comp. Immunol. Microbiol. Infect. Dis. 9, 71-77.
Tachibana, H., Nakamura, S., Adachi, Y., 2003. Proposal of Brachyspira ibaraki sp. nov. for Japanese human intestinal spirochetes closely related to Brachyspira aalborgi. Abstract 3. En: Proceedings of the Second International Conference on Colonic Spirochaetal Infections in Animals and Humans, April 2-4, Eddleston, U. K.
Taylor, D.J., Alexander, T.J., 1971. The production of dysentery in swine by feeding cultures containing a spirochaete. Br. Vet. J. 127, 58-61.
Tenaya, I.W., Penhale, W.J., Hampson, D.J., 1998. Preparation of diagnostic polyclonal and monoclonal antibodies against outer envelope proteins of Serpulina pilosicoli. J. Med. Microbiol. 47, 317-324.
Tesouro, M., 1969. Spirochaetales micro-organisms: an agent possibly associated with swine dysentery. Vet. Rec. 85, 562-563.
172 Referencias
ter Huurne, A.A., van Houten, M., Koopman, M.B., van der Zeijst, B.A., Gaastra, W., 1992. Characterization of Dutch porcine Serpulina (Treponema) isolates by restriction endonuclease analysis and DNA hybridization. J. Gen. Microbiol. 138, 1929-1934.
Thomas, W., Sellwood, R., Lysons, R.J., 1992a. A 16-kilodalton lipoprotein of the outer membrane of Serpulina (Treponema) hyodysenteriae. Infect. Immun. 60, 3111-3116.
Thomas, W., Sellwood, R. 1992b. Monoclonal antibodies to a 16-kDa antigen of Serpulina (Treponema) hyodysenteriae. J. Med. Microbiol. 37, 214-220.
Thomsen, L.E., Knudsen, K.E., Jensen, T.K., Christensen, A.S., Møller, K., Roepstorff, A., 2007. The effect of fermentable carbohydrates on experimental swine dysentery and whip worm infections in pigs. Vet. Microbiol. 119, 152-163.
Thomson, J.R., Smith, W.J., Murray, B.P., Murray, D., Dick, J.E., Sumption, K.J., 2001. Porcine enteric spirochete infections in the UK: surveillance data and preliminary investigation of atypical isolates. Anim. Health Res. Rev. 2, 31-36.
Townsend, K.M., Giang, V.N., Stephens, C., Scott, P.T., Trott, D.J., 2005. Application of nox-restriction fragment length polymorphism for the differentiation of Brachyspira intestinal spirochetes isolated from pigs and poultry in Australia. J. Vet. Diagn. Invest. 17, 103-109.
Trott, D.J., McLaren, A.J., Hampson, D.J., 1995. Pathogenicity of human and porcine intestinal spirochaetes in day-old specific pathogen free chicks: an animal model of intestinal spirochetosis. Infect. Immun. 63, 3705-3710.
Trott, D.J., Stanton, T.B., Jensen, N.S., Duhamel, G.E., Johnson, J.L., Hampson, D.J., 1996a. Serpulina pilosicoli sp. nov., the agent of porcine intestinal spirochetosis. Int. J. Syst. Bacteriol. 46, 206-215.
Trott, D.J., Huxtable, C.R., Hampson, D.J., 1996b. Experimental infection of newly weaned pigs with human and porcine strains of Serpulina pilosicoli. Infect. Immun. 64, 4648-4654.
Trott, D.J., Combs, B.G., Mikosza, A.S., Oxberry, S.L., Robertson, I.D., Passey, M., Taime, J., Sehuko, R., Alpers, M.P., Hampson, D.J.,
Referencias 173
1997a. The prevalence of Serpulina pilosicoli in humans and domestic animals in the Eastern Highlands of Papua New Guinea. Epidemiol. Infect. 119, 369-379.
Trott, D.J., Jensen, N.S., Saint Girons, I., Oxberry, S.L., Stanton, T.B., Lindquist, D., Hampson, D.J., 1997b. Identification and characterization of Serpulina pilosicoli isolates recovered from the blood of critically ill patients. J. Clin. Microbiol. 35, 482-485.
Trott, D.J., Mikosza, A.S., Combs, B.G., Oxberry, S.L., Hampson, D.J., 1998. Population genetic analysis of Serpulina pilosicoli and its molecular epidemiology in villages in the Eastern Highlands of Papua New Guinea. Int. J. Syst. Bacteriol. 48, 659-668.
Turek, J.J., Meyer, R.C., 1977. Studies on a canine intestinal spirochete. I. Its isolation, cultivation and ultrastructure. Can. J. Comp. Med. 41, 332-337.
Vester, B., Douthwaite, S., 2001. Macrolide resistance conferred by base substitutions in 23S rRNA. Antimicrob. Agents Chemother. 45, 1-12.
Waters, W.R., Pesch, B.A., Hontecillas, R., Sacco, R.E., Zuckermann, F.A., Wannemuehler, M.J., 1999. Cellular immune responses of pigs induced by vaccination with either a whole cell sonicate or pepsin-digested Brachyspira (Serpulina) hyodysenteriae bacterin. Vaccine 18, 711-719.
Webb, D.M., Duhamel, G.E., Mathiesen, M.R., Muniappa, N., White, A.K., 1997. Cecal spirochetosis associated with Serpulina pilosicoli in captive juvenile ring-necked pheasants. Avian Dis. 41, 997-1002.
Weiss, E., 1989. Órganos digestivos. En: Dahme, E., Weiss, E., (Eds.), Anatomía patológica especial veterinaria. Editorial Acribia, Zaragoza, España, p. 174.
Welsh, J., McClelland, M., 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 18, 7213-7218.
Westerman, R.B., Phillips, R.M., Joens, L.A., 1995. Production and characterization of monoclonal antibodies specific for lipooligosaccharide of Serpulina hyodysenteriae. J. Clin. Microbiol. 33, 2145-2149.
174 Referencias
Whiting, R.A., Doyle, L.P., Spray, R.S., 1921. Swine dysentery. Purdue Univ. Agric. Exp. Stat. Bull. 257, 3-15.
Wier, A., Dolan, M., Grimaldi, D., Guerrero, R., Wagensberg, J., Margulis, L., 2002. Spirochete and protist symbionts of a termite (Mastotermes electrodominicus) in Miocene amber. Proc. Natl. Acad. Sci. U. S. A. 99, 1410-1413.
Willems, H., Reiner, G., 2010. A multiplex real-time PCR for the simultaneous detection and quantitation of Brachyspira hyodysenteriae, Brachyspira pilosicoli and Lawsonia intracellularis in pig faeces. Berl. Munch. Tierarztl. Wochenschr. 123, 205-209.
Williams, J.G., Kubelik, A.R., Livak, K.J., Rafalski, J.A., Tingey, S.V., 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18, 6531-6535.
Wood, E.N., Lysons, R.J., 1988. Financial benefit from the eradication of swine dysentery. Vet. Rec. 122, 277-279.
Wood, E.J., Seviour, R.J., Siddique, A.B., Glaisher, R.W., Webb, R.I., Trott, D.J., 2006. Spherical body formation in the spirochaete Brachyspira hyodysenteriae. FEMS Microbiol. Lett. 259, 14-19.
Wright, J.C., Wilt, G.R., Reed, R.B., Powe, T.A., 1989. Use of an enzyme-linked immunosorbent assay for detection of Treponema hyodysenteriae infection in swine. J. Clin. Microbiol. 27, 411-416.
Wyss, C., Choi, B.K., Schüpbach, P., Guggenheim, B., Göbel, U.B., 1996. Treponema maltophilum sp. nov., a small oral spirochete isolated from human periodontal lesions. Int. J. Syst. Bacteriol. 46, 745-752.
Zeeshan, M., Irfan, S., Ahmed, I., 2009. Brachyspira species blood stream infection. J. Pak. Med. Assoc. 59, 723-724.
Zhao, X., Drlica, K., 2001. Restricting the selection of antibiotic-resistant mutants: a general strategy derived from fluoroquinolone studies. Clin. Infect. Dis. 33, 147-156.
Zhao, X., Drlica, K., 2002. Restricting the selection of antibiotic-resistant mutant bacteria: measurement and potential use of the mutant selection window. J. Infect. Dis. 185, 561-565.
Referencias 175
Zuerner, R.L., Stanton, T.B., 1994. Physical and genetic map of the Serpulina hyodysenteriae B78T chromosome. J. Bacteriol. 176, 1087-1092.
Zuerner, R.L., Stanton, T.B., Minion, F.C., Li, C., Charon, N.W., Trott, D.J., Hampson, D.J., 2004. Genetic variation in Brachyspira: chromosomal rearrangements and sequence drift distinguish B. pilosicoli from B. hyodysenteriae. Anaerobe 10, 229-237.
Zymet, C.L., 1969. Canine spirochetosis and its association with diarrhea. Vet. Med. Small Anim. Clin. 64, 883-887.
Agradecimientos
El autor desea expresar su agradecimiento a las siguientes
personas e instituciones:
A Pedro Miguel Rubio Nistal y Ana María Carvajal
Urueña por la dirección de este trabajo.
A Claes Fellström y Märit Pringle de la Universidad de
Ciencias Agrícolas (SLU) de Uppsala, Suecia, por acogerle en su
grupo de investigación.
A David J. Hampson de la Universidad de Murdoch,
Australia, por invitarle en calidad de “Visiting Research
Associate” a unirse a su grupo de investigación durante unos
meses.
A la Consejería de Educación de la Junta de Castilla y
León por la concesión de una ayuda para la formación de
personal investigador, cofinanciada por el Fondo Social Europeo.
