CHARACTERIZATION OF P-CADHERIN IN FELINE MAMMARY TUMOURS · CHARACTERIZATION OF P-CADHERIN IN FELINE MAMMARY TUMOURS ... A boa disposição e humor com que sempre me recebeu,

CHARACTERIZATION OF P-CADHERIN IN FELINE MAMMARY TUMOURS ASSOCIATION WITH TUMOUR AGGRESSIVENESS

ANA CATARINA PAIS DOS SANTOS FIGUEIRA

TESE DE DOUTORAMENTO EM CIÊNCIAS VETERINÁRIASAPRESENTADA AO INSTITUTO DE CIÊNCIAS BIOMÉDICAS ABEL SALAZARDA UNIVERSIDADE DO PORTO

ANA CATARINA PAIS DOS SANTOS FIGUEIRA

CHARACTERIZATION OF P-CADHERIN IN FELINE MAMMARY TUMOURS ASSOCIATION WITH TUMOUR AGGRESSIVENESS

Tese de Candidatura ao grau de Doutor em Ciências Veterinárias submetida ao Instituto de Ciências Biomédicas Abel Salazar da Universidade do Porto

Orientador | Professora Doutora Maria de Fátima Gärtner Categoria | Professora CatedráticaAfiliação | Instituto de Ciências Biomédicas Abel Salazar, Universidade do Porto (ICBAS-UP)

Co-orientador | Professor Doutor Augusto de MatosCategoria | Professor AuxiliarAfiliação | Instituto de Ciências Biomédicas Abel Salazar, Universidade do Porto (ICBAS-UP)

Co-orientador | Professora Doutora Patrícia Dias-PereiraCategoria | Professora AuxiliarAfiliação | Instituto de Ciências Biomédicas Abel Salazar, Universidade do Porto (ICBAS-UP)

‘A quem me pergunta se sou pessimista ou otimista,respondo que o meu conhecimento é de pessimista,

mas a minha vontade e a minha esperança são de otimista.’

Albert Schweitzer

FINANCIAL SUPPORT

PhD Fellowship (SFRH/BD/69493/2010) provided by the Portuguese Foundation for Sci-ence and Technology (FCT) of the Portuguese Ministry of Science, Technology and Higher Education

Bolsa Individual de Doutoramento (SFRH/BD/69493/2010) da Fundação Portuguesa para a Ciência e a Tecnologia (FCT) do Ministério da Ciência, Tecnologia e Ensino Superior

DECLARATION

In accordance to the disposed in “nº 2, alínea a, do Art.º 31º do Decreto-Lei nº 230/2009”, the author of this thesis declares to have actively participated in the elaboration and execu-tion of experimental work that led to the results presented, as well as in its interpretation and in the writing of the respective manuscripts.

The following original manuscripts (published and in preparation) are integral parts of this PhD thesis: Figueira AC, Gomes C, de Oliveira J, Vilhena H, Carvalheira J, De Matos A, Dias-Pereira P, Gärtner F, 2014. Aberrant P-cadherin expression is associated to aggressive feline mam-mary carcinomas. BMC Vet Res, 10, 270.

Figueira AC, Gomes C, Vilhena H, Miranda S, Carvalheira J, de Matos AJ, Dias-Pereira P, Gärtner F, 2015. Characterization of α-, β- and p120-catenin expression in feline mammary tissues and their relation with E- and P-cadherin. Anticancer Res, 35, 3361-9.

Figueira AC, Vilhena H, Gomes C, Carvalheira J, de Matos AJ, Dias-Pereira P, Gärtner F, Phenotypical, cell-adhesion, hormonal receptors and cell-cycle associated markers: an in-tegrated immunohistochemical study in feline mammary lesions. Manuscript in preparation.

Figueira AC, Gomes C, Mendes N, de Matos AJ, Dias-Pereira P, Gärtner F, An in vitro and in vivo characterization of the cadherin-catenin adhesion complex in a feline mammary car-cinoma cell line. Manuscript in preparation.

ACKNOWLEDGMENTS

To the Instituto de Ciências Biomédicas Abel Salazar, University of Porto for accepted me and for giving me the opportunity of making part of a high quality educational training of the Veterinary Science PhD programme.

To the Institute of Molecular Pathology and Immunology of the University of Porto, for ac-cepted me in a team with high technical and scientific skills.

To the Escola Universitária Vasco da Gama, Coimbra, for the encouragement and support in this work.

To the Portuguese Foundation for Science and Technology (FCT) of the Portuguese Min-istry of Science, Technology and Higher Education, for providing me the PhD Fellowship (SFRH/BD/69493/2010).

13

PERSONAL THANKS AGRADECIMENTOS

A todas as pessoas que de uma forma ou outra me acompanharam e apoiaram durante o periodo de realização deste trabalho, aqui ficam os meus sinceros agradecimentos.

À Professora Doutora Fátima Gärtner, por me ter permitido realizar este projeto e fazer parte do grupo de investigação, conhecendo e contatando de perto com os seus colabora-dores e colegas, abrindo portas para o mundo da investigação em oncologia. A Professora, para além da excelente académica e investigadora, é uma grande amiga, com um coração enorme como conheço poucos. Um muito obrigada por todas as lições ao longo destes quatro anos.

À Professora Doutora Patrícia Dias-Pereira, que para além da preciosa ajuda na co-orien-tação deste trabalho, mostrou ser uma amiga que espero para a vida. O apoio em fases cruciais do projeto de doutoramento, bem como na minha vida pessoal, foram fundamen-tais para que pudessem ser ultrapassadas. Obrigada por me mostrares que os passos atrás que damos no nosso caminho, por vezes são para ganharmos balanço para seguir em frente.

Ao Professor Doutor Augusto de Matos, por continuar a ser o excelente Professor que recordava da licenciatura em Medicina Veterinária. Muito obrigada por todas as críticas, sugestões e “food for the brain” que me ajudaram a refletir sobre o trabalho desenvolvido.

Ao Professor Doutor Júlio Carvalheira, por todo o apoio e disponibilidade para as inúmeras dúvidas estatísticas. A boa disposição e humor com que sempre me recebeu, tornaram o trabalho nesta área mais agradável.

À Dra Filomena Ramalho e à Dra Mariana Portugal pela disponibilidade e amabilidade na parceria com o Canil Municipal de Coimbra.

À Catarina Gomes por ter sido sem dúvida um “anjo” que me apareceu em determinada altura do trabalho. Sabes bem a importância e valor que tiveste neste projeto e para mim foi um privilégio poder trabalhar contigo.

14

Ao Nuno Mendes por todo o apoio no trabalho no biotério, por todas as trocas de e-mails e por teres ajudado a tornar esta parte do trabalho menos penosa.

À Dra Anália do Carmo e à Sofia Anastácio pela disponibilidade e ajuda com o trabalho de ELISA.

Aos Ipatimupianos um muito obrigada pela amabilidade e carinho com que receberam esta “deslocada” de Coimbra. Fizeram-me sentir em casa.

À equipa do Laboratório de Patologia Veterinária do ICBAS, pelo apoio na realização técnica do trabalho.

Ao Hugo Vilhena, por seres o melhor colega para trabalhar em investigação clínica. Sempre atento, preocupado, disponível e interessado. Foste uma “peça fundamental neste puzzle”.

À Sónia Miranda, por teres permitido a excelente colaboração com o Hospital Veterinário do Baixo Vouga e por toda a ajuda na parte cirúrgica e imagiológica.

Aos meus amigos do coração Raquel, Ana “Espanhola”, Carla, João Paulo, Inês, António, Teresa, Marta, Ana Canadas e Pedro e aos eternos amigos da “La Famiglia”, que de alguma forma com a vossa amizade permitiram duplicar as minhas alegrias e dividir as minhas tristezas.

Ao Miguel, que continuo a considerar um grande amigo.

À Xana, sei que és de poucas palavras, mas quando as dizes fazem todo o sentido. Só o facto de seres a melhor “tia Xana” do mundo, deixa-me mais tranquila e completa.

À minha Mãe por todo o apoio durante esta fase. Sem ti nada disto teria sido possível.

(Ao meu Pai e à avó Regina que de onde estão, continuam a fazer parte da minha vida).

E porque os últimos são sempre os primeiros, à Carolina a minha pequena grande princesa, um agradecimento muito especial, por na sua inocência dos 4 anos ter sempre apoiado a mãe. A Ti um pedido de desculpa por todos os momentos de ausência e só espero que um dia sintas por mim o mesmo orgulho que eu sinto por ti!

15

THESIS OUTLINE

The present thesis has been divided into nine chapters and one appendix.

Chapter 1 is a general introduction on the state of the art in feline mammary tumours, as well as the molecules of the cadherin-catenin complex both in human breast cancer and in feline mammary tumours.

Chapter 2 summarizes the objectives of the thesis as well as the motivation for the study of P-cadherin in feline mammary carcinogenesis.

Chapters 3, 4, 5, 6 and 7 encompass original data of this thesis, both published and unpub-lished, along with ongoing work.

The first study, Chapter 3, focuses on P-cadherin expression in feline mammary tumours. This study entitled "Aberrant P-cadherin expression is associated to aggressive feline mam-mary carcinomas” was published in BMC Vet Res, 2014, 10, 270.

The second study, Chapter 4, focuses on the characterization of the cadherin-catenin com-plex in feline mammary tumours. This study entitled “Characterization of α-, β- and p120-catenin expression in feline mammary tissues and their relation with E- and P-cadherin” was published in Anticancer Res, 2015, 35, 3361-9.

The third study, Chapter 5, focuses on the molecular characterization of feline mammary tumours. This study is entitled “Phenotypical, cell-adhesion, hormonal receptors and cell-cycle associated markers: an integrated immunohistochemical study in feline mammary lesions” and the manuscript is in preparation.

The fourth study, Chapter 6, focuses on the determination of an in vitro and in vivo models for the P-cadherin study in feline mammary tumours. This study is entitled “An in vitro and in vivo characterization of the cadherin-catenin adhesion complex in a feline mammary car-cinoma cell line” and the manuscript is in preparation.

16

The fifth study, Chapter 7, is an ongoing work focused on the determination of the soluble P-cadherin serum levels in queens with mammary tumours.

A general discussion of the results is presented in Chapter 8, followed by conclusions and future perspectives in Chapter 9.

Appendix includes the published manuscripts.

17

ABSTRACT

Mammary cancer in cats have high recurrence and metastatic potential. The need of reli-able prognostic markers and promising therapeutic approaches to feline mammary carcino-mas, has led to an intensive research aiming to accomplish a molecular characterization of feline mammary tumours that reflects their biological behaviour, similarly to what has been previously performed in human breast cancer.

Cadherins are calcium-dependent cell-to-cell adhesion glycoproteins playing a critical role in the formation and maintenance of normal tissue architecture. Abnormal expression or function in the major molecules of the cadherin-catenin adhesion complex have been relat-ed to breast cancer development and associated to cell migration, invasion and metastatic dissemination.

The classical cadherins (P-cadherin and E-cadherin) as well as major catenins (α-, β-, and p120-) immunoexpression were studied in a series of feline normal mammary glands, hy-perplastic/dysplastic lesions, benign and malignant tumours. Phenotypical molecular mark-ers (AE1/AE3, vimentin, p63), hormonal receptor status (ER, PR) and markers of prolifera-tive activity (Ki-67) were also characterized.

The results allowed us to conclude that aberrant expression of P-cadherin detected in feline mammary tumours is associated to malignant phenotypes, higher histological grade and invasive behaviour, suggesting that this protein may be a relevant prognosis biomarker. Co-expression of P- and E-cadherin was related with high grade carcinomas, and P-cad-herin overexpression seems to be a more reliable indicator of prognosis in feline mammary carcinomas than the aberrant expression of E-cadherin. Although the prognostic value of α-, β- and p120-catenin was not supported by our results, the development of mammary carcinomas in cats is associated to a decreased expression of these catenins suggesting that they may represent a valuable diagnostic tool. Moreover, aggressive feline mammary carcinomas are associated to high histological grade, high proliferative activity, absence of ER, aberrant expression of P-cadherin and vimentin.

Major molecules from the cadherin-catenin complex (E- and P-cadherin, α-, β- and p120-

18

catenin) were evaluated in a feline metastatic mammary carcinoma cell line (FMCm). This cell line besides expressing P-cadherin also co-expressed E-cadherin and α-, β- and p120-catenin, and those molecules were in close relation with each other pointing to a preserved E-cadherin-catenin complex. The FMCm cell line showed high tumourigenic capacity, aggressive and metastatic characteristics in nude mice, with xenograft and metastatic le-sions expressing P- and E-cadherin as well as α-, β- and p120-catenin. Thus, FMCm cell line can be proposed as a useful model for in vitro and in vivo studies of P-cadherin and associated molecules of the cadherin-catenin complex for study of feline mammary carci-noma progression.

In conclusion, the results presented in this study highlighted P-cadherin as a relevant molecule in tumour aggressiveness of the feline mammary carcinomas.

19

RESUMO

Os carcinomas mamários felinos estão associados a elevadas taxas de recidiva e potencial metastático. A necessidade de marcadores de prognóstico fiáveis e de abordagens terapêu-ticas promissoras para os carcinomas mamários felinos, levou à investigação e caracteriza-ção molecular destas lesões com o objetivo de determinar o seu comportamento biológico, à semelhança do que tem sido realizado em carcinomas mamários na mulher.

As caderinas são glicoproteínas fundamentais na adesão célula a célula, dependentes do cálcio que desempenham um papel na formação e manutenção da arquitetura dos tecidos normais. A expressão e função alteradas das principais moléculas do complexo de adesão caderina-catenina têm sido associadas ao cancro da mama. A sua desregulação tem um papel fundamental na migração celular, invasão e disseminação metastática.

A imunoexpressão das caderinas clássicas (caderina P e caderina E) bem como das principais cateninas (α, β e p120) foi estudada numa série de tecido normal da glândula mamária felina, em lesões hiperplásicas/displásicas, tumores benignos e malignos. Foram também caracter-izados marcadores moleculares de fenótipo (AE1/AE3, vimentina e p63), recetores hormonais (RE, RP) e marcadores de atividade proliferativa (Ki-67).

Os resultados permitiram concluir que a expressão aberrante da caderina P detetada nos tu-mores mamários felinos está associada ao fenótipo maligno, a grau histológico elevado e a um comportamento invasivo, o que sugere que a caderina P seja um biomarcador molecular com relevância prognóstica. A co-expressão da caderina P e da caderina E está associada a carcinomas de grau histológico elevado e a sobre-expressão da caderina P em carcinomas de mama de felinos parece ser um indicador de prognóstico mais fiável do que a expressão alterada da caderina E.

Apesar do valor prognóstico das cateninas α, β e p120 não ter sido confirmado com os nos-sos resultados, o desenvolvimento de carcinomas mamários em gatas está associado a uma diminuição destas cateninas, sugerindo que possam ter valor diagnóstico. Os carcinomas mamários felinos com comportamento mais agressivo estão associados a grau histológico el-evado, elevada atividade proliferativa, ausência de recetores de estrogénio e expressão aber-rante de caderina P, bem como de vimentina.

20

As principais moléculas do complexo caderina-catenina (caderina E e P e cateninas α, β, e p120) foram estudadas numa linha celular de metástase de carcinoma mamário felino (FMCm). Esta linha celular para além de expressar caderina P também co-expressava caderina E e as cateninas α, β e p120. Estas moléculas apresentavam uma relação positiva entre si apontando para a presença de um complexo caderina E-catenina preservado. A linha celular FMCm revelou capacidade tumorigénica, agressividade e potencial metastático em ratinhos nude, com as lesões de xenotransplantes e lesões metastáticas mostrando expressão de caderina E e ca-derina P, bem como cateninas α, β e p120. Assim, esta linha celular FMCm pode ser proposta como um modelo útil para estudos in vitro e in vivo da caderina P e das restantes moléculas do complexo caderina-catenina na progressão dos carcinomas mamários felinos.

Em conclusão, os resultados apresentados neste estudo evidenciam a caderina P como uma molécula relevante na agressividade tumoral dos carcinomas mamários felinos.

21

ABBREVIATION LIST

ctn CateninBCA Bicinchoninic acidBLBC Basal-like breast cancerBRCA1 Breast cancer susceptibility gene 1BSA Bovine serum albuminCAMs Cell adhesion moleculesCBD Catenin binding domainCDH1 Cadherin 1 or E-cadherin geneCDH3 Cadherin 3 or P-cadherin geneCK CytokeratinCSC Cancer stem cellsDAB 3’ 3’-diaminobenzidine tetrahydrochlorideDAPI 4,6-diamidino-2-phenylindole endihydrochlorideDCIS Ductal carcinoma in situDIF Double-labell immunofluorescenceDFI Disease free intervalDNA Desoxyribonucleic acidEC Extracelular sub-domainE-cadherin Epithelial cadherinECM Extracellular matrixEGFR Epidermal growth factor receptorELISA Enzyme-linked immunosorbent assayEMT Epithelial to mesenchymal transitionER Oestrogen receptorFMCm Feline mammary carcinoma metastatic cell lineHE Haematoxylin eosinHER2 Receptor tyrosine-protein kinase erbB-2HR Hormone receptorsIHC ImmunohistochemistryJMD Juxtamembrane domainLOH Lost of heterozygoty

22

MET Mesenchymal to epithelial transitionMMP Matrix metalloproteinasesNAF Nipple aspirate fluidNS Not significantOS Overall survivalPBS Phosphate buffered salineP-cadherin Placental cadherinPLA Proximity ligation assayPR Progesterone receptorSAM Substratum adhesion moleculessE-cad Soluble fragment of E-cadherinsP-cad Soluble fragment of P-cadherinTBS Tris-buffered salineTNBC Triple-negative breast carcinomaTNM Tumour-node-metastasisTS total scoreVEGF Vascular endothelial growth factorWHO World Health Organization

23

ÍNDICE

ABSTRACT 17RESUMO 19ABREVIATION LIST 21

CHAPTER 01 GENERAL INTRODUCTION 27

FELINE MAMMARY TUMOURS 29Histopathology and diagnosis 31Therapy and prognosis 33Molecular features 34CELL ADHESION MOLECULES 37CLASSICAL CADHERINS 39The cadherin-catenin complex 40THE CADHERIN-CATENIN COMPLEX AND THE MAMMARY GLAND 42E-cadherin and breast cancer 44Catenins and breast cancer 46P-cadherin and breast cancer 46P-cadherin as a potential therapeutic target 49Cadherins and epithelial to mesenchymal transition (EMT) in breast cancer 50Cadherins fragments in body fluids 51THE CADHERIN-CATENIN COMPLEX IN FELINE MAMMARY TISSUES 52REFERENCES 54

CHAPTER 02 AIMS AND OBJECTIVES 73

GENERAL AIMS 75SPECIFIC AIMS 76

24

CHAPTER 03 P-CADHERIN EXPRESSION IN FELINE MAMMARY TUMOURS 79

ABERRANT P-CADHERIN EXPRESSION IS ASSOCIATED TO AGGRESSIVE FELINE MAMMARY CARCINOMAS 81

ABSTRACT 83BACKGROUND 85MATERIALS AND METHODS 87Tissue samples 87Evaluation of P-cadherin and E-cadherin immunohistochemistry labelling 88Evaluation of P-cadherin and E-cadherin double-labelling immunofluorescence 89Statistical methods 90RESULTS 91P-Cadherin and E-cadherin expression by immunohistochemistry 91P-Cadherin and E-cadherin expression by double-labelling immunofluorescence 93Relationship between the expression of P-cadherin, E-cadherin and clinicopathological parameters 94DISCUSSION 96CONCLUSIONS 100REFERENCES 101

CHAPTER 04CADHERIN-CATENIN COMPLEX MOLECULES IN FELINE MAMMARY TUMOURS 107

CHARACTERIZATION OF α-, β- AND P120-CATENIN EXPRESSION IN FELINE MAMMARY TISSUES AND THEIR RELATION WITH E- AND P-CADHERIN 109

ABSTRACT 111BACKGROUND 113MATERIALS AND METHODS 115Tissue samples 115α-, β- and p120-Catenin expression by immunohistochemistry 116Statistical methods 117RESULTS 118Expression of α-catenin 118Expression of β-catenin 120Expression of p120-catenin 121DISCUSSION 124CONCLUSIONS 128REFERENCES 129

CHAPTER 05MOLECULAR CHARACTERIZATION OF FELINE MAMMARY TUMOURS 133

25

PHENOTYPICAL, CELL-ADHESION, HORMONAL RECEPTORS ANDCELL-CYCLE ASSOCIATED MARKERS: AN INTEGRATED IMMUNOHISTOCHEMICAL STUDY IN FELINE MAMMARY LESIONS 135

ABSTRACT 137BACKGROUND 139MATERIALS AND METHODS 141Tissue samples 141Immunoexpression 142Evaluation of immunolabelling 142Statistical methods 143RESULTS 144AE1/AE3 144Vimentin 145P63 147ER 152PR 152Ki-67 153DISCUSSION 154CONCLUSIONS 158REFERENCES 159

CHAPTER 06IN VITRO AND IN VITRO MODEL FOR THE STUDY OF P-CADHERIN IN FELINE MAMMARY CARCINOGENESIS 165

AN IN VITRO AND IN VIVO CHARACTERIZATION OF THECADHERIN-CATENIN ADHESION COMPLEX IN A FELINE MAMMARY CARCINOMA CELL LINE 167

ABSTRACT 169BACKGROUND 171MATERIALS AND METHODS 173IN VITRO STUDIES 173Cell culture 173Western blot analysis 174Immunofluorescence 174In situ proximity ligation assay 174E-cadherin immunoprecipitation 176IN VIVO STUDIES 176Animals 176FMCm tumorigenic and metastatic capacity assessment 176Immunohistochemistry of mice xenografts 177P-cadherin and E-cadherin double-labelling immunofluorescence in mice xenografts 178RESULTS 179Characterization of the FMCm cell line 179

26

In vivo behaviour of FMCm cell line – tumourigenic and metastatic capacity 182Characterization of mice xenografts 184DISCUSSION 189CONCLUSIONS 192REFERENCES 193SUPPLEMENTARY DATA 198In vitro invasion capacity of FMCm cell line 198P-cadherin transcript sequencing 199EXON 3-14 sequencing 199

CHAPTER 07DETERMINATION OF THE SOLUBLE P-CADHERIN SERUM LEVELS IN QUEENS WITH MAMMARY TUMOURS 201

SOLUBLE FRAGMENT OF P-CADHERIN INSERUM OF QUEENS WITH MAMMARY TUMOURS 203

BACKGROUND 205MATERIALS AND METHODS 207Sample collection 207Patients follow-up 208Detection and quantification of soluble P-cadherin by ELISA 208RESULTS AND DISCUSSION 210CONCLUSIONS 213REFERENCES 214

CHAPTER 08GENERAL DISCUSSION 217

GENERAL DISCUSSION 219REFERENCES 225

CHAPTER 09CONCLUSIONS AND FUTURE PERSPECTIVES 233

CONCLUSIONS 235FUTURE PERSPECTIVES 237

APPENDIXPUBLISHED MANUSCRIPTS 239

01GENERAL

INTRODUCTION

29

General introduction Chapter 01

FELINE MAMMARY TUMOURS

Domestic animals spontaneously develop several diseases, namely cancer, that in many aspects parallel human morbidities, and hence are considered excellent natural models of disease [1]. Spontaneous feline mammary carcinomas have been proposed by the World Health Organiza-tion (WHO) as models for human breast cancer based on age of onset, incidence, histopathologic features, biologic behaviour, and prognosis [1-3].

Mammary neoplasia is the third most common type of tumour affecting female cats, following hematopoietic and skin tumours, accounting for 17% of all tumours in the species [2, 4], with 85 to 90% being malignant [1, 4, 5].

Queens have four pairs of mammary glands, two pairs of thoracic and two pairs of abdominal glands [6], localized at the ventral thoracic and abdominal walls [7]. The knowledge of vasculariza-tion and lymphatic communication of mammary glands is fundamental to understand the meta-static process in mammary tumours. A lymphatic network connects the glands of the same side and the ipsilateral lymph nodes, while in the vascular network some veins of the mammary glands cross the midline, eventually allowing for the metastatic dissemination between paired glands [8] (Figure 1).

30

Chapter 01 General introduction

Figure 1. (A) The four pairs of mammary glands in the cat, with their associated lymph nodes and lymphatic drainage. (B) Venous drainage of the mammary glands. (Adapted from Gimenez et al., (2010) [8]).

Feline mammary tumours develop as single or multiple nodules in different glands, the lat-ter being more frequent [3]. All four pairs of mammary glands can be affected, with studies reporting different location incidences [9-13].

Middle-age to old queens are most commonly affected with an average age at diagnosis of 10 to 12 years [2, 4, 10, 12, 14]. Although the vast majority of affected cats are females, ap-proximately 1-5% of the cases have been diagnosed in tom cats [5, 15], with no sex-related differences of biologic behaviour or clinical signs [15, 16]. Siamese, Oriental and Domestic shorthair cats appear to be associated to higher risk for the development of mammary neo-plasia [4, 5, 17].

The endocrine environment, defined by the length of exposure to sex hormones oestrogen and progesterone, has been suggested to have a role in the development of feline mam-mary carcinomas [18, 19]. In fact, cats spayed before six month and one year of age have been reported to have a 91% and 86% reduction risk for the development of the disease, when compared to intact cats [18]. The administration of progestogens to prevent oestrus

Thoracic 1

Thoracic 2

Abdominal 1

Abdominal 2

Axillary nodes

Sternal nodes

Accessory axillary nodes

Superficial inguinal nodes

(primary & accessory)

Lateral thoracic v.

Internal thoracic v.

Cranial epigastric v.

epigastric v.

Dorsal intercostal vv.

Azygos v.

31


increases the risk of mammary tumour development by a dose-related tumourigenic effect [19-21]. This outcome appears to be more evident if these drugs are given regularly for long periods of time rather than intermittently [20] and male cats are at a similar risk if treated with progestogens [22].

The clinical detection, by examination and palpation, of mammary nodules or masses is suggestive of mammary tumour diagnosis but fine needle aspiration may be helpful for ruling out skin and subcutaneous non-mammary malignancies and differentiate mammary carcinoma from fibroadenomatous hyperplasia [8]. Although studies revealed a good agree-ment between cytological and histological diagnosis in feline mammary carcinomas [12, 23], histopathology is needed to confirm the diagnosis, to classify the type of lesion, and to evaluate the extension of surgical margins [3, 12].

Clinical staging relies mostly on the modified tumour-node-metastasis (TNM) WHO staging system that includes the largest diameter of the primary tumour or tumours and the clinical evidence of invasiveness (fixation to skin or fascia), the status of the regional lymph nodes, and the detection of distant metastases [4, 24].

Tumour size has been significantly correlated to post-surgery survival, and consequently considered of prognostic importance [9, 14, 25]. Cats with mammary carcinomas larger than 3 cm in diameter have a poor prognosis, with median survival periods ranging from 4 to 12 months. However, tumour size alone is of limited prognostic value in tumours smaller than 3 cm in diameter, due to the wide range of median survival periods (6.8-54 months), so additional characteristics are needed for prognostic purposes [13].

Feline mammary carcinomas are characterized by rapidly growing, highly infiltrative and invasive lesions with extensive necrotic areas, skin ulceration and metastases [1, 2], fea-tures associated to poor prognosis [9, 12]. At the time of diagnosis, one quarter of queens with carcinomas have lymphatic and blood vessels invasion [2] and metastases are often detected, ultimately leading to high morbidity and mortality rates [3]. Metastasis to regional lymph nodes (83%), lungs (83%), pleura (22%) and liver (25%) are the most common, although the adrenal glands, diaphragm and kidneys have also been documented to be involved [5, 9, 11].

Histopathology and diagnosis

The WHO classification (Table 1) is the most widely accepted histological classification of feline mammary tumours [26]. More than 80% are classified histologically as carcinomas, with tubular, papillary, solid and cribriform being the most common specific types, although some carcinomas are a combination of more than one histological type in the same lesion [4, 9]. This classification is, however, more morphological than prognostic [26] and has a

32


limited prognostic value [9], although the distinction between in situ and infiltrative carcino-mas is of relevance [9, 26].

The Elston and Ellis histological grading system (also known as the Nottingham grading system) is used to determine the histological grade of primary breast carcinoma and with significant correlation with prognosis [27]. It is based on three major histopathologic fea-tures namely tubule formation, nuclear pleomorphism, and mitotic count [27]. Each feature is assessed and scored on a scale of 1 to 3 for a possible total of 3 to 9 points (Table 2).

Table 1. The WHO histological classification of mammary tumours of the cat (Misdorp et al., (1999) [26])

Mammary Hyperplasias/Dysplasias

Ductal hyperplasia

Lobular hyperplasia

Epithelial hyperplasia

Adenosis

Fibroadenomatous change (feline mammary hypertrophy, fibroepithelial hypertrophy)

Cysts

Duct ectasia

Focal fibrosis (fibroesclerosis)

Benign Tumours

AdenomaSimple adenoma

Complex adenomaFibroadenoma

Low-cellularity fibroadenoma

High-cellularity fibroadenomaBenign mixed tumour

Duct papiloma

Malignant Tumours

Noninfiltrating (in situ) carcinoma

Tubulopapillary carcinoma

Solid carcinoma

Cribriform carcinoma

Squamous cell carcinoma

Mucinous carcinoma

Carcinosarcoma

Carcinoma or sarcoma in benign tumour

Unclassified Tumours

33


The total score indicates the histological grade (I-III). The histological grade was allocated by an arbitrary division of the total points: grade I (well differentiated) 3, 4 or 5 points; grade II (moderately differentiated) 6 or 7 points; and grade III (poorly differentiated) 8 or 9 points [27]. This method has been widely adopted by veterinary pathologists/researchers for grading feline mammary carcinomas [28-31] and considered a reliable and independent prognostic factor, identifying groups of queens with distinct risk of developing metastatic disease as well as predicting overall and disease free survival [29, 30, 32]. Recently, Mills et al. (2015) designed three new grading systems: the mitotic-modified Elston and Ellis grading system (with subcategories within the mitotic count category), the revised Elston and Ellis grading system (that included nuclear form scoring and lymphovascular invasion) and a novel grading system (based solely on lymphovascular invasion, mitotic count and nuclear form). They defend that an adaptation of a species-specific system (as the ones they proposed) may improve the prognostic value of histological grading in feline mam-mary carcinomas [33]. A recent study conducted by Zappulli et al. (2015) considered that the most reliable prognostic factors in feline malignant mammary tumours are histological grade, presence of lymphovascular invasion and of lymph node metastases [34].

Therapy and prognosis

The most widely used treatment for feline mammary tumours is surgical excision, being uni-lateral or bilateral chain mastectomy with removal of the draining lymph nodes the method of choice [4, 17]. The therapeutic approach affects the prognosis, with uni or bilateral chain

Table 2. Summary of semi-quantitative method for assessing histological grade in feline mammary carcinoma (Elston and Ellis, (1998) [27])

Feature Score

Tubule formation

Majority of tumour (>75%)

Moderate degree (10-75%)

Little or none (<10%)

1

2

3

Nuclear pleomorphism

Small, regular uniform cells

Moderate increase in size and variability

Marked variation

1

2

3

Mitotic counts*

0-8 mitosis

9-18 mitosis

>19 mitosis

1

2

3

* Dependent on microscopic field area

34


mastectomy significantly increasing the disease-free interval, when compared to partial mastectomy, though the same effect has not been demonstrated for overall survival time [14, 25]. Although surgery remains the most widely accepted treatment for feline mammary tumours, it is not usually an effective treatment [8], and high rates of post-mastectomy re-currence or metastatic disease continue to be demonstrated [1, 2]. Survival after primary tu-mour detection averages 12 months in untreated cats, while the post-surgical survival times for cats treated with surgery alone are variable and depend on clinical staging [33, 34].

Due to low hormone receptor expression in feline mammary carcinomas, hormonal therapy does not appear to be beneficial [4, 8] and the benefit of using chemotherapy as an adjunct to surgical excision of mammary tumours in cats, is still not clear [3, 4, 17]. In cats with non-resectable local disease or distant metastatic disease treated with a combined protocol of doxorubicin and cyclophosphamide it was demonstrated partial responses [35, 36]. McNeil et al. (2009) have not find benefits of adjuvant-based doxorubicin in feline mammary car-cinomas compared to surgery alone [37]. Studies where doxorubicin-based chemotherapy was used alone [38] or with meloxicam [39], both as adjunct to surgical removal, reported similar median survival times not supporting the use of this treatment combination. Different immunomodulators have been studied in cell culture [40] and as adjuvant to surgical exci-sion [41], yet they have not been proved to have benefits as additional therapy in the feline mammary tumours treatment [40, 41]. Recently a study by Adelfinger et al. (2014) reported virotherapy, on the basis of oncolytic vaccinia virus infection, to be a promising candidate for therapy of feline mammary carcinoma patients. Despite progresses in the diagnosis and treatment of feline mammary cancer, overall patient treatment outcome has not been substantially improved [42].

One of the major challenges for the veterinary oncologist is to identify prognostic variables which allow for the prediction of disease behaviour in individual cases and to identify pa-tients that may benefit from adjunctive therapeutic modalities. Thus, the characterization of mammary tumours according to subsets with specific biologic behaviour is of clinical importance [3, 34, 43].

Molecular features

The search for prognostic and predictive factors in feline mammary tumours led to the study of the expression of molecules that, in combination with clinical and histological features, may be of importance in the identification of biological tumour aggressiveness [28, 34, 44, 45].

Steroid hormones are associated with the development of mammary tumours, as evidenced by the fact that normal and neoplastic mammary tissues have different expressions of hor-mone receptors (HR) [19, 46, 47]. Oestrogen receptor (ER) is present in most normal tis-

35


sues with a statistically significant progressive decrease in ER-positivity between normal tissue, dysplastic tissue, benign tumours and invasive carcinomas [48, 49]. The majority of feline mammary carcinomas are, therefore, characterized by a large proportion of ER-negative tumours [48, 49] and the ER-negative status has been associated with high histo-logical grades [48-50].

Oestrogens are known to stimulate the growth of both interlobular and intralobular ducts and to induce the expression of progesterone receptors [11]. Although in human breast cancer, progesterone receptor (PR) positivity is frequently related to ER expression and considered a good prognostic factor [51], its expression in feline mammary carcinomas is not necessarily a good indicator of the integrity of oestrogen receptor pathway, as several invasive feline carcinomas are ER-/PR+ [48, 52].

There is a progressive loss of HR expression from non-neoplastic to benign and from those to malignant tumours [28, 47, 53, 54]. However, Millanta et al. (2005) described that the expression of PR was significantly increased from healthy and dysplastic to neoplastic le-sions, with higher values in in situ carcinomas and a decrease in invasive tumours [48]. The ER and PR expressions are not currently assessed in feline mammary cancer, due to the lack of consensual data of the relation of hormone receptor status of the feline mammary tumours and prognosis [34, 48, 55, 56]. The lower expression of ER, when compared to PR, in feline mammary cancer and the overall lower HR status, when compared to human breast carcinomas [45, 57], led to the proposal of feline mammary cancer as a natural model of the non-hormone-dependent human mammary carcinomas [1, 47, 49, 58].

Ki-67 is a nuclear protein expressed in all the active phases of cell cycle. As it is only ex-pressed by cycling cells, the relative number of Ki-67-positive cells indicates the proportion of cells in proliferation at any given moment [34, 59]. There is generally a progressive in-crease of the Ki-67 index from normal mammary tissue to hyperplastic lesions and benign and malignant tumours, with the exception of fibroadenomatous lesions that exhibit very high proliferative activity, comparable to carcinomas [29, 31]. The Ki-67 index has been cor-related with histological grade [31, 50, 60], but not with histological type of feline mammary tumours [29, 31, 60]. Its prognostic value is debated, with some authors suggesting lack of prognostic significance [29, 43, 56, 61], while others defend that it is related with a more aggressive behaviour and smaller post-surgical survival times [60].

Other molecular markers have been investigated in feline mammary tumours in order to elucidate the pathways of tumour progression and assist in the determination of the prog-nosis. A wealth of literature exists on molecular markers, namely AgNOR [43, 62], PCNA [63], HER2 [45, 64-68], COX-2 [50, 69, 70], STAT [71], RON [72], TopBP1 [50], PTEN [73], Akt [54], p53 [50, 74, 75], VEGF [76], among others.

36


The main goal of prognostic studies is to identify and characterize reliable clinically applicable markers to establish a molecular-based model of tumour classification representing clini-cally distinct entities, as proposed for human breast cancer [77]. Recently, several studies were conducted aiming to contribute to such goal [28, 44, 45, 78]. Brunetti et al. (2013) characterized a series of 21 feline mammary carcinomas based on ER, PR, c-erB2, CK5,6, CK14, CK19 and p63 profiles, and primary tumours were classified as luminal B (52.4%), c-erbB2 overexpressing (38.1%) and basal-like (9.5%), with no association between his-tological diagnosis and molecular phenotypes. The authors described that the molecular phenotypes of the primary tumours were not always concordant with their corresponding lymph node metastasis, concluding that the evaluation of the molecular profile in both sites is crucial for the planning of effective therapy [44]. Wiese et al. (2013) evaluated a series of 24 feline mammary carcinomas based on the immunoexpression of ER, PR, HER2, CK5/6 and EGFR, revealing that feline mammary tumours were highly aggressive neoplasms, mostly triple negative and with nearly 80% displaying a basal-like subtype, pointing feline mammary tumours as a valuable natural occurring animal model for the study of human triple negative breast carcinomas (TNBCs) of the basal-like subtype [45]. Other study of 77 feline malignant mammary tumours conducted by Caliari et al. (2014) was based on ER, PR, HER2 and cytoplasmic filament expression, reported that feline mammary carcinomas are generally aggressive HR-negative neoplasms (85%) with heterogeneous phenotypes, characterized by basal cytokeratin and vimentin expression, sharing similar features with human TNBCs [28].

The expression of vimentin by neoplastic epithelial cells has also been described in feline mammary tumours and associated to epithelial to mesenchymal transition (EMT) [28, 79-82], although this abnormal expression failed to be associated to well-established features of malignancy, such as regional metastasis or tumour grade. Hence, it is plausible that the expression of vimentin may be regarded as a hallmark of carcinoma rather than a marker of invasive behaviour [81].

Most of the feline oncology studies are retrospective and lack survival data as it is often difficult to consistently and systematically follow these patients. The high methodological variability hampers the studies comparison and the establishment of consensual guidelines on the prognostic significance of many of these molecules expression. Several publications defend the need to standardize procedures in prognostic studies of spontaneous feline mammary tumours and to follow recommended guidelines in order to facilitate reproduc-ibility and assessment of results [34, 77, 83].

37


CELL ADHESION MOLECULES

Cell adhesion is essential for the arrangement of individual cells within the three-dimen-sional tissues architecture [84, 85]. Several cell adhesion mechanisms are responsible for assembling cells together and, along with their connections to the internal cytoskeleton, determine the overall architecture of the tissues [84]. The loss of cell-cell adhesion, which leads to loss of contact inhibition and escape from the growth control signals, is gener-ally present in human cancer, and is one of the initial steps in the invasion and metastatic cascade. These are followed by other gain or loss of cell characteristics that allows cancer cells to abandon the primary mass and invade the surrounding tissues, enter the circulation, lodge in distant vascular beds, extravasate into the target organ and proliferate. However, there is still a lack of clear understanding of metastatic process of dissemination in cancer patients [86, 87]. Moreover, cell-cell and cell-matrix adhesive interactions have a role in tumourigenesis, tumour progression, and metastasis [88, 89].

Cell adhesion molecules (CAMs) that mediate cell-to-cell adhesion, and substratum adhe-sion molecules (SAMs) that mediate adhesion between cell and extracellular matrix proteins, participate in events such as morphogenesis, differentiation, cell migration, and intercellular communication [88, 89]. CAMs have been classified in four major families: the immuno-globulin-like family, the integrin family, the cadherin family and the selectin family [90, 91]. Cadherins are members of a large family of transmembrane glycoproteins that mediate

38


calcium-dependent homotypic cell-cell adhesion. Cadherins play a role in cell sorting during embryogenesis and in the maintenance of specific organ and adult tissue architecture, as well as in several signaling pathways [85, 92-94]. The cadherin superfamily encompasses at least six sub-families based on the protein domain composition, genomic structure and sequences phylogenetic analysis. These sub-families comprise: classical cadherins or type I cadherins, atypical or type II cadherins, desmocollins, desmogleins, protocadherins and Flamingo cadherins [90].

39


CLASSICAL CADHERINS

The classical cadherins include CDH1/E-cadherin (epithelial), CDH2/N-cadherin (neuro-nal), CDH3/P-cadherin (placental) and CDH4/R-cadherin (retinal), designated according to their specific tissue distribution [90]. They are localized in the adherens junctions, which are responsible for the strong cell-cell adhesions that maintain the epithelial cell shape and po-larity and the homeostasis of normal adult epithelial tissues [95]. The cadherin subclasses display unique patterns of tissue distribution, with each cell type characterized by the ex-pression of a particular cadherin subclass or set of cadherin subclasses [92]. P-cadherin was originally identified as a highly expressed cadherin in the mouse, but not human, pla-centa throughout pregnancy [96, 97]. P-cadherin is expressed only in the basal or lower layers of normal stratified or pseudostratified epithelia with high proliferative potential, but not in simple epithelia, while E-cadherin is present in almost all epithelial tissues. This tis-sue distribution suggests a relationship between P-cadherin and the maintenance of the proliferative compartment, while E-cadherin seems to be associated with the formation and maintenance of epithelial tissues [98, 99].

Despite their distinct specificities, the cadherin subclasses have a common genetic back-ground [100, 101], and nearly 50% of their amino acids sequences, mostly in the cytoplas-mic domain, are conserved [102]. Moreover, homologous cadherin subclasses identified across species are generally well conserved [100]. The human epithelial E-cadherin is a

40


120kDa glycoprotein encoded by the gene CDH1 that maps to chromosome 16q22.1 [95, 103], while the human P-cadherin is a 118kDa glycoprotein, encoded by the gene CDH3 that is 32 kilobases upstream of the E-cadherin gene and shares 66% of homology with CDH1 [96, 104, 105].

The cadherin-catenin complex

E- and P-cadherin mature proteins are constituted by three major structural domains: an extracellular amino-terminal domain; a single pass transmembrane domain of anchorage to the cellular membrane and a cytoplasmic carboxy-terminal domain [85, 106] (Figure 2).

Figure 2. Schematic representation of structural components of the classical cadherin-catenin complex. Classical cadherins mediate calcium-dependent intercellular adhesion. They are composed by: an extracel-lular domain that interacts with the cadherin extracellular domain of adjacent cells to mediate cell adhesion through the extracellular sub-domain (EC1); a transmembrane domain; and a cytoplasmic domain. The latter domain comprises a juxtamembrane domain (JMD), which binds p120-catenin, and a catenin-binding domain (CBD), which binds β-catenin. α-catenin associates with β-catenin and is directly linked to the actin cytoskel-eton. (Adapted from Albergaria et al. (2011) [107])

The extracellular domain is directly responsible for the homotypic interaction that medi-ates cell-cell adhesion. It is composed by five repeated extracellular structural sub-domains (EC), which are sequences of 110 amino acids commonly designated as EC1–EC5 [92, 108, 109] (Figure 2). The EC1 domain is the main responsible for the molecule adhesive properties and specificity [110]. The normal conformation of the classical cadherins and their adhesion properties are dependent on the presence of Ca2+ in the extracellular domain [100, 111]. Calcium-binding sites consist of short highly conserved aminoacid sequences that are located between neighbouring EC repeats [92, 109]. Classical cadherins mediate the adhesion between adjacent cells by forming homodimers with identical molecules of adjacent cells and with cadherins in the same cell, by lateral clustering, forming lateral ho-modimers [112]. The intercellular binding is achieved through the formation of a cell surface

Intercellular space

Intracellulardomain

Extracellulardomain

Plasma membrane Cytoplasmic space

p120-catenin

-catenin

-catenin

actinJMD

Ca2+

EC5 EC4 EC3 EC2 EC1

Transmembranedomain

CBD

41


multimolecular structure with a “zipper-like” conformation that is a hallmark of the cadherins [113].

Cadherins connect indirectly to the actin cytoskeleton through their cytoplasmic domain, via a group of proteins, collectively known as catenins. The catenin family comprises α-, β-, γ- and p120-catenin [86, 114]. β-catenin is a 95 kDa protein that shares about 65 per cent identity with γ-catenin, an 82 kDa protein also named plakoglobin [106, 115]. Both catenins associate directly with classical cadherins in a mutually exclusive way and can substitute one another in the cadherin-catenin complex. α-catenin is a 102 kDa protein that indirectly associates with classical cadherins through its interaction with β or γ-catenin, mediating the interaction between the cadherin-catenin complex and the actin cytoskeleton [106, 115]. Additional proteins that provide a link between catenins and the actin cytoskeleton include ZO1, α-actinin and vinculin. P120-catenin binds to the cadherin juxtamembrane region, but does not link the complex with the actin cytoeskeleton [106, 116, 117]. Thus, the highly conserved cytoplasmic domain comprises two main domains: the juxtamembrane domain (JMD) that binds p120ctn, and the catenin-binding domain (CBD) that binds β- and γ-catenin [90]. The cytoplasmic domain contacts with the cytoskeletal components and regulates the cell-cell adhesion function of the extracellular domain [118-120] (Figure 2). In addition to the structural role in the adherens junction, catenins act to regulate the adhesive function of cadherins, since a cadherin-catenin complex integrity is indispensable for the proper cad-herin function and normal cell–cell adhesion [119, 121].

Besides their participation in the anchorage of E-cadherin to the actin cytoskeleton, caten-ins also have other cell functions [106]. α-catenin plays an important role in the regulation of several signalling pathways involved in cell proliferation, apoptosis, growth, migration and invasion, hence being considered a molecule with tumour suppressor function [122, 123]. β-catenin is involved in cell–cell adhesion by interacting with the cadherin cytoplasmic tail [124] and participates in cell signalling, in the Wnt signalling pathway [106, 124-127], regulating the transcription of genes involved in inhibition of apoptosis and promoting cel-lular proliferation and migration [86]. β-catenin is suggested to have a dual role as a tumour suppressor and as a oncogene in human cancer [86]. P120-catenin stabilizes the cadherin–catenin complex and modulates cadherin intracellular trafficking and cell stability, adhesive-ness and motility [128-131].

Besides the recognised adhesion functions, the cadherin-catenin complex is involved in major modulatory transcription mechanisms of specific genes, regulating several cellular processes such as proliferation, survival, polarization, differentiation, shape and migration [112, 132]. In this context, disorders of the molecules of the cadherin-catenin complex may affect the formation and maintenance of cellular and tissue integrity, and are involved in pathological events, such as cancer [94, 95, 99, 107, 133-135].

42


THE CADHERIN-CATENIN COMPLEX AND THE MAMMARY GLAND

The mammary gland is structurally composed by two layers of epithelium, an inner luminal cell layer and an outer myoepithelial cell layer, forming the mammary ducts and the terminal end buds [136]. Cap cells are localized at the tip of each terminal end bud that are thought to generate descendants cells of both myoepithelial and epithelial cell lineages [99, 107]. Two members of the cadherin family are expressed by the normal adult mature non-lactat-ing human mammary gland: E-cadherin is present in both luminal epithelial and myoepithe-lial cells [137-139], whereas P-cadherin is confined to the myoepithelium [137, 140, 141]. The interconnection between the luminal and the myoepithelial layers seems to be related to desmosomal cadherins (desmogleins and desmocollins) and are critical for establishing this bilayered arrangement [126] (Figure 3).

43


Figure 3. Schematic representation of the structure of the terminal mammary end bud and duct. (A) Cap cells, localized at the tip of terminal end bud, are P-cadherin positive. (B) Cross-section through the mammary duct. P-cadherin is expressed at sites of myoepithelial cell-cell contact in the adherens junctions and E-cadherin between luminal epithelial cells. Desmosomal cadherins link the two cell types. Basal/intermediate cells, which are a putative stem/progenitor population, are also indicated. (Adapted from Cowin et al., (2005) [126])

P-cadherin has an essential role in the development of mammary gland, particularly during ductal mammary branching, being expressed by the monolayer of cap cells at the terminal end buds [142] (Figure 3). P-cadherin mediated cell-cell interactions and signalling are regulatory determinants of the negative growth of the luminal epithelium, important for the maintenance of an undifferentiated state of normal mammary gland [143]. In normal mature non-lactating mammary gland, P-cadherin is expressed at sites of cell-cell contact by the myoepithelial [137, 142, 144], but not in the luminal epithelial cells [144, 145]. The selective expression of E- and P-cadherin is necessary for the correct architecture of normal breast, with epithelial cells facing the lumen and myoepithelial cells facing the basement membrane [142, 146].

During late pregnancy and lactation, P-cadherin is present in human mammary luminal epithelial cells, but not at the cell-cell border, as expected for a cadherin. It moves into the cytoplasm, at the apical surface of epithelial cells, the typical distribution of a secreted protein. This observation suggests that, during lactation, P-cadherin is secreted by luminal epithelium [145] (Figure 4). In fact, a soluble fragment of P-cadherin (sP-cad) with 80kDa, which corresponds to the extracellular domain of the molecule, was found in human milk at significant higher concentrations when compared to the levels found in serum [145, 147, 148]. There are currently some theories trying to explain this secretion, namely that sP-cad has a role in the alveolar differentiation during lactation, in the immune response of the mother or the infant, or has a signalling role between epithelial and myoepithelial cells, but its function in normal breast is still not clear [107, 145, 147].

Stromal cellsBody cellsCap cells Myoepithelial cells

Epithelial luminal cells

E-cadherin P-cadherin

Basal/ intermediate cell

Desmosomalcadherins

(P-cad+) (E-cad+)

44


Figure 4. During late pregnancy and lactation, P-cadherin is present in human mammary luminal epithelial cells. Secretory cells in the breast alveoli become P-cadherin positive at the cytoplasm, and secrete a soluble form of this protein (sP-cad) that is detected in the milk. (Adapted from Albergaria et al., (2011) [107]).

E-cadherin and breast cancer

E-cadherin, the prototype member of the classical cadherin family, is the predominant cadherin of the adherens junctions in most epithelial cells with paramount importance in maintaining cell polarity and epithelial integrity [87, 95]. The suppression of E-cadherin ex-pression is regarded as one of the main molecular events responsible for the dysfunction of cell-cell adhesion [95]. Besides its function in normal cells, it can play a major role in malignant cell transformation, tumour development and progression [95, 114, 149]. In fact, the E-cadherin gene can act as an invasion and tumour suppressor, and its alterations have been associated with dedifferentiation, invasiveness and metastasis of tumour cells [87, 95, 114, 150, 151]. In breast carcinoma several studies reported alterations of the E-cadherin expression, particularly partial or total loss [152-159].

Infiltrating ductal breast carcinomas, the predominant histological subtype of breast cancer, show no significant reduction of E-cadherin expression, while the less prevalent infiltrating lobular carcinoma has significantly reduced or absent expression of the molecule [114, 141, 156, 159-161].

Loss or down-regulation of E-cadherin, along the multistage carcinogenesis, can occur by several different mechanisms, both irreversible and reversible, including genetic and epi-genetic events [162, 163], and the prevalence of each phenomenon is related to the his-tological subtype of breast cancer [126]. Lobular breast carcinomas have been associated with germline mutations of the E-cadherin gene [116, 164, 165]. The loss of heterozygoty (LOH) at 16q22.1, which involves the E-cadherin gene CDH1, is frequently combined with

Alveoli sP-Cad

Milk

45


mutations (nearly 50%) or epigenetic silencing of the remaining allele [114, 126, 160, 166, 167]. Ductal breast carcinomas often show LOH at 16q but lack mutational inactivation of the remaining CDH1 allele [114, 160]. These evidences suggest that the E-cadherin dys-function results from a two-hit mechanism, as occurs in the classical tumour suppressor genes [162, 168]. However, the majority of malignant carcinomas lack mutations in this gene [116], signifying that other mechanisms are responsible for the protein expression alterations [86, 166, 169, 170], namely epigenetic silencing such as hypermethylation of the CDH1/E-cad promoter [162, 163, 171-173] or by transcription modulators [116, 124, 126, 139, 164, 174] or even controlled post-transcriptionally [175].

Alternative mechanisms that have been suggested to play a role in the regulation of tumour cell adhesion include alterations in the composition of the cadherin-catenin complex, phos-phorylation of its components, alterations of the interaction of the complex with the actin cytoskeleton and N-glycosylation of E-cadherin [106, 117, 176]. Phosphorylation of the cad-herin-catenin complex [86, 106, 162, 177-179] or reduced expression of either α-catenin, β-catenin or plakoglobin (γ-catenin) may result in disruption of the intercellular adhesion and acquisition of the invasive phenotype, that is independent of the E-cadherin expression [92, 177, 179-181].

Although stromal and vascular invasion is facilitated by the down-regulation of E-cadherin, the retention of its expression and adhesive properties seems to confer an advantage once the vasculature has been entered. There is some evidence that a “switch on-switch off” dynamic process regulates loss or gain of cell–cell adhesion [182] and transient E-cadherin down regulating mechanisms may be involved in malignant tumours without irreversible inactivation of the E-cadherin gene [114]. In fact, the expression of E-cadherin in metastatic lesions is frequently different from that of the primary tumour, with both E-cadherin-positive and E-cadherin-negative metastatic lesions being reported [116, 183], while the levels of E-cadherin are increased in intravascular breast cancer cells [116]. It is possible that tempo-rary or localized downregulation of E-cadherin expression or function promotes the detach-ment of cells from the primary tumour and invasion of the local environment [164], whereas its re-expression favours survival of intravascular and metastatic cancer cells [116].

There are conflicting reports regarding the relationship between E-cadherin expression and pathological features and prognostic factors. One study revealed a relationship be-tween E-cadherin and tumour size [174], while others failed to demonstrate this association [139, 156, 184]. A reduced E-cadherin expression was related to high histological grades by some authors [139, 156, 159, 174], while others were unable to find such association [184]. A correlation between loss of E-cadherin and the presence of nodal metastases was found by some investigators [174], but this has not been widely reported [139, 156, 184, 185]. Some evidence in the breast cancer literature relates a reduction in E-cadherin ex-pression to poor outcome [139, 161], whilst other studies reveal no independent value for the E-cadherin status over established prognostic factors [139, 184, 186]. Indeed, there are

46


studies reporting strong E-cadherin immunostaining of tumours affecting patients with poor survival and of cells in the most aggressive forms of breast cancer [185, 187, 188]. There-fore, the expression of E-cadherin in human breast cancer as an independent predictor of tumour behaviour seems, at this time, unsubstantiated. However, some authors postulated that it has a value as a phenotypic marker, particularly in the distinction between lobular and ductal carcinomas [139, 141].

Catenins and breast cancer

It is important to notice that E-cadherin immunoreactivity does not always imply the pres-ence of a functionally normal cadherin-catenin complex [86], and that a reduced cell–cell adhesion may be present in an apparently preserved membrane-bound cadherin tumour [185]. Thus, to predict tumour invasion and metastasis in carcinomas, it is useful to inves-tigate not only the expression of E-cadherin but also the expression of the catenins [86]. In fact, the simultaneous expression of E-cadherin and one of the catenins has been pointed to be of higher prognostic value than the evaluation of each molecule individually [182].

Abnormal α-catenin expression (such as reduced membrane expression and cytoplasmic or nuclear location) has been described in breast cancer [183, 189-191] and several reports documented an association between down-regulation or loss of α-catenin and high tumour grades [123], metastasis [123, 182, 189] and poor survival [123], raising the possibility that it may be considered a prognostic marker. Loss of membrane-bound β-catenin, as well as its cytoplasmic or nuclear expression, have been described in human breast cancer [182, 189, 192-194], suggesting that upstream elements of the Wnt and/or other pathways that stabilize β-catenin are deregulated in breast cancer [195]. However, the prognostic value of β-catenin in breast cancer has not been clarified, with different studies revealing contradic-tory results [122, 159, 182, 186, 189, 196]. P120-catenin is thought to play a dual role in breast carcinogenesis, acting as a tumour/metastasis suppressor or as an oncogene/me-tastasis promoter when found in the cell membrane or when translocated to the cytoplasm, respectively [130, 131].

P-cadherin and breast cancer

P-cadherin has been reported to be altered in various human tumour models, but its effective role in the carcinogenesis process remains elusive, as it seems to behave differently de-pending on the tumour cell model and context. In colorectal cancer and melanoma tumour cell models, P-cadherin has been suggested to act as an invasion suppressor [197-199], while in several other models, namely breast, bladder, pancreas, gastric, endometrial and ovarian cancer, P-cadherin behaves as an oncogene [198, 200-206].

47


In breast carcinomas, the luminal epithelial aberrant expression of P-cadherin is character-ized by a simultaneous membranous and cytoplasmic expression and has been described in 20–50% of invasive ductal carcinomas [99, 137, 140, 144, 186, 207], as well as in 25% of ductal carcinomas in situ (DCIS) [99, 137, 203]. In fact, the majority of P-cadherin posi-tive tumours are invasive ductal carcinomas, or carcinomas with metaplastic or medul-lary features (carcinosarcomas and sarcomatoid breast carcinomas) [144, 208, 209], which supports a myoepithelial/basal cell histogenic origin or line of differentiation for these neo-plasms [208, 210]. However, no significant correlation was observed between this cell ad-hesion protein and a specific breast cancer histological type [144, 208-210].

P-cadherin expression has been positively associated with poorly differentiated and high histological grade carcinomas [137, 140, 144, 186, 207, 209, 211, 212] and with high pro-liferation indexes [144, 209]. However, it was not related to tumour size and lymph node metastasis [144, 186, 209]. In the clinical setting, abnormal P-cadherin expression in mam-mary carcinomas is associated with poor prognosis [99, 144, 186, 207, 209, 213], with a relation with shorter overall survival [144, 186, 196, 214] and disease-free survival [196, 214, 215].

P-cadherin has been extensively studied in breast cancer, but the mechanisms that regulate its expression are still poorly known. Mechanisms regulating CDH3/P-cad are essentially at the promoter region. It is known that the CDH3 promoter can be activated through direct binding of several transcription factors, leading to P-cadherin overexpression [216-219].

One of the important activators of the CDH3 promoter is p63, a p53-family related transcrip-tion factor and a key regulator of the adhesion and survival of the mammary gland basal cells [220]. In a non-cancer model, P-cadherin revealed to be a direct p63 transcriptional target, denoting a functional relationship between these two molecules [219]. In fact, p63 is co-expressed with P-cadherin in the basal layer of stratified and pseudo-stratified epithelia [221].

β-catenin is also associated with the CDH3 promoter activation and P-cadherin expression in basal mammary epithelial cells, suggesting that a β-catenin-dependent modulation of P-cadherin expression can contribute to the establishment of the basal phenotype [216]. Both P-cadherin and the transcription factor CCAAT/enhancer binding protein β (C/EBPβ) are co-localized in breast cancer cells, indicating a physical interaction between this tran-scription factor and the CDH3 gene promoter [217]. C/EBPβ was able to activate the CDH3 promoter in breast cancer cells and high levels of C/EBPβ have been associated with tu-mour progression and unfavourable prognostic factors in breast cancer [218].

Conversely, some regulators of the CDH3 gene promoter act as repressors of the P-cad-herin expression, namely the BRCA1/c-Myc-complex. In BRCA1-deficient hereditary tu-mours there is no repression of CDH3 and consequently there is P-cadherin expression

48


[222]. Moreover, the expression profiling of BRCA1-deficient hereditary tumours has identi-fied a pattern of gene expression that is similar to human basal-like breast tumours, strongly associated with P-cadherin expression [107, 223-225].

ER is also a CDH3 repressor and the absence of ER-signalling leads to an increased P-cadherin expression [204]. In fact, P-cadherin positive breast tumours are essentially ER-negative [204, 211, 212, 226]. Moreover, when ER-positive breast cancer cells are treated with anti-oestrogens, a specific transcription site of the CDH3 promoter suffers chromatin remodelling exposing it to transcription regulators and leading to P-cadherin overexpres-sion. Thus, selective ER modulators and anti-oestrogens can induce expression of normally repressed genes, thus playing an important role in the capacity of breast cancer cells to evade their growth inhibitory effects, and contribute, in the appropriate context, to a breast cancer cell invasive phenotype [218].

Besides the epigenetic regulation through promoter chromatin remodelling [218], it is likely that CDH3 can be regulated by other epigenetic events, such as methylation [144]. Nor-mal P-cadherin-negative breast epithelial cells showed methylation of the P-cadherin gene, while hypomethylation of a specific region of the CDH3 promoter was significantly associat-ed to P-cadherin overexpression in breast cancer [144]. Methylation of the P-cadherin gene promoter in breast cancer may be regarded as a novel therapeutic approach to silence its expression and, consequently, block tumour progression [144].

The mechanisms by which P-cadherin overexpression in breast cancer cells promotes the oncogene-associated effects such as increased motility, migration and invasiveness remain poorly known [204, 227]. A significant association between P-cadherin overexpression and the invasive capacity of breast cancer cells that maintain the wild-type E-cadherin expres-sion was reported [227]. Moreover, P-cadherin promotes oncogenic-associated events by inducing the secretion of matrix metalloproteinases, such as MMP-1 and MMP-2, leading to the cleavage of its extracellular domain, thus producing a soluble P-cadherin fragment (sP-cad) that is able to induce and maintain the secretion of active MMPs. Furthermore, sP-cad has a critical role in the induction of invasion of breast cancer cells co-expressing both cadherins [227]. Recently, Ribeiro et al. (2013) described that the P-cadherin ability to in-duce breast cancer cell invasion is dependent on the expression of E-cadherin [228]. When co-localized with E-cadherin, P-cadherin was able to promote cell invasion by disrupting the interaction between E-cadherin and both p120- and β-catenin [228]. E- and P-cadherin co-expression by breast cancer cells significantly enhanced in vivo tumour growth [228]. Moreover, aberrant P-cadherin expression in E-cadherin positive tumours was also associ-ated with p120-catenin cytoplasmic expression and activation of signalling pathways, alter-ing the actin cytoskeleton polymerization and promoting cell migration and motility [229]. It is also known that the pro-invasive activity of P-cadherin is dependent on the presence of its intact juxtamembrane domain, more specifically the binding site of p120-catenin [204]. These findings clarify the mechanisms associated to cell invasion and may explain the rela-

49


tion between E- and P-cadherin co-expression and high-grade breast carcinomas, biologi-cally aggressive and with poor patient survival, being this co-expression suggested a strong prognostic factor in breast cancer [228, 229]. Recently, it was described a positive relation-ship between P-cadherin, the laminin receptor α6β4 integrin and the adhesion of breast cancer cells to extracellular matrix. Moreover, there was a crosstalk between P-cadherin and the laminin oncogenic signalling pathways in the induction of cancer cell invasion and survival [230].

P-cadherin as a potential therapeutic target

In contrast with the significant low levels of P-cadherin in several normal tissues [206], overexpression of the protein is frequently observed in various malignant tumours, including breast, endometrial, colorectal and pancreatic carcinomas [144, 200, 205, 206, 231]. Thus, interruption of P-cadherin signalling may represent a potential novel therapeutic approach for cancer therapy [232, 233].

The human monoclonal antibody against P-cadherin (PF-03732010) is a highly specific and selective antibody, able to interrupt P-cadherin signalling pathway in a large panel of P-cadherin overexpressing tumour models, including mammary cancer models. In xeno-graft model, PF-03732010 resulted in inhibition of growth and metastatic progression of high P-cadherin expression tumours, with no apparent adverse effects [232]. PF-03732010 negatively modulates P-cadherin and β-catenin membrane levels and suppresses cyto-plasmic vimentin, resulting in antiproliferation and metastatic activities, as well as increased apoptosis [232]. More recently, Bernardes et al. (2013) reported that azurin, a small copper bacterial protein, acts as an anticancer agent in vitro and promotes tumour regression in xe-nografted mice [234]. Azurin decreased membranous P-cadherin expression and presented anti-invasive effects in P-cadherin overexpressing breast cancer cells, with no interference with the expression of E-cadherin [234]. The effects of azurin may be related to a decreased MMP-2 activity and reduction of the sP-cad levels [234]. Thus, the use of azurin and/or PF-03732010 may constitute new therapeutic strategies to treat aggressive breast carcinomas overexpressing P-cadherin in a wild type E-cadherin context.

P-cadherin aberrant expression is associated to hypoxic/glycolitic and acid-resistant phe-notypes in breast cancer carcinomas, and seems to have a role in the metabolic repro-gramming of breast cancer cells that may be responsible for tumours aggressiveness and resistance to standard therapies [235].

50


Cadherins and epithelial to mesenchymal transition (EMT)in breast cancer

The epithelial to mesenchymal transition (EMT) is a multistep program in which epithelial cells lose their epithelial characteristics and acquire properties that are typical of mesen-chymal cells [236, 237]. One of the hallmarks of this process is the cadherin switch, charac-terized by a modification of the expression of cadherins, from those expressed in epithelial cells to those expressed mainly in mesenchymal cells. There is a progressive downregu-lation of the cell-cell adhesion epithelial-specific proteins (e.g. E-cadherin) and de novo expression of mesenchymal markers (e.g. vimentin, N-cadherin), resulting in numerous phenotypical changes, such as the loss of cell-cell adhesion and cell polarity and acquisition of migratory and invasive properties [124, 236-238].

In cancer, the EMT process leads to the development of cells that are chemoresistant, able to escape to immune cells and with stem cell properties that support tumour cell migration, resis-tance to apoptosis, invasion and metastatic dissemination [236, 237]. Cancer cells that have gone through EMT migrate to a secondary site in the body where they sometimes go through mesenchymal to epithelial transition (MET), reverting to a more epithelial phenotype [124].

There are, however, examples of highly aggressive and invasive tumours, such as basal-like tumours, where the expression of E-cadherin is rarely lost, and overexpression of other classical cadherins, namely P-cadherin, is observed [213, 228, 229, 237]. Most cancer cells undergo partial EMT, an intermediate state in which they retain epithelial characteristics but gain some migratory ability [237]. The end result is a group of cells with particular character-istics, such as collective cell migration and invasive potential associated with the acquisition of stem cell properties [228], the so called “metastable phenotype” [228, 237]. Thus, Ribeiro et al. (2015) consider that P-cadherin may also be used as an EMT marker, mainly to iden-tify intermediate and transient EMT state associated with a metastable phenotype [237]. In fact, they defend a three-protein EMT signature (E-, P-cadherin and vimentin) where P-cadherin identifies an intermediate stage between the epithelial and mesenchymal phe-notypes [237]. In human breast cancer, some authors stated that the expression of vimentin represents one of the first steps in tumour progression and that vimentin-positive cells are prone to develop subsequent EMT changes, such as loss of cadherins [239].

In human breast cancer, gene profiling provided a molecular classification into different subtypes of invasive breast carcinoma: luminal A, luminal B, normal breast-like, HER2-overexpressing and basal-like [240, 241]. This classification revealed subtypes of breast cancer with distinct clinical behaviours, namely the basal-like breast cancer (BLBC) that is of particular clinical interest. Currently there is no known effective therapy for BLBC, hence this subtype is considered to imply a poorer prognosis [214, 225, 242]. Most BLBC are triple negative (ER-/PR-/HER2-) and several additional markers have been proposed for its precise immunohistochemical identification, a work still in progress [243]. The most com-

51


monly used markers are ER, PR and HER2, together with EGFR or CK5/6, but additional markers such as basal cytokeratins, P-cadherin, vimentin, and p63, have been suggested to improve the sensitivity panel for identifying BLBC [99, 153, 209, 213, 214, 223, 225, 242, 244-246].

There are evidences supporting the concept that a subset of cancer cells, the cancer stem cells (CSCs), are responsible for tumour heterogeneity, resistance to therapy (radiation and chemotherapy), relapse and metastasis [107, 237, 247]. The identification and analysis of those CSCs are mandatory especially in carcinomas with high patient mortality rate, early relapses, and lack of a targeted therapy, such as BLCB [247]. Besides being considered one of the biomarkers of BLBC, P-cadherin has been pointed as a good marker in the identifica-tion of basal-like breast cancer cells with stem cell properties [107, 235, 237, 247]. Vieira et al., (2012) found that the inhibition of P-cadherin sensitizes cancer cells to x-ray-induced death [247]. Thus, future therapies to the aggressive BLBC can eventually involve the target-ing of P-cadherin of CSCs and possible improve radiation therapy in those patients [237].

Cadherin fragments in body fluids

The cleavage of the external domain of cadherins is a normal part of their cellular turnover and not an event typically associated with cancer [147, 248-250]. The ectodomain shedding generates soluble 80kDa fragments of E-cadherin (sE-cad) and P-cadherin (sP-cad) [227], released in the extracellular space [148, 250]. However, the increased protein ectodomain shedding is a process that has also been suggested to be associated to cancer progression as a consequence of the general increased proteolysis that characterizes most neoplasms [147, 148]. Although the mechanisms and regulation of the cadherin extracellular domain fragment release are not fully understood, they involve proteases, namely matrix metallo-proteinases [148].

It has been suggested that the cadherin fragments levels in circulation could be useful as a non-invasive tools for cancer diagnosis [147, 148], however there is no consensus about the clinical significance of serum sE-cad and sP-cad levels in patients with cancer [148, 250-253].

Serum levels of sE-cad are known to be increased in patients affected by cancer (e.g., breast, gastric, and colorectal cancers) when compared to healthy persons [249, 250, 252-254]. In breast cancer patients, high serum levels of sE-cad have been associated with TNM stage, tumour grade, lymph node metastases, overall survival and disease-free survival in breast cancer [250, 253, 255]. In contrast, Knudsen et al. (2000) failed to demonstrate a correlation between serum levels of this cadherin and the presence of breast cancer [148]. Considering the serum sP-cad levels, it was reported no significant differences among no-cancer and breast cancer patients [147, 148].

52


THE CADHERIN-CATENIN COMPLEX IN FELINE MAMMARY TISSUES

Only a small number of studies have assessed the expression of cadherins in feline mam-mary tumours [81, 256-258] and research concerning catenins are scarcer and restricted to β-catenin [81, 259].

In normal feline mammary glands, E- and P-cadherin have distinct expression patterns. E-cadherin is expressed at the cell-cell boundaries in luminal epithelial cells and there is no myoepithelial membranous expression [257, 259], while P-cadherin is restricted to myo-epithelium [256]. The expression of β-catenin is membranous in the luminal epithelial cells [259].

In hyperplastic lesions and benign neoplasms, the expression of E-cadherin changes from an exclusive membranous expression to a simultaneous cytoplasmic staining in the luminal epithelium and cytoplasmic staining in the myoepithelium [257]. Such changes in the E-cad-herin pattern have been particularly significant in malignant tumours, where a reduced or no membranous expression parallels cytoplasmic staining [81, 257-259]. E-cadherin expres-sion was demonstrated to be lowest in tubulopapillary [259], cribriform and solid carcino-mas [257], although the statistical significance of such differences was never assessed. No

53


significant association with tumour grade has been described, and it has been claimed that a preserved expression of E-cadherin is a significant feature of non-metastatic carcinomas [81], while others failed to find associations between the protein expression and survival, recurrence or metastases [259]. When studies were extended to β-catenin, although all samples exhibited a membranous expression there was a significant decrease and cyto-plasmic translocation in malignant tumours and metastases when compared with normal tissues, hyperplastic/dysplastic lesions and benign tumours. No relationship has been dem-onstrated with histological grade, survival, recurrence or metastases [259]. Penafiel-Verdu et al. (2012) revealed that the preserved expression of E-cadherin and β-catenin are sig-nificant features of non-metastatic carcinomas, whereas carcinomas with metastasis loose one or both adhesion molecules [81]. The membrane labelling intensity and scoring were higher in primary tumours than in metastases for both E-cadherin and β-catenin, while the cytoplasmic expression of the two molecules increased in metastases compared with primary tumours [259]. An association was also found between the combined E-cadherin and β-catenin preservation and tumour grade, with grade I carcinomas preserving the ex-pression of both molecules [81]. The association between the combined preservation of E-cadherin and β-catenin and metastasis was stronger than that of each individual biomarker, suggesting that the former combination would be a better prognostic factor than E-cadherin alone [81].

To the best of our knowledge, only our group assessed the expression of P-cadherin in feline mammary tumours. In a series of feline mammary normal tissues and mammary le-sions, we observed that the expression pattern of P-cadherin in hyperplastic and benign feline mammary lesions was similar to that of normal mammary gland, being restricted to myoepithelial cells [256]. The molecule has been aberrantly expressed in epithelial cells of malignant tumours, with a membranous and cytoplasmic staining pattern observed pre-dominantly in cells of the tumours periphery and in invading cellular nests [256]. In these tumours, P-cadherin expression was related to histological grade, although no relationship was observed with histological type [256].

54


REFERENCES

1. Martín De Las Mulas J, Reymundo C, 2000. Animal models of human breast carci-noma: canine and feline neoplasms. Revista de Oncología, 2:274-281.

2. Misdorp W, Weijer K, 1980. Animal model of human disease: breast cancer. Am J Pathol, 98(2):573-576.

3. Zappulli V, De Zan G, Cardazzo B, Bargelloni L, Castagnaro M, 2005. Feline mam-mary tumours in comparative oncology. Journal of Dairy Research, 72(S1):98.

4. Sorenmo KU, Worley DR, Goldschmidt MH, 2013. Tumours of the Mammary Gland. In: WITHROW, S. J., VAIL, D. M. & PAGE, R. L. (eds.) Withrow & MacEwen´s Small Animal Clinical Oncology. 5th edition ed. Missouri: Elsevier Saunders.

5. Hayes HM, Jr., Milne KL, Mandell CP, 1981. Epidemiological features of feline mam-mary carcinoma. Vet Rec, 108(22):476-479.

6. Barone R, 2001. Chapitre IV - Mamelles. Anatomie Comparée des Mammifères Domestiques. Troisiéme Edition ed.

7. Bevier D, 1993. Integumentary System. In: HUDSON, L. P. H., W.P. (ed.) Atlas of feline anatomy for veterinarians Philadelphia: W.B. Saunders Company.

8. Gimenez F, Hecht S, Craig LE, Legendre AM, 2010. Early detection, aggressive therapy: optimizing the management of feline mammary masses. J Feline Med Surg, 12(3):214-224.

9. Weijer K, Hart AA, 1983. Prognostic factors in feline mammary carcinoma. J Natl Cancer Inst, 70(4):709-716.

55


10. Weijer K, Head KW, Misdorp W, Hampe JF, 1972. Feline malignant mammary tumors. I. Morphology and biology: some comparisons with human and canine mammary car-cinomas. J Natl Cancer Inst, 49(6):1697-1704.

11. Hahn KA, Bravo L, Avenell JS, 1994. Feline breast carcinoma as a pathologic and therapeutic model for human breast cancer. In vivo, 8(5):825-828.

12. Amorim FV, Souza HJ, Ferreira AM, Fonseca AB, 2006. Clinical, cytological and his-topathological evaluation of mammary masses in cats from Rio de Janeiro, Brazil. J Feline Med Surg, 8(6):379-388.

13. Viste JR, Myers SL, Singh B, Simko E, 2002. Feline mammary adenocarcinoma: tumor size as a prognostic indicator. Can Vet J, 43(1):33-37.

14. Ito T, Kadosawa T, Mochizuki M, Matsunaga S, Nishimura R, Sasaki N, 1996. Progno-sis of malignant mammary tumor in 53 cats. J Vet Med Sci, 58(8):723-726.

15. Skorupski KA, Overley B, Shofer FS, Goldschmidt MH, Miller CA, Sorenmo KU, 2005. Clinical characteristics of mammary carcinoma in male cats. J Vet Intern Med, 19(1):52-55.

16. Gregorio H, Pires I, Seixas F, Queiroga F, 2012. Mammary invasive micropapillary carcinoma in a male cat: Immunohistochemical description and clinical follow-up. Acta Vet Hung, 60(2):257-261.

17. Novosad CA, 2003. Principles of treatment for mammary gland tumors. Clin Tech Small Anim Pract, 18(2):107-109.

18. Overley B, Shofer FS, Goldschmidt MH, Sherer D, Sorenmo KU, 2005. Association be-tween ovarihysterectomy and feline mammary carcinoma. J Vet Intern Med, 19(4):560-563.

19. Rutteman GR, Misdorp W, 1993. Hormonal background of canine and feline mammary tumours. J Reprod Fertil Suppl, 47:483-487.

20. Misdorp W, Romijn A, Hart AA, 1991. Feline mammary tumors: a case-control study of hormonal factors. Anticancer Res, 11(5):1793-1797.

21. Misdorp W, 1991. Progestagens and mammary tumours in dogs and cats. Acta Endocrinol (Copenh), 125 Suppl 1:27-31.

22. Jacobs TM, Hoppe BR, Poehlmann CE, Ferracone JD, Sorenmo KU, 2010. Mammary adenocarcinomas in three male cats exposed to medroxyprogesterone acetate (1990-2006). J Feline Med Surg, 12(2):169-174.

23. Shafiee R, Javanbakht J, Atyabi N, Bahrami A, Kheradmand D, Safaei R, Khadivar F, Hosseini E, 2013. Comparative value of clinical, cytological, and histopathological fea-tures in feline mammary gland tumors; an experimental model for the study of human breast cancer. Diagn Pathol, 8:136.

24. Von Euler H, 2011. Tumours of the mammary glands. In: DOBSON, J. M. & LAS-CELLES, B. D. (eds.) BSAVA Manual of Canine and Feline Oncology. 3rd Edition ed. Gloucester: BSAVA British Small Animal Veterinary Association.

25. Macewen EG, Hayes AA, Harvey HJ, Patnaik AK, Mooney S, Passe S, 1984. Prognos-tic factors for feline mammary tumors. J Am Vet Med Assoc, 185(2):201-204.

26. Misdorp W, Else RW, Hellmén E, Lipscomb TP, 1999. Histological Classification of

56


Mammary Tumors of the Dog and the Cat., Washington, D.C. USA, WHO, Armed Forces Institute of Pathology, American Registry of Pathology.

27. Elston CW, Ellis IO, 1998. Assessment of histological grade. In: ELSTON, C. W. & ELLIS, I. O. (eds.) The Breast. Systemic pathology. Third Edition ed. Edinburgh: Churchill-Livingstone.

28. Caliari D, Zappulli V, Rasotto R, Cardazzo B, Frassineti F, Goldschmidt MH, Castagn-aro M, 2014. Triple-negative vimentin-positive heterogeneous feline mammary carci-nomas as a potential comparative model for breast cancer. BMC Vet Res, 10(1):185.

29. Millanta F, Lazzeri G, Mazzei M, Vannozzi I, Poli A, 2002. MIB-1 Labeling index in fe-line dysplastic and neoplastic mammary lesions and its relationship with postsurgical prognosis. Vet Pathol, 39(1):120-126.

30. Castagnaro M, Casalone C, Bozzetta E, De Maria R, Biolatti B, Caramelli M, 1998. Tumour grading and the one-year post-surgical prognosis in feline mammary carcino-mas. J. Comp. Path., 119:263-275.

31. Dias Pereira P, Carvalheira J, Gartner F, 2004. Cell proliferation in feline normal, hy-perplastic and neoplastic mammary tissue-an immunohistochemical study. Vet J, 168(2):180-185.

32. Seixas F, Palmeira C, Pires MA, Bento MJ, Lopes C, 2011. Grade is an independent prognostic factor for feline mammary carcinomas: a clinicopathological and survival analysis. Vet J, 187(1):65-71.

33. Mills SW, Musil KM, Davies JL, Hendrick S, Duncan C, Jackson ML, Kidney B, Philibert H, Wobeser BK, Simko E, 2015. Prognostic value of histologic grading for feline mam-mary carcinoma: a retrospective survival analysis. Vet Pathol, 52(2):238-249.

34. Zappulli V, Rasotto R, Caliari D, Mainenti M, Pena L, Goldschmidt MH, Kiupel M, 2015. Prognostic evaluation of feline mammary carcinomas: a review of the literature. Vet Pathol, 52(1):46-60.

35. Jeglum KA, Deguzman E, Young KM, 1985. Chemotherapy of advanced mammary adenocarcinoma in 14 cats. J Am Vet Med Assoc, 187(2):157-160.

36. Mauldin GN, Matus RE, Patnaik AK, Bond BR, Mooney SC, 1988. Efficacy and toxic-ity of doxorubicin and cyclophosphamide used in the treatment of selected malignant tumors in 23 cats. J Vet Intern Med, 2(2):60-65.

37. Mcneill CJ, Sorenmo KU, Shofer FS, Gibeon L, Durham AC, Barber LG, Baez JL, Over-ley B, 2009. Evaluation of adjuvant doxorubicin-based chemotherapy for the treatment of feline mammary carcinoma. J Vet Intern Med, 23(1):123-129.

38. Novosad CA, Bergman PJ, O'brien MG, Mcknight JA, Charney SC, Selting KA, Gra-ham JC, Correa SS, Rosenberg MP, Gieger TL, 2006. Retrospective evaluation of adjunctive doxorubicin for the treatment of feline mammary gland adenocarcinoma: 67 cases. J Am Anim Hosp Assoc, 42(2):110-120.

39. Borrego JF, Cartagena JC, Engel J, 2009. Treatment of feline mammary tumours using chemotherapy, surgery and a COX-2 inhibitor drug (meloxicam): a retrospective study of 23 cases (2002-2007). Vet Comp Oncol, 7(4):213-221.

40. Penzo C, Ross M, Muirhead R, Else R, Argyle DJ, 2009. Effect of recombinant feline

57


interferon-omega alone and in combination with chemotherapeutic agents on putative tumour-initiating cells and daughter cells derived from canine and feline mammary tumours. Vet Comp Oncol, 7(4):222-229.

41. Macewen EG, Hayes AA, Mooney S, Patnaik AK, Harvey HJ, Passe S, Hardy WD, Jr., 1984. Evaluation of effect of levamisole on feline mammary cancer. J Biol Response Mod, 3(5):541-546.

42. Adelfinger M, Gentschev I, Grimm De Guibert J, Weibel S, Langbein-Laugwitz J, Hartl B, Murua Escobar H, Nolte I, Chen NG, Aguilar RJ, Yu YA, Zhang Q, Frentzen A, Szalay AA, 2014. Evaluation of a new recombinant oncolytic vaccinia virus strain GLV-5b451 for feline mammary carcinoma therapy. PLoS One, 9(8):e104337.

43. Preziosi R, Sarli G, Benazzi C, Mandrioli L, Marcato PS, 2002. Multiparametric survival analysis of histological stage and proliferative activity in feline mammary carcinomas. Res Vet Sci, 73(1):53-60.

44. Brunetti B, Asproni P, Beha G, Muscatello LV, Millanta F, Poli A, Benazzi C, Sarli G, 2013. Molecular phenotype in mammary tumours of queens: correlation between pri-mary tumour and lymph node metastasis. J Comp Pathol, 148(2-3):206-213.

45. Wiese DA, Thaiwong T, Yuzbasiyan-Gurkan V, Kiupel M, 2013. Feline mammary bas-al-like adenocarcinomas: a potential model for human triple-negative breast cancer (TNBC) with basal-like subtype. BMC Cancer, 13:403.

46. Martin PM, Cotard M, Mialot JP, Andre F, Raynaud JP, 1984. Animal models for hor-mone-dependent human breast cancer. Relationship between steroid receptor profiles in canine and feline mammary tumors and survival rate. Cancer Chemother Pharmacol, 12(1):13-17.

47. Burrai GP, Mohammed SI, Miller MA, Marras V, Pirino S, Addis MF, Uzzau S, Antuo-fermo E, 2010. Spontaneous feline mammary intraepithelial lesions as a model for human estrogen receptor- and progesterone receptor-negative breast lesions. BMC Cancer, 10:156.

48. Millanta F, Calandrella M, Bari G, Niccolini M, Vannozzi I, Poli A, 2005. Comparison of steroid receptor expression in normal, dysplastic, and neoplastic canine and feline mammary tissues. Res Vet Sci, 79(3):225-232.

49. Martin De Las Mulas J, Van Niel M, Millan Y, Blankenstein MA, Van Mil F, Misdorp W, 2000. Immunohistochemical analysis of estrogen receptors in feline mammary gland benign and malignant lesions: comparison with biochemical assay. Domest Anim Endocrinol, 18(1):111-125.

50. Morris JS, Nixon C, Bruck A, Nasir L, Morgan IM, Philbey AW, 2008. Immunohisto-chemical expression of TopBP1 in feline mammary neoplasia in relation to histological grade, Ki67, ERα and p53. Vet J, 175(2):218-226.

51. Clark GM, Mcguire WL, 1983. Progesterone receptors and human breast cancer. Breast Cancer Res Treat, 3(2):157-163.

52. Martin De Las Mulas J, Van Niel M, Millan Y, Ordas J, Blankenstein MA, Van Mil F, Misdorp W, 2002. Progesterone receptors in normal, dysplastic and tumourous fe-line mammary glands. Comparison with oestrogen receptors status. Res Vet Sci, 72(2):153-161.

58


53. Millanta F, Calandrella M, Vannozzi I, Poli A, 2006. Steroid hormone receptors in nor-mal, dysplastic and neoplastic feline mammary tissues and their prognostic signifi-cance. Vet Rec, 158(24):821-824.

54. Maniscalco L, Iussich S, De Las Mulas JM, Millan Y, Biolatti B, Sasaki N, Nakagawa T, De Maria R, 2012. Activation of AKT in feline mammary carcinoma: a new prognostic factor for feline mammary tumours. Vet J, 191(1):65-71.

55. Hughes K, Dobson JM, 2012. Prognostic histopathological and molecular markers in feline mammary neoplasia. Vet J, 194(1):19-26.

56. Morris J, 2013. Mammary tumours in the cat: size matters, so early intervention saves lives. J Feline Med Surg, 15(5):391-400.

57. Rutteman GR, Blankenstein MA, Minke J, Misdorp W, 1991. Steroid receptors in mam-mary tumours of the cat. Acta Endocrinol (Copenh), 125 Suppl 1:32-37.

58. Cardazzo B, Zappulli V, Frassineti F, Patarnello T, Castagnaro M, Bargelloni L, 2005. Full-length sequence and expression analysis of estrogen receptor α mRNA in feline mammary tumors. J Steroid Biochem Mol Biol, 96(2):109-118.

59. Dowsett M, Nielsen TO, A'hern R, Bartlett J, Coombes RC, Cuzick J, Ellis M, Henry NL, Hugh JC, Lively T, Mcshane L, Paik S, Penault-Llorca F, Prudkin L, Regan M, Salter J, Sotiriou C, Smith IE, Viale G, Zujewski JA, Hayes DF, 2011. Assessment of Ki67 in breast cancer: recommendations from the International Ki67 in Breast Cancer working group. J Natl Cancer Inst, 103(22):1656-1664.

60. Castagnaro M, De Maria R, Bozzetta E, Ru G, Casalone C, Biolatti B, Caramelli M, 1998. Ki-67 index as indicator of the post-surgical prognosis in feline mammary carci-nomas. Research in Veterinary Science, 65:223-226.

61. Sarli G, Preziosi R, Benazzi C, Castellani G, Marcato PS, 2002. Prognostic value of histologic stage and proliferative activity in canine malignant mammary tumors. J Vet Diagn Invest, 14(1):25-34.

62. Castagnaro M, Casalone C, Ru G, Nervi GC, Bozzetta E, Caramelli M, 1998. Argyro-philic nucleolar organiser regions (AgNORs) count as indicator of post-surgical prog-nosis in feline mammary carcinomas. Research in Veterinary Science, 64:97-100.

63. Preziosi R, Sarli G, Benazzi C, Marcato PS, 1995. Detection of proliferating cell nuclear antigen (PCNA) in canine and feline mammary tumours. J Comp Pathol, 113(4):301-313.

64. De Maria R, Olivero M, Iussich S, Nakaichi M, Murata T, Biolatti B, Di Renzo MF, 2005. Spontaneous feline mammary carcinoma is a model of HER2 overexpressing poor prognosis human breast cancer. Cancer Res, 65(3):907-912.

65. Millanta F, Calandrella M, Citi S, Della Santa D, Poli A, 2005. Overexpression of HER-2 in feline invasive mammary carcinomas: an immunohistochemical survey and evalua-tion of its prognostic potential. Vet Pathol, 42(1):30-34.

66. Winston J, Craft DM, Scase TJ, Bergman PJ, 2005. Immunohistochemical detection of HER-2/neu expression in spontaneous feline mammary tumours. Vet Comp Oncol, 3(1):8-15.

67. Ordas J, Millan Y, Dios R, Reymundo C, De Las Mulas JM, 2007. Proto-oncogene

59


HER-2 in normal, dysplastic and tumorous feline mammary glands: an immunohisto-chemical and chromogenic in situ hybridization study. BMC Cancer, 7:179.

68. Rasotto R, Caliari D, Castagnaro M, Zanetti R, Zappulli V, 2011. An Immunohistochem-ical study of HER-2 expression in feline mammary tumours. J Comp Pathol, 144(2-3):170-179.

69. Millanta F, Citi S, Della Santa D, Porciani M, Poli A, 2006. COX-2 expression in canine and feline invasive mammary carcinomas: correlation with clinicopathological features and prognostic molecular markers. Breast Cancer Res Treat, 98(1):115-120.

70. Sayasith K, Sirois J, Dore M, 2009. Molecular characterization of feline COX-2 and expression in feline mammary carcinomas. Vet Pathol, 46(3):423-429.

71. Petterino C, Ratto A, Podesta G, Drigo M, Pellegrino C, 2007. Immunohistochemical evaluation of STAT3-p-tyr705 expression in feline mammary gland tumours and cor-relation with histologic grade. Res Vet Sci, 82(2):218-224.

72. De Maria R, Maggiora P, Biolatti B, Prat M, Comoglio PM, Castagnaro M, Di Renzo MF, 2002. Feline STK gene expression in mammary carcinomas. Oncogene, 21(11):1785-1790.

73. Ressel L, Millanta F, Caleri E, Innocenti VM, Poli A, 2009. Reduced PTEN protein expression and its prognostic implications in canine and feline mammary tumors. Vet Pathol, 46(5):860-868.

74. Nakano M, Wu H, Taura Y, Inoue M, 2006. Immunohistochemical detection of Mdm2 and p53 in feline mammary gland tumors. J Vet Med Sci, 68(5):421-425.

75. Murakami Y, Tateyama S, Rungsipipat A, Uchida K, Yamaguchi R, 2000. Immunohis-tochemical analysis of cyclin A, cyclin D1 and P53 in mammary tumors, squamous cell carcinomas and basal cell tumors of dogs and cats. J Vet Med Sci, 62(7):743-750.

76. Millanta F, Lazzeri G, Vannozzi I, Viacava P, Poli A, 2002. Correlation of vascular en-dothelial growth factor expression to overall survival in feline invasive mammary carci-nomas. Vet Pathol, 39(6):690-696.

77. Webster JD, Dennis MM, Dervisis N, Heller J, Bacon NJ, Bergman PJ, Bienzle D, Cassali G, Castagnaro M, Cullen J, Esplin DG, Pena L, Goldschmidt MH, Hahn KA, Henry CJ, Hellmen E, Kamstock D, Kirpensteijn J, Kitchell BE, Amorim RL, Lenz SD, Lipscomb TP, Mcentee M, Mcgill LD, Mcknight CA, Mcmanus PM, Moore AS, Moore PF, Moroff SD, Nakayama H, Northrup NC, Sarli G, Scase T, Sorenmo K, Schulman FY, Shoieb AM, Smedley RC, Spangler WL, Teske E, Thamm DH, Valli VE, Vernau W, Von Euler H, Withrow SJ, Weisbrode SE, Yager J, Kiupel M, 2011. Recommended guidelines for the conduct and evaluation of prognostic studies in veterinary oncology. Vet Pathol, 48(1):7-18.

78. Beha G, Muscatello LV, Brunetti B, Asproni P, Millanta F, Poli A, Benazzi C, Sarli G, 2014. Molecular Phenotype of Primary Mammary Tumours and Distant Metastases in Female Dogs and Cats. J Comp Pathol.

79. Martin De Las Mulas J, Espinosa De Los Monteros A, Bautista MJ, Gomez-Villaman-dos JC, Morales C, 1994. Immunohistochemical distribution pattern of intermediate filament proteins and muscle actin in feline and human mammary carcinomas. J Comp Pathol, 111(4):365-381.

60


80. Sarli G, Brunetti B, Benazzi C, 2006. Mammary mucinous carcinoma in the cat. Vet Pathol, 43(5):667-673.

81. Penafiel-Verdu C, Buendia AJ, Navarro JA, Ramirez GA, Vilafranca M, Altimira J, San-chez J, 2012. Reduced expression of E-cadherin and β-catenin and high expression of basal cytokeratins in feline mammary carcinomas with regional metastasis. Vet Pathol, 49(6):979-987.

82. Martin De Las Mulas J, Reymundo C, Espinosa De Los Monteros A, Millan Y, Ordas J, 2004. Calponin expression and myoepithelial cell differentiation in canine, feline and human mammary simple carcinomas. Vet Comp Oncol, 2(1):24-35.

83. Matos AJ, Baptista CS, Gartner MF, Rutteman GR, 2012. Prognostic studies of canine and feline mammary tumours: the need for standardized procedures. Vet J, 193(1):24-31.

84. Gumbiner BM, 1996. Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell, 84(3):345-357.

85. Takeichi M, 1990. Cadherins: a molecular family important in selective cell-cell adhe-sion. Annu Rev Biochem, 59:237-252.

86. Wijnhoven BP, Dinjens WN, Pignatelli M, 2000. E-cadherin-catenin cell-cell adhesion complex and human cancer. Br J Surg, 87(8):992-1005.

87. Yilmaz M, Christofori G, 2010. Mechanisms of motility in metastasizing cells. Mol Cancer Res, 8(5):629-642.

88. Ohene-Abuakwa Y, Pignatelli M, 2000. Adhesion Molecules as Diagnostic Tools in Tu-mor Pathology. International Journal of Surgical Pathology, 8(3):191-200.

89. Christofori G, 2003. Changing neighbours, changing behaviour: cell adhesion mole-cule-mediated signalling during tumour progression. The EMBO Journal, 22(20):2318-2323.

90. Nollet F, Kools P, Van Roy F, 2000. Phylogenetic analysis of the cadherin superfamily allows identification of six major subfamilies besides several solitary members. J Mol Biol, 299(3):551-572.

91. Elangbam CS, Qualls CW, Jr., Dahlgren RR, 1997. Cell adhesion molecules - update. Vet Pathol, 34(1):61-73.

92. Takeichi M, 1991. Cadherin cell adhesion receptors as a morphogenetic regulator. Science, 251:1451-1455.

93. Takeichi M, Nakagawa S, Aono S, Usui T, Uemura T, 2000. Patterning of cell assem-blies regulated by adhesion receptors of the cadherin superfamily. Philos Trans R Soc Lond B Biol Sci, 355(1399):885-890.

94. Knudsen KA, Frankowski C, Johnson KR, Wheelock MJ, 1998. A role for cadherins in cellular signaling and differentiation. J Cell Biochem Suppl, 30-31:168-176.

95. Pecina-Slaus N, 2003. Tumor suppressor gene E-cadherin and its role in normal and malignant cells. Cancer Cell Int, 3(1):17.

96. Nose A, Takeichi M, 1986. A novel cadherin cell adhesion molecule: its expression patterns associated with implantation and organogenesis of mouse embryos. J Cell Biol, 103(6 Pt 2):2649-2658.

97. Shimoyama Y, Yoshida T, Terada M, Shimosato Y, Abe O, Hirohashi S, 1989. Molecu-lar cloning of a human Ca2+-dependent cell-cell adhesion molecule homologous to

61


mouse placental cadherin: its low expression in human placental tissues. J Cell Biol, 109(4 Pt 1):1787-1794.

98. Shimoyama Y, Hirohashi S, Hirano S, Noguchi M, Shimosato Y, Takeichi M, Abe O, 1989. Cadherin cell-adhesion molecules in human epithelial tissues and carcinomas. Cancer Res, 49(8):2128-2133.

99. Paredes J, Correia AL, Ribeiro AS, Albergaria A, Milanezi F, Schmitt FC, 2007. P-cadherin expression in breast cancer: a review. Breast Cancer Research, 9(5):214.

100. Shirayoshi Y, Hatta K, Hosoda M, Tsunasawa S, Sakiyama F, Takeichi M, 1986. Cad-herin cell adhesion molecules with distinct binding specificities share a common struc-ture. EMBO J, 5(10):2485-2488.

101. Nose A, Nagafuchi A, Takeichi M, 1987. Isolation of placental cadherin cDNA: identi-fication of a novel gene family of cell-cell adhesion molecules. EMBO J, 6(12):3655-3661.

102. Hatta K, Nose A, Nagafuchi A, Takeichi M, 1988. Cloning and expression of cDNA en-coding a neural calcium-dependent cell adhesion molecule: its identity in the cadherin gene family. J Cell Biol, 106(3):873-881.

103. Berx G, Staes K, Van Hengel J, Molemans F, Bussemakers MJ, Van Bokhoven A, Van Roy F, 1995. Cloning and characterization of the human invasion suppressor gene E-cadherin (CDH1). Genomics, 26(2):281-289.

104. Bussemakers MJ, Van Bokhoven A, Voller M, Smit FP, Schalken JA, 1994. The genes for the calcium-dependent cell adhesion molecules P- and E-cadherin are tandemly arranged in the human genome. Biochem Biophys Res Commun, 203(2):1291-1294.

105. Hatta M, Miyatani S, Copeland NG, Gilbert DJ, Jenkins NA, Takeichi M, 1991. Ge-nomic organization and chromosomal mapping of the mouse P-cadherin gene. Nucleic Acids Res, 19(16):4437-4441.

106. Nollet F, Berx G, Van Roy F, 1999. The role of the E-cadherin/catenin adhesion complex in the development and progression of cancer. Mol Cell Biol Res Commun, 2(2):77-85.

107. Albergaria A, Ribeiro AS, Vieira AF, Sousa B, Nobre AR, Seruca R, Schmitt F, Pare-des J, 2011. P-cadherin role in normal breast development and cancer. Int J Dev Biol, 55:811-822.

108. Yagi T, Takeichi M, 2000. Cadherin superfamily genes: functions, genomic organiza-tion, and neurologic diversity. Genes Dev, 14(10):1169-1180.

109. Takeichi M, 1995. Morphogenetic roles of classic cadherins. Curr Opin Cell Biol, 7(5):619-627.

110. Nose A, Tsuji K, Takeichi M, 1990. Localization of specificity determining sites in cad-herin cell adhesion molecules. Cell, 61(1):147-155.

111. Cailliez F, Lavery R, 2005. Cadherin mechanics and complexation: the importance of calcium binding. Biophys J, 89(6):3895-3903.

112. Angst BD, Marcozzi C, Magee AI, 2001. The cadherin superfamily: diversity in form and function. J Cell Sci, 114(4):629-641.

113. Shapiro L, Fannon AM, Kwong PD, Thompson A, Lehmann MS, Grubel G, Legrand JF, Als-Nielsen J, Colman DR, Hendrickson WA, 1995. Structural basis of cell-cell adhe-sion by cadherins. Nature, 374(6520):327-337.

62


114. Berx G, Van Roy F, 2001. The E-cadherin/catenin complex: an important gatekeeper in breast cancer tumorigenesis and malignant progression. Breast Cancer Research, 3(5):289-293.

115. Ozawa M, Kemler R, 1992. Molecular organization of the uvomorulin-catenin complex. J Cell Biol, 116(4):989-996.

116. Wheelock MJ, Soler AP, Knudsen KA, 2001. Cadherin junctions in mammary tumors. J Mammary Gland Biol Neoplasia, 6(3):275-285.

117. Gumbiner BM, 2000. Regulation of cadherin adhesive activity. J Cell Biol, 148(3):399-404.118. Nagafuchi A, Takeichi M, 1989. Transmembrane control of cadherin-mediated cell ad-

hesion: a 94 kDa protein functionally associated with a specific region of the cytoplas-mic domain of E-cadherin. Cell Regul, 1(1):37-44.

119. Ozawa M, Baribault H, Kemler R, 1989. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J, 8(6):1711-1717.

120. Nagafuchi A, Takeichi M, 1988. Cell binding function of E-cadherin is regulated by the cytoplasmic domain. EMBO J, 7(12):3679-3684.

121. Ozawa M, Ringwald M, Kemler R, 1990. Uvomorulin-catenin complex formation is regulated by a specific domain in the cytoplasmic region of the cell adhesion molecule. Proc Natl Acad Sci U S A, 87(11):4246-4250.

122. Goyal A, Martin TA, Mansel RE, Jiang WG, 2008. Real time PCR analyses of expres-sion of E-cadherin, α-, β- and γ-catenin in human breast cancer for predicting clinical outcome. World J Surg Oncol, 6:56.

123. Sun Y, Zhang J, Ma L, 2014. α-Catenin: A tumor suppressor beyond adherens junc-tions. Cell Cycle, 13(15).

124. Andrews JL, Kim AC, Hens JR, 2012. The role and function of cadherins in the mam-mary gland. Breast Cancer Res, 14(1):203.

125. Morin PJ, 1999. β-catenin signaling and cancer. Bioessays, 21(12):1021-1030.126. Cowin P, Rowlands TM, Hatsell SJ, 2005. Cadherins and catenins in breast cancer.

Curr Opin Cell Biol, 17(5):499-508.127. Behrens J, 1999. Cadherins and catenins: role in signal transduction and tumor pro-

gression. Cancer Metastasis Rev, 18(1):15-30.128. Reynolds AB, Carnahan RH, 2004. Regulation of cadherin stability and turnover by

p120ctn: implications in disease and cancer. Semin Cell Dev Biol, 15(6):657-663.129. Reynolds AB, Daniel J, Mccrea PD, Wheelock MJ, Wu J, Zhang Z, 1994. Identification

of a new catenin: the tyrosine kinase substrate p120cas associates with E-cadherin complexes. Mol Cell Biol, 14(12):8333-8342.

130. Thoreson MA, Reynolds AB, 2002. Altered expression of the catenin p120 in human cancer: implications for tumor progression. Differentiation, 70(9-10):583-589.

131. Anastasiadis PZ, Reynolds AB, 2001. Regulation of Rho GTPases by p120-catenin. Curr Opin Cell Biol, 13(5):604-610.

132. Berx G, Van Roy F, 2009. Involvement of members of the cadherin superfamily in can-cer. Cold Spring Harb Perspect Biol, 1(6):a003129.

63


133. Cavallaro U, Schaffhauser B, Christofori G, 2002. Cadherins and the tumour progres-sion: is it all in a switch? Cancer Lett, 176(2):123-128.

134. Stemmler MP, 2008. Cadherins in development and cancer. Mol Biosyst, 4(8):835-850.135. Conacci-Sorrell M, Zhurinsky J, Ben-Ze’ev A, 2002. The cadherin-catenin adhesion

system in signaling and cancer. Journal of Clinical Investigation, 109(8):987-991.136. Mulligan AMOMFR, 2012. The Breast. In: STRAYER, D. S. (ed.) Rubin´s Patholo-

gy Clinicopathologic Foundations of Medicine. 7th Ed ed. Baltimore: Wolters Kluwer Health.

137. Paredes J, Milanezi F, Viegas L, Amendoeira I, Schmitt F, 2002. P-cadherin expression is associated with high-grade ductal carcinoma in situ of the breast. Virchows Archiv, 440(1):16-21.

138. Glukhova M, Koteliansky V, Sastre X, Thiery JP, 1995. Adhesion systems in normal breast and in invasive breast carcinoma. Am J Pathol, 146(3):706-716.

139. Parker C, Rampaul RS, Pinder SE, Bell JA, Wencyk PM, Blamey RW, Nicholson RI, Robertson JF, 2001. E-cadherin as a prognostic indicator in primary breast cancer. Br J Cancer, 85(12):1958-1963.

140. Palacios J, Benito N, Pizarro A, Suarez A, Espada J, Cano A, Gamallo C, 1995. Anom-alous expression of P-cadherin in breast carcinoma. Correlation with E-cadherin ex-pression and pathological features. Am J Pathol, 146(3):605-612.

141. Rasbridge SA, Gillett CE, Sampson SA, Walsh FS, Millis RR, 1993. Epithelial (E-) and placental (P-) cadherin cell adhesion molecule expression in breast carcinoma. J Pathol, 169(2):245-250.

142. Daniel CW, Strickland P, Friedmann Y, 1995. Expression and functional role of E- and P-cadherins in mouse mammary ductal morphogenesis and growth. Dev Biol, 169(2):511-519.

143. Radice GL, Ferreira-Cornwell MC, Robinson SD, Rayburn H, Chodosh LA, Takeichi M, Hynes RO, 1997. Precocious mammary gland development in P-cadherin-deficient mice. J Cell Biol, 139(4):1025-1032.

144. Paredes J, Albergaria A, Oliveira JT, Jeronimo C, Milanezi F, Schmitt FC, 2005. P-cadherin overexpression is an indicator of clinical outcome in invasive breast carci-nomas and is associated with CDH3 promoter hypomethylation. Clin Cancer Res, 11(16):5869-5877.

145. Peralta Soler A, Russo J, Russo IH, Knudsen KA, 2002. Soluble Fragments of P-cad-herin Adhesion Protein Found in Human Milk. J. Cell. Biochem., 85:180-184.

146. Chansona L, Brownfieldb D, Garbeb JC, Kuhnb I, Stampferb MR, Bissellb MJ, La-bargeb AA, 2010. Self-organization is a dynamic and lineage-intrinsic property of mammary epithelial cells. PNAS, 108(8):3264–3269.

147. Mannello F, Tonti GA, Medda V, Pederzoli A, Sauter ER, 2008. Increased shedding of soluble fragments of P-cadherin in nipple aspirate fluids from women with breast can-cer. Cancer Sci, 99(11):2160-2169.

148. Knudsen KA, Lin CY, Johnson KR, Wheelock MJ, Keshgegian AA, Soler AP, 2000. Lack of correlation between serum levels of E- and P-cadherin fragments and the pres-ence of breast cancer. Hum Pathol, 31(8):961-965.

64


149. Van Roy F, Berx G, 2008. The cell-cell adhesion molecule E-cadherin. Cell Mol Life Sci, 65(23):3756-3788.

150. Frixen UH, Behrens J, Sachs M, Eberle G, Voss B, Warda A, Lochner D, Birchmeier W, 1991. E-cadherin-mediated cell-cell adhesion prevents invasiveness of human car-cinoma cells. J Cell Biol, 113(1):173-185.

151. Sommers CL, Thompson EW, Torri JA, Kemler R, Gelmann EP, Byers SW, 1991. Cell adhesion molecule uvomorulin expression in human breast cancer cell lines: relation-ship to morphology and invasive capacities. Cell Growth Differ, 2(8):365-372.

152. De Leeuw WJ, Berx G, Vos CB, Peterse JL, Van De Vijver MJ, Litvinov S, Van Roy F, Cornelisse CJ, Cleton-Jansen AM, 1997. Simultaneous loss of E-cadherin and catenins in invasive lobular breast cancer and lobular carcinoma in situ. J Pathol, 183(4):404-411.

153. Liu T, Zhang X, Shang M, Zhang Y, Xia B, Niu M, Liu Y, Pang D, 2013. Dysregulated expression of Slug, vimentin, and E-cadherin correlates with poor clinical outcome in patients with basal-like breast cancer. J Surg Oncol, 107(2):188-194.

154. Rieger-Christ KM, Pezza JA, Dugan JM, Braasch JW, Hughes KS, Summerhayes IC, 2001. Disparate E-cadherin mutations in LCIS and associated invasive breast carcinomas. Mol Pathol, 54(2):91-97.

155. Mastracci TL, Tjan S, Bane AL, O'malley FP, Andrulis IL, 2005. E-cadherin alterations in atypical lobular hyperplasia and lobular carcinoma in situ of the breast. Mod Pathol, 18(6):741-751.

156. Gamallo C, Palacios J, Suarez A, Pizarro A, Navarro P, Quintanilla M, Cano A, 1993. Correlation of E-cadherin expression with differentiation grade and histological type in breast carcinoma. Am J Pathol, 142(4):987-993.

157. Harigopal M, Shin SJ, Murray MP, Tickoo SK, Brogi E, Rosen PP, 2005. Aberrant E-cadherin staining patterns in invasive mammary carcinoma. World J Surg Oncol, 3:73.

158. Goldstein NS, Bassi D, Watts JC, Layfield LJ, Yaziji H, Gown AM, 2001. E-cadherin reactivity of 95 noninvasive ductal and lobular lesions of the breast. Implications for the interpretation of problematic lesions. Am J Clin Pathol, 115(4):534-542.

159. Gonzalez MA, Pinder SE, Wencyk PM, Bell JA, Elston CW, Nicholson RI, Robertson JF, Blamey RW, Ellis IO, 1999. An immunohistochemical examination of the expres-sion of E-cadherin, α- and β/γ-catenins, and α2- and β1-integrins in invasive breast cancer. J Pathol, 187(5):523-529.

160. Berx G, Cleton-Jansen A-M, Nollet, De Leeuwl WJF, Van De Vijverl MJ, Cornelisse C, Van Roy F, 1995. E-cadherin is a tumour/invasion suppressor gene mutated in human lobular breast cancers. The EMBO Journal, 14(24):6107-6115.

161. Siitonen SM, Kononen JT, Helin HJ, Rantala IS, Holli KA, Isola JJ, 1996. Reduced E-cadherin expression is associated with invasiveness and unfavorable prognosis in breast cancer. Am J Clin Pathol, 105(4):394-402.

162. Hirohashi S, 1998. Inactivation of the E-cadherin-mediated cell adhesion system in human cancers. Am J Pathol, 153(2):333-339.

163. Van Horssen R, Hollestelle A, Rens JA, Eggermont AM, Schutte M, Ten Hagen TL, 2012. E-cadherin promotor methylation and mutation are inversely related to motility capacity of breast cancer cells. Breast Cancer Res Treat, 136(2):365-377.

65


164. Knudsen KA, Wheelock MJ, 2005. Cadherins and the mammary gland. J Cell Biochem, 95(3):488-496.

165. Berx G, Becker KF, Hofler H, Van Roy F, 1998. Mutations of the human E-cadherin (CDH1) gene. Hum Mutat, 12(4):226-237.

166. Cleton-Jansen A-M, 2002. E-cadherin and loss of heterozygosity at chromosome 16 in breast carcinogenesis: different genetic pathways in ductal and lobular breast cancer? Breast Cancer Res, 4(1):5-8.

167. Berx G, Cleton-Jansen A-M, Strumane K, De Leeuw WJ, Nollet F, Van Roy F, Cor-nelisse C, 1996. E-cadherin is inactivated in a majority of invasive human lobular breast cancers by truncation mutations throughout its extracellular domain. Oncogene, 13(9):1919-1925.

168. Oda T, Kanai Y, Oyama T, Yoshiura K, Shimoyama Y, Birchmeier W, Sugimura T, Hiro-hashi S, 1994. E-cadherin gene mutations in human gastric carcinoma cell lines. Proc Natl Acad Sci U S A, 91(5):1858-1862.

169. Semb H, Christofori G, 1998. The tumor-suppressor function of E-cadherin. Am J Hum Genet, 63(6):1588-1593.

170. Baranwal S, Alahari SK, 2009. Molecular mechanisms controlling E-cadherin expres-sion in breast cancer. Biochem Biophys Res Commun, 384(1):6-11.

171. Yoshiura K, Kanai Y, Ochiai A, Shimoyama Y, Sugimura T, Hirohashi S, 1995. Silencing of the E-cadherin invasion-suppressor gene by CpG methylation in human carcino-mas. Proc Natl Acad Sci U S A, 92(16):7416-7419.

172. Graff JR, Herman JG, Lapidus RG, Chopra H, Xu R, Jarrard DF, Isaacs WB, Pitha PM, Davidson NE, Baylin SB, 1995. E-cadherin expression is silenced by DNA hypermeth-ylation in human breast and prostate carcinomas. Cancer Res, 55(22):5195-5199.

173. Hiraguri S, Godfrey T, Nakamura H, Graff J, Collins C, Shayesteh L, Doggett N, John-son K, Wheelock M, Herman J, Baylin S, Pinkel D, Gray J, 1998. Mechanisms of inac-tivation of E-cadherin in breast cancer cell lines. Cancer Res, 58(9):1972-1977.

174. Oka H, Shiozaki H, Kobayashi K, Inoue M, Tahara H, Kobayashi T, Takatsuka Y, Mat-suyoshi N, Hirano S, Takeichi M, Et al., 1993. Expression of E-cadherin cell adhesion molecules in human breast cancer tissues and its relationship to metastasis. Cancer Res, 53(7):1696-1701.

175. Liu Y, Zhao J, Zhang PY, Zhang Y, Sun SY, Yu SY, Xi QS, 2012. MicroRNA-10b targets E-cadherin and modulates breast cancer metastasis. Med Sci Monit, 18(8):BR299-308.

176. Zhao H, Liang Y, Xu Z, Wang L, Zhou F, Li Z, Jin J, Yang Y, Fang Z, Hu Y, Zhang L, Su J, Zha X, 2008. N-glycosylation affects the adhesive function of E-Cadherin through modifying the composition of adherens junctions (AJs) in human breast carcinoma cell line MDA-MB-435. J Cell Biochem, 104(1):162-175.

177. Matsuyoshi N, Hamaguchi M, Taniguchi S, Nagafuchi A, Tsukita S, Takeichi M, 1992. Cadherin-mediated cell-cell adhesion is perturbed by v-src tyrosine phosphorylation in metastatic fibroblasts. J Cell Biol, 118(3):703-714.

178. Braga VMM, 1999. Small GTPases and regulation of cadherin dependent cell–cell adhesion. J Clin Pathol: Mol Pathol, 52:197–202.

179. Kawanishi J, Kato J, Sasaki K, Fujii S, Watanabe N, Niitsu Y, 1995. Loss of E-cadherin-

66


dependent cell-cell adhesion due to mutation of the β-catenin gene in a human cancer cell line, HSC-39. Mol Cell Biol, 15(3):1175-1181.

180. Shimoyama Y, Nagafuchi A, Fujita S, Gotoh M, Takeichi M, Tsukita S, Hirohashi S, 1992. Cadherin dysfunction in a human cancer cell line: possible involvement of loss of α-catenin expression in reduced cell-cell adhesiveness. Cancer Res, 52(20):5770-5774.

181. Shimoyama Y, Hirohashi S, 1991. Expression of E- and P-cadherin in gastric carcino-mas. Cancer Res, 51(8):2185-2192.

182. Bukholm IK, Nesland JM, Karesen R, Jacobsen U, Borresen-Dale AL, 1998. E-Cad-herin and α-, β-, and γ-catenin protein expression in relation to metastasis in human breast carcinoma. J Pathol, 185(3):262-266.

183. Bukholm IK, Nesland JM, Borresen-Dale AL, 2000. Re-expression of E-cadherin, α-catenin and β-catenin, but not of γ-catenin, in metastatic tissue from breast cancer patients. J Pathol, 190(1):15-19.

184. Lipponen P, Saarelainen E, Ji H, Aaltomaa S, Syrjanen K, 1994. Expression of E-cadherin (E-CD) as related to other prognostic factors and survival in breast cancer. J Pathol, 174(2):101-109.

185. Gillett CE, Miles DW, Ryder K, Skilton D, Liebman RD, Springall RJ, Barnes DM, Hanby AM, 2001. Retention of the expression of E-cadherin and catenins is associated with shorter survival in grade III ductal carcinoma of the breast. J Pathol, 193(4):433-441.

186. Peralta Soler A, Knudsen KA, Salazar H, Han AC, Keshgegian AA, 1999. P-cadherin expression in breast carcinoma indicates poor survival. Cancer, 86(7):1263-1272.

187. Tan DS, Potts HW, Leong AC, Gillett CE, Skilton D, Harris WH, Liebmann RD, Hanby AM, 1999. The biological and prognostic significance of cell polarity and E-cadherin in grade I infiltrating ductal carcinoma of the breast. J Pathol, 189(1):20-27.

188. Howard EM, Lau SK, Lyles RH, Birdsong GG, Umbreit JN, Kochhar R, 2005. Expres-sion of E-cadherin in high-risk breast cancer. J Cancer Res Clin Oncol, 131(1):14-18.

189. Nakopoulou L, Gakiopoulou-Givalou H, Karayiannakis AJ, Giannopoulou I, Keramo-poulos A, Davaris P, Pignatelli M, 2002. Abnormal α-catenin expression in invasive breast cancer correlates with poor patient survival. Histopathology, 40(6):536-546.

190. Pedersen KB, Nesland JM, Fodstad O, Maelandsmo GM, 2002. Expression of S100A4, E-cadherin, α- and β-catenin in breast cancer biopsies. Br J Cancer, 87(11):1281-1286.

191. Tsang JY, Mendoza P, Lam CC, Yu AM, Putti TC, Karim RZ, Scolyer RA, Lee CS, Tan PH, Tse GM, 2012. Involvement of α- and β-catenins and E-cadherin in the develop-ment of mammary phyllodes tumours. Histopathology, 61(4):667-674.

192. Khramtsov AI, Khramtsova GF, Tretiakova M, Huo D, Olopade OI, Goss KH, 2010. WNT/β-catenin pathway activation is enriched in basal-like breast cancers and predicts poor outcome. Am J Pathol, 176(6):2911-2920.

193. Esposito NN, Chivukula M, Dabbs DJ, 2007. The ductal phenotypic expression of the E-cadherin/catenin complex in tubulolobular carcinoma of the breast: an immunohisto-chemical and clinicopathologic study. Mod Pathol, 20(1):130-138.

194. Karayiannakis AJ, Nakopoulou L, Gakiopoulou H, Keramopoulos A, Davaris PS, Pig-

67


natelli M, 2001. Expression patterns of β-catenin in in situ and invasive breast cancer. Eur J Surg Oncol, 27(1):31-36.

195. Incassati A, Chandramouli A, Eelkema R, Cowin P, 2010. Key signaling nodes in mam-mary gland development and cancer: β-catenin. Breast Cancer Res, 12(6):213.

196. Fanelli MA, Montt-Guevara M, Diblasi AM, Gago FE, Tello O, Cuello-Carrion FD, Calle-gari E, Bausero MA, Ciocca DR, 2008. P-Cadherin and β-catenin are useful prognostic markers in breast cancer patients; β-catenin interacts with heat shock protein Hsp27. Cell Stress Chaperones, 13(2):207-220.

197. Van Marck V, Stove C, Van Den Bossche K, Stove V, Paredes J, Vander Haeghen Y, Bracke M, 2005. P-cadherin promotes cell-cell adhesion and counteracts invasion in human melanoma. Cancer Res, 65(19):8774-8783.

198. Van Marck V, Stove C, Jacobs K, Van Den Eynden G, Bracke M, 2011. P-cadherin in adhesion and invasion: opposite roles in colon and bladder carcinoma. Int J Cancer, 128(5):1031-1044.

199. Bauer R, Bosserhoff AK, 2006. Functional implication of truncated P-cadherin expres-sion in malignant melanoma. Exp Mol Pathol, 81(3):224-230.

200. Taniuchi K, Nakagawa H, Hosokawa M, Nakamura T, Eguchi H, Ohigashi H, Ishikawa O, Katagiri T, Nakamura Y, 2005. Overexpressed P-cadherin/CDH3 promotes motility of pancreatic cancer cells by interacting with p120ctn and activating rho-family GT-Pases. Cancer Res, 65(8):3092-3099.

201. Mandeville JA, Silva Neto B, Vanni AJ, Smith GL, Rieger-Christ KM, Zeheb R, Loda M, Libertino JA, Summerhayes IC, 2008. P-cadherin as a prognostic indicator and a mod-ulator of migratory behaviour in bladder carcinoma cells. BJU Int, 102(11):1707-1714.

202. Cheung LW, Leung PC, Wong AS, 2010. Cadherin switching and activation of p120 catenin signaling are mediators of gonadotropin-releasing hormone to promote tumor cell migration and invasion in ovarian cancer. Oncogene, 29(16):2427-2440.

203. Paredes J, Lopes N, Milanezi F, Schmitt FC, 2007. P-cadherin and cytokeratin 5: use-ful adjunct markers to distinguish basal-like ductal carcinomas in situ. Virchows Archiv 450(1):73-80.

204. Paredes J, Stove C, Stove V, Milanezi F, Van Marck V, Derycke L, Mareel M, Bracke M, Schmitt F, 2004. P-cadherin is up-regulated by the antiestrogen ICI 182,780 and promotes invasion of human breast cancer cells. Cancer Res, 64(22):8309-8317.

205. Stefansson IM, Salvesen HB, Akslen LA, 2004. Prognostic impact of alterations in P-cadherin expression and related cell adhesion markers in endometrial cancer. J Clin Oncol, 22(7):1242-1252.

206. Imai K, Hirata S, Irie A, Senju S, Ikuta Y, Yokomine K, Harao M, Inoue M, Tsunoda T, Nakatsuru S, Nakagawa H, Nakamura Y, Baba H, Nishimura Y, 2008. Identifica-tion of a novel tumor-associated antigen, cadherin 3/P-cadherin, as a possible target for immunotherapy of pancreatic, gastric, and colorectal cancers. Clin Cancer Res, 14(20):6487-6495.

207. Gamallo C, Moreno-Bueno G, Sarrio D, Calero F, Hardisson D, Palacios J, 2001. The prognostic significance of P-cadherin in infiltrating ductal breast carcinoma. Modern pathology 14(7):650-654.

68


208. Reis-Filho JS, Milanezi F, Paredes J, Silva P, Pereira EM, Maeda SA, De Carvalho LV, Schmitt FC, 2003. Novel and classic myoepithelial/stem cell markers in metaplas-tic carcinomas of the breast. Applied immunohistochemistry & molecular morphology 11(1):1-8.

209. Turashvili G, Mckinney SE, Goktepe O, Leung SC, Huntsman DG, Gelmon KA, Los G, Rejto PA, Aparicio SA, 2011. P-cadherin expression as a prognostic biomarker in a 3992 case tissue microarray series of breast cancer. Modern pathology 24(1):64-81.

210. Han AC, Soler AP, Knudsen KA, Salazar H, 1999. Distinct cadherin profiles in special variant carcinomas and other tumors of the breast. Hum Pathol, 30(9):1035-1039.

211. Paredes J, Milanezi F, Reis-Filho JS, Leitão D, Athanazio D, Schmitt F, 2002. Cor-relação entre as expressões de P-caderina e de receptores de estrógeno no câncer da mama. Correlation between P-cadherin and estrogen receptor expression in breast cancer. Jornal Brasileiro de Patologia e Medicina Laboratorial, 38:307-331.

212. Kovacs A, Dhillon J, Walker RA, 2003. Expression of P-cadherin, but not E-cadherin or N-cadherin, relates to pathological and functional differentiation of breast carcinomas. Journal of clinical pathology: molecular pathology, 56(6):318-322.

213. Sousa B, Paredes J, Milanezi F, Lopes N, Martins D, Dufloth R, Vieira D, Albergaria A, Veronese L, Carneiro V, Carvalho S, Costa JL, Zeferino L, Schmitt F, 2010. P-cadherin, vimentin and CK14 for identification of basal-like phenotype in breast carcinomas: an immunohistochemical study. Histol Histopathol, 25(8):963-974.

214. Liu N, Yu Q, Liu TJ, Gebreamlak EP, Wang SL, Zhang RJ, Zhang J, Niu Y, 2012. P-cadherin expression and basal-like subtype in breast cancers. Med Oncol, 29(4):2606-2612.

215. Faria G, Cardoso MJ, Martins D, Bettencourt H, Amendoeira I, Schimitt F, 2012. P-cadherin as prognostic factor for loco-regional relapse in breast cancer. Acta Med Port, 25(2):97-105.

216. Faraldo MM, Teuliere J, Deugnier MA, Birchmeier W, Huelsken J, Thiery JP, Cano A, Glukhova MA, 2007. β-Catenin regulates P-cadherin expression in mammary basal epithelial cells. FEBS Lett, 581(5):831-836.

217. Albergaria A, Resende C, Nobre AR, Ribeiro AS, Sousa B, Machado JC, Seruca R, Paredes J, Schmitt F, 2013. CCAAT/enhancer binding protein beta (C/EBPbeta) iso-forms as transcriptional regulators of the pro-invasive CDH3/P-cadherin gene in hu-man breast cancer cells. PLoS One, 8(2):e55749.

218. Albergaria A, Ribeiro AS, Pinho S, Milanezi F, Carneiro V, Sousa B, Sousa S, Oliveira C, Machado JC, Seruca R, Paredes J, Schmitt F, 2010. ICI 182,780 induces P-cadherin overexpression in breast cancer cells through chromatin remodelling at the promoter level: a role for C/EBPβ in CDH3 gene activation. Hum Mol Genet, 19(13):2554-2566.

219. Shimomura Y, Wajid M, Shapiro L, Christiano AM, 2008. P-cadherin is a p63 target gene with a crucial role in the developing human limb bud and hair follicle. Development, 135(4):743-753.

220. Carroll DK, Carroll JS, Leong CO, Cheng F, Brown M, Mills AA, Brugge JS, Ellisen LW, 2006. p63 regulates an adhesion programme and cell survival in epithelial cells. Nat Cell Biol, 8(6):551-561.

69


221. Faraldo MM, Teuliere J, Deugnier MA, Taddei-De La Hosseraye I, Thiery JP, Gluk-hova MA, 2005. Myoepithelial cells in the control of mammary development and tu-morigenesis: data from genetically modified mice. J Mammary Gland Biol Neoplasia, 10(3):211-219.

222. Gorski JJ, James CR, Quinn JE, Stewart GE, Staunton KC, Buckley NE, Mcdyer FA, Kennedy RD, Wilson RH, Mullan PB, Harkin DP, 2010. BRCA1 transcriptionally regu-lates genes associated with the basal-like phenotype in breast cancer. Breast Cancer Res Treat, 122(3):721-731.

223. Arnes JB, Brunet JS, Stefansson I, Begin LR, Wong N, Chappuis PO, Akslen LA, Foulkes WD, 2005. Placental cadherin and the basal epithelial phenotype of BRCA1-related breast cancer. Clin Cancer Res, 11(11):4003-4011.

224. Palacios J, Honrado E, Osorio A, Cazorla A, Sarrio D, Barroso A, Rodriguez S, Cigudo-sa JC, Diez O, Alonso C, Lerma E, Sanchez L, Rivas C, Benitez J, 2003. Immunohis-tochemical characteristics defined by tissue microarray of hereditary breast cancer not attributable to BRCA1 or BRCA2 mutations: differences from breast carcinomas aris-ing in BRCA1 and BRCA2 mutation carriers. Clin Cancer Res, 9(10 Pt 1):3606-3614.

225. Paredes J, Albergaria A, Carvalho S, Schmitt F, 2006. “Basal-like” Breast Carcinomas: Identification by P-cadherin, P63 and EGFR Basal Cytokeratins Expression. Applied Cancer Research, 26(2):41-55.

226. Paredes J, Milanezi F, Reis-Filho JS, Leitao D, Athanazio D, Schmitt F, 2002. Aberrant P-cadherin expression: is it associated with estrogen-independent growth in breast cancer? Pathol Res Pract, 198(12):795-801.

227. Ribeiro AS, Albergaria A, Sousa B, Correia AL, Bracke M, Seruca R, Schmitt FC, Pare-des J, 2010. Extracellular cleavage and shedding of P-cadherin: a mechanism under-lying the invasive behaviour of breast cancer cells. Oncogene, 29(3):392-402.

228. Ribeiro AS, Sousa B, Carreto L, Mendes N, Nobre AR, Ricardo S, Albergaria A, Cam-eselle-Teijeiro JF, Gerhard R, Soderberg O, Seruca R, Santos MA, Schmitt F, Paredes J, 2013. P-cadherin functional role is dependent on E-cadherin cellular context: a proof of concept using the breast cancer model. J Pathol, 229(5):705-718.

229. Paredes J, Correia AL, Ribeiro AS, Milanezi F, Cameselle-Teijeiro J, Schmitt FC, 2008. Breast carcinomas that co-express E- and P-cadherin are associated with p120-catenin cytoplasmic localisation and poor patient survival. J Clin Pathol, 61(7):856-862.

230. Vieira AF, Ribeiro AS, Dionisio MR, Sousa B, Nobre AR, Albergaria A, Santiago-Gomez A, Mendes N, Gerhard R, Schmitt F, Clarke RB, Paredes J, 2014. P-cadherin signals through the laminin receptor α6β4 integrin to induce stem cell and invasive properties in basal-like breast cancer cells. Oncotarget, 5(3):679-692.

231. Hardy RG, Tselepis C, Hoyland J, Wallis Y, Pretlow TP, Talbot I, Sanders DS, Matthews G, Morton D, Jankowski JA, 2002. Aberrant P-cadherin expression is an early event in hyperplastic and dysplastic transformation in the colon. Gut, 50(4):513-519.

232. Zhang CC, Yan Z, Zhang Q, Kuszpit K, Zasadny K, Qiu M, Painter CL, Wong A, Kraynov E, Arango ME, Mehta PP, Popoff I, Casperson GF, Los G, Bender S, Anderes K, Christensen JG, Vanarsdale T, 2010. PF-03732010: a fully human monoclonal an-

70


tibody against P-cadherin with antitumor and antimetastatic activity. Clin Cancer Res, 16(21):5177-5188.

233. Park J, Park E, Han SW, Im SA, Kim TY, Kim WH, Oh DY, Bang YJ, 2012. Down-regulation of P-cadherin with PF-03732010 inhibits cell migration and tumor growth in gastric cancer. Invest New Drugs, 30(4):1404-1412.

234. Bernardes N, Ribeiro AS, Abreu S, Mota B, Matos RG, Arraiano CM, Seruca R, Paredes J, Fialho AM, 2013. The bacterial protein azurin impairs invasion and FAK/Src signal-ing in P-cadherin-overexpressing breast cancer cell models. PLoS One, 8(7):e69023.

235. Sousa B, Ribeiro AS, Nobre AR, Lopes N, Martins D, Pinheiro C, Vieira AF, Albergaria A, Gerhard R, Schmitt F, Baltazar F, Paredes J, 2014. The basal epithelial marker P-cadherin associates with breast cancer cell populations harboring a glycolytic and acid-resistant phenotype. BMC Cancer, 14:734.

236. Thiery JP, Acloque H, Huang RY, Nieto MA, 2009. Epithelial-mesenchymal transitions in development and disease. Cell, 139(5):871-890.

237. Ribeiro AS, Paredes J, 2015. P-Cadherin Linking Breast Cancer Stem Cells and Inva-sion: A Promising Marker to Identify an "Intermediate/Metastable" EMT State. Front Oncol, 4(371):1-6.

238. Thiery JP, 2002. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer, 2(6):442-454.

239. Maeda M, Johnson KR, Wheelock MJ, 2005. Cadherin switching: essential for behav-ioral but not morphological changes during an epithelium-to-mesenchyme transition. Journal of Cell Science, 118(5):873-887.

240. Perou CM, Sorlie T, Eisen MB, Van De Rijn M, Jeffrey SS, Rees CA, Pollack JR, Ross DT, Johnsen H, Akslen LA, Fluge O, Pergamenschikov A, Williams C, Zhu SX, Lon-ning PE, Borresen-Dale AL, Brown PO, Botstein D, 2000. Molecular portraits of human breast tumours. Nature, 406(6797):747-752.

241. Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H, Hastie T, Eisen MB, Van De Rijn M, Jeffrey SS, Thorsen T, Quist H, Matese JC, Brown PO, Botstein D, Lonning PE, Borresen-Dale AL, 2001. Gene expression patterns of breast carcino-mas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A, 98(19):10869-10874.

242. Tsang JY, Au SK, Ni YB, Shao MM, Siu WM, Hui SW, Chan SK, Chan KW, Kwok YK, Chan KF, Tse GM, 2013. P-cadherin and vimentin are useful basal markers in breast cancers. Hum Pathol, 44(12):2782-2791.

243. Korsching E, Jeffrey SS, Meinerz W, Decker T, Boecker W, Buerger H, 2008. Basal carcinoma of the breast revisited: an old entity with new interpretations. J Clin Pathol, 61(5):553-560.

244. Matos I, Dufloth R, Alvarenga M, Zeferino LC, Schmitt F, 2005. p63, cytokeratin 5, and P-cadherin: three molecular markers to distinguish basal phenotype in breast carcinomas. Virchows Archiv, 447(4):688-694.

245. Livasy CA, Karaca G, Nanda R, Tretiakova MS, Olopade OI, Moore DT, Perou CM, 2006. Phenotypic evaluation of the basal-like subtype of invasive breast carcinoma. Mod Pathol, 19(2):264-271.

71


246. Rakha EA, El-Sayed ME, Green AR, Paish EC, Lee AH, Ellis IO, 2007. Breast car-cinoma with basal differentiation: a proposal for pathology definition based on basal cytokeratin expression. Histopathology, 50(4):434-438.

247. Vieira AF, Ricardo S, Ablett MP, Dionisio MR, Mendes N, Albergaria A, Farnie G, Ger-hard R, Cameselle-Teijeiro JF, Seruca R, Schmitt F, Clarke RB, Paredes J, 2012. P-cadherin is coexpressed with CD44 and CD49f and mediates stem cell properties in basal-like breast cancer. Stem Cells, 30(5):854-864.

248. De Wever O, Derycke L, Hendrix A, De Meerleer G, Godeau F, Depypere H, Bracke M, 2007. Soluble cadherins as cancer biomarkers. Clin Exp Metastasis, 24(8):685-697.

249. Okugawa Y, Toiyama Y, Inoue Y, Iwata T, Fujikawa H, Saigusa S, Konishi N, Tanaka K, Uchida K, Kusunoki M, 2012. Clinical significance of serum soluble E-cadherin in colorectal carcinoma. J Surg Res, 175(2):e67-73.

250. Repetto O, De Paoli P, De Re V, Canzonieri V, Cannizzaro R, 2014. Levels of soluble E-cadherin in breast, gastric, and colorectal cancers. Biomed Res Int, 2014:408047.

251. Katayama M, Hirai S, Yasumoto M, Nishikawa K, Nagata S, Otsuka M, Kamihagi K, Kato I, 1994. Soluble fragments of E-cadherin cell-adhesion molecule increase in urinary-excretion of cancer-patients, potentially indicating its shedding from epithelial tumor-cells. Int J Oncol, 5(5):1049-1057.

252. Katayama M, Hirai S, Kamihagi K, Nakagawa K, Yasumoto M, Kato I, 1994. Soluble E-cadherin fragments increased in circulation of cancer patients. Br J Cancer, 69(3):580-585.

253. Liang Z, Sun XY, Xu LC, Fu RZ, 2014. Abnormal expression of serum soluble E-cad-herin is correlated with clinicopathological features and prognosis of breast cancer. Med Sci Monit, 20:2776-2782.

254. Perez-Rivas LG, Jerez JM, Fernandez-De Sousa CE, De Luque V, Quero C, Pajares B, Franco L, Sanchez-Munoz A, Ribelles N, Alba E, 2012. Serum protein levels fol-lowing surgery in breast cancer patients: a protein microarray approach. Int J Oncol, 41(6):2200-2206.

255. Hofmann G, Balic M, Dandachi N, Resel M, Schippinger W, Regitnig P, Samonigg H, Bauernhofer T, 2013. The predictive value of serum soluble E-cadherin levels in breast cancer patients undergoing preoperative systemic chemotherapy. Clin Biochem, 46(15):1585-1589.

256. Figueira AC, Teodosio AS, Carvalheira J, Lacerda M, De Matos A, Gartner F, 2012. P-cadherin expression in feline mammary tissues. Vet Med Int, 2012:687424.

257. Dias Pereira P, Gärtner F, 2003. Expression of E-cadherin in normal, hyperplastic and neoplastic feline mammary tissue. The veterinary record 153(10):297-302.

258. Buendia AJ, Penafiel-Verdu C, Navarro JA, Vilafranca M, Sanchez J, 2014. N-cadherin expression in feline mammary tumors is associated with a reduced E-cadherin expres-sion and the presence of regional metastasis. Vet Pathol, 51(4):755-758.

259. Zappulli V, De Cecco S, Trez D, Caliari D, Aresu L, Castagnaro M, 2012. Immunohisto-chemical expression of E-cadherin and β-catenin in feline mammary tumours. J Comp Pathol, 147:161-170.

02AIMS AND OBJECTIVES

75

Aims and objectives Chapter 02

GENERAL AIMS

Cadherins are cell-to-cell adhesion glycoproteins with important roles in morphogenesis, development and maintenance of tissues and organs. Changes in these adhesion mol-ecules and their associated molecules, namely catenins, result in destabilization of the cell adhesion interfering with regulation process of differentiation of epithelial structures. Thus, loss of function, down or overexpression of cadherins and catenins are involved in the complex process of mammary carcinogenesis.

This study aims to characterize P-cadherin and associated molecules of the cadherin-catenin complex in feline mammary tumours in order to determine its contribution to tumou-rigenesis and to the invasive and metastatic behaviour of feline mammary carcinomas.

76

Chapter 02 Aims and objectives

SPECIFIC AIMS

This work consisted of several stages, namely:

1. Determination of P-cadherin expression in feline mammary tumours

The purposes of this study were to examine the expression of P-cadherin in a series of normal mammary gland tissues and spontaneous hyperplastic and tumour mammary le-sions, and to determine its relationship with the expression of E-cadherin as well as tumour clinicopathological features with potential prognostic value.

2. Determination of the expression of the molecules of cadherin-catenin complex in feline mammary tumours

In this study our purpose was to characterize the molecules that compose the cadherin–catenin complex in feline mammary tumours by assessing the immunoexpression of α-, β- and p120-catenin in a series of hyperplastic/dysplastic lesions and benign and malignant mammary tumours, determine the relation with the expression of classical P- and E-cad-herin and with clinicopathological parameters with potential prognostic value.

77

Aims and objectives Chapter 02

3. Contribute to the molecular characterization of feline mammary tumours

The intention was to contribute, by immunohistochemistry, for the molecular character-ization of hyperplastic/dysplastic, benign and malignant feline mammary tumours, using phenotypic markers (AE1AE3, vimentin, p63), hormone receptors (ER, PR) and cell-cycle associated molecules (Ki-67), as well as P- and E-cadherin. With this, we pretend to add knowledge to feline mammary molecular markers with assist in the determination of the biological behaviour of individual tumours, as well as with potential prognostic and therapeutic value.

4. Characterization of a feline mammary carcinoma cell line

There are still few and contradictory information about the cadherins and catenins role in feline mammary tumours. In this context, we search for a feline mammary carcinoma cell line in order to determine a suitable in vitro and in vivo model systems to evaluate the ex-pression and functions of cadherin-catenin complex molecules, namely P and E-cadherin, as well as α-, β-, and p120-catenin, point toward a better understanding of their role in feline mammary tumours progression.

5. Determination of the soluble P-cadherin serum levels in queens with mammary tumours

The ectodomain cleavage P-cadherin generates a soluble fragment (sP-cad) that may be increased during tumourigenesis. In this context we planned to determine the serum levels of the sP-cad fragment in a group of queens with spontaneous mammary lesions and in a group of healthy queens, in order to determine if sP-cad can be considered a tumour marker for mammary tumour in feline species as a diagnostic/prognostic marker, as well as in the follow-up monitoring.

03P-CADHERIN

EXPRESSION IN FELINEMAMMARY TUMOURS

81

P-cadherin expression in feline mammary tumours Chapter 03

ABERRANT P-CADHERIN EXPRESSIONIS ASSOCIATED TO AGGRESSIVE FELINE

MAMMARY CARCINOMAS

Ana Catarina Figueira, Catarina Gomes, Joana Tavares de Oliveira, Hugo Vilhena, Júlio Carvalheira, Augusto JF de Matos, Patrícia Dias Pereira and Fátima Gärtner

BMC Veterinary Research 2014,10:270

83


ABSTRACT

Background: Cadherins are calcium-dependent cell-to-cell adhesion glycoproteins play-ing a critical role in the formation and maintenance of normal tissue architecture. In normal mammary gland, E-cadherin is expressed by luminal epithelial cells, while P-cadherin is re-stricted to myoepithelial cells. Changes in the expression of classical E- and P-cadherin have been observed in mammary lesions and related to mammary carcinogenesis. P-cadherin and E-cadherin expressions were studied in a series of feline normal mammary glands, hy-perplastic/dysplastic lesions, benign and malignant tumours by immunohistochemistry and double-label immunofluorescence.

Results: In normal tissue and in the majority of hyperplastic/dysplastic lesions and be-nign tumours, P-cadherin was restricted to myoepithelial cells, while 80% of the malig-nant tumours expressed P-cadherin in luminal epithelial cells. P-cadherin expression was significantly related to high histological grade of carcinomas (p<0.0001), tumour necrosis (p=0.001), infiltrative growth (p=0.0051), and presence of neoplastic emboli (p=0.0401). Moreover, P-cadherin positive carcinomas had an eightfold likelihood of developing neo-plastic emboli than negative tumours. Cadherins expression profile in high grade and in in-filtrative tumours was similar, the majority expressing P-cadherin, regardless of E-cadherin expression status. The two cadherins were found to be co-expressed in carcinomas with aberrant P-cadherin expression and preserved E-cadherin.

Conclusions: The results demonstrate a relationship between P-cadherin expression and aggressive biological behaviour of feline mammary carcinomas, suggesting that P-cadherin may be considered an indicator of poor prognosis in this animal species. More-over, it indicates that, in queens, the aberrant expression of P-cadherin is a better marker of mammary carcinomas aggressive behaviour than the reduction of E-cadherin expression. Further investigation with follow-up studies in feline species should be conducted in order to evaluate the prognostic value of P-cadherin expression in E-cadherin positive carcinomas.

85


BACKGROUND

Cadherins are calcium-dependent cell-to-cell adhesion glycoproteins with critical roles in the formation and maintenance of normal tissue architecture [1-4], including in normal mamma-ry gland [4-7]. E-cadherin (epithelial) and P-cadherin (placental), are the best characterisedmembers of the cadherin superfamily [8], similarly expressed in normal mammary epithe-lium of different species, namely human [4,6,9-13], canine [14-17] and feline [18-20]: E-cad-herin is expressed by luminal epithelial cells while P-cadherin is restricted to myoepithelialcells. Changes in their expression have been observed in mammary tumours and related to mammary carcinogenesis, both in humans [5,9,11-13,21-27], dogs [14,16,17,28-30], as well as in cats [18-20,31,32]. Loss of expression and/or abnormal function of E-cadherin increase the ability of cells to invade neighbouring tissues, thus favouring mammary tumour progression and spread [4,13,33-35], whereas overexpression of P-cadherin is related to increased cell proliferation, motility, invasiveness, and metastatic progression, thus being considered an invasion-promoting protein in breast cancer [5,22,25,26,36-38]. Moreover, P-cadherin inhibition has anti-tumoural and anti-metastatic effects, suggesting that inter-rupting the P-cadherin signalling pathway may be a novel therapeutic approach for breast cancer [5,39,40].

Mammary gland tumours are the third most common neoplasm in queens and have been proposed as excellent model for the study of human mammary carcinogenesis, due to his-

86

Chapter 03 P-cadherin expression in feline mammary tumours

topathological and clinical similarities with human breast cancer [41,42]. As opposed to the large body of knowledge on E- and P-cadherin expressions in human breast carcinomas, there are only a few studies of these molecules in feline mammary tumours [18-20,31,32,43], and their role is still poorly understood in this species. Studies on E-cadherin protein in feline mammary tumours demonstrated its reduction or absent expression in carcinomas when compared to benign lesions [18,19,31,32]. The prognostic value of this molecule in feline carcinomas is still controversial: while no statistically significant association between E-cadherin expression and tumour histological grade has been found [31], one study dem-onstrated a negative correlation between E-cadherin expression and regional lymph node metastases at the time of diagnosis [31], however another revealed no correlation between the expression of E-cadherin and survival, recurrence or metastases [19].

To the best of our knowledge, only one study addressed the P-cadherin expression in feline mammary tumours, demonstrating that the protein is aberrantly expressed by neoplastic epi-thelial cells in malignant tumours and significantly associated to high grade carcinomas [20].

The purposes of this study were to examine the expression of P-cadherin in a series of normal mammary gland tissues and spontaneous hyperplastic and tumour mammary le-sions, and to determine its relationship with the expression of E-cadherin as well as tumour clinicopathological features with recognized prognostic value [44-49], namely neoplastic intravascular emboli and lymph node metastases.

87


MATERIAL AND METHODS

Tissue samples

Samples from 75 queens with naturally occurring mammary lesions, surgically excised with curative intents, and nine normal mammary glands (obtained from queens that were hu-manely euthanized for reasons not related to a neoplastic disease) were included in this study. In each case an informed consent was granted by the owners. All specimens were fixed in 10% neutral buffered formalin. After tissue dehydration and embedding in paraffin wax, sequential 2 μm sections were cut from each block. One section was stained with haematoxylin and eosin (HE) for routine histological examination and diagnosis, and sub-sequent sections were used for immunohistochemical studies. When available, local and regional lymph nodes were processed and examined for the presence of metastases.

The histological classification of tumours was independently performed by three observers (ACF, PDP and FG) based on the criteria of the World Health Organization (WHO) for the histological classification of mammary tumours of domestic animals [50].

Carcinomas were graded in accordance with the Nottingham grading system for human breast carcinomas [51]. Grading was based on the assessment of three morphological features: degree of tubule formation, nuclear pleomorphism, and mitotic counts, and tu-

88


mours were classified as grade I (well differentiated), grade II (moderately differentiated) and grade III (poorly differentiated) [51]. Variables with known prognostic value, such as the mode of growth (infiltrative or expansive), tumour largest diameter (<2 cm, 2–3 cm, >3 cm), presence of necrosis, skin ulceration, lymph node metastases, and presence of intravascu-lar neoplastic emboli [41,44], were also recorded.

Evaluation of P-cadherin and E-cadherin immunohistochemistry labelling

Immunohistochemistry (IHC) was performed using a polymer based system (Novolink Max Polymer Detection System, Product No: RE7280-K Leica Biosystems, Newcastke, UK), according to the manufacturer’s instructions. Sections were dewaxed in xylene, rehydrated through graded alcohols and treated with extran for 10 minutes in microwave oven for an-tigen retrieval. Endogenous peroxidase activity was blocked by treating the sections with hydrogen peroxide 3% in methanol for 10 minutes and rinsed in Tris-buffered saline (TBS, pH 7.6, 0.5 M). Sections were incubated overnight at 4°C in a humid chamber with a specific mouse anti-human monoclonal antibody against P-cadherin (clone 56, BD Transduction Laboratories, Lexington, Kentucky, USA) directed at the extracellular domain of this adhe-sion molecule, and a specific mouse anti-monoclonal antibody against E-cadherin (clone 4A2C7, Zymed/Invitrogen, Camarillo, CA, USA) that recognizes the cytoplasmic domain of this molecule. The antibodies were diluted 1:50 in TBS with 5% bovine serum albumin (BSA). Labelling was visualized with 3,3’-diaminobenzidine (DAB) incubated at room tem-perature and sections were then counterstained with Mayer’s haematoxilin, dehydrated and mounted. For negative controls, the primary antibody was replaced by TBS. Sections of feline normal mammary gland were used as positive controls. In the sections of mammary lesions, adjacent normal mammary tissues or skin were also used as internal positive con-trols.

In the lymph nodes sections, additional immunohistochemical analysis was performed in order to determine the presence of tumour cell micrometastases, as suggested by Matos et al. (2006) [52]. However, we used the antibody antipancytokeratin AE1/AE3 and anti-p63 protein, since p63 protein is a sensitive and highly specific marker of myoepithelial cells [53].

Assessment of P-cadherin expression was based on a semi quantitative analysis, accord-ing to the percentage of immunoreactive luminal epithelial cells with membranous and/or cytoplasmic patterns, and graded as 0 - <10%, 1 - 10-25%, 2 - 26-50% and 3 - >50%. For statistical analysis, cases with less than 10% positive luminal epithelial cells were consid-ered negative and those with ≥10% stained cells were considered positive [16,20].

E-cadherin expression was assessed semi quantitatively in accordance with the percent-age of immunoreactive luminal epithelial cells with membranous labelling, and graded as

89


0 - <25%, 1 - 25-50%, 2 - 51-75% and 3 - >75% [54]. Cases with >75% stained cells were considered to have preserved expression and those with ≤75% positive cells as having re-duced expression of E-cadherin [55].

To evaluate the combined expression of P-cadherin and E-cadherin, samples were grouped according to the expression of both molecules as P

+/E

+, P

+/E

−, P

−/E

+, and P

−/E

−, (P

+= P

−

cadherin positive; P− = P-cadherin negative; E

+ = Preserved E-cadherin; E

− = Reduced

E-cadherin) [56].

Evaluation of P-cadherin and E-cadherin double-labelling immunofluorescence

Double-label immunofluorescence (DIF) was performed for simultaneous visualization of P- and E-cadherin expressions. Tissue sections of normal mammary gland, hyperplastic/dysplastic lesions, benign and malignant mammary tumours were selected and sections with neoplastic intravascular emboli and lymph node metastases were also included.

Tissue sections were dewaxed in xylene, rehydrated through a series of graded alcohols and treated with extran for 10 minutes in microwave oven for antigen retrieval. Then, tis-sues sections were blocked with 10% BSA for 20 minutes, followed by incubation with the primary antibodies mouse anti P-cadherin (mouse anti-human monoclonal antibody against P-cadherin, clone 56, BD Transduction Laboratories, Lexington, Kentucky, USA) and rabbit anti E-cadherin (rabbit anti-human monoclonal antibody against E-cadherin, clone 24E10, Cell Signaling Technology, MA, USA) diluted 1:50 and 1:100, respectively, in 5% BSA for two hours in a wet chamber. After washing in phosphate buffered saline (PBS), slides were incubated with Alexa Fluor® 488 goat anti-mouse IgG (A11029, Life Technology, Carlsbad, CA, USA) and Alexa Fluor® 594 goat anti-rabbit IgG (A11037, Life Technology, Carlsbad, CA, USA) secondary antibodies diluted 1:500 in 5% BSA, for one hour. Washes were per-formed with PBS and slides incubated with 4,6-diamidine-2-phenylindolendihydrochoride (DAPI) 100 μg/mL for 15 minutes. Slides were mounted in glycerol-based Vectashield me-dium (Vector, Burlingame, CA, USA).

Immunostained sections were analyzed by fluorescence microscopy (Zeiss Imager Z1 mi-croscope) with appropriated filters. Separate images for Alexa 488 and Alexa 594 were captured at x200 magnification and then merged to allow for the visualization of P-cadherin and E-cadherin double immunostaining. For negative controls, the primary antibody was replaced by PBS.

90


Statistical methods

Data was organized in contingency tables and the likelihood ratio chi-square test of asso-ciations was used to determine the significance of the relationship between the expression of the cadherins and the tumours’ clinicopathological parameters. Whenever biologically consistent, 2x2 tables of contingency were built and Fisher’s exact test was performed. The odds ratio was calculated to estimate the relative risk of lymph node metastasis and neoplastic intravascular emboli in tumours expressing P- and E-cadherin molecules, with a confidence interval of 95%. All statistical analysis was performed using SAS/STAT, 1989 (SAS Institute Inc., Cary, NC, USA) [57] and, in all instances, p <0.05 was considered to be statistically significant.

91


RESULTS

The present study comprised 9 normal mammary gland samples, 13 hyperplastic/dysplastic le-sions (7 fibrocystic diseases and 6 fibroadenomatous changes), 10 benign tumours (7 simple ad-enomas and 3 fibroadenomas) and 60 malignant tumours (32 tubulopapillary carcinomas, 16 solid carcinomas, 4 cribriform carcinomas, 6 mucinous carcinomas and 2 carcinosarcomas). Seven malignant tumours were grade I, 25 grade II and 28 grade III. Twenty-one carcinomas (36.21%) had neoplastic intravascular emboli and, within the 35 cases where lymph nodes were available, 18 (51.43%) had metastases.

P-Cadherin and E-cadherin expression by immunohistochemistry

In normal mammary tissue, the expression of P-cadherin was restricted to myoepithelial cells surrounding lobular and ductal structures (Figure 1Aa). However, in lobules with secretory activity P-cadherin was present in the cytoplasm of luminal epithelial cells as well as in the secretion.

92


Figure 1

P- and E-cadherin expression by immunohistochemistry (IHC) and by double-label immunofluores-cence (DIF) in feline mammary tissue. A. P-cadherin immunohistochemistry (IHC) - (a) Normal mammary gland with strong expression of P-cadherin by myoepithelial cells and lack of immunoreactivity in luminal epithelial cells. x400; (b) Strong P-cadherin ex-pression in high atypical neoplastic cells from a grade III tubulopapillary carcinoma. x200; (c) Neoplastic in-travascular embolus showing strong P-cadherin expression. x400; (d) Lymph node metastases showing P-cadherin expression by neoplastic cells. x100.B. P- and E-cadherin double-label immunofluorescence (DIF) - (a) Normal mammary gland tissue with P-cad-herin in myoepithelial cells (green colour) and E-cadherin in luminal epithelial cells (red colour). x200; (b) Tu-bulopapillary carcinoma with tumour cell populations co-expressing P-cadherin and E-cadherin (yellow colour). x200; (c) Neoplastic intravascular embolus. x200. and (d) lymph node metastatic cells. x200. with a pattern of expression similar to primary malignant neoplasia, with tumour cell populations co-expressing P-cadherin and E-cadherin (yellow colour).

A similar staining pattern to normal mammary tissue was evident in the majority (84.62%) of hyper-plastic mammary lesions, although two fibroadenomatous changes exhibited P-cadherin expres-sion in 10 to 25% of luminal epithelial cells. In benign tumours, P-cadherin was restricted to myo-epithelial cells in most cases (70%). All 7 simple adenomas were P-cadherin negative while the three fibroadenomas were positive, one with 10-25% and the other two with 26-50% positive cells.

AP-cadherin E-cadherin

BP-cadherin Merge

Lym

ph n

ode

met

asta

ses

Intra

vasc

ular

neop

last

ic e

mbo

lus

Tubo

lopa

pilla

ryca

rcin

oma

Nor

mal

mam

mar

y gl

and

a

b

c

d

93


Within the 60 malignant tumours, 48 (80%) had aberrant luminal epithelial P-cadherin ex-pression (Figure 1Ab), most noticeable in the tumour periphery, in invasive clusters, in tubulopapillary areas and in the most atypical cells (large cells, with bizarre shapes, large nucleus, multiple nucleolus). In mucinous carcinomas, the cells surrounding mucus were P-cadherin positive although the mucus itself was negative. P-cadherin expression was also observed in squamous cells, particularly in the most undifferentiated basal cells, and in the mesenchymal cells component of carcinosarcomas.

P-cadherin expression was analysed in the neoplastic intravascular emboli of 16 malig-nant tumours (in 5 cases no representative sections for immunohistochemical evaluation were available) and 18 lymph node metastases. Amongst the former, 13 (81.25%) were P-cadherin positive (Figure 1Ac) and 17 (94.4%) of the later were also P-cadherin positive (Figure 1Ad).

E-cadherin was expressed at the membrane of more than 75% acinar and ductal luminal epithelial cells of normal mammary gland samples, while myoepithelial cells were E-cad-herin negative. Eleven (84.6%) hyperplastic lesions preserved this pattern of expression, while two cases of fibrocystic disease had less than 75% positive cells. Benign tumours preserved E-cadherin expression by luminal epithelial cells, except in one simple adenoma where only 51-75% of the epithelial cells were stained.

E-cadherin immunohistochemical expression was reduced in almost half (46.67%) of the malignant tumours. Five of the six mucinous carcinomas showed reduced E-cadherin ex-pression, most obvious in the areas with mucus secretion; the mucus itself did not stain for E-cadherin. Squamous cells stained positive while mesenchymal and myoepithelial cells were negative to this protein.

Intravascular emboli of 17 malignant tumours were evaluated for E-cadherin expression (in four cases it was not possible to obtain representative sections for evaluation) and the pro-tein was expressed by more than 75% cells in 13 cases (76.5%). More than half (55.6%) of the 18 lymph node metastases had more than 75% cells expressing E-cadherin.

P-Cadherin and E-cadherin expression by double-labelling immunofluorescence

The P-cadherin and E-cadherin double-labelling immunofluorescence analysis demonstrated that they were expressed in normal, hyperplastic and benign mammary tissues in different cell types, with luminal epithelial cells expressing E-cadherin, while myoepithelial/basal cells ex-pressed P-cadherin (Figure 1Ba). In carcinomas it was possible to observe aberrant P-cadherin expression by luminal epithelial cells, frequently co-expressed with E-cadherin (Figure 1Bb), particularly at the peripheral invasive front. The same expression pattern was observed in the intravascular neoplastic emboli (Figure 1Bc) and in lymph node metastases (Figure 1Bd).

94


Relationship between the expression of P-cadherin, E-cadherin and clinicopathological parameters

Benign and malignant tumours diverged significantly with respect to both P- and E-cadherin immunoexpression, with most of the malignant tumours (80%) overexpressing P-cadherin and the vast majority of the benign tumours (90%) preserving the expression of E-cadherin (Table 1). When the combined expression of P- and E-cadherin was considered, most (60%) of the benign tumours were P

−/E

+ while the most common pattern in malignant tumours was

P+/E

− (41.67%).

Table 1. Cadherin expression profiles of benign and malignant tumours

Tumour type

n

P-cadherin E-cadherin P-cadherin/E-cadherin

Negative Positive Preserved Reduced +/+ +/– –/+ –/–Benign 10 7 3 9 1 3 0 6 1

Malignant 60 12 48 32 28 23 25 9 3

p 0.0029 0.0384 0.0027

In malignant tumours, there was a statistically significant association between P-cadherin overexpression and higher histological grade, presence of necrosis, infiltrative mode of growth, and neoplastic intravascular emboli (Table 2). In the majority of malignant tumours, the expression of P-cadherin by neoplastic intravascular emboli and lymph node metastases was similar to that observed in corresponding primary tumours (81.25%, p=0.0012 and 77.78%, p=0.0008, respectively). Furthermore, the expression of P-cadherin was associ-ated to a nearly 8.5 odds ratio for vascular invasion.

The reduced expression of E-cadherin, although significantly related to the malignant his-tological tumour type (p = 0.0243), was not related with the other parameters; neither there was a statistical significant association between the expression of E-cadherin in primary tumours and in their neoplastic intravascular emboli and lymph node metastases.

The P-cadherin/E-cadherin combined expression patterns were significantly associated with histological grade of carcinomas, mode of growth and presence of necrosis. In fact, 71.4% of grade I tumours were P

−/E

+, while nearly 90% of grade II and III tumours (n=53)

were P+/E

− (n = 25, 47.2%) or P

+/E

+ (n = 23, 43.4%). All tumours with expansive growth were

P−/E

+, a staining pattern that was present in less than 10% of the infiltrative ones. Half of the

tumours with necrosis were P+/E

−, while the most common pattern of non-necrotic cases

was P−/E

+ (41.67%).

95


Table 2. Cadherin expression profiles and clinicopathological parameters of malignant tumoursClinicopathological parameters

n P-cadherin E-cadherin P-cadherin/E-cadherinNegative Positive Preserved Reduced +/+ +/– –/+ –/–

Histological type

Tubulopapillary carcinoma

Solid carcinoma

Cribriform carcinoma

Mucinous carcinoma

Carcinosarcoma

32

16

4

6

2

8

3

1

0

0

24

13

3

6

2

16

9

4

1

2

16

7

0

5

0

11

6

3

1

2

13

7

0

5

0

5

3

1

0

0

3

0

0

0

0

p NS 0.0243 NS

Histological grade*

Grade I

Grade II

Grade III

7

25

28

7

2

3

0

23

25

5

12

12

2

13

13

0

10

13

0

13

12

5

2

2

2

0

1

p <0.0001 NS <0.0001Mode of growth**

Expansive

Infiltrative

3

56

3

6

0

48

3

28

0

28

0

23

0

25

2

5

0

3

p 0.0051 NS 0.0044

Tumour largest diameter

<2 cm

2–3 cm

>3 cm

33

10

17

7

2

3

26

8

14

19

7

6

14

3

11

13

5

5

13

3

9

6

2

1

1

0

2

p NS NS NS

Ulceration

Absent

Present

48

12

10

2

38

10

27

5

21

7

19

4

19

6

8

1

2

1

p NS NS NS

Necrosis

Absent

Present

12

48

7

5

5

43

9

23

3

25

4

19

1

24

5

4

2

1

p 0.0010 NS 0.0026Neoplastic intravascular emboli

Absent

Present

37

21

11

1

26

20

19

12

18

9

11

11

15

9

8

1

3

0

p 0.0401 NS NS

Odds ratio 8.4615 (1.0071-71.0959)Lymph node metastases

Absent

Present

17

18

3

0

14

18

10

10

7

8

7

10

7

8

3

0

0

0

p NS NS NS

NS -not significant. *According to Elston & Ellis, (1998) [51]. **In one case the margins were not included in sample.

96


DISCUSSION

In the present work, feline normal mammary tissue presented E-cadherin expression in luminal epithelial cells and P-cadherin in myoepithelial cells of lobular and ductal struc-tures, without any evidence of overlapping between the two cadherins, similarly to what is described in normal mammary gland tissue in humans [4,6,9-13], dogs [14-17] and cats [18-20]. In lactating or pseudolactating mammary tissue, P-cadherin immunoreactivity was observed in the cytoplasm of luminal epithelial cells and in luminal secretion, in line with data from previous studies in human breast [58] and canine mammary gland [59]. It is be-lieved that P-cadherin is not just an adhesion molecule, also acting as a signalling protein involved in breast tissue remodelling, and that its soluble fragment present in human milk may result from the proteolysis of the extracellular domain [58,59].

In this series, a significant overexpression of P-cadherin by luminal epithelial cells was ob-served in carcinomas, when compared to benign mammary tumours. Furthermore, P-cad-herin expression was positive in all mucinous carcinomas and carcinosarcomas a fact that points to a basal/myoepithelial cell histogenesis origin or line of differentiation of these tu-mour types [16,60,61], since P-cadherin is a well-recognized biomarker of basal mammary carcinomas in humans [6,62-65]. However, the association between P-cadherin expression and the histological type of carcinomas was not achieved in the present study, has not been

97


yet demonstrated in humans [5] and is not consensual in other animal models such as dogs [16,56]. A significant association was found between P-cadherin expression and histologi-cal grade of carcinomas, as previously reported by other authors in human breast cancer [11,21,23,24,26,27,62,66-68] and canine mammary tumours [16,56], suggesting that this molecule may be regarded as a prognostic indicator of aggressiveness in feline mammary carcinomas. Moreover, P-cadherin expression was more evident in the most periphery cells of the tumour and in the invasive clusters, denoting its importance in invasion and re-enforc-ing its value as a marker of adverse behaviour in feline mammary carcinomas.

To the best of our knowledge, this is the first study addressing the association between the expression of P-cadherin and the invasive/metastatic capacity of feline mammary tumours. All tumours with lymph node metastases and all, except one, with evident neoplastic intra-vascular emboli were P-cadherin positive, which indicates that the aberrant expression of P-cadherin may constitute an important step in the invasion/metastatic process. This hypoth-esis is reinforced by the fact that P-cadherin positive tumours were 8.46 times more likely to invade vessels than negative tumours. However, this result must be regarded with caution, since the wide confidence interval (CI) reveals a low precision of the estimate. Although in human breast cancer P-cadherin overexpression has been associated with decreased sur-vival and relapse-free intervals [36,64], other studies failed to find a significant association between P-cadherin and lymph node metastases at the time of diagnosis [11,21,27]; how-ever, Gamallo et al. (2001) found an association between P-cadherin expression and lymph node-positive breast tumours [26]. In this study we failed to establish a relationship between P-cadherin expression and lymph node metastases. Our findings suggest that, in spite of the importance of this cadherin in infiltrative/invasive process (increased cell motility, vas-cular invasion), the arrest and establishment of neoplastic cells in sites of metastases may require the acquisition of other morphological and functional features, not so closely related to P-cadherin. To the best of our knowledge there are no survival studies in feline mammary tumours related with P-cadherin expression.

Nearly half of the carcinomas included in this series exhibited reduced E-cadherin expres-sion, a significant difference compared to benign tumours, where only one case showed E-cadherin down-expression. An association was also established between specific histologi-cal types of carcinomas and the E-cadherin expression pattern. All cribriform carcinomas and carcinosarcomas showed preserved E-cadherin expression, while the majority of mu-cinous carcinomas had a reduced expression of the protein. In cats, E-cadherin expression has been documented to be reduced in tubulopapillary [19], cribriform and solid carcinomas [18], although the statistical significance of such associations has never been assessed. Moreover, several studies demonstrated that a reduced/loss membrane expression of E-cadherin is significantly associated with histological types of mammary tumours, namely lobular carcinomas in women [9,10,13,69] and solid carcinomas in bitches [15,17,54,56,70]. In our study, E-cadherin expression was not related to histological grade of carcinomas. In fact, the association between this two factors is not consensual both in humans [9,10,71]

98


and dogs [54,56] and the studies performed in cats have not proved this association, to date [19,31].

In the present study, the expression of E-cadherin was not associated to the presence of neoplastic intravascular emboli and lymph node metastases, corroborating the human breast cancer [4,9,10,72-74] and feline mammary tumours [19,31] literature in which there is no consensus regarding the prognostic value of E-cadherin. Furthermore, and in accor-dance with previous studies [72,75], the pattern of E-cadherin expression differ between pri-mary tumours and their lymph node metastases, reinforcing the concept that, during breast carcinoma progression, there is a dynamic and reversible modulation of the E-cadherin complex [4,76,77].

When analysing the combined expression of P- and E-cadherin, two different patterns emerged: while 90% of the benign tumours preserved the expression of E-cadherin, irre-spective of the P-cadherin status, 80% of the malignant tumours exhibited an overexpres-sion of P-cadherin, independently of the E-cadherin staining pattern. These results suggest that the abnormal expression of P-cadherin is a better indicator of the malignant potential of feline mammary neoplasm than the loss of E-cadherin. Furthermore, the combined ex-pression of P- and E-cadherin was significantly associated with the histological grade of the tumours, with the majority (90%) of grade II and III carcinomas exhibiting a P

+/E

+ or P

+/

E− immunophenotype. The fact that half of the grade III P

+ malignant tumours were also

E+ deserves the evaluation of the prognostic value of aberrant P-cadherin expression in a

context of preserved E-cadherin expression through follow-up studies. Ribeiro et al. (2013) hypothesized that, in breast cancer cells, the E- and P-cadherin co-expression could be involved in a more aggressive biological behaviour, and that the establishment of strong adhesion complexes is compromised by the interaction of both molecules at the cell mem-brane [74]. Moreover, they demonstrate that E

+/P

+ cells have deregulated cadherin/catenin

complexes at the cellular membrane, when compared with cells expressing only one of the cadherins and have a higher invasive capacity [74]. In fact, P-cadherin overexpression in an E-cadherin wild type context leads to disruption of the interaction between E-cadherin and intracellular catenins, an alternative mechanism for cancer invasion [5,74,78,79]. The co-expression of both molecules was significantly correlated with high-grade, biologically aggressive, breast carcinomas and poor patient survival [5,39,74].

The association between P- and E-cadherin expression and four clinicopathological param-eters with known prognostic value in feline mammary tumours, namely ulceration [46,47], necrosis [47], infiltrative growth [44], and tumour largest diameter [47-49], was also ad-dressed in this study. Interestingly, the E- and P-cadherin immunostaining pattern observed in infiltrative carcinomas was very similar to the findings in grade III tumours, i.e. the ma-jority expressing P-cadherin, and surprisingly, nearly half of the P

+ infiltrative carcinomas

preserved E-cadherin expression. This is in accordance with data from immunofluores-

99


cence analysis that revealed P- and E-cadherin co-expression, particularly at the malignant tumour periphery. When considered together (neoplastic intravascular emboli and/or lymph node metastases), none of the invasive tumours was P

−/E

−, suggesting that the simple re-

duction of E-cadherin, when not accompanied by an aberrant expression of P-cadherin, is insufficient for an invasive tumour behaviour. Furthermore, more than half of the P-cadherin positive tumours associated with vascular emboli and lymph node metastases were also E-cadherin positive. In fact, in P

+/E

+ malignant tumours, double immunofluorescence evi-

denced a co-expression of the two cadherins, a pattern also observed in the intravascular neoplastic emboli and in lymph nodes metastatic cells. These results reinforce the need for the study of the prognostic value of P-cadherin positivity in tumours that preserve E-cadherin expression in feline mammary species.

Besides its prognostic value, P-cadherin has been recently considered as a therapeutic target. A highly selective human monoclonal antibody against P-cadherin (PF-03732010, Pfizer, Inc) may constitute a novel anticancer therapy in high P-cadherin expressing tu-mours [40]. Furthermore, azurin is pointed as a therapeutic tool for poor-prognosis breast carcinomas overexpressing P-cadherin in a wild type E-cadherin context [39]. Within this scenario, the highly aggressive P-cadherin positive feline mammary tumours with preserved E-cadherin expression may benefit from one of these novel therapeutic approaches.

100


CONCLUSIONS

The present study demonstrated an association between the aberrant expression of P-cadherin and a malignant phenotype, higher histological grade and invasive behaviour, sug-gesting that this protein may constitute a reliable independent biomarker of poor prognosis in feline mammary tumours. Moreover, it suggests that P-cadherin aberrant expression may represent a relevant prognostic factor, being associated with an aggressive biological be-haviour in feline mammary carcinomas, better than the reduction of E-cadherin expression. The prognostic value of P-cadherin expression in E-cadherin positive carcinomas in feline species should be evaluated in further investigation with follow-up studies.

101


REFERENCES

1. Angst BD, Marcozzi C, Magee AI, 2001. The cadherin superfamily: diversity in form and function. J Cell Sci, 114(4):629–641.

2. Takeichi M, 1991. Cadherin cell adhesion receptors as a morphogenetic regulator. Science, 251:1451–1455.

3. Takeichi M, 1995. Morphogenetic roles of classic cadherins. Curr Opin Cell Biol, 7(5):619–627.

4. Wheelock MJ, Soler AP, Knudsen KA, 2001. Cadherin junctions in mammary tumors. J Mammary Gland Biol Neoplasia, 6(3):275–285.

5. Albergaria A, Ribeiro AS, Vieira AF, Sousa B, Nobre AR, Seruca R, Schmitt F, Pare-des J, 2011. P-cadherin role in normal breast development and cancer. Int J Dev Biol, 55:811–822.

6. Paredes J, Correia AL, Ribeiro AS, Albergaria A, Milanezi F, Schmitt FC, 2007. P-cadherin expression in breast cancer: a review. Breast Cancer Res, 9(5):214.

7. Nollet F, Kools P, van Roy F, 2000. Phylogenetic analysis of the cadherin superfamily allows identification of six major subfamilies besides several solitary members. J Mol Biol, 299(3):551–572.

8. Nose A, Takeichi M, 1986. A novel cadherin cell adhesion molecule: its expression patterns associated with implantation and organogenesis of mouse embryos. J Cell Biol, 103(6 Pt 2):2649–2658.

102


9. Gamallo C, Palacios J, Suarez A, Pizarro A, Navarro P, Quintanilla M, Cano A, 1993.Correlation of E-cadherin expression with differentiation grade and histological type in breast carcinoma. Am J Pathol, 142(4):987–993.

10. Parker C, Rampaul RS, Pinder SE, Bell JA, Wencyk PM, Blamey RW, Nicholson RI, Robertson JF, 2001. E-cadherin as a prognostic indicator in primary breast cancer. Br J Cancer, 85(12):1958–1963.

11. Palacios J, Benito N, Pizarro A, Suarez A, Espada J, Cano A, Gamallo C, 1995. Anoma-lous expression of P-cadherin in breast carcinoma. Correlation with E-cadherin expres-sion and pathological features. Am J Pathol, 146(3):605–612.

12. Cowin P, Rowlands TM, Hatsell SJ, 2005. Cadherins and catenins in breast cancer. Curr Opin Cell Biol, 17(5):499–508.

13. Berx G, Van Roy F, 2001. The E-cadherin/catenin complex: an important gatekeeper in breast cancer tumorigenesis and malignant progression. Breast Cancer Res, 3(5):289–293.

14. Restucci B, Papparella S, De Vico G, Maiolino P, 1997. E cadherin expression in normal and neoplastic canine mammary gland. J Comp Pathol, 116(2):191–202.

15. Sarli G, Preziosi R, De Tolla L, Brunetti B, Benazzi C, 2004. E-cadherin immunoreactiv-ity in canine mammary tumors. J Vet Diagn Investig, 16(6):542–547.

16. Gama A, Paredes J, Albergaria A, Gärtner F, Schmitt F, 2004. P-cadherin expression in canine mammary tissues. J Comp Pathol, 130(1):13–20.

17. Reis AL, Carvalheira J, Schmitt FC, Gartner F, 2003. Immunohistochemical study of the expression of E-cadherin in canine mammary tumours. Vet Rec, 152(20):621–624.

18. Dias Pereira P, Gartner F, 2003. Expression of E-cadherin in normal, hyperplastic and neoplastic feline mammary tissue. Vet Rec, 153(10):297–302.

19. Zappulli V, De Cecco S, Trez D, Caliari D, Aresu L, Castagnaro M, 2012. Immunohisto-chemical expression of E-cadherin and β-catenin in feline mammary tumours. J Comp Pathol, 147:161–170.

20. Figueira AC, Teodosio AS, Carvalheira J, Lacerda M, de Matos A, Gartner F, 2012. P-cadherin expression in feline mammary tissues. Vet Med Int, 2012:687424.

21. Paredes J, Albergaria A, Oliveira JT, Jeronimo C, Milanezi F, Schmitt FC, 2005. P-cad-herin overexpression is an indicator of clinical outcome in invasive breast carcinomas and is associated with CDH3 promoter hypomethylation. Clin Cancer Res, 11(16):5869–5877.

22. Paredes J, Stove C, Stove V, Milanezi F, Van Marck V, Derycke L, Mareel M, Bracke M, Schmitt F, 2004. P-cadherin is up-regulated by the antiestrogen ICI 182,780 and pro-motes invasion of human breast cancer cells. Cancer Res, 64(22):8309–8317.

23. Peralta Soler A, Knudsen KA, Salazar H, Han AC, Keshgegian AA, 1999. P-cadherin expression in breast carcinoma indicates poor survival. Cancer, 86(7):1263–1272.

24. Paredes J, Milanezi F, Viegas L, Amendoeira I, Schmitt F, 2002. P-cadherin expression is associated with high-grade ductal carcinoma in situ of the breast. Virchows Arch, 440(1):16–21.

25. Vieira AF, Ricardo S, Ablett MP, Dionisio MR, Mendes N, Albergaria A, Farnie G, Ger-

103


hard R, Cameselle-Teijeiro JF, Seruca R, Schmitt F, Clarke RB, Paredes J, 2012. P-cadherin is coexpressed with CD44 and CD49f and mediates stem cell properties in basal-like breast cancer. Stem Cells, 30(5):854–864.

26. Gamallo C, Moreno-Bueno G, Sarrio D, Calero F, Hardisson D, Palacios J, 2001. The prognostic significance of P-cadherin in infiltrating ductal breast carcinoma. Mod Pathol, 14(7):650–654.

27. Kovacs A, Dhillon J, Walker RA, 2003. Expression of P-cadherin, but not E-cadherin or N-cadherin, relates to pathological and functional differentiation of breast carcinomas. Mol Pathol, 56(6):318–322.

28. De Matos AJ, Lopes CC, Faustino AM, Carvalheira JG, Rutteman GR, Gärtner MF, 2007. E-cadherin, β-catenin, invasion and lymph node metastases in canine malignant mammary tumours. APMIS, 115(4):327–334.

29. Nowak M, Madej JA, Dziegiel P, 2007. Expression of E-cadherin, β-catenin and Ki-67 antigen and their reciprocal relationships in mammary adenocarcinomas in bitches. Folia Histochem Cytobiol, 45(3):233–238.

30. Restucci BM, Martano P, Esposito M, De Filippis G, Borzacchiello D, Lo Muzio GL, 2007. Expression of β-catenin, E-cadherin and APC in Canine mammary tumors. Anticancer Res, 27:3083–3090.

31. Penafiel-Verdu C, Buendia AJ, Navarro JA, Ramirez GA, Vilafranca M, Altimira J, San-chez J, 2012. Reduced expression of E-cadherin and β-catenin and high expression of basal cytokeratins in feline mammary carcinomas with regional metastasis. Vet Pathol, 49(6):979–987.

32. Buendia AJ, Penafiel-Verdu C, Navarro JA, Vilafranca M, Sanchez J, 2014. N-cadherin expression in feline mammary tumors is associated with a reduced E-cadherin expres-sion and the presence of regional metastasis. Vet Pathol, 51(4):755–758

33. Semb H, Christofori G, 1998. The tumor-suppressor function of E-cadherin. Am J Hum Genet, 63(6):1588–1593.

34. Knudsen KA, Wheelock MJ, 2005. Cadherins and the mammary gland. J Cell Biochem, 95(3):488–496.


36. Paredes J, Figueiredo J, Albergaria A, Oliveira P, Carvalho J, Ribeiro AS, Caldeira J, Costa AM, Simoes-Correia J, Oliveira MJ, Pinheiro H, Pinho SS, Mateus R, Reis CA, Leite M, Fernandes MS, Schmitt F, Carneiro F, Figueiredo C, Oliveira C, Seruca R, 2012. Epithelial E- and P-cadherins: role and clinical significance in cancer. Biochim Biophys Acta, 1826(2):297–311.

37. Paredes J, Lopes N, Milanezi F, Schmitt FC, 2007. P-cadherin and cytokeratin 5: use-ful adjunct markers to distinguish basal-like ductal carcinomas in situ. Virchows Arch, 450(1):73–80.

38. Vieira AF, Ribeiro AS, Dionisio MR, Sousa B, Nobre AR, Albergaria A, Santiago-Gomez A, Mendes N, Gerhard R, Schmitt F, Clarke RB, Paredes J, 2014. P-cadherin signals through the laminin receptor α6β4 integrin to induce stem cell and invasive properties in

104


basal-like breast cancer cells. Oncotarget, 5(3):679–692.39. Bernardes N, Ribeiro AS, Abreu S, Mota B, Matos RG, Arraiano CM, Seruca R, Paredes

J, Fialho AM, 2013. The bacterial protein azurin impairs invasion and FAK/Src signaling in P-cadherin-overexpressing breast cancer cell models. PLoS One, 8(7):e69023.

40. Zhang CC, Yan Z, Zhang Q, Kuszpit K, Zasadny K, Qiu M, Painter CL, Wong A, Kraynov E, Arango ME, Mehta PP, Popoff I, Casperson GF, Los G, Bender S, Anderes K, Christensen JG, VanArsdale T, 2010. PF-03732010: a fully human monoclonal an-tibody against P-cadherin with antitumor and antimetastatic activity. Clin Cancer Res, 16(21):5177–5188.

41. Zappulli V, De Zan G, Cardazzo B, Bargelloni L, Castagnaro M, 2005. Feline mammary tumours in comparative oncology. J Dairy Res, 72(S1):98.

42. Martín de las Mulas J, Reymundo C, 2000: Animal models of human breast carcinoma: canine and feline neoplasms. Rev Oncol, 2:274–281.

43. Takauji SR, Watanabe M, Uyama R, Nakagawa T, Miyajima N, Mochizuki M, Nishimura R, Sugano S, Sasaki N, 2007. Expression and subcellular localization of E-cadherin, α-catenin, and β-catenin in 8 feline mammary tumor cell lines. J Vet Med Sci, 69(8):831–834.

44. Matos AJ, Baptista CS, Gartner MF, Rutteman GR, 2012. Prognostic studies of canine and feline mammary tumours: the need for standardized procedures. Vet J, 193(1):24–31.

45. Seixas F, Palmeira C, Pires MA, Bento MJ, Lopes C, 2011. Grade is an independent prognostic factor for feline mammary carcinomas: a clinicopathological and survival analysis. Vet J, 187(1):65–71.

46. Amorim FV, Souza HJ, Ferreira AM, Fonseca AB, 2006. Clinical, cytological and histo-pathological evaluation of mammary masses in cats from Rio de Janeiro. Brazil J Feline Med Surg, 8(6):379–388.

47. Weijer K, Hart AA, 1983. Prognostic factors in feline mammary carcinoma. J Natl Cancer Inst, 70(4):709–716.

48. MacEwen EG, Hayes AA, Harvey HJ, Patnaik AK, Mooney S, Passe S, 1984. Prognos-tic factors for feline mammary tumors. J Am Vet Med Assoc, 185(2):201–204.

49. Viste JR, Myers SL, Singh B, Simko E, 2002. Feline mammary adenocarcinoma: tumor size as a prognostic indicator. Can Vet J, 43(1):33–37.

50. Misdorp W, Else RW, Hellmén E, Lipscomb TP, 1999. Histological Classification of Mam-mary Tumors of the Dog and the Cat, Volume VII. Washington, D.C. USA: WHO, Armed Forces Institute of Pathology, American Registry of Pathology.

51. Elston CW, Ellis IO, 1998. Assessment of Histological Grade. In The Breast Systemic pathology, Volume 13. 3rd edition. Edited by Elston CW, Ellis IO. Edinburgh: Churchill-Livingstone; 365–384.

52. Matos AJ, Faustino AM, Lopes C, Rutteman GR, Gartner F, 2006. Detection of lymph node micrometastases in malignant mammary tumours in dogs by cytokeratin immu-nostaining. Vet Rec, 158(18):626–630.

53. Gama A, Alves A, Gartner F, Schmitt F, 2003. p63: a novel myoepithelial cell marker in canine mammary tissues. Vet Pathol, 40(4):412–420.

54. Matos AJ, Lopes C, Carvalheira J, Santos M, Rutteman GR, Gartner F, 2006. E-cadherin

105


expression in canine malignant mammary tumours: relationship to other clinico-patho-logical variables. J Comp Pathol, 134:182–189.

55. Brunetti B, Sarli G, Preziosi R, Monari I, Benazzi C, 2005. E-cadherin and β-catenin re-duction influence invasion but not proliferation and survival in canine malignant mammary tumors. Vet Pathol, 42(6):781–787.

56. Gama A, Paredes J, Gartner F, Alves A, Schmitt F, 2008. Expression of E-cadherin, P-cadherin and β-catenin in canine malignant mammary tumours in relation to clinico-pathological parameters, proliferation and survival. Vet J, 177(1):45–53.

57. SAS, 1989. SAS/STAT User’s Guide. In SAS/STAT User’s Guide - Version 6, Volume 4. 6th edition. Cary NC, USA: SAS Institute Inc.

58. Peralta Soler A, Russo J, Russo IH, Knudsen KA, 2002. Soluble fragments of P-cad-herin adhesion protein found in human milk. J Cell Biochem, 85:180–184.

59. Gama A, Paredes J, Milanezi MF, Reis-Filho JS, Gartner F, Schmitt FC, 2002. P-cad-herin expression in canine lactating mammary gland. J Cell Biochem, 86(3):420–421.

60. Han AC, Soler AP, Knudsen KA, Salazar H, 1999. Distinct cadherin profiles in special variant carcinomas and other tumors of the breast. Hum Pathol, 30(9):1035–1039.

61. Reis-Filho JS, Milanezi F, Paredes J, Silva P, Pereira EM, Maeda SA, de Carvalho LV, Schmitt FC, 2003. Novel and classic myoepithelial/stem cell markers in metaplastic carcinomas of the breast. Appl Immunohistochem Mol Morphol, 11(1):1–8.

62. Turashvili G, McKinney SE, Goktepe O, Leung SC, Huntsman DG, Gelmon KA, Los G, Rejto PA, Aparicio SA, 2011. P-cadherin expression as a prognostic biomarker in a 3992 case tissue microarray series of breast cancer. Mod Pathol, 24(1):64–81.

63. Sousa B, Paredes J, Milanezi F, Lopes N, Martins D, Dufloth R, Vieira D, Albergaria A, Veronese L, Carneiro V, Carvalho S, Costa JL, Zeferino L, Schmitt F, 2010. P-cadherin, vimentin and CK14 for identification of basal-like phenotype in breast carcinomas: an immunohistochemical study. Histol Histopathol, 25(8):963–974.

64. Liu N, Yu Q, Liu TJ, Gebreamlak EP, Wang SL, Zhang RJ, Zhang J, Niu Y, 2012. P-cadherin expression and basal-like subtype in breast cancers. Med Oncol, 29(4):2606–2612.

65. Matos I, Dufloth R, Alvarenga M, Zeferino LC, Schmitt F, 2005. p63, cytokeratin 5, and P-cadherin: three molecular markers to distinguish basal phenotype in breast carcinomas. Virchows Arch, 447(4):688–694.

66. Paredes J, Milanezi F, Reis-Filho JS, Leitao D, Athanazio D, Schmitt F, 2002. Aberrant P-cadherin expression: is it associated with estrogen-independent growth in breast can-cer? Pathol Res Pract, 198(12):795–801.

67. Arnes JB, Brunet JS, Stefansson I, Begin LR, Wong N, Chappuis PO, Akslen LA, Foul-kes WD, 2005. Placental cadherin and the basal epithelial phenotype of BRCA1-related breast cancer. Clin Cancer Res, 11(11):4003–4011.

68. Paredes JCAF, Milanezi MFG, Reis-Filho JS, Leitão DRA, Athanazio DA, Schmitt FCL, 2002. Correlação entre as expressões de P-caderina e de receptores de estrógeno no câncer da mama. Correlation between P-cadherin and estrogen receptor expression in breast cancer. Jornal Brasileiro de Patologia e Medicina Laboratorial, 38:307–331.

106



70. Gama A, Schmitt F, 2012. Cadherin cell adhesion system in canine mammary cancer: a review. Vet Med Int, 357187.

71. Madhavan M, Srinivas P, Abraham E, Ahmed I, Mathew A, Vijayalekshmi NR, Balaram P, 2001. Cadherins as predictive markers of nodal metastasis in breast cancer. Mod Pathol, 14(5):423–427.

72. Gillett CE, Miles DW, Ryder K, Skilton D, Liebman RD, Springall RJ, Barnes DM, Hanby AM, 2001. Retention of the expression of E-cadherin and catenins is associated with shorter survival in grade III ductal carcinoma of the breast. J Pathol, 193(4):433–441.

73. Howard EM, Lau SK, Lyles RH, Birdsong GG, Umbreit JN, Kochhar R, 2005. Expres-sion of E-cadherin in high-risk breast cancer. J Cancer Res Clin Oncol, 131(1):14–18.

74. Ribeiro AS, Sousa B, Carreto L, Mendes N, Nobre AR, Ricardo S, Albergaria A, Came-selle-Teijeiro JF, Gerhard R, Soderberg O, Seruca R, Santos MA, Schmitt F, Paredes J, 2013. P-cadherin functional role is dependent on E-cadherin cellular context: a proof of concept using the breast cancer model. J Pathol, 229(5):705–718.

75. Bukholm IK, Nesland JM, Borresen-Dale AL, 2000. Re-expression of E-cadherin, α-catenin and β-catenin, but not of γ-catenin, in metastatic tissue from breast cancer patients. J Pathol, 190(1):15–19.


77. Pinho SS, Osorio H, Nita-Lazar M, Gomes J, Lopes C, Gartner F, Reis CA, 2009. Role of E-cadherin N-glycosylation profile in a mammary tumor model. Biochem Biophys Res Commun, 379(4):1091–1096.

78. Paredes J, Correia AL, Ribeiro AS, Milanezi F, Cameselle-Teijeiro J, Schmitt FC, 2008. Breast carcinomas that co-express E- and P-cadherin are associated with p120-catenin cytoplasmic localisation and poor patient survival. J Clin Pathol, 61(7):856–862.

79. Ribeiro AS, Albergaria A, Sousa B, Correia AL, Bracke M, Seruca R, Schmitt FC, Pare-des J, 2010. Extracellular cleavage and shedding of P-cadherin: a mechanism underly-ing the invasive behaviour of breast cancer cells. Oncogene, 29(3):392–402.

04CADHERIN-CATENIN COMPLEX

MOLECULES IN FELINEMAMMARY TUMOURS

109

Cadherin-catenin complex molecules in feline mammary tumours Chapter 04

CHARACTERIZATION OF α-, β- AND P120-CATENINEXPRESSION IN FELINE MAMMARY TISSUES AND

THEIR RELATION WITH E- AND P-CADHERIN

Ana Catarina Figueira, Catarina Gomes, Hugo Vilhena, Sónia Miranda, Júlio Carvalheira, Augusto J.F. de Matos, Patrícia Dias-Pereira and Fátima Gärtner

Anticancer Res 2015, 35(6):3361-9

111


ABSTRACT

Background: Abnormal catenin expression has been related to mammary carcinogen-esis in both human and canine species and they are considered tumour and invasion sup-pressor molecules; however, in feline mammary tissues they have been scarcely studied.

Materials and Methods: The immunohistochemical expression of α-, β- and p120-catenin was studied in a series of normal feline mammary glands, hyperplastic/dysplastic lesions and benign and malignant mammary tumours. Their relationship with clinicopatho-logical parameters and with E- and P-cadherin expression was assessed.

Results: Normal tissues, hyperplastic/dysplastic lesions and benign tumours expressed α-, β- and p120-catenin in the membrane of more than 75% of the luminal epithelial cells, while in malignant tumours, there was a reduction in their membranous expression and a p120-catenin cytoplasmic expression in 40%. Reduced α- catenin expression was re-lated to tumour features with prognostic value, namely tumour size (p=0.0203) and necrosis (p=0.0205). The expression of α-, β- and p120-catenin were individually related to each other and collectively associated with E-cadherin expression.

Conclusions: The results demonstrate a relationship between feline mammary carci-nogenesis and decreased expression of catenins, suggesting that they may represent a valuable tool in the diagnosis of feline mammary neoplasms.

113


BACKGROUND

Tumour progression depends on the ability of tumour cells to overcome cell–cell adhesion and to invade, metastasize, and colonize distant sites [1]. The cadherin–catenin complex, localized in the adherens junctions, is involved in cell-cell adhesion and the stability of this complex is required to maintain the integrity of epithelial tissues [2, 3]. There exists evi-dence that the abnormal expression or function of the cadherin–catenin complex molecules results in decreased intercellular adhesion, tumour cell migration, invasion and metastatic dissemination in human breast cancer [3-6].

The classical E- and P-cadherin are transmembrane molecules responsible for calcium-dependent cell–cell adhesion that have three distinct domains: i) an extracellular domain that contains five cadherin repeats and forms homophilic bonds with cadherins on adjacent cells; ii) a single-pass transmembrane domain; and iii) a highly conserved cytoplasmic do-main that forms complexes with a group of proteins collectively known as catenins (α-, β-, γ- and p120-catenin) [1-3, 7]. Both β- and γ-catenin interact directly with the cytoplasmic carboxy-terminal catenin-binding domain of the cadherins in a mutually exclusive manner. α-Catenin is recruited to the complex through its interaction with β- or γ-catenin, linking the cadherin complex to the actin cytoskeleton, while p120-catenin connects directly to the juxtamembrane domain of the cytoplasmic tail of the cadherin molecules [2, 8].

114

Chapter 04 Cadherin-catenin complex molecules in feline mammary tumours

The three catenins have distinct functions: α-catenin in addition to linking to the actin network, plays an important role in the regulation of distinct signaling pathways involved in cell prolif-eration, apoptosis, growth, migration and invasion, hence being considered a tumour sup-pressor molecule [9, 10]; β-catenin is involved in cell–cell adhesion and cell signaling, as a member of the WNT/wingless signal transduction pathway [3], and in the regulation of the transcription of several proliferation and differentiation genes [11]; p120-catenin stabilizes the cadherin–catenin complex and modulates cadherin intracellular trafficking, stability, ad-hesive capacity and cell motility [3, 12].

Although the expression of cadherins has been reported in canine and feline mammary tumours, to the best of our knowledge only β-catenin expression was studied in these species [13-19] and the characterization of the whole cadherin–catenin system in feline mammary carcino-genesis has not yet been described. In this context, we assessed the immunoexpression of α-, β- and p120-catenin in a series of normal feline mammary glands, hyperplastic/dys-plastic lesions and benign and malignant mammary tumours, as well as their relation with the expression of classical P- and Ecadherin and with clinicopathological parameters with recognized prognostic value.

115


MATERIALS AND METHODS

Tissue samples

Samples from 75 queens with naturally-occurring mammary lesions, surgically excised with curative intent, and nine normal mammary glands (obtained from queens that were humanely euthanized for reasons unrelated to neoplastic disease) were included in this study. In each case, an informed consent was granted by the owners. All specimens were fixed in 10% neu-tral buffered formalin and processed routinely. Consecutive histological sections (2 μm) were cut from each paraffin block. One was stained with haematoxylin and eosin (HE) for histologi-cal examination, and the others were used for immunohistochemistry (IHC). When available, local and regional lymph nodes were also processed and examined for the presence of metas-tases as described in Figueira et al. (2014) [20].

Histological classification of the tumours was performed independently by three observers (ACF, PDP and FG) based on the criteria of the World Health Organization (WHO) for the his-tological classification of mammary tumours of domestic animals [21].

Carcinomas were graded in accordance with the Nottingham grading system for human breast carcinomas, based on the assessment of three morphological features: tubule for-mation, nuclear pleomorphism, and mitotic counts, and tumours were classified as grade I

116


(well-differentiated), grade II (moderately differentiated) and grade III (poorly differentiated) [22]. Variables with known prognostic value, such as the mode of growth (infiltrative or ex-pansive), tumour diameter (<2 cm, 2-3 cm, >3 cm), presence of necrosis, skin ulceration, lymph node metastases, and intravascular neoplastic emboli [23, 24] were also recorded.

α-, β- and p120-Catenin expression by immunohistochemistry

Immunohistochemistry was performed using a polymer-based system (Novolink Max Poly-mer Detection System, Product No: RE7280-K; Leica Biosystems, Newcastle, UK), according to the manufacturer’s instructions. Sections were dewaxed in xylene and rehydrated through graded alcohols. Sections for β-catenin evaluation were treated with extran for 10 minutes in a microwave oven for antigen retrieval, while sections for α-catenin and p120-catenin evaluation were treated with 10 mM citrate buffer, pH 6.0, for 3 minutes in a pressure cooker. Endogenous peroxidase activity was blocked by treating the sections with 3% hydrogen peroxide in metha-nol for 10 minutes and rinsing in Tris-buffered saline (TBS, pH 7.6, 0.5 M). Sections were incu-bated overnight at 4˚C in a humid chamber with specific mouse monoclonal antibodies against human α-catenin (clone αCAT-7A4; Zymed/Invitrogen, Camarillo, CA, USA), β-catenin (clone CAT-5H10; Zymed/Invitrogen), and p120-catenin (clone 98/pp120; BD Transduction Laborato-ries, Lexington, KY, USA). The antibodies were diluted 1:100, 1:300 and 1:1,000, respectively in TBS with 5% bovine serum albumin. Labelling was performed using 3,3’-diaminobenzidine at room temperature and sections were then counterstained with Mayer’s haematoxylin, dehy-drated and mounted. For negative controls, the primary antibody was replaced by TBS. Sec-tions of human normal mammary gland were used as positive controls.

The immunoexpression evaluation of α-, β- and p120-catenin was assessed semiquantita-tively according to the percentage of immunoreactive luminal epithelial cells with a mem-branous pattern, and graded as 0: <25%; 1: 25-50%; 2: 51-75% and 3: >75%, adapted from Penafiel-Verdu et al. (2012) [18]. For statistical analysis, whenever >75% of luminal epithelial cells had membranous staining, the sample was considered to have preserved catenin ex-pression, while all other cases were considered as having reduced expression. The staining pattern of primary tumours, lymph node metastases and intravascular neoplastic emboli was evaluated according to this described method.

The staining and evaluation methods for E- and P-cadherin expression were performed as described by Figueira et al. (2014) [20]. To evaluate the combined expression of E-cadherin and catenins, samples were grouped according to the pattern of E-cadherin expression, as preserved or reduced and to the pattern of catenin expression as preserved expression of all catenins or reduced expression of at least one catenin.

117


Statistical methods

Data were organized in contingency tables and the likelihood ratio Chi-square test of asso-ciations was used to determine the significance of the relationship between the expression of the catenins and the tumours’ clinicopathological parameters, as well as the cadherin expression. Whenever biologically consistent, 2x2 tables of contingency were built and Fisher’s exact test was performed. All statistical analysis was performed using SAS/STAT, 1989 (SAS Institute Inc., Cary, NC, USA) [25] and, in all instances, p ≤ 0.05 was considered to be statistically significant.

118


RESULTS

Nine normal mammary gland samples, 13 hyperplastic/ dysplastic lesions (7 fibrocystic disease cases and 6 of fibroadenomatous changes), 10 benign tumours (7 simple adeno-mas and 3 fibroadenomas) and 60 malignant tumours (32 tubulopapillary carcinomas, 16 solid carcinomas, 4 cribriform carcinomas, 6 mucinous carcinomas and 2 carcinosarcomas) were analyzed. Seven (11.67%) malignant tumours were grade I, 25 (41.67%) grade II and 28 (46.67%) grade III. In 21 (36.21%) carcinomas, neoplastic intravascular emboli were observed and in 18 (51.43%) out of the 35 cases where lymph nodes were available, metas-tases were identified. The P- and E-cadherin expression in this series has been previously analyzed and described by Figueira et al. (2014) [20].

Expression of α-catenin

In all normal mammary tissues, hyperplastic/dysplastic lesions, and benign tumours, α-catenin was expressed in the membrane of more than 75% of luminal epithelial cells (Figure 1a). The protein expression was reduced in 23 (38.33%) carcinomas (Figure 1b), a significant differ-ence when compared with benign tumours (p=0.0245). Statistically significant relationships were also found between reduced α-catenin expression and larger tumour size (p=0.0203) and the presence of necrosis (p=0.0205) (Table 1). Almost two-thirds (64.7%) of tumours

119


larger than 3 cm had decreased α-catenin expression, while 72.1% of those of 3 cm or less had preserved the expression. The majority of non-necrotic carcinomas (91.7%) preserved α-catenin expression, while almost half of those with necrosis had reduced expression. There were no significant relationships between carcinoma α-catenin expression and histo-logical type, grade or mode of growth, ulceration, neoplastic intravascular emboli or lymph node metastases (Table 1).

Table 1. Association of α-catenin, β-catenin and p120-catenin expression in malignant tumours with clinicopathological parameters

Clinicopathological parameter n

α-Catenin β-Catenin p120-Catenin

Preserved Reduced Preserved Reduced Preserved Reduced

Histological type

Tubulopapillary carcinomaSolid carcinomaCribriforme carcinomaMucinous carcinomaCarcinosarcoma

3216462

21 (65.63%)9 (56.25%)2 (50%)4 (66.67%)1 (50%)

11 (34.38%)7 (43.75%)2 (50%)2 (33.33%)1 (50%)

16 (50%)9 (56.25%)3 (75%)3 (50%)1 (50%)

16 (50%)7 (43.75%)1 (25%)3 (50%)1 (50%)

25 (78.13%)11 (68.75%)2 (50%)3 (50%)2 (100%)

7 (21.88%)5 (31.25%)2 (50%)3 (50%)0

p 0.9369 0.9052 0.3834

Histological grade

Grade IGrade IIGrade III

72528

6 (85.71%)15 (60%)16 (57.14%)

1 (14.29%)10 (40%)12 (42.86%)

5 (71.43%)12 (48%)15 (53.57%)

2 (28.57%)13 (52%)13 (46.43%)

7 (100%)18 (72%)18 (64.29%)

07 (28%)10 (35.71%)

p 0.3254 0.5368 0.0678

Mode of growth

ExpansiveInfiltrative

356

3 (100%)33 (58.93%)

023 (41.07%)

1 (33.33%)30 (53.57%)

2 (66.67%)26 (46.43%)

3 (100%)39 (69.64%)

017 (30.36%)

p 0.2741 0.5995 0.5498


<2 cm2-3 cm>3 cm

331017

25 (75.76%)6 (60%)6 (35.29%)

8 (24.24%)4 (40%)11 (64.71%)

21 (63.64%)6 (60%)5 (29.41%)

12 (36.36%)4 (40%)12 (70.59%)

26 (78.79%)6 (60%)11 (64.71%)

7 (21.21%)4 (40%)6 (35.29%)

p 0.0203 0.0611 0.3890

Ulceration

AbsentPresent

4812

31 (64.58%)6 (50%)

17 (35.42%)6 (50%)

28 (58.33%)4 (33.33%)

20 (41.67%)8 (66.67%)

36 (75%)7 (58.33%)

12 (25%)5 (41.67%)

p 0.5081 0.1953 0.2930

Necrosis

AbsentPresent

1248

11 (91.67%)26 (54.17%)

1 (8.33%)22 (45.83%)

9 (75%)23 (47.92%)

3 (25%)25 (52.08%)

10 (83.33%)33 (68.75%)

2 (16.67%)15 (31.25%)

p 0.0205 0.1155 0.4793

Neoplastic intravascular emboli

AbsentPresent

3721

21 (56.76%)14 (66.67%)

16 (43.24%)7 (33.33%)

18 (48.65%)13 (61.9%)

19 (51.35%)8 (38.1%)

26 (70.27%)16 (76.19%)

11 (29.73%)5 (23.81%)

p 0.5794 0.4154 0.7636

Lymph node metastases

AbsentPresent

1718

14 (82.35%)9 (50%)

3 (17.65%)9 (50%)

10 (58.82%)10 (55.56%)

7 (41.18%)8 (44.44%)

13 (76.47%)13 (72.22%)

4 (23.53%)5 (27.78%)

p 0.0750 1.0000 1.0000

120


Sixteen (88.89%) out of the 18 cases with neoplastic emboli (in three cases it was not possible to obtain representative sections for immunohistochemistry), exhibited preserved α-catenin expression (Figure 1c), while half of the 18 lymph node metastases also had pre-served α-catenin expression (Figure 1d). The embolic and nodal metastatic patterns were unrelated to the expression of primary tumours.

There was a significant direct relationship between the expression of α-catenin and E-cadherin (p=0.0336), with preserved α-catenin expression in 75% of the carcinomas with preserved E-cadherin, and reduction in half of the tumours with reduced E-cadherin. No relationship was observed with the expression of P-cadherin (Table 2).

Expression of β-catenin

In normal mammary glands, hyperplastic/dysplastic lesions, and benign tumours, β-catenin was expressed in the membrane of more than 75% of luminal epithelial cells (Figure 1e), while 38 (46.67%) carcinomas had reduced β-catenin expression (Figure 1f), a significant difference when compared with benign tumours (p=0.0045). In addition, nuclear β-catenin expression was observed in three carcinomas.

There were no statistical significant relationship between the expression of β-catenin and tumour histological type or grade, mode of growth, size, necrosis, or ulceration, nor with the presence of intravascular neoplastic emboli or lymph node metastases (Table 1). The majority of cases with evidence of neoplastic emboli (n=16/18; 88.89%) (in three cases it was not possible to obtain representative sections for immunohistochemistry) preserved β-catenin expression by intravascular neoplastic cells (Figure 1g), while eight (44.44%) out of the 18 lymph node metastases had preserved β-catenin expression (Figure 1h). No significant relationships were established between the β-catenin expression pattern in the intravascular emboli and lymph node metastases and their primary tumours. There was no significant re-lationship between the expression of β-catenin, P- and E-cadherin in carcinomas (Table 2).

Table 2. Association between expression of catenins and P- and E-cadherin in feline malignant mammary tumours

α-Catenin β-Catenin p120-Catenin

Reduced Preserved p Reduced Preserved p Reduced Preserved p

P-Cadherin

PositiveNegative

20 (41.67%)3 (25%)

28 (58.33%)9 (75%) 0.3404 23 (47.92%)

5 (41.67%)25 (52.08%)7 (58.33%) 0.7560 16 (33.33%)

1 (8.33%)32 (66.67%)11 (91.67%) 0.1505

E-Cadherin

ReducedPreserved

15 (53.57%)8 (25%)

13 (46.43%)24 (75%) 0.0336 5 (71.43%)

12 (48%)11 (39.29%)21 (65.63%) 0.0687 14 (50%)

3 (9.38%)14 (50%)29 (90.63%) <0.001

121


Expression of p120-catenin

In normal mammary tissues, hyperplastic/dysplastic lesions, and benign tumours, p120-catenin was expressed in the membrane of more than 75% of the luminal epithelial cells (Figure 1i). In 17 (28.33%) carcinomas, there was a reduction in p120-catenin expression (Figure 1j), although this was not related to any of the evaluated clinicopathological pa-rameters (Table 1). Nuclear p120-catenin expression was observed in three carcinomas and one case of fibrocystic disease (Figure 2a). Although diffuse cytoplasmic p120-catenin expression was also observed in 40% of carcinomas (Figure 2b), it was not significantly as-sociated with clinicopathological parameters or cadherin expression.

From the 20 cases with evidence of neoplastic emboli (in one case it was not possible to ob-tain representative sections for immunohistochemistry), the majority (n=18; 90%) exhibited preserved p120-catenin expression by intravascular neoplastic cells (Figure 1k), while 12 (66.67%) out of the 18 lymph node metastases preserved p120-catenin expression (Figure 1l).

There was a significant relationship between the protein expression in the primary tumours, their intravascular emboli (p=0.0316) and lymph node metastases (p=0.0217), all with pre-served p120-catenin expression also exhibiting the same pattern in intravascular neoplastic cells (n=16; 100%), as well as in the majority of the lymph node metastases (n=11; 84.6%).

There was a significant relationship between the expression of p120-catenin and E-cadherin (p<0.001), with 90% of the malignant tumours with preserved E-cadherin also preserving p120-catenin. No relationship was demonstrated with the expression of P-cadherin (Table 2).

The expressions of α-, β- and p120-catenin in malignant tumours were individually related to each other. Moreover, most carcinomas (n=21; 60%) with reduced expression of at least one catenin also had reduced expression of E-cadherin, and the majority of the tumours with preserved expression of all catenins (n=18; 72%) also preserved E-cadherin expres-sion (p=0.0191). Considering the four elements of the complex (E-cadherin, and α-, β-, and p120-catenin), most benign tumours (n=9; 90%) preserved expression of all molecules, while 70% of the carcinomas had a reduction in at least one of the molecules that constitute the cadherin–catenin complex.

122


α-catenin ß-catenin p120-cateninC

arci

nom

aLy

mph

nod

em

etas

tase

sIn

trava

scul

arne

opla

stic

em

bolu

sN

orm

alm

amm

ary

glan

d

Figure 1.

α- β- and p120-catenin expression by immunohistochemistry (IHC) in feline mammary tissue. (a) Normal mammary gland with strong expression of α-catenin immunoreactivity in the membrane of luminal epithelial cells, x400. (b) Reduced membranous α-catenin expression in neoplastic cells in a grade II tubulopapillary car-cinoma, x400. (c) Neoplastic intravascular embolus showing strong α-catenin expression, x400. (d) Lymph node metastases showing α-catenin expression in neoplastic cells, x400. (e) Normal mammary gland with strong expression of β-catenin immunoreactivity in the membrane of luminal epithelial cells, x400. (f) Reduced mem-branous β-catenin expression in neoplastic cells in a grade II tubulopapillary carcinoma, x400. (g) Neoplastic in-travascular embolus showing strong β-catenin expression, x400. (h) Lymph node metastases showing β-catenin expression in neoplastic cells, x400. (i) Normal mammary gland with strong expression of p120-catenin immu-noreactivity in the membrane of luminal epithelial cells, x400. (j) Reduced membranous p120-catenin expres-sion in the membrane of epithelial cells in a grade III solid carcinoma, x400. (k) Neoplastic intravascular embolus showing strong p120-catenin expresion, x400. (l) Lymph node metastases showing p120-catenin expression in neoplastic cells, x400. Bar=50 μm.

123


Figure 2.

(a) Nuclear p120-catenin expression in a grade II tubulopapillary carcinoma as shown by immunohistochem-istry. x400. (b) Diffuse cytoplasmic p120-catenin expression (*) in a grade III solid carcinoma as shown by im-munohistochemistry. x400. Bar=50 μm.

124


DISCUSSION

Numerous studies have reported the expression of the cadherin–catenin complex mole-cules and their association with breast cancer [4-6]. Although E-cadherin is considered a tumour and metastasis suppressor [26], it is questionable that the single loss of E-cadherin explains the neoplastic or metastatic phenotype, as the loss of adhesiveness does not nec-essarily induce cells to become motile or invasive [8]. Since E-cadherin function is regulated by catenins [26], combined studies of cadherins and catenins may add information to the characterization of this phenotype. Such studies are scarce for feline mammary tumours [18, 19] and, to the best of our knowledge, this is the first time that the major catenins and cadherins have been simultaneously evaluated in normal and neoplastic feline mammary tissue.

The present investigation documented consistent membranous expression of α-, β-, and p120-catenin in luminal epithelial cells of the normal feline mammary gland, reflecting the importance of catenins in the maintenance of the structural and functional integrity of the normal mammary tissue in this species, mimicking similar roles in human breast [4, 27, 28].

Hyperplastic/dysplastic lesions and benign tumours maintained a similar pattern, while nearly 60% of carcinomas exhibited reduced expression of the three catenins, suggesting that, as previously shown for human [4, 5, 29, 30] and canine [13-15, 17] species, their loss

125


contributes to the development of a malignant phenotype in queens. Our data support the widely accepted concept that the underexpression of cell adhesion molecules and loss of intercellular cohesion represent crucial events in the process of the typical architectural disorganization of mammary cancer [1, 3]. α-Catenin is able to inhibit tumour formation and progression by maintaining the integrity of the cadherin–catenin complex and by regulating several signalling pathways involved in tumourigenesis such as WNT/β-catenin, Hippo/Yes-associated protein (Hippo-YAP), nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB), and Hedhehog pathways [10, 31]. Abnormal α-catenin expression (such as reduced membrane expression and cytoplasmic or nuclear location) has been described in breast cancer [4, 27, 32, 33]. Furthermore, several reports documented an association between down-regulation or loss of α-catenin in breast cancer and high tumour grade [10], metastasis [4, 10, 34] and poor survival [10], which raises the possibility that it may be con-sidered a prognostic marker.

Our results also demonstrated a significant association between α-catenin expression and two parameters with known prognostic value, namely tumour size and necrosis. In larger tumours, a hostile metabolic microenvironment emerges, characterized by ischaemia, nutri-ents and energy deprivation, as a result of the discrepancies between cancer cell multiplica-tion and the slower development of the supporting vascular network. It is widely accepted that changes in the tumour microenvironment influence several steps of carcinogenesis and neoplastic spread, acting as a potent modulator in the progression of the disease [35]. Recently, Plumb et al. (2009) demonstrated that a stressful microenvironment contributes to the under-expression of α-catenin, being able to confer a selective survival and growth ad-vantage to the neoplastic cells under ischaemic conditions [36]. Furthermore, a borderline association between reduced α-catenin expression and larger tumour size in breast cancer was described by Bukholm et al. (2006) [37]. Under such stressful conditions, the loss of α-catenin results in increased proliferation, decreased apoptosis and increased growth-factor signalling, thus promoting faster tumour growth that can account for larger tumour volumes and ischaemic necrosis at diagnosis [31, 36].

In our series, a significant reduction in β-catenin expression was observed in carcinomas compared to benign tumours. A similar loss of membrane-bound β-catenin, as well as its cytoplasmic or nuclear expression, have been described in human [4, 11, 34], canine [15-17] and feline [18, 19] mammary tumours. However, the prognostic value of β-catenin in human [4, 9, 34, 38] and canine [13-15] mammary tumours has not been clarified, with different studies revealing contradictory results. Similarly, this subject is not unequivocal in cats: while Penafiel-Verdu et al. (2012) associated preserved β-catenin expression with low-grade non-metastatic feline mammary carcinomas and its underexpression with meta-static carcinomas [18], Zappulli et al. (2012) failed to demonstrate an association between reduced β-catenin expression and clinicopathological features with known prognostic value [19].

126


Another interesting finding in this study relates to the subcellular p120-catenin location. While in normal mammary gland, hyperplastic and benign lesions p120-catenin was exclu-sively membranous, in 40% of carcinomas it was also identified in the cytoplasm. Further-more, nearly 96% (23/24) of mammary tumours with cytoplasmatic p120-catenin expres-sion were moderate- or high-grade carcinomas. Although significant correlation between sub-cellular p120-catenin location and the histological grade of carcinomas was not estab-lished, possibly due to the small number of tumours with this aberrant expression pattern, our data suggest that it may be relevant for the development and progression of feline mammary cancer. Previous reports on humans hypothesized that p120-catenin may play a dual role in breast carcinogenesis, acting as a tumour/metastasis suppressor as an ele-ment of the cell membrane cadherin–catenin complex, and as an oncogene/metastasis promoter when translocated to the cytoplasm [8, 26]. Cytoplasmic p120-catenin interacts with members of the Rho family GTPases [8, 12, 39] that regulate cell shape, adhesion, migration and polarity, thus promoting the invasive behaviour of neoplasms [8, 40]. Its cyto-plasmic translocation may also be responsible for structural changes in adherens junctions and disruption of actin filament organization, leading to significant modifications of cellular morphology and differentiation, hence justifying the higher histological grade of the lesions exhibiting this feature [39].

Expressions of α- and β-catenin in neoplastic intravascular emboli and lymph node metas-tases were unrelated to their expression in corresponding primary tumours. In contrast, the expression pattern of p120-catenin in neoplastic emboli and lymph node metastases was very similar to that of the corresponding primary carcinomas. This finding corroborates the observations by Johnson et al. (2010) in breast cancer, where p120-catenin expression was maintained in distant metastases [40]. Our data suggest that the staining pattern of p120-catenin is preserved during tumour progression, contradicting the previous concept that p120-catenin is lost during the metastatic process [5, 26].

In the course of metastasis, neoplastic cells must breakaway from the primary tumour, move into the surrounding stroma, invade the lymphatic or vascular circulation, and reestablish growth at a secondary site. In this process, the loss or reduction of intercellular adhesion molecules has been postulated to facilitate detachment from the primary mass. However, during transit through the circulation, cohesive cell migration seems to provide a survival advantage compared to that of single dissociated cells [41]. In fact, in approximately 90% of carcinomas with emboli, neoplastic intravascular cells preserve the expression of α-, β- and p120-catenin, irrespective of the expression in the primary tumour. This feature raises the possibility that the expression of the catenins in embolic cells may represent a strategy ensuring an effective spread of neoplastic cells. Cancer cells may migrate and invade both individually or as cohesive groups [42]. During group cell migration, the maintenance of epithelial characteristics, namely a preserved cell–cell adhesion system, provides the group with strong mechanical, structural and functional properties; this allows the group to operate as a unit, increasing the individual chances of survival and metastasis [42-44]. Our findings

127


emphasize this concept, suggesting that catenins may contribute to intercellular physical and functional cohesion within emboli. Once at metastatic sites, the suitability of the mi-croenvironment is an important factor in determining whether colonization occurs or not. In the lymph node metastases, we observed that the expression was preserved in 50%, 44.4% and 66.7% for α-, β- and p120-catenin, respectively. In order to overcome vascu-lar extravasation, survive, proliferate and invade in a harsh microenvironment, metastatic cells undergo modifications that may include modifications of catenin expression that are advantageous for metastasized cells, such as the demonstrated association between un-derexpression of α-catenin and increased proliferation, decreased apoptosis and survival in hostile microenvironments [36].

In 70% of the carcinomas included in this series, underexpression of at least one of the members of the E-cadherin–catenin complex was observed; supporting the concept that dysfunction of the cadherin–catenin adhesion system is intimately related to malignancy in feline mammary carcinogenesis. Moreover, we found that carcinomas with underexpression of E-cadherin frequently lose α- and p120-catenin expression. Concurrent loss of β- catenin was also observed, but this feature was not statistically significant. Considering that α-, β- and p120-catenin work together in the cadherin–catenin complex, it was not surprising that their expressions were individually related in our series of carcinomas, as has previously been described in breast cancer [4, 27].

Efforts to unveil the prognostic value of catenins in mammary carcinomas have not been conclusive in humans [29, 30, 38, 45], dogs [13-15] or cats [18, 19]. While some studies associated a down-regulation of catenins with metastatic disease and poor prognosis [4, 5, 34, 45], others were unable to relate the expression of the catenins with traditional prognos-tic indicators (lymph node status, tumour size, steroid receptor expression, age and overall survival) [9, 27, 28].

128


CONCLUSIONS

This study describes membranous expression of α-, β- and p120-catenin in the luminal epithelium of normal feline mammary glands and demonstrates an association between decreased expression of these adhesion molecules and carcinogenesis in this species. In fact, underexpression of catenins was observed only in carcinomas, suggesting that catenins may represent a valuable tool assessing in the diagnosis of mammary neoplasm in queens.

Furthermore, data from this investigation point to the importance of the E-cadherin–catenin complex in mammary carcinogenesis in feline species. However, the prognostic value of these cell adhesion molecules seems to be limited in cats. Further prospective studies, with larger series of mammary carcinomas and of different carcinoma grades and types, as well as functional molecular studies, are warranted to evaluate the importance of the cadherin–catenin complex in feline mammary carcinogenesis, as well as its prognostic relevance.

129


REFERENCES

1. Conacci-Sorrell M, Zhurinsky J, Ben-Ze’ev A, 2002. The cadherincatenin adhesion sys-tem in signaling and cancer. Journal of Clinical Investigation 109: 987-991.

2. Nollet F, Berx G, van Roy F, 1999. The role of the E-cadherin/ catenin adhesion complex in the development and progression of cancer. Molecular cell biology research commu-nications: MCBRC 2: 77-85.

3. Wheelock MJ, Soler AP, Knudsen KA, 2001. Cadherin junctions in mammary tumours. Journal of mammary gland biology and neoplasia 6: 275-285.

4. Nakopoulou L, Gakiopoulou-Givalou H, Karayiannakis AJ, Giannopoulou I, Keramopou-los A, Davaris P, Pignatelli M, 2002. Abnormal α-catenin expression in invasive breast cancer correlates with poor patient survival. Histopathology 40: 536-546.

5. Talvinen K, Tuikkala J, Nykanen M, Nieminen A, Anttinen J, Nevalainen OS, Hurme S, Kuopio T, Kronqvist P, 2010. Altered expression of p120-catenin predicts poor outcome in invasive breast cancer. Journal of cancer research and clinical oncology 136: 1377-1387.

6. Paredes J, Correia AL, Ribeiro AS, Milanezi F, Cameselle-Teijeiro J, Schmitt FC, 2008. Breast carcinomas that co-express Eand P-cadherin are associated with p120-catenin cytoplasmic localisation and poor patient survival. Journal of clinical pathology 61: 856-862.

7. Knudsen KA, Wheelock MJ, 2005. Cadherins and the mammary gland. Journal of cellular biochemistry 95: 488-496.

130


8. Anastasiadis PZ, Reynolds AB, 2001. Regulation of Rho GTPases by p120-catenin. Current opinion in cell biology 13: 604-610.

9. Goyal A, Martin TA, Mansel RE, Jiang WG, 2008. Real time PCR analyses of expres-sion of E-cadherin, α-, β- and γ-catenin in human breast cancer for predicting clinical outcome. World journal of surgical oncology 6: 56.

10. Sun Y, Zhang J, Ma L, 2014. α-Catenin: A tumour suppressor beyond adherens junc-tions. Cell cycle 13.

11. Khramtsov AI, Khramtsova GF, Tretiakova M, Huo D, Olopade OI, Goss KH, 2010. WNT/β-catenin pathway activation is enriched in basal-like breast cancers and predicts poor outcome. The American journal of pathology 176: 2911-2920.

12. Reynolds AB, Carnahan RH, 2004. Regulation of cadherin stability and turnover by p120ctn: implications in disease and cancer. Seminars in cell & developmental biology 15: 657-663.

13. Gama A, Paredes J, Gartner F, Alves A, Schmitt F, 2008. Expression of E-cadherin, P-cadherin and β-catenin in canine malignant mammary tumours in relation to clinico-pathological parameters, proliferation and survival. Veterinary J 177: 45-53.

14. De Matos AJ, Lopes CC, Faustino AM, Carvalheira JG, Rutteman GR, Gartner Mde F, 2007. E-Cadherin, β-catenin, invasion and lymph node metastases in canine malignant mammary tumours. APMIS: acta pathologica, microbiologica, et immunologica Scandi-navica 115: 327-334.

15. Brunetti B, Sarli G, Preziosi R, Monari I, Benazzi C, 2005. Ecadherin and β-catenin reduction influence invasion but not proliferation and survival in canine malignant mam-mary tumours. Veterinary pathology 42: 781-787.

16. Nowak M, Madej JA, Dziegiel P, 2007. Expression of E-cadherin, β-catenin and Ki-67 antigen and their reciprocal relationships in mammary adenocarcinomas in bitches. Folia histochemica et cytobiologica/Polish Academy of Sciences, Polish Histochemical and Cytochemical Society 45: 233-238.

17. Restucci BM, Martano P, Esposito M, De Filippis G, Borzacchiello D, Lo Muzio LG, 2007. Expression of β-catenin, Ecadherin and APC in canine mammary tumours. Anti-cancer Research 27: 3083-3090.

18. Penafiel-Verdu C, Buendia AJ, Navarro JA, Ramirez GA, Vilafranca M, Altimira J, San-chez J, 2012. Reduced expression of E-cadherin and β-catenin and high expression of basal cytokeratins in feline mammary carcinomas with regional metastasis. Veterinary pathology 49: 979-987.

19. Zappulli V, De Cecco S, Trez D, Caliari D, Aresu L, Castagnaro M, 2012. Immunohist chemical expression of E-cadherin and β-catenin in feline mammary tumours. Journal of comparative pathology 147: 161-170.

20. Figueira A, Gomes C, de Oliveira J, Vilhena H, Carvalheira J, de Matos A, Dias Pereira P, Gärtner F, 2014. Aberrant P-cadherin expression is associated to aggressive feline mammary carcinomas. BMC veterinary research 10: 270.

21. Misdorp W, Else RW, Hellmén E, Lipscomb TP, 1999. Histological Classification of Mam-mary Tumours of the Dog and the Cat. Washington, D.C. USA: WHO, Armed Forces Institute of Pathology, American Registry of Pathology.

131


22. Elston CW, Ellis IO, 1998. Assessment of histological grade. In: The Breast. Systemic pathology (Elston CW, Ellis IO eds.). Edinburgh: Churchill-Livingstone, pp. 365-384.

23. Matos AJ, Baptista CS, Gartner MF, Rutteman GR, 2012. Prognostic studies of canine and feline mammary tumours: the need for standardized procedures. Veterinary journal 193: 24-31.

24. Zappulli V, De Zan G, Cardazzo B, Bargelloni L, Castagnaro M, 2005. Feline mammary tumours in comparative oncology. Journal of Dairy Research 72: 98.

25. SAS, 1989: SAS/STAT User’s Guide. In: SAS/STAT User’s Guide - Version 6. Cary NC, USA: SAS Institute Inc..

26. Thoreson MA, Reynolds AB, 2002. Altered expression of the catenin p120 in human cancer: implications for tumour progression. Differentiation; research in biological diver-sity 70: 583-589.

27. Pedersen KB, Nesland JM, Fodstad O, Maelandsmo GM, 2002. Expression of S100A4, E-cadherin, α- and β-catenin in breast cancer biopsies. British journal of cancer 87: 1281-1286.

28. Dillon DA, D’Aquila T, Reynolds AB, Fearon ER, Rimm DL, 1998. The expression of p120ctn protein in breast cancer is independent of α- and β-catenin and E-cadherin. American Journal of Pathology 152: 75-82.

29. Gonzalez MA, Pinder SE, Wencyk PM, Bell JA, Elston CW, Nicholson RI, Robertson JF, Blamey RW, Ellis IO, 1999. An immunohistochemical examination of the expression of Ecadherin, α- and β/γ-catenins, and α2- and β1-integrins in invasive breast cancer. The Journal of pathology 187: 523-529.

30. Park D, Karesen R, Axcrona U, Noren T, Sauer T, 2007. Expression pattern of adhe-sion molecules (E-cadherin, α-, β-, γ-catenin and claudin-7), their influence on survival in primary breast carcinoma, and their corresponding axillary lymph node metastasis. APMIS: acta pathologica, microbiologica, et immunologica Scandinavica 115: 52-65.

31. Benjamin JM, Nelson WJ, 2008. Bench to bedside and back again: molecular mecha-nisms of α-catenin function and roles in tumourigenesis. Seminars in cancer biology 18: 53-64.

32. Bukholm IK, Nesland JM, Borresen-Dale AL, 2000. Re-expression of E-cadherin, α-catenin and β-catenin, but not of γ-catenin, in metastatic tissue from breast cancer patients. The Journal of pathology 190: 15-19.

33. Tsang JY, Mendoza P, Lam CC, Yu AM, Putti TC, Karim RZ, Scolyer RA, Lee CS, Tan PH, Tse GM, 2012. Involvement of α- and β-catenins and E-cadherin in the develop-ment of mammary phyllodes tumours. Histopathology 61: 667-674.

34. Bukholm IK, Nesland JM, Karesen R, Jacobsen U, Borresen- Dale AL, 1998. E-Cad-herin and α-, β-, and γ-catenin protein expression in relation to metastasis in human breast carcinoma. The Journal of pathology 185: 262-266.

35. Vaupel P, Hockel M, 2000. Blood supply, oxygenation status and metabolic micromilieu of breast cancers: characterization and therapeutic relevance. International journal of oncology 17: 869-879.

36. Plumb CL, Adamcic U, Shahrzad S, Minhas K, Adham SA, Coomber BL, 2009. Modu-

132


lation of the tumour suppressor protein α-catenin by ischemic microenvironment. The American journal of pathology 175: 1662-1674.

37. Bukholm IR, Nesland JM, Bukholm G, 2006. Expression of adhesion proteins E-cad-herin, α-catenin, β-catenin and γ-catenin is different in T1 and T2 breast tumours. Pathology 38: 403-407.

38. Fanelli MA, Montt-Guevara M, Diblasi AM, Gago FE, Tello O, Cuello-Carrion FD, Calle-gari E, Bausero MA, Ciocca DR, 2008. P-Cadherin and β-catenin are useful prognostic markers in breast cancer patients; β-catenin interacts with heat shock protein Hsp27. Cell stress & chaperones 13: 207-220.

39. van Hengel J, van Roy F, 2007. Diverse functions of p120ctn in tumours. Biochimica et biophysica acta 1773: 78-88.

40. Johnson E, Seachrist DD, DeLeon-Rodriguez CM, Lozada KL, Miedler J, Abdul-Karim FW, Keri RA, 2010. HER2/ERBB2-induced breast cancer cell migration and invasion re-quire p120 catenin activation of RAC1 and CDC42. The Journal of biological chemistry 285: 29491-29501.

41. Chui MH, 2013. Insights into cancer metastasis from a clinicopathologic perspective: Epithelial-mesenchymal transition is not a necessary step. International journal of can-cer Journal international du cancer 132: 1487-1495.

42. Friedl P, Wolf K, 2003. Tumour-cell invasion and migration: diversity and escape mecha-nisms. Nature reviews Cancer 3: 362-374.

43. Friedl P, Gilmour D, 2009. Collective cell migration in morphogenesis, regeneration and cancer. Nature reviews Molecular cell biology 10: 445-457.

44. Rorth P, 2007. Collective guidance of collective cell migration. Trends in cell biology 17: 575-579.

45. Shibata T, Kokubu A, Sekine S, Kanai Y, Hirohashi S, 2004. Cytoplasmic p120ctn regu-lates the invasive phenotypes of Ecadherin- deficient breast cancer. The American journal of pathology 164: 2269-2278.

05MOLECULAR

CHARACTERIZATION OF FELINE

MAMMARY TUMOURS

135

Molecular characterization of feline mammary tumours Chapter 05

PHENOTYPICAL, CELL-ADHESION,HORMONAL RECEPTORS AND

CELL-CYCLE ASSOCIATED MARKERS:AN INTEGRATED IMMUNOHISTOCHEMICAL

STUDY IN FELINE MAMMARY LESIONS

Ana Catarina Figueira, Hugo Vilhena, Catarina Gomes, Júlio Carvalheira, Augusto J.F. de Matos, Patrícia Dias-Pereira and Fátima Gärtner

Manuscript in preparation

137


ABSTRACT

Background: The need of reliable prognostic markers and promising therapeutic ap-proaches to feline mammary carcinomas, has led to an intensive research aiming to accom-plish a molecular characterization of feline mammary tumours that reflects their biological behaviour, similarly to what has been previously performed in human breast cancer.

Materials and Methods: The aim of this study was to characterize by immunohisto-chemistry the molecular markers of normal mammary gland, hyperplastic/dysplastic mam-mary lesions, and benign and malignant feline mammary tumours applying phenotypical molecular markers (AE1/AE3, vimentin, p63), hormonal receptor status (ER, PR) and mark-ers of proliferative activity (Ki-67), as well as the classical cadherins P- and E-cadherin expression.

Results: In feline mammary carcinomas there was overexpression of vimentin and p63, higher proliferation index and a reduction of estrogen receptors expression, when com-pared with benign tumours. Carcinomas that were simultaneously P-cadherin-positive, vimentin-positive and oestrogen negative were associated to a higher histological grade. Moreover, P-cadherin and vimentin positive tumours were also associated to the presence of neoplastic emboli, presenting a threefold likelihood of intravascular dissemination than negative tumours.

Conclusions: P-cadherin, vimentin and ER expression seem to be relevant molecular markers in feline mammary carcinomas associated with a more aggressive behaviour.

139


BACKGROUND

Mammary tumours are the third most common neoplasm in queens, with more than 90% classified as malignant. The prognosis is guarded for most cases, with a mean post-diag-nosis survival time of 10-12 months, and death or euthanasia mainly attributable to local recurrence or metastasis [1, 2]. Several features have been studied as prognostic indicators in feline mammary tumours, including clinical features such as tumour size, lymph node status, and metastases; pathological features, namely histological grade; and molecular markers, such as cell-cycle associated molecules, oestrogen and progesterone receptors (ER and PR), cell adhesion molecules, among others [3-8]. Currently, lymph node involve-ment, lymphovascular invasion, and tumour histological grade are the most widely accept-ed prognostic parameters [9]. Constitutional and functional changes of cell–cell adhesion molecules, such as E- and P-cadherin, have been implicated in the progression of human breast cancer and related to a more aggressive behaviour and poor prognosis [10-14], and changes of the expression of E- and P-cadherin are associated with feline mammary carci-nogenesis [7, 15-19].

The search for prognostic and predictive factors has led to development of studies direct-ed to molecular and immunophenotypic markers in order to classify feline mammary tu-mours more accurately, and provide additional information in terms of diagnosis, prognosis and therapeutic targets [20-22], similarly to what has previously been performed in human

140

Chapter 05 Molecular characterization of feline mammary tumours

breast cancer [23, 24]. The identification of those molecular markers in carcinogenesis re-quires the knowledge of the pathways involved in the process, not only in laboratory models but also in spontaneous cases, both for the benefit of the animals and humans affected by cancers with similar development and clinical behaviour. Feline mammary tumours have been pointed as suitable spontaneous animal model for some sub-types of human breast cancer, thus our aim was to evaluate, by immunohistochemistry, samples of normal, and hyperplastic/dysplastic mammary tissue, benign and malignant feline mammary tumours using phenotypical markers (AE1/AE3, vimentin, p63), hormone receptors (ER, PR) and cell-cycle associated molecules (Ki-67), as well as cell adhesion molecules (namely P- and E-cadherin), in order to contribute to the molecular characterization of feline mammary tu-mours, enhancing their value as models of human breast cancer.

141



Tissue samples

Samples from 75 queens with naturally occurring mammary lesions surgically excised with curative intent and nine normal mammary glands (obtained from queens that were hu-manely euthanized for reasons unrelated to neoplastic disease) were included in this study. In each case, an informed consent was granted by the owners. All specimens were fixed in 10% neutral buffered formalin and routinely processed. Consecutive histological sections (2 µm) were cut from each paraffin block. One was stained with haematoxylin and eosin (HE) for histological examination, and the others were used for immunohistochemistry (IHC). When available, local and regional lymph nodes were also processed and examined for the presence of metastases as described in Figueira et al. [19].

The histological classification of the tumours was performed independently by three observ-ers (ACF, PDP and FG) based on the criteria of the World Health Organization (WHO) for the histological classification of mammary tumours of domestic animals [25].

Carcinomas were graded in accordance with the Nottingham grading system for human breast carcinomas, based on the assessment of three morphological features: tubule for-mation, nuclear pleomorphism, and mitotic counts, and classified as grade I (well-differenti-

142


ated), grade II (moderately differentiated) and grade III (poorly differentiated) [26]. Variables with known prognostic value, such as mode of growth (infiltrative or expansive), tumour diameter (<2 cm, 2-3 cm, >3 cm), presence of necrosis, skin ulceration, lymph node metas-tases, and intravascular neoplastic emboli [2, 27] were also recorded.

Immunoexpression

Immunohistochemistry (IHC) was performed using a polymer-based system (Novolink Max Polymer Detection System, Product No: RE7280-K Leica Biosystems, Newcastle, UK), ac-cording to the manufacturer’s instructions. Sections were dewaxed in xylene, rehydrated through graded alcohols and treated with 10mM citrate buffer, pH 6.0, for 3 minutes in a pressure cooker. Endogenous peroxidase activity was blocked by treating the sections with 3% hydrogen peroxide in methanol for 10 minutes and rinsing in Tris-buffered saline (TBS, pH 7.6, 0.5 M). Sections were incubated overnight at 4ºC in a humid chamber with specific mouse monoclonal antibodies against human pan-cytokeratin AE1/AE3 (clone AE1/AE3, Zymed/Invitrogen, Camarillo, CA, USA), vimentin (clone V9, Dako, Gostrup, Denmark), p63 (clone 4A4, Thermo Scientific, Fremont, USA), ER (clone 6F11, Novocastra, Newcastle Upon Tyne, United Kingdom), PR (clone 1A6, Novocastra, Newcastle Upon Tyne, United Kingdom), and Ki-67 (clone MIB-1, DakoCytomation, Denmark). Antibodies were diluted 1:300, 1:500, 1:200, 1:40, 1:40 and 1:50, respectively, in TBS with 5% bovine serum albu-min (BSA). Immunolabelling was detected with 3,3’-diaminobenzidine tetrahydrochloride (DAB) incubated at room temperature and sections were then counterstained with Mayer’s haematoxilin, dehydrated and mounted. For negative controls, the primary antibody was re-placed by TBS. Sections of feline normal mammary glands were used as positive controls.

Evaluation of immunolabelling

All samples were evaluated regarding the expression of pan-cytokeratin AE1/AE3 (epitheli-al cells), vimentin (mesenchymal cells), and p63 (myoepithelial cells) for phenotypical char-acterization. Positivity was indicated by the presence of distinct dark brown nuclear (p63), cytoplasmic (vimentin) or cytoplasmic and/or membranous (AE1/AE3) staining.

The AE1/AE3 imunoexpression was considered reduced when less than 75% of the epithe-lial cells were stained. Vimentin and p63 were considered overexpressed when epithelial cells showed cytoplasmic and nuclear staining, respectively. For data analysis, tumours with less than 10% positive cells were considered negative and those with ≥10% stained cells were considered positive (adapted from [28-30]) .

The assessment of ER and PR was also based on a semi quantitative analysis, according to the percentage of stained nuclei and the intensity of staining. The percentage of tumour

143


cells with nuclear staining (proportion score, PS) was graded as 0 - < 5%; 1 - 5–19%; 2 - 20–60%, and 3 > 60%. The staining intensity (intensity score, IS) was estimated accord-ing to the average staining intensity of positive cells and scored as 0 = negative, 1 = light staining, 2 = moderate staining, 3 = strong staining. PS and IS were added to obtain a total hormone-receptor score (TS) (range 0–6). Tumours were considered hormone-receptor positive when PS was ≥ 1 and TS ≥ 2 [31].

The proliferation activity was determined by assessing the Ki-67 index [32], determined by counting 1000 neoplastic cells, in 10 representative fields, at high magnification (40x objective) and expressing the percentage of positive cells (nuclear staining, regardless of the intensity) [6, 33]. For statistical analysis, tumours were grouped according to quartiles, following the approach of Castagnaro et al. (1998) [6].

The staining and evaluation method for the expression of P- and E-cadherin was previously described [19].

Statistical Methods

Data was organized in contingency tables and the likelihood ratio chi-square test was used to determine the significance of the relationship between the expression of the catenins and the tumours’ clinicopathological parameters as well as the cadherins expression. When-ever biologically consistent, 2x2 tables of contingency were built and Fisher´s exact test was performed. All statistical analysis was performed using SAS/STAT, 1989 (SAS Institute Inc., Cary, NC, USA) [34] and, in all instances, p < 0.05 was considered to be statistically significant.

144


RESULTS

Nine normal mammary gland samples, 13 hyperplastic/dysplastic lesions (seven fibrocys-tic disease cases and six fibroadenomatous changes), 10 benign tumours (seven simple adenomas and three fibroadenomas) and 60 malignant tumours (32 tubulopapillary car-cinomas, 16 solid carcinomas, four cribriform carcinomas, six mucinous carcinomas and two carcinosarcomas) were analysed. Seven (11.67%) malignant tumours were grade I, 25 (41.67%) grade II and 28 (46.67%) grade III. Neoplastic intravascular emboli were observed in 21 (36.21%) carcinomas, while lymph node metastases were identified in 18/35 (51.43%) cases with available lymph nodes. The expression of P- and E-cadherin in this series was previously described [19].

AE1/AE3

In normal mammary tissues, pan-cytokeratin AE1/AE3 was expressed in the membrane and cytoplasm of luminal epithelial cells, with a lighter staining in myoepithelial cells. A simi-lar pattern was observed in hyperplastic/dysplastic lesions, benign and malignant tumours, with the exception of a reduced expression in five (8.33%) carcinomas. Both intravascular emboli and lymph node metastases were positive to AE1/AE3, with only one lymph node metastasis revealing less than 75% of positive metastatic cells.

145


Vimentin

In normal mammary tissues, the expression of vimentin was present in myoepithelial and mesenchymal cells, as well as in the luminal compartment of the ducts. Similar patterns were observed in hyperplastic/dysplastic lesions and benign tumours, with the exception of the fibroadenomatous changes cases where we observed a cytoplasmic expression in more than 10% of the ductal and acinar epithelial cells. In the two carcinosarcomas, the sarcomatous component was vimentin positive and cytokeratin negative.

An overexpression of vimentin was observed in the cytoplasm of neoplastic epithelial cells in 35 (58.33%) carcinomas, a significant difference when compared with benign tumours (p<0.0001) (Figure 1a and 1b) (Figure 2).

Moreover, a significant association was found between the overexpression of vimentin and the histological grade of carcinomas (p=0.0318), with no immunoreactivity observed in most low-grade carcinomas (n=6; 85.71%) and positivity in nearly two-thirds of moderate and high grade carcinomas (n=34; 64.15%) (Table 1). There was a significant direct association between the overexpression of vimentin and P-cadherin in the epithelial cells of malignant tumours (p<0.0001) (Table 2), and those that expressed both proteins were significantly related with the presence of intravascular neoplastic emboli (p=0.0307). Although there was no direct association between the expression of vimentin and E-cadherin, the combined expression of P- and E-cadherin was statistically related with the expression of vimentin, with P-cad+/E-cad- being the most predominant pattern (n=20; 57.14%) amongst vimentin-positive tumours. Vimentin expression in primary tumours was not always consistent with the expression observed in the intravascular neoplastic emboli and in corresponding lymph node metastasis (Table 3).

146


Vim

P63

ER

PR

Ki-67

Figure 1. Vimentin, p63, estrogen receptor, progesterone receptor and Ki-67 expression by immuno-histochemistry in feline mammary carcinomas. (a) Vimentin expression in more than 50% of the epithelial neoplastic cells of a grade III tubulopapillary carcinoma. x100; (b) Detail of the increased vimentin expression. x400; (c) p63 expression in the epithelial cells of a grade III mucinous carcinoma. x100; (d) Detail of the p63 overexpression. x400; (e) Estrogen receptor negative grade II cribriform carcinoma (*positive internal control). x200; (f) Detail of the negative estrogen receptor carcinoma x400; (g) Progesterone receptor reduction in a grade III solid carcinoma. x200; (h) Detail of the PR expression x400. (i) Ki-67 high expression in a grade III solid carcinoma. x100 (j) Detail of the Ki-67 expression: x400.

147


Figure 2. Pan-cytokeratin AE1AE3 (a) and vimentin (b) co-expression in a grade III tubulopapillary carcinoma. IHC. x200.

P63

In normal mammary tissues, hyperplastic/dysplastic lesions and benign tumours, the ex-pression of p63 was restricted to the nuclei of myoepithelial cells, while luminal epithelium was consistently negative.

In malignant tumours, p63-positive myoepithelial cells were identified surrounding some areas of epithelial tumour cells. P63 immunostainning was also found in the squamous metaplastic (basal and parabasal) carcinoma cells. In three malignant tumours, p63 immu-noexpression revealed the existence of a myoepithelial cell phenotype not easily identified by routine HE evaluation.

P63 expression was also observed, albeit less intense than in myoepithelial cells, in the nuclei of epithelial cells in 23 (38.33%) carcinomas (Figure 1c and 1d), significantly different when compared to benign tumours (p=0.0245). There was a significant direct relationship between p63 aberrant expression and the histological grade of carcinomas (p=0.0072), with all grade I tumours being p63-negative and more than half (n=15; 53.57%) of grade III being p63-positive (Table 1). Furthermore, significant p63 expression differences were observed between different histological types (p=0.0026), with both carcinosarcomas, most muci-nous carcinomas, and half of the solid carcinomas being p63-positive, while all cribriform and three quarters of the tubulopapillary carcinomas were p63-negative (Table 1). The vast majority of P-cadherin-negative tumours were also p63-negative (p=0.0205), but there was no significant association between the expression of p63 and E-cadherin. When the P- and E-cadherin combined expression was considered, P+/E- was the most predominant pattern (n=13; 56.52%) amongst the p63-positive tumours.

In the vast majority of cases, p63 was similarly expressed by primary tumours and their intravascular neoplastic emboli and lymph node metastases (Table 3).

148


Table 1. Association between vimentin, p63, PR, ER expression, Ki-67 index and clinicopathological parameters in feline malignant mammary tumours

Clinicopathological parameters nVimentin p63 ER* ER* PR Ki-67 index*

Positive Negative Positive Negative Negative Positive Negative Positive <47.46% 47.46-61.1% 61.1-74.8% >74.8%

Histological type

Tubulopapillary carcinoma 32 17 (53.13%) 15 (46.88%) 8 (25%) 24 (75%) 21 (65.63%) 11 (34.38%) 8 (25%) 24 (75%) 10 (31.25%) 7 (21.88%) 7 (21.88%) 8 (25%)

Solid carcinoma 16 9 (56.25%) 7 (43.75%) 8 (50%) 8 (50%) 12 (80%) 3 (20%) 4 (25%) 12 (75%) 3 (20%) 4 (26.67%) 5 (33.33%) 3 (20%)

Cribriform carcinoma 4 3 (75%) 1 (25%) 0 4 (100%) 3 (75%) 1 (25%) 0 4 (100%) 1 (25%) 2 (50%) 0 1 (25%)Mucinous carcinoma 6 5 (83.33%) 1 (16.67%) 5 (83.33%) 1 (16.67%) 6 (100%) 0 0 6 (100%) 0 1 (16.67%) 3 (50%) 2 (33.33%)

Carcinosarcoma 2 1 (50%) 1 (50%) 2 (100%) 0 1 (50%) 1 (50%) 2 (100%) 0 0 1 (50%) 0 1 (50%)

P NS 0.0026 NS NS 0.0243 NS

Histological grade

Grade I 7 1 (14.29%) 6 (85.71%) 0 7 (100%) 1 (14.29%) 6 (85.71%) 2 (28.57%) 5 (71.43%) 7 (100%) 0 0 0Grade II 25 17 (68%) 8 (32%) 8 (32%) 17 (68%) 21 (84%) 4 (16%) 4 (16%) 21 (84%) 2 (8%) 9 (36%) 7 (28%) 7 (28%)

Grade III 28 17 (60.71%) 11 (39.29%) 15 (53.57%) 13 (46.43%) 21 (77.78%) 6 (22.22%) 8 (28.57%) 20 (71.43%) 5 (18.52%) 6 (22.22%) 8 (29.63%) 8 (29.63%)

P 0.0318 0.0072 0.0018 0.0018 NS 0.0003

Mode of growth

Expansive 3 0 3 (100%) 0 3 (100%) 1 (33.33%) 2 (66.67%) 0 3 (100%) 1 (33.33%) 1 (33.33%) 0 1 (33.33%)

Infiltrative 56 34 (60.71%) 22 (39.29%) 23 (41.07%) 33 (58.93%) 42 (76.36%) 13 (23.64%) 13 (23.21%) 43 (76.79%) 12 (21.82%) 14 (25.45%) 15 (27.27%) 14 (25.45%)

P NS NS NS NS NS NS


<2 cm 33 17 (51.52%) 16 (48.48%) 11 (33.33%) 22 (66.67%) 21 (65.63%) 11 (34.38%) 7 (21.21%) 26 (78.79%) 6 (18.75%) 12 (37.5%) 8 (25%) 6 (18.75%)2-3 cm 10 7 (70%) 3 (30%) 5 (50%) 5 (50%) 8 ( 80%) 2 (20%) 2 (20%) 8 (80%) 2 (20%) 2 (20%) 3 (30%) 3 (30%)

>3 cm 17 11 (64.71%) 6 (35.29%) 7 (41.18%) 10 (58.82%) 14 (82.35%) 3 (17.65%) 5 (29.41%) 12 (70.59%) 6 (35.29%) 1 (5.88%) 4 (23.53%) 6 (35.29%)

P NS NS NS NS NS NS

Ulceration

Absent 48 26 (54.17%) 22 (45.83%) 16 (33.33%) 32 (66.67%) 33 (70.21%) 14 (29.79%) 9 (18.75%) 39 (81.25%) 12 (25.53%) 13 (27.66%) 11 (23.4%) 11 (23.4%)

Present 12 9 (75%) 3 (25%) 7 (58.33%) 5 (41.67%) 10 (83.33%) 2 (16.67%) 5 (41.67%) 7(58.33%) 2 (16.67%) 2 (16.67%) 4 (33.33%) 4 (33.33%)

P NS NS NS NS NS NS

Necrosis

Absent 12 5 (41.67%) 7 (58.33%) 1 (8.33%) 11 (91.67%) 5 (45.45%) 6 (54.55%) 3 (25%) 9 (75%) 5 (45.45%) 1 (9.09%) 4 (36.36%) 1 (9.09%)

Present 48 30 (62.50%) 18 (37.50%) 22 (45.83%) 26 (54.17%) 38 (79.17%) 10 (20.83%) 11 (22.92%) 37 (77.08%) 9 (18.75%) 14 (29.17%) 11 (22.92%) 14 (29.17%)

P NS 0,0205 NS NS NS NS


Absent 37 18 (48.65%) 19 (51.35%) 12 (32.43%) 25 (67.57%) 25 (67.57%) 12 (32.43%) 10 (27.03%) 27 (72.97%) 11 (29.73%) 8 (21.62%) 7 (18.92%) 11 (29.73%)

Present 21 16 (76.19%) 5 (23.81%) 10 (47.62%) 11 (52.38%) 16 (80%) 4 (20%) 4 (19.05%) 17 (80.95%) 3 (15%) 7 (35%) 6 (30%) 4 (20%)

P NS NS NS NS NS NS


Absent 17 10 (58.82%) 7 (41.18%) 5 (29.41%) 12 (70.59%) 12 (70.59%) 5 (29.41%) 2 (11.76%) 15 (88.24%) 5 (29.41%) 2 (11.76%) 6 (35.29%) 4 (23.53%)

Present 18 13 (72.22%) 5 (27.78%) 9 (50%) 9 (50%) 13 (76.47%) 4 (23.53%) 6 (33.33%) 12 (66.67%) 3 (17.65%) 6 (35.29%) 4 (23.53%) 4 (23.53%)

P NS NS NS NS NS NS

P- probability value.

NS -not significant.

* - one case was excluded because there was no positive stainning in the internal poistive control of the sample.

149


Table 1. Association between vimentin, p63, PR, ER expression, Ki-67 index and clinicopathological parameters in feline malignant mammary tumours

Clinicopathological parameters nVimentin p63 ER* ER* PR Ki-67 index*

Positive Negative Positive Negative Negative Positive Negative Positive <47.46% 47.46-61.1% 61.1-74.8% >74.8%

Histological type

Tubulopapillary carcinoma 32 17 (53.13%) 15 (46.88%) 8 (25%) 24 (75%) 21 (65.63%) 11 (34.38%) 8 (25%) 24 (75%) 10 (31.25%) 7 (21.88%) 7 (21.88%) 8 (25%)

Solid carcinoma 16 9 (56.25%) 7 (43.75%) 8 (50%) 8 (50%) 12 (80%) 3 (20%) 4 (25%) 12 (75%) 3 (20%) 4 (26.67%) 5 (33.33%) 3 (20%)

Cribriform carcinoma 4 3 (75%) 1 (25%) 0 4 (100%) 3 (75%) 1 (25%) 0 4 (100%) 1 (25%) 2 (50%) 0 1 (25%)Mucinous carcinoma 6 5 (83.33%) 1 (16.67%) 5 (83.33%) 1 (16.67%) 6 (100%) 0 0 6 (100%) 0 1 (16.67%) 3 (50%) 2 (33.33%)

Carcinosarcoma 2 1 (50%) 1 (50%) 2 (100%) 0 1 (50%) 1 (50%) 2 (100%) 0 0 1 (50%) 0 1 (50%)

P NS 0.0026 NS NS 0.0243 NS

Histological grade

Grade I 7 1 (14.29%) 6 (85.71%) 0 7 (100%) 1 (14.29%) 6 (85.71%) 2 (28.57%) 5 (71.43%) 7 (100%) 0 0 0Grade II 25 17 (68%) 8 (32%) 8 (32%) 17 (68%) 21 (84%) 4 (16%) 4 (16%) 21 (84%) 2 (8%) 9 (36%) 7 (28%) 7 (28%)

Grade III 28 17 (60.71%) 11 (39.29%) 15 (53.57%) 13 (46.43%) 21 (77.78%) 6 (22.22%) 8 (28.57%) 20 (71.43%) 5 (18.52%) 6 (22.22%) 8 (29.63%) 8 (29.63%)

P 0.0318 0.0072 0.0018 0.0018 NS 0.0003

Mode of growth

Expansive 3 0 3 (100%) 0 3 (100%) 1 (33.33%) 2 (66.67%) 0 3 (100%) 1 (33.33%) 1 (33.33%) 0 1 (33.33%)

Infiltrative 56 34 (60.71%) 22 (39.29%) 23 (41.07%) 33 (58.93%) 42 (76.36%) 13 (23.64%) 13 (23.21%) 43 (76.79%) 12 (21.82%) 14 (25.45%) 15 (27.27%) 14 (25.45%)

P NS NS NS NS NS NS


<2 cm 33 17 (51.52%) 16 (48.48%) 11 (33.33%) 22 (66.67%) 21 (65.63%) 11 (34.38%) 7 (21.21%) 26 (78.79%) 6 (18.75%) 12 (37.5%) 8 (25%) 6 (18.75%)2-3 cm 10 7 (70%) 3 (30%) 5 (50%) 5 (50%) 8 ( 80%) 2 (20%) 2 (20%) 8 (80%) 2 (20%) 2 (20%) 3 (30%) 3 (30%)

>3 cm 17 11 (64.71%) 6 (35.29%) 7 (41.18%) 10 (58.82%) 14 (82.35%) 3 (17.65%) 5 (29.41%) 12 (70.59%) 6 (35.29%) 1 (5.88%) 4 (23.53%) 6 (35.29%)

P NS NS NS NS NS NS

Ulceration

Absent 48 26 (54.17%) 22 (45.83%) 16 (33.33%) 32 (66.67%) 33 (70.21%) 14 (29.79%) 9 (18.75%) 39 (81.25%) 12 (25.53%) 13 (27.66%) 11 (23.4%) 11 (23.4%)

Present 12 9 (75%) 3 (25%) 7 (58.33%) 5 (41.67%) 10 (83.33%) 2 (16.67%) 5 (41.67%) 7(58.33%) 2 (16.67%) 2 (16.67%) 4 (33.33%) 4 (33.33%)

P NS NS NS NS NS NS

Necrosis

Absent 12 5 (41.67%) 7 (58.33%) 1 (8.33%) 11 (91.67%) 5 (45.45%) 6 (54.55%) 3 (25%) 9 (75%) 5 (45.45%) 1 (9.09%) 4 (36.36%) 1 (9.09%)

Present 48 30 (62.50%) 18 (37.50%) 22 (45.83%) 26 (54.17%) 38 (79.17%) 10 (20.83%) 11 (22.92%) 37 (77.08%) 9 (18.75%) 14 (29.17%) 11 (22.92%) 14 (29.17%)

P NS 0,0205 NS NS NS NS


Absent 37 18 (48.65%) 19 (51.35%) 12 (32.43%) 25 (67.57%) 25 (67.57%) 12 (32.43%) 10 (27.03%) 27 (72.97%) 11 (29.73%) 8 (21.62%) 7 (18.92%) 11 (29.73%)

Present 21 16 (76.19%) 5 (23.81%) 10 (47.62%) 11 (52.38%) 16 (80%) 4 (20%) 4 (19.05%) 17 (80.95%) 3 (15%) 7 (35%) 6 (30%) 4 (20%)

P NS NS NS NS NS NS


Absent 17 10 (58.82%) 7 (41.18%) 5 (29.41%) 12 (70.59%) 12 (70.59%) 5 (29.41%) 2 (11.76%) 15 (88.24%) 5 (29.41%) 2 (11.76%) 6 (35.29%) 4 (23.53%)

Present 18 13 (72.22%) 5 (27.78%) 9 (50%) 9 (50%) 13 (76.47%) 4 (23.53%) 6 (33.33%) 12 (66.67%) 3 (17.65%) 6 (35.29%) 4 (23.53%) 4 (23.53%)

P NS NS NS NS NS NS

P- probability value.

NS -not significant.

* - one case was excluded because there was no positive stainning in the internal poistive control of the sample.

150


Tabl

e 2.

Ass

ocia

tion

betw

een

vim

entin

, p63

, PR

, ER

exp

ress

ion

and

Ki-6

7 in

dex

and

P- a

nd E

-cad

herin

in fe

line

mal

igna

nt

mam

mar

y tu

mou

rs

P-

cadh

erin

E-

cadh

erin

P-

cadh

erin

/E-c

adhe

rin

Posi

tive

Neg

ativ

e

Red

uced

Posi

tive

P+

/E+

P+/E

-P-

/E+

P-/E

-

Vim

entin

Posi

tive

34 (9

7.14

%)

1 (2

.86%

)<0

.000

120

(57.

14%

)15

(42.

86%

)N

S14

(40%

)20

(57.

14%

)1

(2.8

6%)

00.

0002

Neg

ativ

e14

(56%

)11

(44%

)8

(32%

)17

(68%

)9

(36%

)5

(20%

)8

(32%

)3

(12%

)

P63

Po

sitiv

e22

(95.

65%

)1

(4.3

5%)

0.02

0513

(56.

52%

)10

(43.

48%

)N

S9

(39.

13%

)13

(56.

52%

)1

(4.3

5%)

00.

0421

Neg

ativ

e26

(70.

27%

)11

(29.

73%

)15

(40.

54%

)22

(59.

46%

)14

(37.

84%

)12

(32.

43%

)8

(21.

62%

)3

(8.1

1%)

ER*

Neg

ativ

e38

(88.

37%

)5

(11.

63%

)0.

0114

25 (5

8.14

%)

18 (4

1.86

%)

0.00

2715

(34.

88%

)23

(53.

49%

)3

(6.9

8%)

2 (4

.65%

)0.

0013

Posi

tive

9 (5

6.25

%)

7 (4

3.75

%)

2 (1

2.5%

)14

(87.

5%)

8 (5

0%)

1 (6

.25%

)6

(37.

5%)

1 (6

.25%

)

PRN

egat

ive

11 (7

8.57

%)

3 (2

1.43

%)

NS

9 (6

4.29

%)

5 (3

5.71

%)

NS

4 (2

8.57

%)

7 (5

0%)

1 (7

.14%

)2

(14.

29%

)N

SPo

sitiv

e37

(80.

43%

)9

(19.

57%

)19

(41.

3%)

27 (5

8.7%

)19

(41.

3%)

18 (3

9.13

%)

8 (1

7.39

%)

1 (2

.17%

)

Ki-6

7 in

dex*

<47.

46%

7 (5

0%)

7 (5

0%)

0.02

58

4 (2

8.57

%)

10 (7

1.43

%)

NS

5 (3

5.71

%)

2 (1

4.29

%)

5 (3

5.71

%)

2 (1

4.29

%)

NS

47.4

6-61

.1%

13 (8

6.67

%)

2 (1

3.33

%)

5 (3

3.33

%)

10 (6

6.67

%)

8 (5

3.33

%)

5 (3

3.33

%)

2 (1

3.33

%)

0

61.1

-74.

8%13

(86.

67%

)2

(13.

33%

)8

(53.

33%

)7

(46.

67%

)6

(40%

)7

(46.

67%

)1

(6.6

7%)

1 (6

.67%

)

>74.

8%14

(93.

33%

)1

(6.6

7%)

10 (6

6.67

%)

5 (3

3.33

%)

4 (2

6.67

%)

10 (6

6.67

%)

1 (6

.67%

)0

P- p

roba

bilit

y va

lue.

N

S -n

ot s

igni

fican

t.*

- one

cas

e w

as e

xclu

ded

beca

use

ther

e w

as n

o po

sitiv

e st

ainn

ing

in th

e in

tern

al p

oist

ive

cont

rol o

f the

sam

ple

151


Tabl

e 3

. Ass

ocia

tion

betw

een

vim

entin

, p63

, PR

, ER

exp

ress

ion

in p

rimar

y tu

mou

r and

in th

e in

trav

ascu

lar

embo

li an

d ly

mph

nod

e m

etas

tase

s

Neo

plas

tic in

trav

ascu

lar e

mbo

li

Lym

ph n

ode

met

asta

ses

Po

sitiv

eN

egat

ive

Po

sitiv

eN

egat

ive

Primary tumour

Vim

entin

Posi

tive

13 (8

6.67

%)

2 (1

3.33

%)

NS

9 (6

9.23

%)

4 (3

0.77

%)

NS

Neg

ativ

e1

(33.

33%

)2

(66.

67%

)1

(20%

)4

(80%

)

p63

Posi

tive

5 (7

1.43

%)

2 (2

8.57

%)

p=0.

0210

7 (7

7.78

%)

2 (2

2.22

%)

p=0.

0023

Neg

ativ

e0

6 (1

00%

)0

9 (1

00%

)

ER*

Neg

ativ

e0

14 (1

00%

)p=

0.00

152

(16.

67%

)10

(83.

33%

)N

SPo

sitiv

e3

(100

%)

03

(75%

)1

(25%

)

PRN

egat

ive

02

(100

%)

p=0.

0074

2 (3

3.33

%)

4 (6

6.67

%)

p=0.

0063

Posi

tive

15 (1

00%

)0

11 (1

00%

)0

P- p

roba

bilit

y va

lue.

N

S -n

ot s

igni

fican

t.*

- one

cas

e w

as e

xclu

ded

beca

use

ther

e w

as n

o po

sitiv

e st

ainn

ing

in th

e in

tern

al p

oist

ive

cont

rol o

f the

sam

ple.

152


ER

As expected, all normal mammary gland tissues expressed ER in the nuclei of more than 60% of the epithelial cells, with moderate to strong intensity and a heterogeneous lobular distribution. A similar pattern was observed in hyperplastic/dysplastic lesions and benign tumours, with the exceptions of one fibroadenomatous change and one fibroadenoma, both ER-negative. The majority of malignant tumours (n=43; 72.88%) was ER-negative (Figure 1e and 1f), a significant difference when compared to benign tumours (p<0.0001). One car-cinoma was excluded from the study because we were unable to stain its internal positive control. The staining intensity was also heterogeneous in carcinomas, with neighbouring areas of poor and strong nuclear expression. There was a significant inverse relationship between the expression of ER and the histological grade of carcinomas (p=0.0018), with most of grade I (n=6; 85.71%) being ER-positive while the majority of grades II and III (n=42; 80.77%) were ER-negative (Table 1). ER expression was also statistically related with P-cadherin (p=0.0114) and E-cadherin (p=0.0027) expression. The majority of ER-neg-ative tumours (n=38; 88.37%) were P-cadherin-positive, while the majority of ER-positive tumours (n=14; 87.5%) were also E-cadherin-positive (Table 2). ER negativity was signifi-cantly related to the combined expression of P- and E-cadherin (p=0.0031), with P-cad+/E-cad- being the most predominant pattern (n=23; 53.49%). The ER expression in primary tumours was coincident with the expression in the corresponding intravascular emboli in all cases, while in lymph node metastases there were some discrepancies (Table 3).

PR

Nuclear expression of PR was identified in more than 60% of the epithelial cells of all normal mammary gland tissues, with a moderated to strong intensity. The distribution of positive nuclei was heterogeneous amongst lobules and/or ducts. The same pattern was observed in hyperplastic/dysplastic lesions and benign tumours, with the exception of one fibroad-enoma, that was PR-negative.

Less than one quarter of the malignant tumours (n=14; 23.33%) were PR-negative (Figure 1g and 1h), not significantly different from benign tumours. The staining intensity in carcino-mas was heterogeneous, with neighbouring areas of poor and strong nuclear expression. All cribriform and mucinous carcinomas and three quarters of tubulopapillary and solid car-cinomas were PR-positive, while both carcinosarcomas were PR-negative, being PR stain-ing associated with histological sub-type of carcinomas (p=0.0243) (Table 1). There were no significant associations between PR and other clinicopathological parameters, nor P- or E-cadherin expression. The PR expression in primary tumours was coincident with the ex-pression in the corresponding intravascular emboli in all cases, albeit some discrepancies with lymph node metastases (Table 3).

153


Ki-67

Ki-67 immunostaining in normal mammary gland tissues was nuclear, with a mean Ki-67 index of 14.6%, ranging from 0.2% to 52.4%. In hyperplastic/dysplastic lesions the mean Ki-67 index was 30.83%, ranging from 3.42% to 67.38%. A marked difference was observed in the mean Ki-67 index between fibrocystic disease (15%, range 3.42% to 30.75%) and fibroadenomatous change (49.29%, range 27.32% to 67.38%).

The mean Ki-67 index of benign tumours (16.08%, range 3.48% to 43.35%) was lower than that of malignant ones (58.28%, range 13.7% to 86.61%) and when indexing the Ki-67 by quartiles a significant association (p<0.0001) was observed with the neoplastic lesions (benign and malignant tumours) (Figure 1i and 1j). One carcinoma was excluded from the study because no staining in the internal positive control of the sample was achieved. When malignant tumours were grouped by Ki-67 index quartiles, a significant relationship with histological grade (p=0.0003) was observed (Table 1). All grade I tumours were included in the first quartile (Ki-67 index < 47.46%) while more than half of grades II and III belonged to the higher two quartiles (Ki-67 index > 61.1%). It was possible to observe an association between Ki-67 index quartiles and the expression of P-cadherin (p=0.0258), ER (p=0.0069) and p63 (p=0.0181) (Table 2). The first quartile was equally distributed between P-cadherin-negative and -positive tumours, while more than 90% of tumours in the highest quartile (Ki-67 > 74.8%) were P-cadherin-positive. Most of the ER-negative carcinomas (n=38; 84.44%) were in the higher quartiles, while the majority of p63-negative tumours (n=13; 99.86%) were in the lowest Ki-67 quartile. No association with the expression of E-cadherin, vimentin and PR was observed.

Analysis of the combined expression of molecular markers and clinicopathological param-eters in carcinomas allowed for the conclusion that P-cad+/vim+/ER- tumours were of mod-erate to high histological grades (n=25; 100%) (p=0.0038), and the majority of tumours with intravascular neoplastic emboli were P-cad+/vim+ (n=16; 76.19%) (p=0.0307). Moreover, P-cad+/vim+ tumours were associated to a 3.76 odds ratio (CL 95%: 1.14-12.43) for vascu-lar invasion. In the opposite, tumours simultaneously Pcad-/vim-/ER+/E-cad+ and with the lowest Ki-67 index were all low grade carcinomas.

154


DISCUSSION

Spontaneous feline mammary carcinomas have been proposed by the World Health Or-ganization as a good model for human breast cancer, based on the similarities in the age of onset, incidence, histopathological features, biological behaviour, and poor prognosis of the malignant mammary tumours in both species [1, 2]. Consequently, it is important to evaluate feline mammary tumours at the molecular level in order to identify prognostic markers and develop targeted therapies, thus enhancing their value as models of human breast cancer and the approach to feline mammary tumours. On that basis, the expression of three phenotypic markers: pan-cytokeratin AE1/AE3 (an epithelial cell marker); vimentin (a mesenchymal cell marker); and p63 (a myoepithelial cell marker) was evaluated both in normal mammary tissues and in mammary lesions.

In normal mammary glands, AE1/AE3 was expressed by luminal epithelial and myoepithe-lial cells (although with less intensity) and p63 was restricted to myopithelial cells. Besides being present in myoepithelial and stromal cells, vimentin was co-expressed with AE1/AE3 by ductal luminal epithelial cells. This co-expression was described for the first time by Ca-liari et al. (2014) [22], and interpreted as a hallmark of a non-terminally differentiated luminal component, diffusely distributed in the mammary ducts. Although the cat seems to be the only species where the mammary non-neoplastic luminal epithelium is described to express vimentin, the phenomenon has been described in the so-called “cap cells” of mice and the “side-population” of human breast containing the progenitor cell compartment [22].

155


P63 is a member of the p53-family of transcription factors found in the basal cell layer in-cluding cap cells and myoepithelium of the mammary gland [35]. In both benign and malig-nant human breast tumours, the expression of p63 is restricted to myoepithelial cells [36] although some authors described a less intensive nuclear p63 expression in epithelial cells of some particular breast carcinomas [36, 37]. More than one third of the carcinomas of our series presented epithelial p63 expression and, although the staining intensity was weaker than in myoepithelial cells, it was related to higher histological grade. This expression may be due to the p63 expression in the early stages of epithelial differentiation [38] or reflect a potential myoepithelial differentiation in a subset of neoplastic cells [36, 37]. P63 [39, 40] and P-cadherin [41] are both considered stem cell markers with p63 being known to act as a transcription factor of the P-cadherin promoter [42, 43]. In fact, the relationship found be-tween these two molecules in our carcinomas series can be in part justified by the existence of an association at the genetic level.

In more than half of the malignant tumours in our series, epithelial cells revealed an aberrant co-expression of vimentin and AE1/AE3, a pattern that has been previously described in hu-man breast cancer [30] and feline malignant mammary tumours [7, 22]. Such phenomenon may be a hallmark of the direct myoepithelial histogenesis; a sign of the epithelial-mesen-chymal transition (EMT) reflecting the end-stage of tumour dedifferentiation; or derive from breast progenitor cells with a bilinear (glandular and myoepithelial) differentiation potential [44]. The expression of vimentin by epithelial breast cancer cells has been associated with increased drug resistance, cancer invasive behaviour and metastasis [45, 46].

Epithelial-mesenchymal transition is a multistep program characterized by the loss of epi-thelial characteristics, such as downregulation of epithelial markers (e.g. E-cadherin), and acquisition of a mesenchymal phenotype, namely through the upregulation of mesenchymal markers (e.g. vimentin) [41, 47, 48]. These changes result in the loss of cell-cell adhesion and polarity, and the acquisition of migratory and invasive properties as well as metastatic potential [41, 48, 49]. More than half of the P-cad+/vim+ carcinomas in our series revealed a reduction of E-cadherin expression, suggesting the acquisition of mesenchymal features while losing epithelial characteristics, respectively. However, some P-cad+/vim+ carcino-mas were simultaneously E-cad+ (n=14; 41.17%), possibly due to an incomplete EMT. This intermediate state is described as a partial EMT, in which the cells retain some characteris-tics of epithelial cells albeit acquiring migratory ability, a feature of mesenchymal cells [41]. It has been proposed that P-cadherin may be considered an EMT marker, able to identify intermediate and transient EMT states associated with metastatic phenotypes, by interfer-ing with epithelial cell-cell adhesion in the presence of E-cadherin [41].

Although hormone receptors are not currently considered to be prognostic markers in feline mammary tumours, they may represent key regulators of other important molecular mark-ers in mammary carcinogenesis [8, 21]. In this series, the expression of ER and PR de-creased from benign to malignant tumours, corroborating previous studies [1, 5, 8, 50] and

156


suggesting that the role of steroid hormones in carcinogenesis is more pronounced at the early stages of tumour development, with a more autonomous growth in advanced stages of malignancy [50]. In fact, an inverse association was found, in carcinomas, between the expression of ER and the histological grade. The downregulation of ER was, however, more evident than that of PR, in agreement with previous reports of consistent loss of ER in carcinomas [5, 8, 51]. Although it has been proposed that the presence of PR is a good indicator of the integrity of the ER molecular pathway in human breast cancer [52], the high number of ER-/PR+ feline carcinomas, similar to previous observations [5, 8], and an ab-sent association between ER and PR expression in our series, suggests the presence of other non-oestrogen-dependent regulators of PR [2].

It has been postulated that estrogens stimulate the expression of E-cadherin in mice and that there are progesterone-responsive elements in the promoter region of the mouse E-cadherin gene [53], although the association between E-cadherin expression and ER/PR status in breast cancer is not consensual [12, 54-57]. In feline mammary carcinomas we observed that the majority of ER positive tumours were also E-cadherin-positive, reinforcing the concept of an estrogen-regulated expression of E-cadherin. Several studies revealed a negative association between the overexpression of P-cadherin and the ER and PR status of breast cancer [11-13, 58, 59]. The lack of ER signalling is responsible for P-cadherin overexpression, categorizing the P-cadherin gene/CDH3 as an oestrogen-repressed gene [59-62]. Our results support this association, with the vast majority of ER-negative carcino-mas being P-cadherin-positive. Thus, in feline mammary tumours the ER expression seems to be associated with both cadherins, suggesting a regulatory role in their expression.

Basal-like human breast carcinomas (BLBC) are a molecular sub-group of breast cancer that have been considered the end-result of EMT and associated with poor prognosis [49, 63, 64]. The immunohistochemical profile of this subtype of human breast cancer is still not consensual [65]. It is recognized that BLBC are usually triple negative cancers (ER-/PR-/HER2-) and several different panels have been used to identify them, including basal cytokeratins, P-cadherin, vimentin, EGFR, and p63 [28, 38, 63, 66-69]. Several studies ap-proached the molecular classification of feline mammary tumours [20, 22, 29] similarly to what has been done in human breast cancer [23, 24], albeit with some differences. Caliari et al. (2014) described the feline mammary carcinomas as mainly aggressive hormone receptors-negative tumours, with basal cytokeratin and vimentin expression [22]. Brunetti et al. (2013) classified one tenth of the carcinomas as basal [29], while Wiese et al. (2013) characterized almost half of feline mammary tumours as triple negative basal-like, propos-ing that they are a valuable natural occurring animal model for the study of human triple-negative breast cancer with basal-like subtype [20]. In our series, although the majority of carcinomas was P-cadherin positive (n=48; 80%), ER negative (n=43; 72.88%), PR nega-tive (n=14; 23.33%), p63 negative (n=37; 61.66%) and vimentin positive (n=35; 58.33%), only five tumours (8.47%) were simultaneously P-cad+, ER-, PR-, p63+ and vim+, repre-senting those that could be considered similar to BLBC.

157


The Ki-67 proliferative index increased from non-neoplastic and benign lesions to malignant tumours, in agreement with previous studies [3, 6, 33, 51]. The use of Ki-67 as a prognos-tic factor in cats is, however, controversial [3, 6, 33, 51] and its use in clinical decisions is still unsubstantiated [3]. Interestingly, in our series higher Ki-67 indexes were related with P-cadherin overexpression, higher histological grades, and ER negative status, supporting its association with tumour aggressiveness. However, the cut-off values from our and other studies [3, 6] hamper the proposal of useful cut-off limits with prognostic significance. To compare the results from different studies it is mandatory that standard methodologies are followed.

When the combined expression of molecular markers was compared to the tumour clinico-pathological features, we observed that tumours simultaneously P-cad-/vim-/ER+/E-cad+ and with the lowest Ki-67 index were all well-differentiated carcinomas, which suggest a molecular profile characteristic of carcinomas with low aggressiveness. On the contrary, P-cad+/vim+/ER- with high Ki-67 index tumours presented significantly higher histological grades. Moreover, P-cad+/vim+ tumours were 3.76 times more likely to invade vessels, corroborating the human breast cancer concept that both P-cadherin [66] and vimentin [45] are invasion-associated molecules. Taken together, our results suggest that the immunohis-tochemical classification of feline carcinomas based on P-cadherin, ER, vimentin and Ki-67 expression may represent a reliable prognostic indicator. Furthermore, the large number of P-cadherin-positive tumours suggests that this protein may be a good therapeutic target [70, 71].

158


CONCLUSIONS

This study suggests that overexpression of P-cadherin and vimentin, and negative expres-sion of ER can be considered as hallmarks of feline mammary carcinomas. Moreover, it raised the possibility that P-cadherin, ER and vimentin can be used together as poor prog-nostic indicators such as high histological grade and high proliferative activity in the identi-fication of feline mammary tumours with a more aggressive behaviour.

159


REFERENCES

1. Martín De Las Mulas J, Reymundo C, 2000. Animal models of human breast carcinoma: canine and feline neoplasms. Revista de Oncología, 2:274-281.

2. Zappulli V, De Zan G, Cardazzo B, Bargelloni L, Castagnaro M, 2005. Feline mammary tumours in comparative oncology. Journal of Dairy Research, 72(S1):98.

3. Millanta F, Lazzeri G, Mazzei M, Vannozzi I, Poli A, 2002. MIB-1 Labeling Index in Fe-line Dysplastic and Neoplastic Mammary Lesions and Its Relationship with Postsurgical Prognosis. Vet Pathol, 39(1):120-126.

4. Viste JR, Myers SL, Singh B, Simko E, 2002. Feline mammary adenocarcinoma: tumor size as a prognostic indicator. Can Vet J, 43(1):33-37.


6. Castagnaro M, De Maria R, Bozzetta E, Ru G, Casalone C, Biolatti B, Caramelli M, 1998. Ki-67 index as indicator of the post-surgical prognosis in feline mammary carcinomas. Re-search in Veterinary Science, 65:223-226.


160


8. Martin De Las Mulas J, Van Niel M, Millan Y, Ordas J, Blankenstein MA, Van Mil F, Mis-dorp W, 2002. Progesterone receptors in normal, dysplastic and tumourous feline mam-mary glands. Comparison with oestrogen receptors status. Res Vet Sci, 72(2):153-161.

9. Zappulli V, Rasotto R, Caliari D, Mainenti M, Pena L, Goldschmidt MH, Kiupel M, 2015. Prognostic evaluation of feline mammary carcinomas: a review of the literature. Vet Pathol, 52(1):46-60.

10. Palacios J, Benito N, Pizarro A, Suarez A, Espada J, Cano A, Gamallo C, 1995. Anoma-lous expression of P-cadherin in breast carcinoma. Correlation with E-cadherin expres-sion and pathological features. Am J Pathol, 146(3):605-612.

11. Gamallo C, Moreno-Bueno G, Sarrio D, Calero F, Hardisson D, Palacios J, 2001. The prognostic significance of P-cadherin in infiltrating ductal breast carcinoma. Modern pa-thology 14(7):650-654.


13. Paredes J, Albergaria A, Oliveira JT, Jeronimo C, Milanezi F, Schmitt FC, 2005. P-cad-herin overexpression is an indicator of clinical outcome in invasive breast carcinomas and is associated with CDH3 promoter hypomethylation. Clin Cancer Res, 11(16):5869-5877.

14. Sarrio D, Palacios J, Hergueta-Redondo M, Gomez-Lopez G, Cano A, Moreno-Bueno G, 2009. Functional characterization of E- and P-cadherin in invasive breast cancer cells. BMC Cancer, 9:74.



17. Buendia AJ, Penafiel-Verdu C, Navarro JA, Vilafranca M, Sanchez J, 2014. N-cadherin Expression in Feline Mammary Tumors Is Associated With a Reduced E-cadherin Ex-pression and the Presence of Regional Metastasis. Vet Pathol, 51(u):755-758.


19. Figueira AC, Gomes C, De Oliveira JT, Vilhena H, Carvalheira J, De Matos AJ, Pereira PD, Gartner F, 2014. Aberrant P-cadherin expression is associated to aggressive feline mammary carcinomas. BMC Vet Res, 10(1):270.



22. Caliari D, Zappulli V, Rasotto R, Cardazzo B, Frassineti F, Goldschmidt MH, Castagnaro M, 2014. Triple-negative vimentin-positive heterogeneous feline mammary carcinomas as a potential comparative model for breast cancer. BMC Vet Res, 10(1):185.

161




25. Misdorp W, Else RW, Hellmén E, Lipscomb TP, 1999. Histological Classification of Mam-mary Tumors of the Dog and the Cat., Washington, D.C. USA, WHO, Armed Forces In-stitute of Pathology, American Registry of Pathology.

26. Elston CW, Ellis IO, 1998. Assessment of histological grade. In: ELSTON, C. W. & EL-LIS, I. O. (eds.) The Breast. Systemic pathology. Third Edition ed. Edinburgh: Churchill-Livingstone.

27. Matos AJ, Baptista CS, Gartner MF, Rutteman GR, 2012. Prognostic studies of canine and feline mammary tumours: the need for standardized procedures. Vet J, 193(1):24-31.



30. Domagala W, Wozniak L, Lasota J, Weber K, Osborn M, 1990. Vimentin is preferentially expressed in high-grade ductal and medullary, but not in lobular breast carcinomas. Am J Pathol, 137(5):1059-1064.

31. Martin De Las Mulas J, Millan Y, Dios R, 2005. A prospective analysis of immunohisto-chemically determined estrogen receptor alpha and progesterone receptor expression and host and tumor factors as predictors of disease-free period in mammary tumors of the dog. Vet Pathol, 42(2):200-212.

32. Preziosi R, Sarli G, Benazzi C, Mandrioli L, Marcato PS, 2002. Multiparametric survival analysis of histological stage and proliferative activity in feline mammary carcinomas. Res Vet Sci, 73(1):53-60.

33. Dias Pereira P, Carvalheira J, Gartner F, 2004. Cell proliferation in feline normal, hyperplas-tic and neoplastic mammary tissue-an immunohistochemical study. Vet J, 168(2):180-185.

34. Sas 1989. SAS/STAT User´s Guide. SAS/STAT User´s Guide - Version 6. 6 ed. Cary NC, USA: SAS Institute Inc.

35. Carroll DK, Carroll JS, Leong CO, Cheng F, Brown M, Mills AA, Brugge JS, Ellisen LW, 2006. p63 regulates an adhesion programme and cell survival in epithelial cells. Nat Cell Biol, 8(6):551-561.

36. Stefanou D, Batistatou A, Nonni A, Arkoumani E, Agnantis NJ, 2004. p63 expression in benign and malignant breast lesions. Histol Histopathol, 19(2):465-471.

162


37. Choi J, Kim D, Koo JS, 2012. Secretory carcinoma of breast demonstrates nuclear or cytoplasmic expression in p63 immunohistochemistry. Int J Surg Pathol, 20(4):367-372.

38. Matos I, Dufloth R, Alvarenga M, Zeferino LC, Schmitt F, 2005. p63, cytokeratin 5, and P-cadherin: three molecular markers to distinguish basal phenotype in breast carcino-mas. Virchows Archiv, 447(4):688-694.

39. Ribeiro-Silva A, Ramalho LN, Garcia SB, Brandao DF, Chahud F, Zucoloto S, 2005. p63 correlates with both BRCA1 and cytokeratin 5 in invasive breast carcinomas: further evidence for the pathogenesis of the basal phenotype of breast cancer. Histopathology, 47(5):458-466.

40. Mckeon F, 2004. p63 and the epithelial stem cell: more than status quo? Genes Dev, 18(5):465-469.

41. Ribeiro AS, Paredes J, 2015. P-Cadherin Linking Breast Cancer Stem Cells and In-vasion: A Promising Marker to Identify an "Intermediate/Metastable" EMT State. Front Oncol, 4(371):1-6.

42. Faraldo MM, Teuliere J, Deugnier MA, Birchmeier W, Huelsken J, Thiery JP, Cano A, Glukhova MA, 2007. β-Catenin regulates P-cadherin expression in mammary basal epi-thelial cells. FEBS Lett, 581(5):831-836.


44. Korsching E, Packeisen J, Liedtke C, Hungermann D, Wulfing P, Van Diest PJ, Brandt B, Boecker W, Buerger H, 2005. The origin of vimentin expression in invasive breast cancer: epithelial-mesenchymal transition, myoepithelial histogenesis or histogenesis from progenitor cells with bilinear differentiation potential? J Pathol, 206(4):451-457.

45. Gilles C, Polette M, Mestdagt M, Nawrocki-Raby B, Ruggeri P, Birembaut P, Foidart JM, 2003. Transactivation of vimentin by β-catenin in human breast cancer cells. Cancer Res, 63(10):2658-2664.

46. Sommers CL, Heckford SE, Skerker JM, Worland P, Torri JA, Thompson EW, Byers SW, Gelmann EP, 1992. Loss of epithelial markers and acquisition of vimentin expression in adriamycin- and vinblastine-resistant human breast cancer cell lines. Cancer Res, 52(19):5190-5197.

47. Thiery JP, Acloque H, Huang RY, Nieto MA, 2009. Epithelial-mesenchymal transitions in development and disease. Cell, 139(5):871-890.

48. Gilles C, Polette M, Zahm JM, Tournier JM, Volders L, Foidart JM, Birembaut P, 1999. Vimentin contributes to human mammary epithelial cell migration. J Cell Sci, 112 (Pt 24): 4615-4625.

49. Sarrio D, Rodriguez-Pinilla SM, Hardisson D, Cano A, Moreno-Bueno G, Palacios J, 2008. Epithelial-mesenchymal transition in breast cancer relates to the basal-like phe-notype. Cancer Res, 68(4):989-997.


51. Burrai GP, Mohammed SI, Miller MA, Marras V, Pirino S, Addis MF, Uzzau S, Antuofermo

163


E, 2010. Spontaneous feline mammary intraepithelial lesions as a model for human estro-gen receptor- and progesterone receptor-negative breast lesions. BMC Cancer, 10:156.

52. Clark GM, Mcguire WL, 1983. Progesterone receptors and human breast cancer. Breast Cancer Res Treat, 3(2):157-163.

53. Blaschuk OW, Farookhi R, 1989. Estradiol stimulates cadherin expression in rat granu-losa cells. Dev Biol, 136(2):564-567.

54. Nakopoulou L, Gakiopoulou-Givalou H, Karayiannakis AJ, Giannopoulou I, Keramopou-los A, Davaris P, Pignatelli M, 2002. Abnormal α-catenin expression in invasive breast cancer correlates with poor patient survival. Histopathology, 40(6):536-546.


56. Gillett CE, Miles DW, Ryder K, Skilton D, Liebman RD, Springall RJ, Barnes DM, Hanby AM, 2001. Retention of the expression of E-cadherin and catenins is associated with shorter survival in grade III ductal carcinoma of the breast. J Pathol, 193(4):433-441.

57. Fearon ER, 2003. Connecting estrogen receptor function, transcriptional repression, and E-cadherin expression in breast cancer. Cancer Cell, 3(4):307-310.


59. Paredes J, Stove C, Stove V, Milanezi F, Van Marck V, Derycke L, Mareel M, Bracke M, Schmitt F, 2004. P-cadherin is up-regulated by the antiestrogen ICI 182,780 and pro-motes invasion of human breast cancer cells. Cancer Res, 64(22):8309-8317.

60. Paredes J, Milanezi F, Reis-Filho JS, Leitão D, Athanazio D, Schmitt F, 2002. Cor-relação entre as expressões de P-caderina e de receptores de estrógeno no câncer da mama. Correlation between P-cadherin and estrogen receptor expression in breast cancer. Jornal Brasileiro de Patologia e Medicina Laboratorial, 38:307-331.

61. Albergaria A, Ribeiro AS, Pinho S, Milanezi F, Carneiro V, Sousa B, Sousa S, Oliveira C, Machado JC, Seruca R, Paredes J, Schmitt F, 2010. ICI 182,780 induces P-cadherin overexpression in breast cancer cells through chromatin remodelling at the promoter level: a role for C/EBPβ in CDH3 gene activation. Hum Mol Genet, 19(13):2554-2566.

62. Paredes J, Milanezi F, Reis-Filho JS, Leitao D, Athanazio D, Schmitt F, 2002. Aberrant P-cadherin expression: is it associated with estrogen-independent growth in breast can-cer? Pathol Res Pract, 198(12):795-801.


64. Choi Y, Lee HJ, Jang MH, Gwak JM, Lee KS, Kim EJ, Kim HJ, Lee HE, Park SY, 2013. Epithelial-mesenchymal transition increases during the progression of in situ to invasive basal-like breast cancer. Hum Pathol, 44(11):2581-2589.

65. Korsching E, Jeffrey SS, Meinerz W, Decker T, Boecker W, Buerger H, 2008. Basal carcinoma of the breast revisited: an old entity with new interpretations. J Clin Pathol, 61(5):553-560.

164


66. Paredes J, Correia AL, Ribeiro AS, Albergaria A, Milanezi F, Schmitt FC, 2007. P-cad-herin expression in breast cancer: a review. Breast Cancer Research, 9(5):214.


68. Tsang JY, Au SK, Ni YB, Shao MM, Siu WM, Hui SW, Chan SK, Chan KW, Kwok YK, Chan KF, Tse GM, 2013. P-cadherin and vimentin are useful basal markers in breast cancers. Hum Pathol, 44(12):2782-2791.

69. Livasy CA, Karaca G, Nanda R, Tretiakova MS, Olopade OI, Moore DT, Perou CM, 2006. Phenotypic evaluation of the basal-like subtype of invasive breast carcinoma. Mod Pathol, 19(2):264-271.

70. Bernardes N, Ribeiro AS, Abreu S, Mota B, Matos RG, Arraiano CM, Seruca R, Paredes J, Fialho AM, 2013. The bacterial protein azurin impairs invasion and FAK/Src signaling in P-cadherin-overexpressing breast cancer cell models. PLoS One, 8(7):e69023.

71. Zhang CC, Yan Z, Zhang Q, Kuszpit K, Zasadny K, Qiu M, Painter CL, Wong A, Kraynov E, Arango ME, Mehta PP, Popoff I, Casperson GF, Los G, Bender S, Anderes K, Christensen JG, Vanarsdale T, 2010. PF-03732010: a fully human monoclonal an-tibody against P-cadherin with antitumor and antimetastatic activity. Clin Cancer Res, 16(21):5177-5188.

06IN VITRO AND IN VIVO

MODEL FOR THE STUDYOF P-CADHERIN

IN FELINE MAMMARY CARCINOGENESIS

167

In vitro and in vivo model for the study of P-cadherin in feline mammary carcinogenesis Chapter 06

AN IN VITRO AND IN VIVO CHARACTERIZATION OF THE CADHERIN-CATENIN ADHESION

COMPLEX IN A FELINE MAMMARYCARCINOMA CELL LINE

Ana Catarina Figueira, Catarina Gomes, Nuno Mendes, Augusto J.F. de Matos, Patrícia Dias-Pereira, Fátima Gärtner

Manuscript in preparation

169


ABSTRACT

Background: Mammary cancer in cats have high recurrence and metastatic potential. Abnormal expression or function in the major molecules of the cadherin-catenin adhesion complex have been related to breast cancer development and associated to cell migra-tion, invasion and metastatic dissemination. In feline mammary tumours, cadherins and catenins´ role is still poorly known. Therefore we seek for suitable in vitro and in vivo model systems to study the leading role of P-cadherin and the molecules of the cadherin-catenin complex in feline mammary carcinogenesis.

Materials and Methods: Major molecules from the cadherin-catenin complex (E- and P-cadherin, α-, β- and p120-catenin) were evaluated in a feline metastatic mammary carci-noma cell line (FMCm), by Western blot analysis, immunofluorescence, imunoprecipitation and in situ proximity ligation assay. The FMCm cell line tumourigenic and metastatic capac-ity were assessed by orthotopically inoculation of a cell suspension in the mammary fat pad of athymic nude mice (N:NIH(S)II-nu/nu). Mice xenografts, as well as metastatic lesions, were evaluated immunohistochemically for cadherins and catenins expression. P- and E-cadherin double-labelling immunofluorescence was also assessed.

Results: The FMCm cell line expressed E- and P-cadherin as well as α-, β- and p120-catenin. Moreover, E-cadherin was showed to interact with each one of the catenins, re-vealing a putative complete cadherin-catenin complex. The cells had E- and P-cadherin co-expression and a close proximity between these two molecules. The FMCm cell line revealed to be high tumourigenic and showed a great metastatic capacity as the orthotopic inoculation in nude mice lead to the formation of primary and metastatic lesions in all mice. Those lesions expressed all of the molecules from the cadherin-catenin complex studied.

Conclusions: FMCm cell line is a high tumourigenic and metastatic cell line in nude mice. It can be proposed as a useful model for in vitro and in vivo studies of P-cadherin and associated molecules of the cadherin-catenin complex for study of feline mammary carci-noma progression.

171


BACKGROUND

Cadherins are members of a large family of transmembrane glycoproteins that mediate calcium-dependent homotypic cell-cell adhesion [1]. Two members of the cadherin family are expressed by the normal mammary gland: E-cadherin, a 120kDa glycoprotein [2, 3], that is present in luminal epithelial and myoepithelial cells [4-6], and P-cadherin, a 118kDa glycoprotein [7-10], which is confined to the myoepithelium [4, 11, 12]. Cadherins connect indirectly to the actin cytoskeleton, through their cytoplasmic domain, via a group of pro-teins, collectively known as catenins [13, 14]. β-Catenin is a 95 kDa protein that associates directly with cadherins, while α-catenin is a 102 kDa protein that indirectly associates with cadherins through its interaction with β-catenin, thus mediating the interaction between cadherin-catenin complex and actin cytoskeleton [15, 16]. p120-Catenin it’s a protein with multiples isoforms, that range in size from 90-120 kDa, and binds to the cadherin juxtamem-brane region, but does not link the complex to the actin cytoskeleton [16, 17]. Changes in the major molecules of the cadherin-catenin adhesion complex are related to the develop-ment of human breast cancer and their abnormal expression or function are associated to decreased intercellular adhesion, cell migration, invasion and metastatic dissemination [14, 18-21]. Loss or delocalization of E-cadherin and catenins from the membrane is usually re-lated to an invasive breast cancer phenotype [14, 22-24], while P-cadherin overexpression is associated to breast cancer progression and worse patient survival [21, 25].

Mammary neoplasia is the third most common tumour type affecting female cats, with 85 to 90% being malignant [26-28]. Affected cats have a high mortality rate and a mean survival

172

Chapter 06 In vitro and in vivo model for the study of P-cadherin in feline mammary carcinogenesis

time of one year [29, 30], due to local recurrence and/or metastatic disease [26, 27], par-ticularly to the regional lymph nodes, lungs, pleura and liver [28, 29], which are the cause of most therapeutic failures [26, 27]. Colonization of distant tissues by tumour cells represents the most dangerous attribute of cancer and prevention of metastasis and effective treat-ments of already established metastases are necessary in order to increase survival. Thus, it is of extreme importance to identify and characterize biologic, biochemical and molecular basis mechanisms that drive metastasis, in order to develop therapeutic agents to inhibit this process [31].

Only a small number of studies assessed the expression of cadherins and catenins in fe-line mammary tumours [32-35], and their role in feline mammary carcinomas is still poorly known. Thus, molecular studies of these proteins in spontaneously lesions, as well as in both in vitro and in vivo models, are extremely valuable to assess their roles in feline mam-mary tumours. We have been focused on studying P-cadherin in feline mammary tumours as it revealed to be associated to aggressive feline mammary carcinomas. To the best of our knowledge there is no feline mammary carcinoma cell line characterized in what con-cern P-cadherin expression, nor studies of this protein in an in vivo model for feline species. Thus, we search a feline mammary carcinoma cell line in order to establish a suitable in vi-tro and in vivo model systems to evaluate the expression and functions of cadherin-catenin complex molecules, namely P and E-cadherin, as well as α-, β-, and p120-catenin, point toward a better understanding of their role in feline mammary tumours progression. In this context we studied the feline mammary carcinoma cell line (FMCm) [36], by evaluating the expression of the P-cadherin molecule as well as the other cadherin-catenin complex mol-ecules, namely E-cadherin, and α-, β- and p120-catenins. Moreover, in order to mimic as much as possible the spontaneous lesions we used xenograft mice aiming to develop an in vivo model for the study of P-cadherin in feline mammary carcinomas, with both prognosis and therapeutic purpose.

173


MATERIAL AND METHODS

In vitro studies

Cell culture

The FMCm cell line was established and characterized by Uyama et al. (2005) [36] and kindly provided by Professor Sasaki, of the Laboratory of Veterinary Surgery, University of Tokyo, Japan.

FMCm cell line was established from a regional lymph node metastatic lesion of a 12 years old Japanese domestic female cat with a primary mammary adenocarcinoma in stage III (T3cN1(+) M0) [36], collected by surgery.

FMCm cells were grown in monolayer culture in RPMI 1640 with Glutamax medium (Gibco, Invitrogen), supplemented with 10% fetal bovine serum (Gibco, Invitrogen) and 1% penicil-lin-streptomycin (Gibco, Invitrogen). Culture was maintained at 37ºC in humidified 5% CO2 atmosphere. Culture medium was replaced every two days.

174


Western blot analysis

Confluent T75 cm2 flasks were incubated with NP40 lysis buffer (1% NP40, 20 mmol/L Tris-HCl (pH 8.0), 137 mmol/L NaCl, 10% glycerol, 2 mmol/L EDTA, 1 mmol/L sodium or-thovanadate, and protease inhibitor cocktail tablet (Roche)) and cells were scraped. Total cell lysates were centrifuged at 14000 rpm for 10 minutes to remove pellet cell debris. Pro-tein concentration was determined by the bicinchoninic acid (BCA) protein assay (Pierce). Proteins from cell lysates were separated according to their molecular weight by gel elec-trophoresis, in 7.5% acrylamide/bis acrylamide (Sigma) SDS-PAGE. A 25 µg of total protein extract was used. Gels were transferred onto a nitrocellulose membrane (Amersham) in a semi-dry system. Membranes were blocked with 5% non-fat milk, washed three times with phosphate buffer saline with 0.005% tween (PBS-T), and incubated overnight at 4ºC with primary antibodies (Table 1). After incubation, membranes were washed three times with PBS-T and incubated 1 hour with secondary antibodies. Secondary antibodies conjugated with horseradish peroxidase (DAKO) were used at 1:2000. Analysis was performed by che-miluminescence using the ECL Western blotting detection reagent and films (both from GE Healthcare).

Immunofluorescence

FMCm cells were cultured in glass slides placed in 24 well plates until they reached approxi-mately 80% confluence. After washing with phosphate buffered saline (PBS) three times, cells were fixed with methanol for 15 minutes at 4ºC. Cells were rehydrated using PBS for 10 minutes and unspecific detection was blocked using normal goat serum (1:5) in 10% BSA for 20 minutes. Incubation was performed with primary antibody (Table 1) diluted in 5% BSA, overnight, in a wet chamber. After three washes with PBS, slides were incubated with secondary antibodies diluted 1:500 in 5% BSA for one hour. Cells were then washed with PBS, followed by incubation with 4,6-diamidine-2-phenylindolendihydrochoride (DAPI) 100µg/mL for 10 minutes. Slides were mounted in glycerol-based Vectashield medium (Vector, Burlingame, CA, USA) and observed by fluorescence microscopy (Zeiss Imager Z1 microscope) with appropriated filters. Separate images for Alexa 488 and Alexa 594 were captured at x200 magnification and then merged to allow a double immunostaining. For negative controls, the primary antibody was replaced by PBS.

In situ proximity ligation assay

Cells were deposited on glass slides and fixed with methanol. In situ proximity ligation as-say (PLA) was performed using the Duolink kit (Olink Bioscience, Uppsala, Sweden) ac-cording to the manufacturer’s recommendations. Slides were analysed with fluorescence microscopy (Zeiss Imager Z1 microscope).

175


Tabl

e 1.

Dat

a fr

om p

rimar

y an

tibod

ies

used

in th

e te

chni

ques

app

lied

in th

is w

ork

Ant

ibod

yM

onoc

lona

l an

tibod

ies

Clo

neLa

bora

tory

Prim

ary

antib

ody

dilu

tion

Ant

igen

retr

ieva

l for

IHC

Wes

tern

bl

otIF

cel

lIF

tiss

ueIH

C

P-c

adhe

rine

mou

se a

nti-h

uman

56B

D T

rans

duct

ion

1:50

01:

501:

501:

50Tr

is-E

DTA

, pH

7.6

E-c

adhe

rinm

ouse

ant

i-hum

an4A

2C7

Invi

troge

n––

––––

1:50

Tris

-ED

TA, p

H 7

.6

E-c

adhe

rinra

bbit

anti-

hum

an24

E10

Cel

l Sig

nalli

ng1:

1000

1:10

01:

100

––––

α-ca

teni

nm

ouse

ant

i-hum

anαC

AT-7

A4

Zym

ed/In

vitro

gen

1:50

01:

100

––1:

100

Tris

-ED

TA, p

H 7

.6

β-ca

teni

nm

ouse

ant

i-hum

anC

AT-5

H10

Zym

ed/In

vitro

gen

1:50

01:

300

––1:

300

Tris

-ED

TA, p

H 7

.6

p120

-cat

enin

mou

se a

nti-h

uman

98/p

p120

BD

Tra

nsdu

ctio

n1:

1000

1:10

00––

1:10

00Tr

is-E

DTA

, pH

7.6

Pan

-cyt

oker

atin

mou

se a

nti-h

uman

AE

1/A

E3

Zym

ed/In

vitro

gen

1:30

0––

––1:

300

10 m

M c

itrat

e bu

ffer ,

pH

7.6

CA

M 5

.2m

ouse

ant

i-hum

anC

K8

BD

Tra

nsdu

ctio

n––

1:5

––––

––

Vim

entin

mou

se a

nti-h

uman

V9

Dak

o1:

500

1:50

0––

1:50

010

mM

citr

ate

buffe

r , p

H 7

.6

p63

mou

se a

nti-h

uman

4A4

Vent

ana

––––

––1:

200

10 m

M c

itrat

e bu

ffer ,

pH

7.6

IF -

imm

unofl

uore

scen

ce

IHC

- im

mun

ohis

toch

emis

try

176


E-cadherin immunoprecipitation

Two µL of rabbit anti-E-cadherin antibody (clone 24E10, Cell Signaling) were coupled to 60 µL of ProteinG Sepharose beads (Sigma) for 2 hours at 4ºC. Protein cell lysates (750 µg) were pre-cleared in 30 µL of ProteinG Sepharose beads during 2 hours in order to block protein unspecific linkage to beads. Following the lysate pre-clear and antibody linkage to the beads, pre-cleared lysates were incubated overnight in antibody-proteinG beads. Beads’ washes were performed with PBS and after protein incubation 1% of Triton X-100 (Sigma) were added to PBS to clear unspecific protein binding. Three independent immu-noprecipitation assays were performed and each immunoprecipitation procedure was done in triplicate in order to have enough protein for the different western blots. The immunopre-cipitated proteins were eluted in SDS Laemmeli buffer and used for E-cadherin, P-cadherin, α-, β- and p120-catenin Western blots. Negative controls were performed using rabbit im-munoglobulins instead of E-cadherin antibody in protein G-beads.

In vivo studies

Animals

N:NIH(S)II-nu/nu athymic nude mice [37], a strain produced by Instituto de Patologia e Imunologia Molecular da Universidade do Porto (IPATIMUP) was used. Animal experiments were carried out in accordance with the European Guidelines for the Care and Use of Labo-ratory Animals, Directive 2010/63/UE and the National Regulation published in 2013 (Diário da República, 1.ª série — N.º 151 — 7 de agosto de 2013). In all experiments the following Humane Endpoints for euthanasia were established: any signals of distress, suffering or pain, body weight loss greater than 20-25% of the body mass and anorexia, related or not to the experimental procedure. The endpoint for the experiment was established at day 185.

FMCm tumourigenic and metastatic capacity assessment

Six female NIH(S)II-nu/nu, aged 8 to 9 weeks-old, were orthotopically inoculated with 1x107

viable FMCm cells suspension in the mammary fat pad using a 25 gauge needle, in order to determine the FMCm tumourigenic potential, as previously described [38]. Mice were monitored every day for development of primary xenografts tumours. When nodules be-come palpable, tumour size was measured using callipers that allowed estimating three dimensions (length, width and thickness). Tumour volumes (mm3) were assessed using the formula: W x L2 x ½, where W is the width and L is the length of the tumour. Tumours were surgically removed when volumes reached approximately 850-1000 mm3. Exception was made in cases where tumours developed large skin ulcers in the overlying epidermis and tumours were removed earlier. For tumours surgical excision purpose, mice were anesthe-

177


tized by intraperitoneal injection with 100 μL of a mixture containing 75 mg/kg of ketamine hydrochloride (Imalgene 1000®, Merial) and 1 mg/kg of medetomidine hydrochloride (Mede-tor®, Virbac). To antagonize the effect of anaesthesia a solution of 100 μL containing 2.5 mg/kg of atipamezole hydrochloride (Revertor®, Virbac) per mice was used also intraperitoneal. An oral solution of 10 mg/kg tramadol hydrochloride (Tramal®, Grunenthal GmbH), was given every 8 hours for 24-48 hours for pain control. At the time of surgery, tumours were collected and fixed in 10% neutral buffered formalin. All mice were humanely euthanized ac-cording to the predefined Humane Endpoints and necropsies were performed. At necropsy, mice were examined visually for macro-metastases and both tumour masses and target organs (lymph nodes, lungs and liver) were removed and fixed in 10% neutral buffered formalin. After routine histological processing, all tissues were embedded in paraffin and sequential 3µm sections were obtained from each block. One section was stained with hae-matoxylin and eosin (HE) for histological examination and subsequent sections were used for immunohistochemical studies.

The histological classification of tumours was performed independently by two observers (ACF and FG) and based on the criteria of the World Health Organization (WHO) for the histological classification of mammary tumours of domestic animals [39]. Carcinomas were graded in accordance with the Nottingham grading system for human breast carcinomas [40].

Immunohistochemistry of mice xenografts

For the immunohistochemical study, paraffin sections were dewaxed in xylene, rehydrated through graded alcohols and treated for antigen retrieval at high temperature (98ºC) with Tris-EDTA (NovocastraTM Epitope Retrieval Solution Tris-EDTA buffer pH9, Newcastke, United Kingdom, RE7119). Endogenous peroxidase activity was blocked with 3% H2O2 in methanol for 10 minutes and washed in PBS three times. Then, sections were incubated with normal goat serum diluted 1:5 in 10% BSA in PBS during 30 minutes, followed by in-cubation with the primary monoclonal antibodies overnight, at 4ºC in a humid chamber. The antibodies (Table 1) were diluted in 5% BSA in PBS. Incubation with biotinylated secondary antibodies (DAKO) was done during 30 minutes at room temperature, followed by avidin-bi-otin complex incubation (Vectastain). Immunolabelling was detected with 3,3´-diaminoben-zidine tetrahydrochloride (DAB) (Sigma) containing 0.02% hydrogen peroxide and sections were then counterstained with Mayer’s hematoxylin. Evaluation of immunostainning was performed in a blind fashion manner by two independent observers. For negative controls, the primary antibody was replaced by PBS. Sections of feline normal mammary gland were used as positive controls. In the lymph nodes, liver and lung sections, additional immuno-histochemical analysis with antibody anti-pancytokeratin AE1/AE3 was performed in order to confirm the presence of metastases or to determine the existence of micrometastases.

178


P-cadherin and E-cadherin double-labellingimmunofluorescence in mice xenografts

Double-label immunofluorescence (DIF) was performed for simultaneous visualization of P- and E-cadherin expression. Tissue sections were dewaxed in xylene, rehydrated through a series of graded alcohols and treated at high temperature (98ºC) with Tris-EDTA (NovocastraTM Epitope Retrieval Solution Tris-EDTA buffer pH9, Newcastke, United Kingdom, RE7119) for antigen retrieval. Then, tissues sections were blocked with 10% BSA for 20 minutes, followed by incubation with the primary antibodies anti P-cadherin and anti E-cad-herin (Table 1) diluted in 5% BSA for two hours in a wet chamber. After washing with PBS, slides were incubated with Alexa 488 and Alexa 594 secondary antibodies diluted 1:500 in 5% BSA, for one hour. Washes were performed with PBS and slides incubated with DAPI 100 μg/mL for 10 minutes. Slides were mounted in glycerol-based Vectashield medium (Vector, Burlingame, CA, USA). Immunostained sections were analyzed by fluorescence microscopy (Zeiss Imager Z1 microscope) with appropriated filters. Separate images for Alexa 488 and Alexa 594 were captured at x200 magnification and then merged to allow for the visualization of P-cadherin and E-cadherin double immunostaining. For negative con-trols, the primary antibody was replaced by PBS.

For immunofluorescence assays, the secondary antibody for P-cadherin, α-catenin, β-catenin, p120-catenin was Alexa Fluor® 488 goat anti-mouse IgG (A11029, Life Technol-ogy, Carlsbad, CA, USA) while for E-cadherin was Alexa Fluor® 594 goat anti-rabbit IgG (A11037, Life Technology, Carlsbad, CA, USA).

179


RESULTS

Characterization of the FMCm cell line

FMCm cell line formed a monolayer of epithelial-like cells in culture, round to spindle in shape, with large nuclei and often two or more nucleoli (Figure 1).

Figure 1. Morphology of FMCm cell line in culture. FMCm cells grown as a monolayer of epithelial-like cells, round to spindle in shape, with large nuclei and often two or more nucleoli. x100 (A) and x200 (B) magnification.

Western blot characterization of cadherin and catenin proteins showed that FMCm cells expressed both E- and P- cadherin as well as p120-, α- and β- catenin (Figure 2). For E-

A B

180


cadherin two main bands were observed at approximately 135 and 110 kDa. Regarding P-cadherin, two bands were formed near 120 and 90kDa. Western blot for catenins demon-strated the expression of α- and β-catenin both at approximately 100 kDa, and the expres-sion of p120-catenin at different weights with the major bands formed at 100 and 120 kDa. FMCm cells also expressed epithelial and mesenchymal markers, such as cytokeratins in the 45 kDa position and vimentin at approximately 80 kDa (Figure 2).

Figure 2. Western blot analysis of the expression of proteins from the cadherin-catenin complex, as well as phenotypic markers, of the FMCm total cell lysate. FMCm cells showed expression of (A) E-cadherin, (B) P-cadherin (B) as well as (E) p120-catenin, (F) α-catenin and (G) β-catenin. The expression of epithelial and mesenchymal markers was also evaluated by expression of (C) cytokeratins and (D) vimentin.

Immunofluorescence revealed that E-cadherin, p120-, α- and β- catenins were present at the membrane of the majority of the cells, while P-cadherin was restricted to the cell membrane of a smaller population of cells (Figure 3). Double immunofluorescence analysis showed the co-expression of E-cadherin with each catenin (α-, β- and p120-catenin) at the cell membrane, as well as with P-cadherin. In addition, immunofluorescence analysis of FMCm cells confirmed the expression of both cytokeratins and vimentin (Figure 3).

Immunoprecipitation assays were performed in order to evaluate the possible interaction of E-cadherin with the other proteins of the cadherin-catenin complex. E-cadherin was im-munoprecipitated from total cell lysates of FMCm cells and Western blot analysis for P-cad-herin and p120, α- and β- catenins was performed (Figure 4). The results demonstrated that along with E-cadherin it was possible to detect the presence of each one of the catenins as well as P-cadherin (Figure 4), indicating that E-cadherin interacts with all the catenins and P-cadherin. Furthermore, the P-cadherin Western blot analysis of E-cadherin immunopre-cipitates identified the P-cadherin at a lower molecular weight (approximately 80-90 kDa) when compared with the expression of P-cadherin in the total cell lysate (of 120 kDa). This result was very consistent in all the experiments. Despite many improvements in the immu-noprecipitation protocol, we were not able to have a clear negative control for p120-catenin western blot after E-cadherin immunoprecipitation. We reasoned that the rabbit immuno-globulins used in the negative control have some cross reactivity to feline p120 protein.

MW(KDa)

250

150

100

75

50

37

A B C D E F G

181


Figure 3. Immunofluorescence and double-label immunofluorescence analysis in FMCm cell line. Imuno-fluorescence expression of (A, D, G, J) E-cadherin (red color), (K) P-cadherin (green color), (B) α-catenin (green color), (E) β-catenin (green color) and (H) p120 catenin (green color) in FMCm cells. Double-label immunofluo-rescence co-expression of (C) E-cadherin and α-catenin (yellow color), (F) E-cadherin and β-catenin (yellow color), (I) E-cadherin and p120-catenin (yellow color) and (L) E-cadherin and P-cadherin (yellow color). Immu-nofluorescence expression of (M) cytokeratins (green color) and (N) vimentin (green color). x200 magnification.

CA

M 5

.2

E-c

adhe

rin

E

-cad

herin

E-c

adhe

rin

E

-cad

herin

Vim

entin

P-c

adhe

rin

p120

-cat

enin

β-c

aten

in

α-ca

teni

n

Mer

ge

Mer

ge

Mer

ge

Mer

ge

NM

A

D

G

J

B

E

H

K

C

F

I

L

182


Figure 4. E-cadherin immunoprecipitation and evaluation of cadherin-catenin complex in FMCm cells. Immunoprecipitation of E-cadherin was performed in FMCm cell lysates and the presence of P-cadherin, p120-catenin, α-catenin and β-catenin were evaluated. The results show that the immunoprecipitation assay was capable of capture E-cadherin from FMCm total cell lysates. Furthermore, along with E-cadherin also P-cad-herin, p120-catenin, α-catenin and β-catenin proteins were detected after immunoprecipitation. A) E-cadherin immunoprecipitates; B) Rabbit IgG immunoprecipitates (immunoprecipitation control); C) Protein input from E-cadherin immunoprecipitates; D) Protein input from rabbit IgG immunoprecipitates.

In order to validate the interaction between E- and P-cadherin observed in the immuno-precipitation experiments, an in situ proximity ligation assay was performed, which demon-strated the close proximity of P- and E-cadherin observed by the red dots in cultured cells (Figure 5).

Figure 5. In situ proximity ligation assay for E- and P-cadherin. Positive signals (red dots) was observed in

FMCm cells, showing a proximity and putative interaction between these two proteins.

In vivo behaviour of FMCm cell line –– tumourigenic and metastatic capacity

All mice presented a palpable nodule in the mammary fat pad at days two or three post-inoculation with FMCm cells. The growths of the nodules start to be noticeable from day 7 post-inoculation onwards. The kinetic curve of tumour growth is shown in Graphic 1. The FMCm cell line was able to induce local nodules (Figure 6) in the six inoculated mice.

MW(KDa)250150

10075

50

A B C D A B C D A B C D A B C D A B C D

E-cadherin P-cadherin p120-catenin α-catenin β-catenin

IP: E-cadherin

183


Graphic 1. Kinetic curve of tumours growth at the selected timepoints. Data shown represent the mean tumours volumes (mm3) ± SD calculated for each timepoint for 5 mice. The mouse whose tumour did not grow following

the overall kinetics was excluded.

Figure 6. (A) Development of primary xenograft tumours in the mice; (B) excised tumour.

Two of the 6 mice developed tumours with large areas of skin ulceration leading to its early removal (625mm3 and 550mm3 at the removal) and one mouse had a tumour that did not grow following the overall kinetics (158mm3 at day 51). All mice, except the one that tumour did not grow as the overall, showed signs of body-weight loss and were euthanized. Table 2 displays the time intervals (in days) between inoculation (day 0) and surgical excision of pri-mary tumours (as well as tumour volumes at the time of surgeries) and euthanasia. Organs with histological confirmed metastases at the time of euthanasia are also indicated. It was possible to detect metastases in all mice at the time of euthanasia, including in the one that the tumour did not grow as fast as the majority.

A B

Graphic 1. Kinetic Curve of Tumours Growth

Time (days)

Mea

n tu

mou

rs v

olum

e (m

m3 )

1100

1000

900

800

700

600

500

400

300

200

100

07 18 23 30 38 48 51

184


Characterization of mice xenografts

All tumours were classified as solid carcinomas, characterized by a predominant solid pat-tern with areas of tubular differentiation, high mitotic counts, and marked nuclear pleo-morphism. Tumours were classified as grade III solid carcinomas (poorly differentiated) and exhibited extensive areas of necrosis and invasive growth. In four cases (66.67%) the masses ulcerated and all mice developed nodal macro or micrometastases. In two animals (33.33%) lung metastases were also documented. Histologically, metastases showed fea-tures similar to those observed in mice xenografts. There was no evidence of metastases in the liver. Neoplastic lesions expressed both cytokeratin and vimentin, however immuno-reactivity to p63 was not observed (Figure 7).

All tumours showed immunopositivity for E-cadherin (Figure 8). α-, β- and p120-catenin (Figure 9) had a membranous expression in approximately 75% of the neoplastic cells. The expression of P-cadherin was also membranous and found in more than half of the neoplastic epithelial cells (Figure 8). The pattern of expression in metastases matched their xenografts (Figure 8 and 9).

P- and E-cadherin double-labelling immunofluorescence analysis revealed a co-expression of the two molecules, particularly at the tumours´ peripheral invasive front. The same ex-pression pattern was observed in lymph node metastases (Figure 10).

Table 2. Time interval (in days) between inoculation (day 0) and tumour excision, and tumour volume at the time of surgery. Time between inoculation and euthanasia and between tumour excision and euthanasia. Metastases location at time of euthanasia.

Mice Surgery (days)/ Tumour volume (mm3)

Euthanasia (days inoculation/

days tumour excision)Metastases location

1 52 / 847 185 /133 Lymph node

2 51 / 963 104 / 53 Lymph node/Lungs

3 52 / 550 146 / 94 Lymph node

4* 74 / 158 185 / 111 Lymph node

5 52 / 625 114 / 62 Lymph node/Lungs

6 51 / 1080 114 / 63 Lymph node

*mice excluded from the kinetic curve of tumour growth; the tumour did not grow after day 51

185


P63

Vi

men

tin

A

E1/

AE

3

Figure 7. AE1/AE3, vimentin and p63 expression by immunohistochemistry in mice xenografts. (A) Strong AE1/AE3 immunoreactivity in the membrane and cytoplasm of epithelial cells, x200; (B) Detail of AE1/AE3 expression, x400; (C) Strong vimentin immunoreactivity in the membrane of epithelial cells, x200; (D) Detail of vimentin overexpression, x400;.(E) Absence of p63 immunoreactivity in epithelial cells, x200. (F) Detail of the carcinoma, x400.

A

C

E

B

D

F

186


P-c

adhe

rin

E

-cad

herin

A

C

E

G

B

D

F

H

Figure 8. E- and P-cadherin expression by immunohistochemistry in mice lesions. (A) Carcinoma with E-cadherin expression in more than 75% of the epithelial cells, x200; (B) Detail of E-cadherin expression, x400; (C) E-cadherin expression in lymph node metastase, x100; (D) E-cadherin expression in lung metastase, x100; (E) Carcinoma with P-cadherin expression expression in more than 50% of the epithelial cells, x200; (F) Detail of P-cadherin expression, x400; (G) P-cadherin expression in lymph node metastase, x100; (H) P-cadherin expression in lung metastase, x100.

187


p12

0-ca

teni

n

β-ca

teni

n

α

-cat

enin

A

C

E

B

D

F

Figure 9. α- β- and p120-catenin expression by immunohistochemistry in mice lesions. (A) α-catenin im-munoreactivity in the membrane of epithelial cells of carcinoma, x400. (B) α-catenin expression in lymph node metastase, x400. (C) β-catenin immunoreactivity in the membrane of epithelial cells of carcinoma, x400. (D) β-catenin expression in lymph node metastase, x400. (E) p120-catenin immunoreactivity in the membrane of epithelial cells of carcinoma, x400. (F) p120-catenin expression in lymph node metastase, x400.

188


Figure 10. E- and P-cadherin expression by double-label immunofluorescence in mice lesions x200. (A) Carcinoma with E-cadherin in epithelial cells (red colour) and (B) P-cadherin in epithelial cells (green colour) x200; (C) Carcinoma with co-expression of P-cadherin and E-cadherin (yellow colour). x200; (D) Lymph node metastatic cells expressing E-cadherin (red colour) and (E) P-cadherin (green colour); (F) Lymph node meta-static cells co-expressing P-cadherin and E-cadherin (yellow colour). x200.

E-cadherin P-cadherin Merge

A

D

B

E

C

F

189


DISCUSSION

Experimental model systems are required for cancer research and several established fe-line mammary carcinoma cell lines have been reported [36, 41-44]. However, in vitro models are limited in the representation of real cancer at various levels, including the lack of three dimensional structures and absence of matrix and stromal cells interactions, endocrine in-fluences, immune response, amongst others, which can be achieved only using an in vivo model [45]. The in vivo xenograft models permits heterotransplantation of cancer cells or tumour biopsies into immunodeficient rodents, allowing for the growth of tumours with direct stromal interactions [45, 46].

Our main goal was to determine an in vitro and in vivo model for the study of P-cadherin and the associated molecules of the cadherin-catenin complex, E-cadherin and α-, β-, and p120-catenin, in feline mammary carcinomas. In this context, we choose the FMCm cell line, established from a nodal metastases of a feline mammary carcinoma [36].

The FMCm cell line in culture revealed an epithelial-phenotype with an intense immunore-activity for the epithelial cell marker cytokeratin. However, cells also expressed vimentin, an intermediate filament of mesenchymal cells that has been associated with a loss of cell-to-cell contact and acquisition of migration and invasion capacities by breast cancer cell [47-49]. This cell line was also characterized by the expression of E-cadherin, α-, β- and

190


p120-catenin, and it was determined a link between E-cadherin and each one of the caten-ins. This may indicate a preserved cadherin-catenin complex, a characteristic of intercel-lular adhesion system of luminal epithelial mammary cells [23]. The FMCm cell line also expressed P-cadherin, which is a cadherin not usually present in epithelial luminal cells of the breast, being normally found in myoepithelial cells [21]. In Western blot analysis, for each one of the cadherins (E- and P-cadherin) we detected two bands with distinct molecu-lar weight that probably correspond to the cadherins molecule (higher weight) and to the cadherins fragment sE-cad and sP-cad (lower weight), that results from the cleavage and shedding of the extradomain of the cadherins [50, 51]. By immunofluorescence, P-cadherin was co-localized with E-cadherin, representing a small population of cells, possibly indi-cating a sub-clone population. There was an interaction between these two cadherins, as demonstrated by the in situ proximity ligation assay and confirmed by immunoprecipitation. However, in the immunoprecipitation assay with E-cadherin it was identified the smaller weight P-cadherin. Thus, E-cadherin probably is only able to interact with the small weight P-cadherin, which possibly corresponds to the described fragment of P-cadherin (sP-cad)[50]. Thus, this in vitro cell model displays in the same cell line the major molecules of the cadherin-catenin cell complex.

Aiming to develop an in vivo model for the study of feline mammary carcinomas that could mimic as much as possible the spontaneous lesions, an FMCm cell suspension was inocu-lated in the mammary fat pad of athymic nude mice. The mouse mammary fat pad permits the interaction of the breast tumour cells with matrix and stromal cells from the proper anatomical site and when compared to the subcutaneous area (interscapular), it is a more favourable site for the growth of xenografts of breast cell lines and also to favour metasta-sis [52-54]. Furthermore, it has been reported as the best in vivo model for accurately as-sessing breast cancer metastatic potential [55]. The FMCm cells were able to induce local tumours in all animals revealing to be high tumourigenic cell line in nude mice, with develop-ment of high grade mammary carcinoma.

A significant characteristic of spontaneous feline mammary tumours is the high incidence of metastases, which is the cause of most therapeutic failures [26, 27]. Metastasis is a com-plex multistep process by which tumour cells escape from the primary site, and disseminate through blood or lymphatic vessels to form new lesions in other organs. To metastasize, tumour cells must degrade and cross the extracellular matrix, intravasate, travel through blood or lymphatic vessels, extravasate at the secondary site, and finally, establish second-ary tumours. To understand metastization it is imperative to have a research model that mimics a number of steps of this process [56, 57]. Therefore the mice of this study were not euthanized by the time of surgical excision of the primary tumour, in order to permit metastization and mimic the medical procedure usually applied in the clinical practice to felines’ mammary tumours. At the time of death all mice had developed nodal metastases or micro metastases and in two mice pulmonary metastases were also found. This meta-static pattern is similar to the one described in queens [29], with regional lymph nodes and

191


lungs being most frequently involved. The behaviour of the tumours induced by the FMCm cell line underlines the high aggressive, with high metastastic potential of this cell line. The immunohistochemical analysis of the mammary lesions revealed the presence of all mole-cules of the cadherin-catenin complex and also P-cadherin, both in primary and metastastic lesions. Moreover, double-immunofluorescence revealed co-expression of E-cadherin and P-cadherin.

P-cadherin is normally not expressed by luminal epithelial mammary cells, and its overex-pression in breast cancer cells is correlated with increased tumour cell motility, migration and invasiveness [50] and associated to a worse prognosis [58]. Moreover, the expression of P-cadherin in E-cadherin positive breast cancer is associated to aggressive behaviour, invasion, metastasis and poorest prognosis than that of carcinomas that express only one of the cadherins [50, 59, 60]. The invasive and metastastic potencial of the FMCm cells de-rived tumours in vivo is possibly related to the presence of both E- and P-cadherin.

The most widely used treatment approach to feline mammary tumours is surgical excision [28, 61]. However, cats with mammary cancer have a high rate of post-mastectomy recur-rence or metastatic disease [26, 27]. In spite of attempts to develop better surgical ap-proaches, chemotherapeutic or radiotherapeutic protocols, the treatment options for feline mammary carcinomas are limited and the overall patient treatment outcome has not been substantially improved. Therefore, the development of novel adjuvant therapies is crucial [28, 29]. P-cadherin has been recently considered as a potential therapeutic target in hu-man breast cancer [62, 63], and considering the large number of P-cadherin positive feline mammary tumours [33, 64], this molecule may be hypothesised as a potential therapeutic target in this species too. Therefore, an in vivo model that expresses P-cadherin is funda-mental to study the potential anti-P-cadherin therapy in feline mammary tumours.

192


CONCLUSIONS

The in vitro and in vivo model exposed herein, with co-expression of E- and P-cadherin as well as catenins, might be useful to study the role of these molecules in feline mammary carcinomas development, progression and clinical approach.

193


REFERENCES

1. Takeichi M, 1990. Cadherins: a molecular family important in selective cell-cell adhe-sion. Annu Rev Biochem, 59:237-252.


3. Berx G, Staes K, Van Hengel J, Molemans F, Bussemakers MJ, Van Bokhoven A, Van Roy F, 1995. Cloning and characterization of the human invasion suppressor gene E-cadherin (CDH1). Genomics, 26(2):281-289.



6. Parker C, Rampaul RS, Pinder SE, Bell JA, Wencyk PM, Blamey RW, Nicholson RI, Robertson JF, 2001. E-cadherin as a prognostic indicator in primary breast cancer. Br J Cancer, 85(12):1958-1963.

7. Bussemakers MJ, Van Bokhoven A, Voller M, Smit FP, Schalken JA, 1994. The genes for the calcium-dependent cell adhesion molecules P- and E-cadherin are tandemly arranged in the human genome. Biochem Biophys Res Commun, 203(2):1291-1294.

8. Hatta M, Miyatani S, Copeland NG, Gilbert DJ, Jenkins NA, Takeichi M, 1991. Genomic

194


organization and chromosomal mapping of the mouse P-cadherin gene. Nucleic Acids Res, 19(16):4437-4441.

9. Nose A, Takeichi M, 1986. A novel cadherin cell adhesion molecule: its expression pat-terns associated with implantation and organogenesis of mouse embryos. J Cell Biol, 103(6 Pt 2):2649-2658.

10. Nollet F, Kools P, Van Roy F, 2000. Phylogenetic analysis of the cadherin superfamily allows identification of six major subfamilies besides several solitary members. J Mol Biol, 299(3):551-572.


12. Rasbridge SA, Gillett CE, Sampson SA, Walsh FS, Millis RR, 1993. Epithelial (E-) and placental (P-) cadherin cell adhesion molecule expression in breast carcinoma. J Pathol, 169(2):245-250.

13. Wijnhoven BP, Dinjens WN, Pignatelli M, 2000. E-cadherin-catenin cell-cell adhesion complex and human cancer. Br J Surg, 87(8):992-1005.


15. Ozawa M, Kemler R, 1992. Molecular organization of the uvomorulin-catenin complex. J Cell Biol, 116(4):989-996.

16. Nollet F, Berx G, Van Roy F, 1999. The role of the E-cadherin/catenin adhesion complex in the development and progression of cancer. Mol Cell Biol Res Commun, 2(2):77-85.

17. Paredes J, Correia AL, Ribeiro AS, Schmitt F, 2007. Expression of p120-catenin iso-forms correlates with genomic and transcriptional phenotype of breast cancer cell lines. Cell Oncol, 29(6):467-476.


19. Talvinen K, Tuikkala J, Nykanen M, Nieminen A, Anttinen J, Nevalainen OS, Hurme S, Kuopio T, Kronqvist P, 2010. Altered expression of p120-catenin predicts poor outcome in invasive breast cancer. J Cancer Res Clin Oncol, 136(9):1377-1387.

20. Cowin P, Rowlands TM, Hatsell SJ, 2005. Cadherins and catenins in breast cancer. Curr Opin Cell Biol, 17(5):499-508.



23. Wheelock MJ, Soler AP, Knudsen KA, 2001. Cadherin junctions in mammary tumors. J Mammary Gland Biol Neoplasia, 6(3):275-285.

24. De Leeuw WJ, Berx G, Vos CB, Peterse JL, Van De Vijver MJ, Litvinov S, Van Roy F,

195


Cornelisse CJ, Cleton-Jansen AM, 1997. Simultaneous loss of E-cadherin and catenins in invasive lobular breast cancer and lobular carcinoma in situ. J Pathol, 183(4):404-411.




28. Sorenmo KU, Worley DR, Goldschmidt MH, 2013. Tumours of the Mammary Gland. In: WITHROW, S. J., VAIL, D. M. & PAGE, R. L. (eds.) Withrow & MacEwen´s Small Animal Clinical Oncology. 5th edition ed. Missouri: Elsevier Saunders.


30. Overley B, Shofer FS, Goldschmidt MH, Sherer D, Sorenmo KU, 2005. Association be-tween ovarihysterectomy and feline mammary carcinoma. J Vet Intern Med, 19(4):560-563.

31. Welch DR, Steeg PS, Rinker-Schaeffer CW, 2000. Molecular biology of breast cancer metastasis. Genetic regulation of human breast carcinoma metastasis. Breast Cancer Res, 2(6):408-416



34. Buendia AJ, Penafiel-Verdu C, Navarro JA, Vilafranca M, Sanchez J, 2014. N-cadherin expression in feline mammary tumors is associated with a reduced E-cadherin expression and the presence of regional metastasis. Vet Pathol, 51(4):755-758.


36. Uyama R, Hong SH, Nakagawa T, Yazawa M, Kadosawa T, Mochizuki M, Tsujimoto H, Nishimura R, Sasaki N, 2005. Establishment and characterization of eight feline mam-mary adenocarcinoma cell lines. J Vet Med Sci, 67(12):1273-1276.

37. Azar HA, Hansen CT, Costa J, 1980. N:NIH(S)-nu/nu mice with combined immuno-deficiency: a new model for human tumor heterotransplantation. J Natl Cancer Inst, 65(2):421-430.

38. De Oliveira JT, De Matos AJ, Santos AL, Pinto R, Gomes J, Hespanhol V, Chammas R, Manninen A, Bernardes ES, Albuquerque Reis C, Rutteman G, Gartner F, 2011. Si-alylation regulates galectin-3/ligand interplay during mammary tumour progression - a case of targeted uncloaking. Int J Dev Biol, 55(7-9):823-834.

39. Misdorp W, Else RW, Hellmén E, Lipscomb TP 1999. Histological Classification of Mam-mary Tumors of the Dog and the Cat., Washington, D.C. USA, WHO, Armed Forces

196


Institute of Pathology, American Registry of Pathology.40. Elston CW, Ellis IO 1998. Assessment of histological grade. In: ELSTON, C. W. & EL-

LIS, I. O. (eds.) The Breast. Systemic pathology. Third Edition ed. Edinburgh: Churchill-Livingstone.

41. Norval M, Maingay J, Else RW, 1985. Characteristics of a feline mammary carcinoma cell line. Res Vet Sci, 39(2):157-164.

42. Muleya JS, Nakaichi M, Sugahara J, Taura Y, Murata T, Nakama S, 1998. Establishment and characterization of a new cell line derived from feline mammary tumor. J Vet Med Sci, 60(8):931-935.

43. Adelfinger M, Gentschev I, Grimm De Guibert J, Weibel S, Langbein-Laugwitz J, Hartl B, Murua Escobar H, Nolte I, Chen NG, Aguilar RJ, Yu YA, Zhang Q, Frentzen A, Szalay AA, 2014. Evaluation of a new recombinant oncolytic vaccinia virus strain GLV-5b451 for feline mammary carcinoma therapy. PLoS One, 9(8):e104337.

44. Minke JM, Schuuring E, Van Den Berghe R, Stolwijk JA, Boonstra J, Cornelisse C, Hilkens J, Misdorp W, 1991. Isolation of two distinct epithelial cell lines from a single fe-line mammary carcinoma with different tumorigenic potential in nude mice and express-ing different levels of epidermal growth factor receptors. Cancer Res, 51(15):4028-4037.

45. Kim JB, O'hare MJ, Stein R, 2004. Models of breast cancer: is merging human and ani-mal models the future? Breast Cancer Res, 6(1):22-30.

46. Morton CL, Houghton PJ, 2007. Establishment of human tumor xenografts in immuno-deficient mice. Nat Protoc, 2(2):247-250.

47. Gilles C, Polette M, Zahm JM, Tournier JM, Volders L, Foidart JM, Birembaut P, 1999. Vimentin contributes to human mammary epithelial cell migration. J Cell Sci, 112 ( Pt 24):4615-4625.

48. Gilles C, Polette M, Mestdagt M, Nawrocki-Raby B, Ruggeri P, Birembaut P, Foidart JM, 2003. Transactivation of vimentin by beta-catenin in human breast cancer cells. Cancer Res, 63(10):2658-2664.

49. Sommers CL, Heckford SE, Skerker JM, Worland P, Torri JA, Thompson EW, Byers SW, Gelmann EP, 1992. Loss of epithelial markers and acquisition of vimentin expression in adriamycin- and vinblastine-resistant human breast cancer cell lines. Cancer Res, 52(19):5190-5197.

50. Ribeiro AS, Albergaria A, Sousa B, Correia AL, Bracke M, Seruca R, Schmitt FC, Pare-des J, 2010. Extracellular cleavage and shedding of P-cadherin: a mechanism underly-ing the invasive behaviour of breast cancer cells. Oncogene, 29(3):392-402.

51. Knudsen KA, Lin CY, Johnson KR, Wheelock MJ, Keshgegian AA, Soler AP, 2000. Lack of correlation between serum levels of E- and P-cadherin fragments and the presence of breast cancer. Hum Pathol, 31(8):961-965.

52. Price JE, Polyzos A, Zhang RD, Daniels LM, 1990. Tumorigenicity and metastasis of human breast carcinoma cell lines in nude mice. Cancer Res, 50(3):717-721.

53. Miller FR, Medina D, Heppner GH, 1981. Preferential growth of mammary tumors in intact mammary fatpads. Cancer Res, 41(10):3863-3867.

54. Miller FR, 1981. Comparison of metastasis of mammary tumors growing in the mam-

197


mary fatpad versus the subcutis. Invasion Metastasis, 1(4):220-226.55. Iorns E, Drews-Elger K, Ward TM, Dean S, Clarke J, Berry D, El Ashry D, Lippman M,

2012. A new mouse model for the study of human breast cancer metastasis. PLoS One, 7(10):e47995.

56. Friedl P, Wolf K, 2003. Tumour-cell invasion and migration: diversity and escape mecha-nisms. Nat Rev Cancer, 3(5):362-374.

57. Nguyen DX, Bos PD, Massague J, 2009. Metastasis: from dissemination to organ-spe-cific colonization. Nat Rev Cancer, 9(4):274-284.

58. Paredes J, Stove C, Stove V, Milanezi F, Van Marck V, Derycke L, Mareel M, Bracke M, Schmitt F, 2004. P-cadherin is up-regulated by the antiestrogen ICI 182,780 and promotes invasion of human breast cancer cells. Cancer Res, 64(22):8309-8317.

59. Ribeiro AS, Sousa B, Carreto L, Mendes N, Nobre AR, Ricardo S, Albergaria A, Came-selle-Teijeiro JF, Gerhard R, Soderberg O, Seruca R, Santos MA, Schmitt F, Paredes J, 2013. P-cadherin functional role is dependent on E-cadherin cellular context: a proof of concept using the breast cancer model. J Pathol, 229(5):705-718.


61. Novosad CA, 2003. Principles of treatment for mammary gland tumors. Clin Tech Small Anim Pract, 18(2):107-109.




198


SUPPLEMENTARY DATA

1) In vitro invasion capacity of FMCm cell line

In order to evaluate the in vitro invasive capacity of FMCm cell line, we performed a clas-sical Transwell Matrigel Invasion Chamber assay. As preliminary in vitro results the analy-sis revealed that FMCm cell line present capacity to in vitro invade the matrigel chamber (Supplementary Figure 1).

Supplementary Figure 1. In vitro invasion capacity of FCMm cell line.

Num

ber o

f inv

adin

g ce

lls

FMCm

700

600

500

400

300

200

100

0

199


2) P-cadherin transcript sequencing

In order to evaluate the role of P-cadherin in the invasive capacity of FMCm cell line we started to determine the sequence of P-cadherin transcript. We specifically design different PCR primers that flack all the P-cadherin exons. Supplementary Table 1 depicts the infor-mation about the PCR primers.

Supplementary Table 1. Primers for PCR amplification of P-cadherin cDNA from FCMm cell line.

In this analysis we could amplified the sequences from exons 3-8, 8-11 and 10-14. We did not succeeded in the amplification of the exon 1-3 (Supplementary Figure 2).

Supplementary Figure 2. Different P-cadherin PCR analysis of FMCm cDNA.

Further, we specifically sequence the exons 3-8, 8-11 and 10-14 by PCR sequencing in order to have the sequence of exons 3-14 of P-cadherin from FMCm cell line. The overall sequence obtained by the different exon sequencing was the following:

EXON 3-14 sequencing

AATGGCAAGGGTCCCTTCCCCCAGAAGCTCAATCAGCTCAAATCTAATA-AGGACAGAGGCACCAAGATTTTCTACAGCATCACAGGCCCTGGAGCAGA-CAGCCCCCCTGAGGGTGTCTTCACCATAGAGAAGGAA[ACAGGCTGGTTG

Exons Primers sequence (5´-3)

1-3F: GACCAATCAGCACCCACCT

R:TTCAACAACAACCAGCCTGT

3-8F: AGGCACCAAGATTTTCTACAGC

R: GGGTGGTGATGGTAAAATGG

8-11F: AGCCAATGACAATGCTCCTG

R: CTGGAAAGGGGAGGTGTG

10-14F: AGTGCTGAACATCACGGACA

R: GTTGCTAAGGCCACTTCTTGA

200


TTGTTGAATAAGCCGCTGGACCGGGAGAAGATTGCGAAGTATGAGCTCTTTGGCCAC-GCTGTATCAGAGAACGGTGCCTCAGTGGAAGACCCCATGAACATCTCCATCATTGTA-ACTGACCAGAACGACCACAAGCCCAAGTTCACCCAGGATGTTTTCAGAGGGAGC-GTCTTGGAAGGGGTACTACCCGGCACTTCTGTGATGCAGGTGACAGCCACAGAT-GAGGACGATGCCATCAACACCTACAATGGGGTGGTTGCTTACTCTATCCATAGC-CAAGAGCCAAAGGACCCACATGACCTCATGTTCACCGTCCACCGGAGCACGGGTAC-CATCAGCGTCATCTCCAGTGGCCTGGACCGGGAGAGAGTCCCTGAGTACACACT-GACCATCCAGGCTACAGACATGGATGGGGATGGTTCTACCACCACAGCAGTGGC-CATAGTGGAAATCCTCGATGCCAATGACAATGCTCCTGTGTTTGATCCTCAGAAG-TACGAGGCCCAAGTGCCTGAGAACCTGGTGGGGTACGAGGTGCAGAGGCTGA-CAGTGACTGATCTGGATGCCCCCAACTCACCCGCATGGCACGCCACCTACCGCAT-CTTGGAAGGTGACGATGGGGACCATTTTACCATCACCACCCACCCCGAGAGCAAC-CAGGGCATTCTGACAACCAGGAAGGGCTTGGACTTCGAGGCCAAAAACCAACA-CACCCTGTACGTTGAAGTGACCAATGAGGCTCCCTTTGTGGTGAAGCTCCCAACCTC-CACGGCCACCATAGTAGTCCGTGTGGAGGATGTGAATGAGGCACCTGTGTTT-GTCCCACCCTCCAAAGTCATCGAGGTCCAGGAGGGCATCTCTGTCGGGGAGTCT-GTCTGCACCTACACTGCGCAGGACCCTGACGAGGGAAATCAGAAGATCAGCTAC-CACATCCTCAGAGACCCAGCAGGGTGGCTAGCAATGGACCCAGACAGTGGACAG-GTCACTGCCACGGGGGTTTTAGACCGTGAGGATGAACGGTTTGTGAAGAACAAT-GTCTATGAAGTCATGGTCTTGGCCACAGATGATGGGAGCCCTCCCACCACTG-GCACTGGGACCCTCCTGCTAACACTTATGGACATCAATGACCATGGCCCGGTCCCC-GAACCCCGACAGATCACTATCTGCAACCAAAGCCCTGTGCCCCAAGTGCTGAACAT-CACGGACAAGGACCTGTCCCCCCACACCTCCCCTTTCCAGGCCCAGCTCACACAT-GACTCGGATATCTACTGGACAGCAGAGGTCAATGAGAAAGGAAACACAGTGGCCCT-GTCCTTGAAGAAGTTCCTGAAGCAAGACACATACAATGTGCACCTTTCTCTATCT-GACCATGGCAACAAGGAACAGCTGACAGTGATCAGCGCCACGGTGTGTGACTGC-CACGGCCATGTGGAGACCTGCCCCAAACCCTGGAAGGGGGGCTTCCTCCTCCCG-GTCCTGGGGGCTGTCCTGGCTCTGCTGCTTCTCCTGCTGGTCCTCCTCTTGTTG-GTGAGGAAGAAGAGGAAGGTCAAGGAGCCCCTTCTGCTCCCAGAAGATGACACCC-GTGACAATGTCTTCTACTATGGCGAAGAGGGAGGTGGTGAGGAGGACCAGGAC-TATGACATCACCCAACTCCACCGTGGTCTGGAGGCCCGGCCTGAGGTTGTTCTCC-GCAATGATGTGGCGCCGTCCTTCATCCCCACACCCATGTACCGTCCACGTCCAGC-CAACCCAGATGAGATTGGGAACTTCATCATCGAGAACCTGAAGGCGGCAAACAC-GGACCCCACAGCCCCGCCGTACGACTCCCTGCTGGTGTTTGACTACGAGGGCAGC-GGCTCTGATGCCGCGTCCCTGAGCTCCCTCACTTCCTCAGCCTCTGACCAGGAC-CAAGACTATGACTATCTGAACGAGTGGGGCAGTCGCTTCAAGAAGCTGGCAGACATG-TATGGTGGTGGCCAGGACGACTAGGCGGCCTTCCAACAGGACCCGGGCTAAAGGT-GGGCCGCAGTGGCATTTCCAAGGAGCCTGAGTCCTCTCCTCGGCCAAGAACTT-GGGAGCTTGTCAAGAAGTGGCCTTAGCAACTTGG

This result will enable us to design siRNAs that will specifically down regulate the P-cadherin protein expression, in order to determine the role of P-cadherin in the invasive capacity of FMCm cell line.

07DETERMINATION OF THE

SOLUBLE P-CADHERINSERUM LEVELS IN QUEENS WITH MAMMARY TUMOURS

203

Determination of the soluble P-cadherin serum levels in queens with mammary tumours Chapter 07

SOLUBLE FRAGMENT OF P-CADHERIN INSERUM OF QUEENS WITH MAMMARY TUMOURS

Ana Catarina Figueira, Catarina Gomes, Sofia Anastácio, Anália do Carmo, Augusto J.F. de Matos, Patrícia Dias-Pereira, Fátima Gärtner

Preliminary data

205


BACKGROUND

Classical E- and P-cadherin are members of a superfamily of transmembrane molecules responsible for calcium-dependent cell-cell adhesion [1]. They have an extracellular do-main that forms homophilic bonds with cadherins on adjacent cells, whereas its intracellular domain interacts with a group of proteins called catenins, linking the cadherins to the actin cytoskeleton [2]. In normal mammary gland, E-cadherin is expressed in luminal epithelial cells [3, 4], while P-cadherin is a molecule restricted to myoepithelial cells [3, 5]. Alterations in their expression are involved in human breast cancer [6], with reduction or absence of E-cadherin expression related with mammary tumourigenesis [7-14] and P-cadherin over-expression associated with poorly differentiated, high grade breast carcinomas [3, 5, 15-20] and related to poor prognosis [15, 18-22].

The protein ectodomain shedding is a mechanism that involves the proteolytic process-ing and release of membrane proteins, which alter their functional properties [23, 24]. The ectodomain shedding is not an event typically associated with cancer and is a normal part of their turnover in cell [23, 24]. Upon the ectodomain cleavage of E- and P-cadherin, a soluble 80 kDa E-cadherin fragment (sE-cad) and a 80 kDa soluble P-cadherin (sP-cad) are generated and released into the extracellular space [24-26]. During tumourigenesis, the abundance of proteolytic enzymes, namely metalloproteases (MMPs), in the tumour microenvironment may increase the ectodomain shedding and augment the serum levels

206

Chapter 07 Determination of the soluble P-cadherin serum levels in queens with mammary tumours

of cadherins [25-27]. Increased serum levels of sE-cad were detected in breast cancer patients [24, 28, 29], and were associated with clinical stage, tumour grade, lymph node metastases, overall and disease-free survival [24, 29]. sE-cad levels were proposed as a marker for predicting response to therapy [24, 28, 30]. Discordantly, Knudsen et al. (2000) found no correlation between sE-cad serum levels and the presence of breast cancer [25].

Although P-cadherin also suffers proteolytical cleavage, the serum levels of sP-cad are considerably lower (approximately one twentieth) than sE-cad [25]. The P-cadherin ectodo-main has been detected in serum/plasma both from healthy and breast cancer patients, although the sP-cad were not related with the presence of breast cancer [25, 26], nor with the presence of a P-cadherin positive tumour [25]. It was hypothesised that the secretion of sP-cad in nipple fluids may represent a potential early biomarker to identify patients at higher breast cancer risk [26]. Divergent results between studies hamper a consensus on the clinical significance of serum cadherin levels (sE-cad and s-P-cad) in patients with can-cer [24, 25, 29, 31].

Circulating tumour markers may be useful in screening, diagnosis, staging, prognosis, pre-diction of tumour relapse, and therapeutic monitoring [23]. In this context, we planned to determine the serum levels of sP-cad in a group of queens with spontaneous mammary lesions and to compare them with a group of healthy queens.

207



Sample collection

Twenty one queens affected by naturally occurring mammary lesions, surgically excised with curative intents, and 31 clinically healthy queens were included in this study. Animals with a history of previous tumours or with any other concomitant diseases were excluded.

Blood samples were collected from 31 queens with normal mammary gland, three with hy-perplastic/dysplastic lesions, one benign tumour (fibroadenoma) and 17 malignant tumours (seven tubulopapillary carcinomas, six solid carcinomas, two cribriform carcinomas, one mucinous carcinoma and one carcinosarcoma). One (5.88%) malignant tumour was grade I, eight (47.06%) were grade II and eight (47.06%) were grade III. In 9 (52.94%) carcinomas neoplastic intravascular emboli were identified, and in 11 (78.57%) out of 14 cases, where lymph nodes were available, metastases were diagnosed. Blood samples were collected once from healthy queens and in tumour-bearing animals all had blood collection prior to surgery. In six queens, blood samples were also collected at the post-operative follow-up visits.

Samples were collected into plain collection tube, waited until blood clotting, centrifuged and the serum was drawn and stored at -20ºC. Tumour specimens were processed and evaluated as previously described [32].

208


Patients follow-up

Queens with mammary lesions were examined prior to surgery and 6 tumour-bearing queens were followed three weeks after surgery and every two months thereafter for a two-year period. Each examination consisted of a complete physical examination, thoracic radiographs (three views) and complete abdominal ultrasound. In control visits, blood sam-ples were also collected. Necropsies were performed whenever the owner´s consent and suspected metastases were histologically confirmed.

Overall survival (OS) was calculated from the date of tumour removal to the date of death/euthanasia. Disease-free interval (DFI) was calculated from the date of surgery to the date of detection of the first recurrence or development of distant metastases.

Detection and quantification of soluble P-cadherin by ELISA

P-cadherin concentrations were measured using an enzyme-linked immunosorbent assay (ELISA) kit (DuoSet® ELISA Development System, R&D Systems, Abingdon, UK) accord-ing to the manufacturer’s instructions. Briefly, a 96-well immunoplate was coated with 100 μL/ well of the monoclonal mouse anti-human P-cadherin and incubated overnight at room temperature. The wells were washed 3 times with 400 μL phosphate buffered saline (PBS) containing 0.05% Tween-20 at pH 7.4. Plates were then blocked with 300 μL of PBS con-taining 1% bovine serum albumin (BSA) for 1 hour at room temperature. After a total of three washes, 100 μL/well of samples or standards were added and incubated for 2 hours at room temperature. The plates were again washed for three times and subsequently in-cubated with 100 μL of diluted biotinylated goat anti-human P-cadherin (detection antibody) for 2 hours at room temperature. After three new washings, 100 μL of streptavidin–horse-radish peroxidase was added to each well and incubated at room temperature for 20 min-utes. The three wash step was repeated for the last time and 100 μL of substrate solution containing a mixture of hydrogen peroxide and tetramethylbenzidine (color reagents) was added to each well and incubated for 20 minutes at room temperature. The reaction was finished by adding 50 μL of the stop solution to each well. The optical density of each well was determined using a microplate reader set to 450 nm and to 570 nm (Molecular Devices, SPECTRA max PLUS 384). The readings at 570 nm were subtracted to the readings at 450 nm. Four negative controls were used: 1 - all the procedure was done, skipping the addition of serum, which was replaced by reagent diluents; 2 – a negative sample without the detec-tion antibody; 3 – a positive sample without the detection antibody; 4 – a negative serum and the detection antibody replaced by a goat anti-human IgA antibody. For positive control we used negative serum sample added with the recombinant human P-cadherin from the kit. The sensibility limits of this ELISA kit were 62.50-4.000 pg/ml.

A standard curve was generated for each set of samples assayed, using serial dilutions of

209


P-cadherin. A linear regression equation was created from standards of known P-cadherin concentrations and P-cadherin levels of unknown samples were fit to the standard curve regression equation, corrected for aliquot volume and expressed as pg of P-cad/mL. The standard curve and serum samples were run in duplicate and the average of the two values was reported.

210


RESULTS AND DISCUSSION

Table 1 represents a resume of the clinicopathological features of the queens that had posi-tive sP-cad serum levels and of those that what was possible to have a clinical follow-up. In our series, soluble sP-cad was not detected in serum from healthy queens or from queens with benign or hyperplasic lesions. Amongst the 17 malignancies, sP-cad was detected in two queens diagnosed with grade III carcinomas (Table 1): one cat had measurable levels at the time of surgery and two (including the former) had measurable values during the follow-up visits. The DFI and OS of seven malignant cases are represented in table 1. The metastatic lesions were positive to P-cadherin (Figure 1).

Several molecular and cellular alterations occur with cancer progression, including prote-olysis and release of membrane proteins, such as cadherins, as the result of a proteases enrichment of the tumour environment [23, 24, 33]. In vitro studies revealed a self-sustained loop where the overexpression of P-cadherin induces the secretion of matrix metallopro-teinases capable of cleaving the P-cadherin ectodomain and releasing sP-cad, which, in turn, is able to induce and maintain the secretion of active MMP´s [34]. The serum levels of sP-cad were, therefore, proposed as potential early biomarkers of breast cancer risk or diagnosis, although this hypothesis has not been proved [25, 26].

211


Figure 1. P-cadherin expression by immunohistochemistry. (A) Lung metastases with P-cadherin expres-sion by neoplastic cells. x100; (B) Detail of the lung metastatic lesion with P-cadherin expression. x200.

Although the small size of the series hampers any results interpretation, it seems possible that the sensibility limit of this ELISA kit may difficult the detection of sP-cad in low concen-trations. Therefore, we aim to improve the sensitivity of the test and to study a larger group of cats with neoplastic mammary lesions.

212


Tabl

e 1.

Res

ume

of th

e cl

inic

opat

holo

gica

l fea

ture

s of

the

quee

ns th

at h

ad p

ositi

ve s

P-ca

d se

rum

leve

ls a

nd o

f tho

se in

wha

t was

pos

sibl

e to

hav

e a

clin

ical

follo

w-u

p.

Cas

eH

isto

path

olog

ical

di

agno

sis

His

tolo

gica

l gr

ade

Neo

plas

tic

intr

avas

cula

r em

boli

Lym

ph n

ode

met

asta

ses

Tiss

ue

P-ca

dher

in

imm

unol

abel

ing

Seru

m P

-cad

herin

(pg/

ml)

DFI

OS

Nec

rops

y

(met

asta

ses)

Cx

Ct1

Ct2

Ct3

Ct4

Ct5

1M

ucin

ous

carc

inom

a; s

olid

ca

rcin

oma

II; II

IA

bsen

tA

bsen

tP

ositi

veN

DN

DN

DN

DN

D––

2 m

onth

s12

mon

ths

lung

; per

icar

dium

2S

olid

car

cino

ma

IIIP

rese

ntA

bsen

tP

ositi

ve32

.39

182.

1845

.93

––––

––––

21 m

onth

slu

ng;p

eric

ardi

um

3S

olid

car

cino

ma

IIIP

rese

ntP

rese

ntP

ositi

veN

D29

3.77

––––

––––

––––

––

4S

olid

car

cino

ma

IIIP

rese

ntP

rese

ntP

ositi

veN

DN

DN

DN

DN

DN

D3

mon

ths

8 m

onth

slu

ng; p

leur

a

5C

ribrif

orm

car

cino

ma

IIA

bsen

tP

rese

ntP

ositi

veN

DN

DN

DN

D––

––21

mon

ths

still

aliv

e––

6C

ribrif

orm

car

cino

ma

IIIA

bsen

tP

rese

ntP

ositi

veN

DN

D––

––––

––6

mon

ths

11 m

onth

s––

16Tu

bulo

papi

llary

ca

rcin

oma

IIP

rese

ntP

rese

ntP

ositi

veN

D––

––––

––––

1 m

onth

14 m

onth

s––

18Tu

bulo

papi

llary

ca

rcin

oma

IIA

bsen

tP

rese

ntP

ositi

veN

D––

––––

––––

––1

mon

th *

––

ND

- no

t det

ecte

d

Cx

- sur

gery

Ct -

con

trol v

isit

*Acu

te re

nal f

ailu

re

–– -

no s

ampl

e

213


CONCLUSIONS

It is possible to detect and determine the serum concentration of the soluble P-cadherin fragment in queens using an enzyme-linked immunosorbent assay kit, although the tech-nique needs to be improved or complemented in order to be considered of interest in the evaluation of cats with mammary tumours.

214


REFERENCES

1. Takeichi M, 1995. Morphogenetic roles of classic cadherins. Curr Opin Cell Biol, 7(5):619-627.

2. Shirayoshi Y, Hatta K, Hosoda M, Tsunasawa S, Sakiyama F, Takeichi M, 1986. Cad-herin cell adhesion molecules with distinct binding specificities share a common struc-ture. EMBO J, 5(10):2485-2488.




6. Paredes J, Figueiredo J, Albergaria A, Oliveira P, Carvalho J, Ribeiro AS, Caldeira J, Costa AM, Simoes-Correia J, Oliveira MJ, Pinheiro H, Pinho SS, Mateus R, Reis CA, Leite M, Fernandes MS, Schmitt F, Carneiro F, Figueiredo C, Oliveira C, Seruca R, 2012. Epithelial E- and P-cadherins: role and clinical significance in cancer. Biochim Biophys Acta, 1826(2):297-311.

7. De Leeuw WJ, Berx G, Vos CB, Peterse JL, Van De Vijver MJ, Litvinov S, Van Roy F,

215


Cornelisse CJ, Cleton-Jansen AM, 1997. Simultaneous loss of E-cadherin and catenins in invasive lobular breast cancer and lobular carcinoma in situ. J Pathol, 183(4):404-411.


9. Rieger-Christ KM, Pezza JA, Dugan JM, Braasch JW, Hughes KS, Summerhayes IC, 2001. Disparate E-cadherin mutations in LCIS and associated invasive breast carcino-mas. Mol Pathol, 54(2):91-97.





14. Gonzalez MA, Pinder SE, Wencyk PM, Bell JA, Elston CW, Nicholson RI, Robertson JF, Blamey RW, Ellis IO, 1999. An immunohistochemical examination of the expression of E-cadherin, α- and β/γ-catenins, and α2- and β1-integrins in invasive breast cancer. J Pathol, 187(5):523-529.

15. Paredes J, Albergaria A, Oliveira JT, Jeronimo C, Milanezi F, Schmitt FC, 2005. P-cad-herin overexpression is an indicator of clinical outcome in invasive breast carcinomas and is associated with CDH3 promoter hypomethylation. Clin Cancer Res, 11(16):5869-5877.

16. Paredes JCDaF, Milanezi MFG, Reis-Filho JS, Leitão DRA, Athanazio DA, Schmitt FCDL, 2002. Correlação entre as expressões de P-caderina e de receptores de es-trógeno no câncer da mama. Correlation between P-cadherin and estrogen receptor expression in breast cancer. Jornal Brasileiro de Patologia e Medicina Laboratorial, 38:307-331.


18. Gamallo C, Moreno-Bueno G, Sarrio D, Calero F, Hardisson D, Palacios J, 2001. The prognostic significance of P-cadherin in infiltrating ductal breast carcinoma. Modern pa-thology 14(7):650-654.

19. Peralta Soler A, Knudsen KA, Salazar H, Han AC, Keshgegian AA, 1999. P-cadherin expression in breast carcinoma indicates poor survival. Cancer, 86(7):1263-1272.


216




23. De Wever O, Derycke L, Hendrix A, De Meerleer G, Godeau F, Depypere H, Bracke M, 2007. Soluble cadherins as cancer biomarkers. Clin Exp Metastasis, 24(8):685-697.

24. Repetto O, De Paoli P, De Re V, Canzonieri V, Cannizzaro R, 2014. Levels of soluble E-cadherin in breast, gastric, and colorectal cancers. Biomed Res Int, 2014:408047.

25. Knudsen KA, Lin CY, Johnson KR, Wheelock MJ, Keshgegian AA, Soler AP, 2000. Lack of correlation between serum levels of E- and P-cadherin fragments and the presence of breast cancer. Hum Pathol, 31(8):961-965.

26. Mannello F, Tonti GA, Medda V, Pederzoli A, Sauter ER, 2008. Increased shedding of soluble fragments of P-cadherin in nipple aspirate fluids from women with breast cancer. Cancer Sci, 99(11):2160-2169.

27. Berx G, Van Roy F, 2009. Involvement of members of the cadherin superfamily in can-cer. Cold Spring Harb Perspect Biol, 1(6):a003129.

28. Perez-Rivas LG, Jerez JM, Fernandez-De Sousa CE, De Luque V, Quero C, Pajares B, Franco L, Sanchez-Munoz A, Ribelles N, Alba E, 2012. Serum protein levels fol-lowing surgery in breast cancer patients: a protein microarray approach. Int J Oncol, 41(6):2200-2206.

29. Liang Z, Sun XY, Xu LC, Fu RZ, 2014. Abnormal expression of serum soluble E-cad-herin is correlated with clinicopathological features and prognosis of breast cancer. Med Sci Monit, 20:2776-2782.

30. Hofmann G, Balic M, Dandachi N, Resel M, Schippinger W, Regitnig P, Samonigg H, Bauernhofer T, 2013. The predictive value of serum soluble E-cadherin levels in breast cancer patients undergoing preoperative systemic chemotherapy. Clin Biochem, 46(15):1585-1589.

31. Katayama M, Hirai S, Kamihagi K, Nakagawa K, Yasumoto M, Kato I, 1994. Soluble E-cadherin fragments increased in circulation of cancer patients. Br J Cancer, 69(3):580-585.


33. Okugawa Y, Toiyama Y, Inoue Y, Iwata T, Fujikawa H, Saigusa S, Konishi N, Tanaka K, Uchida K, Kusunoki M, 2012. Clinical significance of serum soluble E-cadherin in colorectal carcinoma. J Surg Res, 175(2):e67-73. .

34. Ribeiro AS, Albergaria A, Sousa B, Correia AL, Bracke M, Seruca R, Schmitt FC, Pare-des J, 2010. Extracellular cleavage and shedding of P-cadherin: a mechanism underly-ing the invasive behaviour of breast cancer cells. Oncogene, 29(3):392-402.

08GENERAL DISCUSSION

219

General discussion Chapter 08

GENERAL DISCUSSION

The majority of feline mammary tumours are carcinomas with an aggressive behaviour and high metastatic potential [1, 2]. Affected queens have a poor prognosis with death or eu-thanasia generally due to local recurrence and/or metastatic disease [1, 3]. It is manifestly evident that the assessment of histological type is not sufficient per se for individual prog-nosis in cats [4], often being complemented, for such purpose, with grading [5-8], and the search for lymphatic and/or blood invasion as well as regional lymph node metastases [8].Recently, several studies have been directed to the search of molecular markers in feline mammary tumours, in order to provide additional information in the diagnosis, prognosis and to select patients that are likely to suffer from progressive disease and that may be sub-mitted to adjuvant therapies [9-12], as is currently standard in human breast cancer [13, 14].

The cadherin-catenin complex is a cell-cell adhesion system that is also involved in major mechanisms of specific genes transcription modulation, hence regulating several cellular processes, namely proliferation, survival, polarization, differentiation, shape and migration [15-17]. Thus, disorders of its components are known to be involved in breast cancer de-velopment [18-25].

The cadherin-catenin complex is important for the maintenance of the overall architecture of the feline normal mammary gland, as revealed by the expression of the molecules that

220

Chapter 08 General discussion

compose this complex. In this study, E-cadherin and catenins were consistently expressed in the membrane of epithelial luminal cells while P-cadherin was restricted to mioepithelial cells. This selective cadherin-catenin expression seems to be necessary for the correct ar-chitecture of normal mammary gland, and alterations of this pattern of expression were only observed in mammary lesions.

P-cadherin overexpression is associated to increased cell proliferation, motility, invasive-ness, and metastatic progression in breast cancer cells, being P-cadherin considered an invasion-promoting protein [15, 16, 20, 26-29], and is related to poor prognosis in breast carcinoma patients [15, 20, 22, 24, 30-32]. In 80% of the feline carcinomas included in this study there was a significant overexpression of P-cadherin by luminal epithelial cells when compared with benign mammary lesions. P-cadherin expression was more evident in the most peripheral cells of the tumour invasion front and in the invasive neoplastic cell clus-ters, denoting its important role in invasion. Moreover, it was associated to high histological grade of carcinomas and high proliferative index revealing a close relationship with less differentiated tumours, as previously reported by other authors in human breast cancer [18-20, 22, 24, 25, 30, 33-35]. These features suggest that P-cadherin may be regarded as a promising prognostic indicator of aggressiveness in feline mammary carcinomas. Although we were unable to demonstrate a relationship between P-cadherin expression and nodal metastases, similar to what is described in humans [18, 19, 22], our results indicate that the aberrant expression of P-cadherin may constitute an important step in the invasion and tumours progression, as P-cadherin positive tumours were 8.46 times more likely to show invasion to vessels than negative ones. This finding suggests that the arrest and fixation of neoplastic cells in distant sites may require the acquisition of other morphological and functional features, other than P-cadherin per se.

Alterations of the E-cadherin expression, particularly partial or total loss, have been also associated to breast cancer [21, 23, 36-42]. We observed that the feline normal mammary tissue presented E-cadherin expression in luminal epithelial cells while nearly half of the carcinomas exhibited reduced expression. E-cadherin was not related to histological grade or to the presence of neoplastic intravascular emboli or lymph node metastases. Several studies suggested that the combined study of cadherins and catenins may contribute to bet-ter characterize their role in breast carcinogenesis [43-45].

Our study revealed that nearly 60% of feline mammary carcinomas exhibited reduced mem-branous expression of α-, β- and p120-catenin, suggesting that their loss contributes to the development of a malignant phenotype in queens, as previously shown in human breast cancer [43, 44, 46, 47]. In breast carcinomas, down-regulation or loss of α-catenin has been associated to high tumour grade [48], metastasis [43, 48, 49] and poor survival [48], which raised the possibility that it may be considered a good prognostic marker. We observed an association between reduced α-catenin expression and larger tumour size and necrosis, which can be justified by the fact that under a stressful tumour microenvironment, loss of

221


α-catenin results in increased proliferation, decreased apoptosis and increased growth-factor signalling, and leads to larger tumour volumes and ischemic necrosis [50, 51].

A significant reduction in β-catenin expression was observed in feline mammary carcino-mas compared to benign tumours, but this reduction had no association with clinicopatho-logical features with known prognostic value. In fact, the prognostic value of β-catenin in both human [43, 49, 52, 53] and feline mammary tumours [54, 55] has not been clarified, with different studies revealing contradictory results.

Another interesting finding from this study was the cytoplasmic p120-catenin subcellular location in 40% of the feline mammary carcinomas in our series. In human breast carcino-mas, this phenomenon is associated to an invasive behaviour [56, 57] and higher histologi-cal grades [58]. Although we were unable to establish a relationship between sub-cellular p120-catenin location and the histological grade of carcinomas (probably due to the low number of cases included in this series), nearly 96% of mammary tumours with cytoplas-matic p120-catenin expression were moderate- or high-grade carcinomas, suggesting that it may be relevant for the development and progression of feline mammary cancer. Approximately 90% of carcinomas showing emboli preserve the expression of α-, β- and p120-catenin in the neoplastic intravascular cells, irrespective of the expression depicted in the primary tumor, which may indicate that catenins in embolic cells represent a strategy for effective spread of neoplastic cells.

Our study supports the concept that dysfunction of the E-cadherin–catenin adhesion com-plex is related to feline malignant mammary tumours, based on the demonstration that 70% of the carcinomas underexpressed at least one member of this complex. Furthermore, we observed that the overexpression of P-cadherin is a better indicator of the malignant behav-iour of feline mammary carcinomas than the loss of E-cadherin and/or catenins.

The results besides denoting the importance of P-cadherin in malignant mammary tumours highlights the need for the study of the prognostic value of P-cadherin positivity in tumours that preserve E-cadherin expression in cats. Curiously, nearly half of the P-cadherin-posi-tive carcinomas studied also preserved a normal pattern of E-cadherin expression. More-over, more than half of the P-cadherin positive tumours that presented vascular emboli and lymph node metastases were also E-cadherin positive. Thus the P+/E+ expression seems to be related to aggressive tumour behaviour similar to what happens in women [16, 59, 60].

In an effort to contribute to the molecular characterization of feline mammary tumours and explore molecular reliable markers that could be helpful as prognostic and therapeutic tar-gets we analysed phenotypic cell markers (AE1/AE3, vimentin, p63), hormonal receptors status (ER, PR) and proliferative activity (Ki-67) and their relationship with the cadherins molecules (P- and E-cadherin).

222


Beyond the normal nuclear p63 expression in myoepithelial cells, it was also found labelling in the nucleus of epithelial cells in 38% of carcinomas, although with less intensity. P63 is thought to be expressed early in epithelial differentiation and may contribute to a commit-ted stem cell and/or progenitor phenotype, such as P-cadherin and CK5 [61]. In fact, p63 is known to act as a transcription factor of the P-cadherin promoter [62, 63] which denotes a functional relationship between these two molecules. Our results suggest that this associa-tion at the genetic level can probably be equated to feline mammary tumours, as we were able to demonstrate a relationship between p63 and P-cadherin expression.

Half of the carcinomas in our study co-expressed vimentin and cytokeratin, a feature pre-viously described in human [64] and feline [11, 54] malignant mammary tumours. These vimentin positive cancer cells could be a hallmark of the direct myoepithelial histogenesis, be a sign of the epithelial-mesenchymal transition (EMT) reflecting the end-stage of tumour dedifferentiation or derive from mammary progenitor cells with bilinear (glandular and myo-epithelial) differentiation potential [65].

In our series P-cad+/vim+ mammary tumours were 3.76 times more prone to invade ves-sels, corroborating the human breast cancer concept that both P-cadherin [15] and vimentin [66] are invasion-associated molecules. Curiously, half of the P-cad+/vim+ carcinomas also preserved E-cadherin expression. This condition may represent a partial EMT phenome-non, in which cells retain some epithelial characteristics albeit acquiring features of mesen-chymal cells, leading some authors to propose that P-cadherin could be considered an EMT marker, able to identify intermediate and transient EMT states, associated with metastatic phenotypes [67].

Steroid hormones are associated with the development of mammary tumours, as evi-denced by the different expression of HR in normal and neoplastic mammary tissues [68-70]. In our series, the expression of ER and PR in malignant tumours was significantly lower when compared to benign tumours, corroborating data from previous studies [1, 69, 71, 72]. Moreover, ER was associated with expression of both P- and E-cadherin, the vast majority of ER-negative carcinomas being P-cadherin-positive and the majority of ER posi-tive tumours being E-cadherin-positive. The lack of ER signalling seems to be responsible for P-cadherin overexpression, categorizing the P-cadherin gene/CDH3 as an oestrogen-repressed gene [26, 33, 35, 73]. The role of ER in the regulation of E-cadherin expression is still obscure [19, 43, 74-77].

The Ki-67 index was higher in carcinomas than in non-neoplastic and benign lesions, cor-roborating data from previous studies [7, 70, 78, 79]. Moreover, higher Ki-67 indexes were related with the overexpression of P-cadherin, higher histological grade, and ER negative status, supporting its association with tumour aggressiveness. The combined analysis of the molecular markers and the tumour clinicopathological features allowed the conclusion that P-cad-/vim-/ER+/E-cad+/low Ki-67 malignant tumours were well-differentiated carcino-

223


mas, which suggests that this molecular profile identifies low-aggressive carcinomas. On opposition, P-cad+/vim+/ER-/high Ki-67 tumours were of higher histological grades, thus suggesting that an immunohistochemical classification based on the combined expression of P-cadherin, ER, vimentin and Ki-67 may be of prognostic value in mammary carcinomas in this species.

Cancer is a complex biologic process and the events involved in the development and pro-gression of feline mammary carcinomas are still poorly known [80], namely the cadherins and catenins role, about which there is still few and contradictory information [54, 81-83]. The development of in vitro and in vivo models to study the molecules of the cadherin-catenin complex, would allow a better understanding of their role in feline mammary carci-nogenesis and in this context we worked with the FMCm cell line [84]. This cell line revealed co-expression of E-cadherin and α-, β- and p120-catenin and a close relationship between E-cadherin and each one of the catenins studied, which points to a preserved E-cadherin-catenin complex. These cells also expressed P-cadherin that was co-localized with E-cad-herin, and it was possible to determine an interaction between these two molecules.

Aiming to develop an in vivo model for the study of feline mammary carcinomas that could mimic as much as possible the spontaneous lesions, we transplanted the FMCm cancer cells into the mammary fat pad of nude mice. Those cells were able to induce local forma-tion of high grade metastatic carcinomas in all mice, revealing that this cell line is highly tumourigenic, and with high metastastic potential. Both xenograft and metastatic lesions expressed P- and E-cadherin as well as α-, β- and p120-catenin. This corroborates data from recent studies describing that the co-expression of both P- and E-cadherin is signifi-cantly associated to aggressive behaviour, invasion and metastasis in breast carcinomas [16, 59, 60].

The metastatic pattern observed in mice was similar to the one described in queens [85], with regional lymph nodes and lungs being the major sites involved. This in vivo model seems to be suitable to identify and characterize molecular mechanisms that drive metas-tasis in feline mammary carcinomas and thus could constitute a valuable tool in order to develop strategies to inhibit the metastatic process in feline species.

Although surgical excision will probably continue to be the treatment of choice, feline mas-tectomized patients present a high incidence of recurrences and metastases [1, 3]. Despite aggressive surgery and some attempts of adjuvant therapies, the clinical outcome has not been substantially improved and there is still a lack of effective post-operative therapeutic plans for feline mammary carcinoma [2, 85]. It was suggested that interruption of the P-cadherin signalling pathway could be a novel therapeutic approach for breast cancer, as P-cadherin inhibition has anti-tumoural and anti-metastatic effects [16, 59, 86]. Both human monoclonal antibody against P-cadherin [86] and bacterial protein azurin [59] are pointed as novel therapeutic tools in P-cadherin expressing malignant tumours. Azurin decreased

224


membranous P-cadherin expression and presented anti-invasive effects in P-cadherin overexpressing breast cancer cells and the monoclonal antibody against P-cadherin, in a xenograft model, resulted in inhibition of growth and metastatic progression of high P-cad-herin expression tumours [86]. This scenario sparked our interest in the study of P-cadherin in feline mammary carcinoma, as a potential therapeutic target. Thus, the FMCm cells both in vitro and in vivo can be used for therapeutic studies concerning P-cadherin molecules in order to determine if the highly aggressive P-cadherin positive feline mammary tumours may benefit from one of these novel therapeutic approaches [59, 86].

225


REFERENCES


2. Sorenmo KU, Worley DR, Goldschmidt MH 2013. Tumours of the Mammary Gland. In: WITHROW, S. J., VAIL, D. M. & PAGE, R. L. (eds.) Withrow & MacEwen´s Small Animal Clinical Oncology. 5th edition ed. Missouri: Elsevier Saunders.


4. Weijer K, Hart AA, 1983. Prognostic factors in feline mammary carcinoma. J Natl Cancer Inst, 70(4):709-716.

5. Seixas F, Palmeira C, Pires MA, Bento MJ, Lopes C, 2011. Grade is an independent prognostic factor for feline mammary carcinomas: a clinicopathological and survival analysis. Vet J, 187(1):65-71.

6. Castagnaro M, Casalone C, Bozzetta E, De Maria R, Biolatti B, Caramelli M, 1998. Tumour Grading and the One-year Post-surgical Prognosis in Feline Mammary Carci-nomas. J. Comp. Path., 119:263-275.

7. Millanta F, Lazzeri G, Mazzei M, Vannozzi I, Poli A, 2002. MIB-1 Labeling Index in Fe-line Dysplastic and Neoplastic Mammary Lesions and Its Relationship with Postsurgical Prognosis. Vet Pathol, 39(1):120-126.

8. Zappulli V, Rasotto R, Caliari D, Mainenti M, Pena L, Goldschmidt MH, Kiupel M, 2015.

226


Prognostic evaluation of feline mammary carcinomas: a review of the literature. Vet Pathol, 52(1):46-60.



11. Caliari D, Zappulli V, Rasotto R, Cardazzo B, Frassineti F, Goldschmidt MH, Castagnaro M, 2014. Triple-negative vimentin-positive heterogeneous feline mammary carcinomas as a potential comparative model for breast cancer. BMC Vet Res, 10(1):185.









20. Gamallo C, Moreno-Bueno G, Sarrio D, Calero F, Hardisson D, Palacios J, 2001. The prognostic significance of P-cadherin in infiltrating ductal breast carcinoma. Modern pathology 14(7):650-654.


22. Paredes J, Albergaria A, Oliveira JT, Jeronimo C, Milanezi F, Schmitt FC, 2005.

227


P-cadherin overexpression is an indicator of clinical outcome in invasive breast car-cinomas and is associated with CDH3 promoter hypomethylation. Clin Cancer Res, 11(16):5869-5877.


24. Peralta Soler A, Knudsen KA, Salazar H, Han AC, Keshgegian AA, 1999. P-cadherin ex-pression in breast carcinoma indicates poor survival. Cancer, 86(7):1263-1272.


26. Paredes J, Stove C, Stove V, Milanezi F, Van Marck V, Derycke L, Mareel M, Bracke M, Schmitt F, 2004. P-cadherin is up-regulated by the antiestrogen ICI 182,780 and pro-motes invasion of human breast cancer cells. Cancer Res, 64(22):8309-8317.

27. Vieira AF, Ricardo S, Ablett MP, Dionisio MR, Mendes N, Albergaria A, Farnie G, Ger-hard R, Cameselle-Teijeiro JF, Seruca R, Schmitt F, Clarke RB, Paredes J, 2012. P-cadherin is coexpressed with CD44 and CD49f and mediates stem cell properties in basal-like breast cancer. Stem Cells, 30(5):854-864.

28. Paredes J, Figueiredo J, Albergaria A, Oliveira P, Carvalho J, Ribeiro AS, Caldeira J, Costa AM, Simoes-Correia J, Oliveira MJ, Pinheiro H, Pinho SS, Mateus R, Reis CA, Leite M, Fernandes MS, Schmitt F, Carneiro F, Figueiredo C, Oliveira C, Seruca R, 2012. Epithelial E- and P-cadherins: role and clinical significance in cancer. Biochim Biophys Acta, 1826(2):297-311.

29. Vieira AF, Ribeiro AS, Dionisio MR, Sousa B, Nobre AR, Albergaria A, Santiago-Gomez A, Mendes N, Gerhard R, Schmitt F, Clarke RB, Paredes J, 2014. P-cadherin signals through the laminin receptor α6β4 integrin to induce stem cell and invasive properties in basal-like breast cancer cells. Oncotarget, 5(3):679-692.




33. Paredes J, Milanezi F, Reis-Filho JS, Leitao D, Athanazio D, Schmitt F, 2002. Aberrant P-cadherin expression: is it associated with estrogen-independent growth in breast can-cer? Pathol Res Pract, 198(12):795-801.

34. Arnes JB, Brunet JS, Stefansson I, Begin LR, Wong N, Chappuis PO, Akslen LA, Foulkes WD, 2005. Placental cadherin and the basal epithelial phenotype of BRCA1-related breast

228


cancer. Clinical cancer research, 11(11):4003-4011.35. Paredes JCDaF, Milanezi MFG, Reis-Filho JS, Leitão DRA, Athanazio DA, Schmitt

FCDL, 2002. Correlação entre as expressões de P-caderina e de receptores de es-trógeno no câncer da mama. Correlation between P-cadherin and estrogen receptor expression in breast cancer. Jornal Brasileiro de Patologia e Medicina Laboratorial, 38:307-331.


37. De Leeuw WJ, Berx G, Vos CB, Peterse JL, Van De Vijver MJ, Litvinov S, Van Roy F, Cornelisse CJ, Cleton-Jansen AM, 1997. Simultaneous loss of E-cadherin and catenins in invasive lobular breast cancer and lobular carcinoma in situ. J Pathol, 183(4):404-411.


39. Rieger-Christ KM, Pezza JA, Dugan JM, Braasch JW, Hughes KS, Summerhayes IC, 2001. Disparate E-cadherin mutations in LCIS and associated invasive breast carcino-mas. Mol Pathol, 54(2):91-97.





44. Talvinen K, Tuikkala J, Nykanen M, Nieminen A, Anttinen J, Nevalainen OS, Hurme S, Kuopio T, Kronqvist P, 2010. Altered expression of p120-catenin predicts poor outcome in invasive breast cancer. J Cancer Res Clin Oncol, 136(9):1377-1387.


46. Gonzalez MA, Pinder SE, Wencyk PM, Bell JA, Elston CW, Nicholson RI, Robertson JF, Blamey RW, Ellis IO, 1999. An immunohistochemical examination of the expression of E-cadherin, α- and β/γ-catenins, and α2- and β1-integrins in invasive breast cancer. J Pathol, 187(5):523-529.

47. Park D, Karesen R, Axcrona U, Noren T, Sauer T, 2007. Expression pattern of adhe-sion molecules (E-cadherin, α-, β-, γ-catenin and claudin-7), their influence on survival in primary breast carcinoma, and their corresponding axillary lymph node metastasis.

229


APMIS, 115(1):52-65.48. Sun Y, Zhang J, Ma L, 2014. α-Catenin: A tumor suppressor beyond adherens junctions.

Cell Cycle, 13(15):2334-9.49. Bukholm IK, Nesland JM, Karesen R, Jacobsen U, Borresen-Dale AL, 1998. E-Cadherin

and α-, β-, and γ-catenin protein expression in relation to metastasis in human breast carcinoma. J Pathol, 185(3):262-266.

50. Plumb CL, Adamcic U, Shahrzad S, Minhas K, Adham SA, Coomber BL, 2009. Modu-lation of the tumor suppressor protein α-catenin by ischemic microenvironment. Am J Pathol, 175(4):1662-1674.

51. Benjamin JM, Nelson WJ, 2008. Bench to bedside and back again: molecular mechanisms of α-catenin function and roles in tumorigenesis. Semin Cancer Biol, 18(1):53-64.


53. Fanelli MA, Montt-Guevara M, Diblasi AM, Gago FE, Tello O, Cuello-Carrion FD, Calle-gari E, Bausero MA, Ciocca DR, 2008. P-Cadherin and β-catenin are useful prognostic markers in breast cancer patients; β-catenin interacts with heat shock protein Hsp27. Cell Stress Chaperones, 13(2):207-220.



56. Anastasiadis PZ, Reynolds AB, 2001. Regulation of Rho GTPases by p120-catenin. Curr Opin Cell Biol, 13(5):604-610.

57. Johnson E, Seachrist DD, Deleon-Rodriguez CM, Lozada KL, Miedler J, Abdul-Karim FW, Keri RA, 2010. HER2/ERBB2-induced breast cancer cell migration and invasion re-quire p120 catenin activation of RAC1 and CDC42. J Biol Chem, 285(38):29491-29501.

58. Van Hengel J, Van Roy F, 2007. Diverse functions of p120ctn in tumors. Biochim Biophys Acta, 1773(1):78-88.


60. Ribeiro AS, Sousa B, Carreto L, Mendes N, Nobre AR, Ricardo S, Albergaria A, Came-selle-Teijeiro JF, Gerhard R, Soderberg O, Seruca R, Santos MA, Schmitt F, Paredes J, 2013. P-cadherin functional role is dependent on E-cadherin cellular context: a proof of concept using the breast cancer model. J Pathol, 229(5):705-718.

61. Matos I, Dufloth R, Alvarenga M, Zeferino LC, Schmitt F, 2005. p63, cytokeratin 5, and P-cadherin: three molecular markers to distinguish basal phenotype in breast carcinomas. Virchows Archiv, 447(4):688-694.

230


62. Faraldo MM, Teuliere J, Deugnier MA, Birchmeier W, Huelsken J, Thiery JP, Cano A, Glukhova MA, 2007. β-Catenin regulates P-cadherin expression in mammary basal epi-thelial cells. FEBS Lett, 581(5):831-836.


64. Domagala W, Wozniak L, Lasota J, Weber K, Osborn M, 1990. Vimentin is preferentially expressed in high-grade ductal and medullary, but not in lobular breast carcinomas. Am J Pathol, 137(5):1059-1064.

65. Korsching E, Packeisen J, Liedtke C, Hungermann D, Wulfing P, Van Diest PJ, Brandt B, Boecker W, Buerger H, 2005. The origin of vimentin expression in invasive breast cancer: epithelial-mesenchymal transition, myoepithelial histogenesis or histogenesis from progenitor cells with bilinear differentiation potential? J Pathol, 206(4):451-457.

66. Gilles C, Polette M, Mestdagt M, Nawrocki-Raby B, Ruggeri P, Birembaut P, Foidart JM, 2003. Transactivation of vimentin by beta-catenin in human breast cancer cells. Cancer Res, 63(10):2658-2664.

67. Ribeiro AS, Paredes J, 2015. P-Cadherin Linking Breast Cancer Stem Cells and In-vasion: A Promising Marker to Identify an "Intermediate/Metastable" EMT State. Front Oncol, 4(371):1-6.

68. Martin PM, Cotard M, Mialot JP, Andre F, Raynaud JP, 1984. Animal models for hor-mone-dependent human breast cancer. Relationship between steroid receptor profiles in canine and feline mammary tumors and survival rate. Cancer Chemother Pharmacol, 12(1):13-17.


70. Burrai GP, Mohammed SI, Miller MA, Marras V, Pirino S, Addis MF, Uzzau S, Antuofer-mo E, 2010. Spontaneous feline mammary intraepithelial lesions as a model for human estrogen receptor- and progesterone receptor-negative breast lesions. BMC Cancer, 10:156.


72. Martin De Las Mulas J, Van Niel M, Millan Y, Ordas J, Blankenstein MA, Van Mil F, Mis-dorp W, 2002. Progesterone receptors in normal, dysplastic and tumourous feline mam-mary glands. Comparison with oestrogen receptors status. Res Vet Sci, 72(2):153-161.

73. Albergaria A, Ribeiro AS, Pinho S, Milanezi F, Carneiro V, Sousa B, Sousa S, Oliveira C, Machado JC, Seruca R, Paredes J, Schmitt F, 2010. ICI 182,780 induces P-cadherin overexpression in breast cancer cells through chromatin remodelling at the promoter level: a role for C/EBPbeta in CDH3 gene activation. Hum Mol Genet, 19(13):2554-2566.

74. Parker C, Rampaul RS, Pinder SE, Bell JA, Wencyk PM, Blamey RW, Nicholson RI, Robertson JF, 2001. E-cadherin as a prognostic indicator in primary breast cancer. Br J

231


Cancer, 85(12):1958-1963. 75. Lipponen P, Saarelainen E, Ji H, Aaltomaa S, Syrjanen K, 1994. Expression of E-

cadherin (E-CD) as related to other prognostic factors and survival in breast cancer. J Pathol, 174(2):101-109.

76. Charpin C, Garcia S, Bouvier C, Devictor B, Andrac L, Choux R, Lavaut M, 1997. E-cadherin quantitative immunocytochemical assays in breast carcinomas. J Pathol, 181(3):294-300.


78. Dias Pereira P, Carvalheira J, Gartner F, 2004. Cell proliferation in feline normal, hy-perplastic and neoplastic mammary tissue-an immunohistochemical study. Vet J, 168(2):180-185.

79. Castagnaro M, De Maria R, Bozzetta E, Ru G, Casalone C, Biolatti B, Caramelli M, 1998. Ki-67 index as indicator of the post-surgical prognosis in feline mammary carcino-mas. Research in Veterinary Science, 65:223-226.

80. Minke JM, Schuuring E, Van Den Berghe R, Stolwijk JA, Boonstra J, Cornelisse C, Hilkens J, Misdorp W, 1991. Isolation of two distinct epithelial cell lines from a single fe-line mammary carcinoma with different tumorigenic potential in nude mice and express-ing different levels of epidermal growth factor receptors. Cancer Res, 51(15):4028-4037.


82. Buendia AJ, Penafiel-Verdu C, Navarro JA, Vilafranca M, Sanchez J, 2014. N-cadherin expression in feline mammary tumors is associated with a reduced E-cadherin expres-sion and the presence of regional metastasis. Vet Pathol, 51(4):755-758.


84. Uyama R, Hong SH, Nakagawa T, Yazawa M, Kadosawa T, Mochizuki M, Tsujimoto H, Nishimura R, Sasaki N, 2005. Establishment and characterization of eight feline mam-mary adenocarcinoma cell lines. J Vet Med Sci, 67(12):1273-1276.



09CONCLUSIONS AND

FUTURE PERSPECTIVES

235

Conclusions and future perspectives Chapter 09

CONCLUSIONS

The results presented and discussed in this thesis allowed us to reach the following conclusions:

- Aberrant expression of P-cadherin detected in feline mammary tumours is associated to malignant phenotypes, higher histological grade and invasive behaviour, suggesting that this protein may be a relevant prognosis biomarker;

- P-cadherin overexpression seems to be a more reliable indicator of prognosis in feline mammary carcinomas than the aberrant expression of E-cadherin;

- Co-expression of P- and E-cadherin was related with high grade carcinomas;

- Development of mammary carcinomas in cats is associated to a decreased expression of α-, β- and p120-catenin, suggesting that these catenins may represent a valuable diagnos-tic tool, although their prognostic value was not supported by our results;

- Aggressive feline mammary carcinomas are characterized by high histological grade, high proliferative activity, absence of ER, aberrant expression of P-cadherin and vimentin. The identification of these five characteristics in the same tumour may be regarded as the basis for the decision to submit affected animals to post-operative adjuvant therapy;

236

Chapter 09 Conclusions and future perspectives

- The FMCm cell line besides expressing P-cadherin also co-expressed E-cadherin and α-, β- and p120-catenins, and those molecules were in close relation with each other pointing to a preserved E-cadherin-catenin complex;

- FMCm cell line showed high tumourigenic, aggressive and metastatic characteristics in nude mice, with xenograft and metastatic lesions expressing P- and E-cadherin as well as α-, β- and p120-catenin. It can be proposed as a useful model for in vitro and in vivo studies of P-cadherin and associated molecules of the cadherin-catenin complex of feline mam-mary carcinoma progression.

Considering the initial aims of this PhD project, we believe that we have successfully ad-dressed most of the questions we have wished for to answer. In conclusion, the results presented in this study highlighted P-cadherin as a relevant molecule in tumour aggressive-ness of feline mammary carcinomas.

237

Conclusions and future perspectives Chapter 09

FUTURE PERSPECTIVES

In general, our results added more knowledge on P-cadherin as a biomarker of feline mammary tumours, as well as on E-cadherin-catenin complex. However, data resulting from this work raises many interesting questions and challenges that remain to be elucidated.

- Clarify the role of P-cadherin expression in FMCm cell line and the possible involvement in the invasive capacity of these cells. We intend to specifically knock down P-cadherin ex-pression and evaluate the in vitro invasive capacity of that cell line upon P-cadherin silencing. For that purpose we specifically will design siRNA according to the cDNA sequencing results described in Chapter 6 (Supplementary data) and perform silencing of P-cadherin expres-sion in this cell line. Further studies on the tumourigenic and metastatic capacity of the cell line in nude mice with the aim of elucidating the role of P-cadherin expression in mammary carcinoma biology behaviour;

- To explore the functional effects of the co-expression of P-cadherin and E-cadherin in FMCm cell line;

- Study P-cadherin as a potential therapeutic target in feline mammary carcinomas in in vitro and in vivo assays;

238

Chapter 09 Conclusions and future perspectives

- Determination of P-cadherin as a potential stem cell marker in feline mammary carcino-mas, by co-expression with known stem cell markers such as CD44 and CD24;

- Further prospective studies, with larger series of mammary carcinomas showing different grade and type characteristics, since to the best of our knowledge there are no survival studies in feline mammary tumours related with P-cadherin expression;

- Study additional molecular markers that improve the feline molecular classification, name-ly HER2, EGFR or CK5/6 helping in the identification of the molecular subtypes with prog-nostic and therapeutic relevance;

- To enhance the sensibility of the ELISA assay in order to determine de sP-cad in serum of feline mammary tumour patients, with the aim to develop a diagnostic kit to monitor the metastatic process.

APPENDIX –– PUBLISHED MANUSCRIPTS

Documents

CHARACTERIZATION OF P-CADHERIN IN FELINE MAMMARY TUMOURS · CHARACTERIZATION OF P-CADHERIN IN FELINE MAMMARY TUMOURS ... A boa disposição e humor com que sempre me recebeu,