Embed Size (px)
Citation preview
Cytokine 65 (2014) 48–55
Contents lists available at ScienceDirect
Cytokine
journal homepage: www.journals .e lsevier .com/cytokine
Cloning and sequence analysis of Peromyscus yucatanicus (Rodentia) Th1(IL-12p35, IFN-c and TNF) and Th2 (IL-4, IL-10 and TGF-b) cytokines
1043-4666/$ - see front matter � 2013 Published by Elsevier Ltd.http://dx.doi.org/10.1016/j.cyto.2013.09.006
Abbreviations: IL, interleukin; CL, cutaneous leishmaniasis; NO, nitric oxide;iNOS, inducible nitric oxide synthase; IFN-c, interferon gamma; TNF, tumornecrosis factor; TGF-b, transforming growth factor beta; mRNA, messenger RNA;cDNA, complementary DNA, RT-PCR reverse transcription polymerase chain reac-tion; nt, nucleotide; FBS, fetal bovine serum; NCBI, National Center for Biotechnol-ogy Information.⇑ Corresponding author. Tel.: +52 999 924 6412x1155; fax: +52 999 923 6120.
E-mail addresses: [email protected] (E.N. Loria-Cervera), [email protected] (E.I. Sosa-Bibiano), [email protected] (L.E. Villanueva-Lizama),[email protected] (N.R. Van Wynsberghe), [email protected] (T. Schountz),[email protected] (F.J. Andrade-Narvaez).
1 Tel.: +52 999 924 6412; fax: +52 999 923 6120.2 Tel.: +1 970 491 7350; fax: +1 970 491 8323.3 These authors contributed equally to this work.
Elsy Nalleli Loria-Cervera a,⇑,1,3, Erika Ivett Sosa-Bibiano a,1,3, Liliana Estefania Villanueva-Lizama a,1,3,Nicole Raymonde Van Wynsberghe a,1,3, Tony Schountz b,2,3, Fernando Jose Andrade-Narvaez a,1,3
a Universidad Autonoma de Yucatan, Centro de Investigaciones Regionales ‘‘Dr. Hideyo Noguchi’’, Laboratorio de Inmunologia, Ave. Itzaes No. 490 x 59-A, Merida, Yucatan, Mexicob Arthropod-Borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, CO 80523, USA
a r t i c l e i n f o
Article history:Received 11 June 2013Received in revised form 22 August 2013Accepted 4 September 2013Available online 10 October 2013
Keywords:Peromyscus yucatanicusTh1/Th2 cytokinesLeishmania
a b s t r a c t
The Yucatan deer mouse, Peromyscus yucatanicus (order Rodentia), is the principal reservoir of Leishmania(Leishmania) mexicana in the Yucatan peninsula of Mexico. Experimental infection results in clinical andhistopathological features similar to those observed in humans with cutaneous leishmaniasis (CL) as wellas peritoneal macrophage production of nitric oxide. These results support the possible use of P. yucata-nicus as a novel experimental model to study CL caused by L. (L.) mexicana. However, immunologicalstudies in these rodents have been limited by the lack of specific reagents. To address this issue, wecloned and analyzed cytokine sequences of P. yucatanicus as part of an effort to develop this species asa CL model. We cloned P. yucatanicus interleukin 4 (IL-4), IL-10, IL-12p35, gamma interferon, transform-ing growth factor beta and tumor necrosis factor partial cDNAs. Most of the P. yucatanicus sequences werehighly conserved with orthologs of other mammalian species and the identity of all sequences were con-firmed by the presence of conserved amino acids with possible biological functions in each putative poly-peptide. The availability of these sequences is a first step which will allow us to carry out studiescharacterizing the immune response during pathogenic and nonpathogenic L. (L.) mexicana infectionsin P. yucatanicus.
� 2013 Published by Elsevier Ltd.
1. Introduction
Leishmaniasis, one of the worlds most neglected diseases, is en-demic in 98 countries with an estimated incidence of 0.2–0.4 mil-lion of visceral leishmaniasis cases (VL) and 0.7–1.2 million ofcutaneous leishmaniasis (CL) cases each year [1,2].
In the Yucatan peninsula, CL caused by Leishmania (Leishmania)mexicana Biagi, 1953, emend. Garham, 1962, is a typical wild zoo-nosis restricted to the tropical forest; and human is only acciden-
tally involved [3,4]. Infection with L. (L.) mexicana may besubclinical (19.8%) or manifest clinically (0.5%) as a single ulcermostly located on the ear lobe, which may persist for months toyears or heal spontaneously [5–7].
Experimental infection in the murine model with L. (L.) majorhas constituted the principal model to understand the immunolog-ical mechanisms that occur during the cell-mediated response toLeishmania [8]. In this model of infection, resistance and suscepti-bility are strongly related to the development of polarized CD4+
Th1 and Th2 responses, respectively [9]. Resolution of lesions inC57BL/6 mice requires the production of interleukin 12 (IL-12),which is implicated in the early establishment of Th1 cells produc-ing gamma interferon (IFN-c) and tumor necrosis factor (TNF) [10–12]. These cytokines constitute the most efficient mechanism ofparasite destruction through the induction of nitric oxide (NO)[12]. In contrast, non-healing of Leishmania infection in BALB/cmice has been associated with the production of anti-inflamma-tory cytokines such as interleukin 4 (IL-4), IL-10 and transforminggrowth factor (TGF-b) which favor the growth of Leishmania para-sites inside of macrophages [13].
Profound differences in the immune mechanism that mediatesusceptibility/resistance in this mouse model have been identified
E.N. Loria-Cervera et al. / Cytokine 65 (2014) 48–55 49
when using other Leishmania species, particularly L. (L.) amazonen-sis and L. (L.) mexicana [14]. Moreover, in human leishmaniasis thedichotomy between Th1 and Th2 responses related to resistance orsusceptibility is less striking. The analysis of the cytokine geneexpression profile in chronic lesions of patients with CL causedby L. (L.) mexicana revealed the concomitant expression of TNF,IL-10 and TGF-b [15]. Similarly, the expression of both mRNAsfor IL-10 and IL-12 was found in lesions of individuals with activeCL [16].
These significant differences between human and the labora-tory mouse (Mus musculus) immune response demonstrate theneed for a new model that faithfully recapitulate the pathologicalfeatures and the immunological responses observed in humanswhen infected with Leishmania. A new approach to study host-par-asite relationships is the use of wild species as animal models [17].Mice of the genus Peromyscus represent an emerging system forthe study of human infectious diseases and ecological niche adap-tation. These outbred animals are highly polymorphic, like hu-mans, and provide an opportunity to combine laboratory studieswith natural genetic variation found in wild populations [18].
Peromyscus yucatanicus is the main natural host of L. (L.) mexica-na in the Yucatan peninsula [19]. Recently, the possibility to useP. yucatanicus as a novel experimental model to study CL causedby L. (L.) mexicana has been supported by the observation of highlysimilar clinical and histopathological features to those caused bythe same parasite in humans [20]. Moreover, NO production has al-ready been induced and determined by co-culturing peritonealmacrophages and lymphocytes from P. yucatanicus infected withL. (L.) mexicana; however, as is typical in a reservoir host, these ro-dents were unable to clear parasite infection [21]. The immune re-sponse in infected P. yucatanicus is unknown because no specificreagents are available. Most monoclonal antibodies to M. musculuscytokines do not cross-react with Peromyscus orthologs [22, Scho-untz T, unpublished observations]. Thus, the aim of this study wasto develop the tools for future analysis of cytokine expression inP. yucatanicus. We amplified Th1 (IL-12p35, INF-c and TNF) andTh2 (IL-4, IL-10 and TGF-b) cytokines from mRNA of P. yucatanicussplenocytes using Peromyscus maniculatus primers. Then, wecloned and analyzed the sequences of these partial cDNAs. Thiswork will allow us to assess the immune response duringpathogenic and nonpathogenic L. (L.) mexicana infections inP. yucatanicus.
2. Materials and methods
2.1. Animals
P. yucatanicus from 6 to 18 months old of both sexes were ob-tained from the colony established in our laboratory. The micewere housed individually in small cages (19 � 29 � 12 cm) linedwith wood shavings and fed at libitum with rodent chow (2018SHarlan, Wisconsin). Animals were kept at 22 �C with a 12/12 h lightcycle. Physical enrichment was provided weekly in form of card-board tubes for hiding and paper for nesting material. Animalswere handled according to the Mexican Law for the use of labora-tory animals [23], and the Guide for the Care and Use of LaboratoryAnimals [24].
2.2. Spleen cell culture
P. yucatanicus spleen cells were isolated by maceration with asyringe plunger in a cotton mesh and washed three times inRPMI-1640 (Roswell Park Memorial Institute medium by Gibco).Red blood cells were depleted by treatment with 5 mL of lysis solu-tion (NH4Cl 0.15 M, Na2EDTA 0.1 M and KHCO3) for 5 min. Spleno-
cytes were cultured in 5% FBS RPMI-1640 containing 5 lg/mL ofconcanavalin A (Con A [Cat# 234567]) CALBIOCHEM) in a 5% CO2
atmosphere at 37 �C for 72 h.
2.3. RNA extraction
Total RNA was isolated from stimulated spleen cells using TRI-zol Reagent (Invitrogen), followed by a precipitation step with iso-propanol. Samples were washed in 75% and 100% ethanol, air driedat room temperature and eluted in sterile water. RNA integrity wasmonitored by electrophoresis in 2% agarose gel containing ethi-dium bromide (5 lg/mL). RNA was stored at �70 �C until used.
2.4. Reverse transcription-polymerase chain reaction
Two micrograms of total RNA were reverse transcribed intocDNA using 10 U/lL of Moloney murine leukemia virus reversetranscriptase (Invitrogen) and oligo dT primers. Partial cDNAs wereamplified using P. maniculatus primers (Table 1). Polymerase chainreaction was performed with 100 ng of cDNA using PCR supermix(Invitrogen) with primers at 4 lM. Amplification was done at 94 �Cfor 30 s, 58 �C for 30 s and 72 �C for 1 min during 35 cycles with afinal extension of 72 �C for 10 min. For IL-12p35 and IL-4 a previ-ous amplification of 5 cycles at 94 �C for 30 s, 52 �C for 30 s and72 �C for 1 min was used. PCR products were visualized on 2% aga-rose gels stained with ethidium bromide.
2.5. Cloning of PCR products
Amplification products were cloned by ligation into pCR�2.1plasmid (Invitrogen) and transformed into Escherichia coli DH5acells according to the manufacturers instructions. Five white colo-nies were picked from each transformation and screened by PCR toverify that the plasmids contained the appropriate inserts. Selectedcolonies were grown in LB containing 50 lg/mL of ampicillin. Plas-mids were purified using a High Pure Plasmid Isolation kit (Roche).
2.6. Sequence analysis
The DNA inserts were sequenced with vector-specific primersand an automated, fluorescent DNA sequencer. The resulting se-quences were identified by a search of the NCBI databases usingBLAST. Sequences of IL-10 [KF150709], IFN-c [HQ696917.1], TNF[JX974722.1] and TGF-b [JX974723.1] were deposited into Gen-bank. Prediction of amino acid sequences was made using the openreading frame finder from NCBI. Clustal Omega algorithm was usedfor amino acid multiple alignment among P. yucatanicus, P. mani-culatus, M. musculus, Rattus norvegicus and human ortholog se-quences. The presence of conserved amino acids with possiblebiological functions was identified in each putative protein, usingUniprot database.
3. Results
P. yucatanicus partial genes corresponding to Th1 (IL-12p35,INF-c and TNF) and Th2 (IL-4, IL-10 and TGF-b) cytokines wereamplified by RT-PCR using P. maniculatus primers. All ampliconswere of the expected size based upon the P. maniculatus sequences.The cDNAs obtained were cloned after amplification and sequenceswere compared to the published deer mouse (P. maniculatus),house mouse (M. musculus), brown rat (Rattus norvegicus) and hu-man (Homo sapiens) sequences. The percentages of homology (Ta-ble 2) found among the sequences analyzed and conserved aminoacids with possible biological functions are described below.
Table 1Primer sequences used to cloned partial cytokine cDNAs from P. yucatanicus.
Cytokine Forwarda Reverse
IL-4 CCCCGTGCTTGAAGAACAATTC GGACTCATTCCCAGTACAGCTTTTCIL-10 AGCCAGACCTACACGCTTCG GATGTCAAACTCACTCATGGIL-12p35 CACCTCAGTTTGGCCAGGGC TTCAGTGTGCTGGTTTTCTCTCCIFN-c GGACGGTGATATAAAAATCATTGAG GAGGCTATTTTTTGGCGACAGGTNF GCGACGTAGAACTGGCAGAGG CTGCGAAGTCTAGGTATTTGGTGF-b ACCACCTGTTGTGGTCCAAG GGGAACAGGATACTGGTTGG
a All sequences are listed 50 to 30 .
Table 2Sequence identities among deer mouse, house mouse, rat and human cytokines.
Cytokine % Nucletide (% amino acid) identity
Pyuc/Deer mice Pyuc/Mouse Pyuc/Rat Pyuc/Human
IL-4 98(96) 70(54) 74(54) (27)IL-10 97(90) 92(86) 92(89) 86(76)IL-12p35 97(97) 80(62) 79(60) 74(57)IFN-c 98(98) 72(51) 71(51) (54)TGF-b 98(98) 93(97) 95(98) 85(84)TNF 97(99) 88(87) 87(84) 82(76)
The sequence identities shown here are for the portions of the sequence corre-sponding to the P. yucatanicus cDNAs. The amino acid sequences were deducedfrom the nucleotide sequence using the open reading frame finder from NCBI.
50 E.N. Loria-Cervera et al. / Cytokine 65 (2014) 48–55
3.1. IL-4
The IL-4 fragment was 108 nucleotides (nt) in length. The se-quence obtained shared 98% of nucleotide identity with deermouse, 70% with house mouse and 74% with brown rat. Identitywith human sequence only was found to the amino acid level.The cloned cDNA encoded for a 33 amino acid portion of theP. yucatanicus IL-4 which represents 22% and 23% of the deermouse and house mouse coding regions, respectively. The polypep-tide shared 96% identity to deer mouse IL-4. Moreover, it possessed54% identity and 70% similarity to the house mouse sequence andwas 27% identical and 73% similar to human protein. The humanIL-4 polypeptide had seven consecutive amino acids not found inthe other species. The two asparagine residues, which are potentialglycosylation sites in the house mouse protein, were conserved inP. yucatanicus sequence (Fig. 1).
3.2. IL-10
The IL-10 fragment was 393 nt and shared 97% identity withdeer mice and 92% with house mouse and brown rat. The encoded131 residues lacked the first 33 amino acids (18 of which are the
Fig. 1. Amino acid alignment of IL-4 sequences. The alignment of the deduced amino amouse (Pman), house mouse (Mus), brown rat (Rattus) and human (Homo) homologs arefollows: Pman, ABE03016.1; Mus, AAK52901.1; Rattus, AAR87867.1; Homo, AAH70123.1Identical amino acids are represented with an asterisk, similar amino acids with a colonindicated by a dagger (�).
putative signal peptide in the orthologous proteins) and repre-sented approximately 74% of the coding region found in the housemouse (Fig. 2). The predicted amino acid sequence shared 90%identity with deer mice and was 86% identical and 95% similar tohouse mouse sequence. P. yucatanicus IL-10 shared 76% identityand 89% similarity with their human ortholog. The fragment pos-sessed the last three conserved cysteine residues required forintrachain disulfide bond formation and an asparagine which is apossible glycosylation site [25].
3.3. IL-12p35
The cloned IL-12p35 fragment was 185 nt and shared 97% iden-tity with deer mouse. The deduced polypeptide sequence was 58amino acids and represents 27% of the coding region. It shared97% identity with deer mouse and possessed 62% identity and81% similarity with house mouse polypeptide. The human IL-12p35 sequence had four consecutive residues not found in the ro-dent orthologs. The two cysteine residues, involved in intrachaindisulfide bond formation, were highly conserved in all aligned se-quences [26]. The conserved arginine, which plays a role in theinterchain disulfide bond with p40 subunit, was present inP. yucatanicus IL-12p35 polypeptide (Fig. 3).
3.4. IFN-c
The P. yucatanicus IFN-c fragment was 194 nt and 98% identicalto deer mice nucleotide sequence. Identity with human sequenceonly was found to the amino acid level. This cDNA representednucleotides 63–256 of the deer mice ortholog. The polypeptidewas 65 amino acids and represented approximately 42% of the cod-ing region found in the house mouse protein, including all but 12residues of the IFN-c C-terminus [27]. P. yucatanicus IFN-c shared51% identity and 92% similarity with the house mouse; and was54% identical and 83% similar to human IFN-c. The P. yucatanicus
cid sequences of the cloned P. yucatanicus (Pyuc) IL-4 cDNA with those of the deershown. The Gen Bank accession numbers used in the sequence comparison were as. The sequences were truncated to align with the cloned P. yucatanicus fragment.and the less conserved substitutions with a dot. Conserved asparagine residues are
Fig. 2. Amino acid alignment of IL-10 sequences. The alignment of the deduced amino acid sequences of the cloned P. yucatanicus (Pyuc) IL-10 cDNA with those of the deermouse (Pman), house mouse (Mus), brown rat (Rattus) and human (Homo) homologs are shown. The Gen Bank accession numbers used in the sequence comparison were asfollows: Pman, AAG30263.1; Mus, NP034678.1; Rattus, CAA43090.1; Homo, CAG46825.1. Identical amino acids are represented with an asterisk, similar amino acids with acolon and the less conserved substitutions with a dot. Conserved cysteine residues are indicated by a double dagger (�) and the conserve asparagine by a dagger (�).
Fig. 3. Amino acid alignment of IL-12p35 sequences. The alignment of the deduced amino acid sequences of the cloned P. yucatanicus (Pyuc) IL-12p35 cDNA with those of thedeer mouse (Pman), house mouse (Mus), brown rat (Rattus) and human (Homo) homologs are shown. The Gen Bank accession numbers used in the sequence comparison wereas follows: Pman, AAP04422.1; Mus, AAF22551.1; Rattus, EDM00915.1; Homo, EAW78658.1. The sequences were truncated to align with the cloned P. yucatanicus fragment.Identical amino acids are represented with an asterisk, similar amino acids with a colon and the less conserved substitutions with a dot. Conserved cysteine residues areindicated by a double dagger (�) and the conserve arginine by a diamond (e).
E.N. Loria-Cervera et al. / Cytokine 65 (2014) 48–55 51
C-terminal region shared 56% identity and 89% similarity to thehouse mouse region (Fig. 4).
3.5. TGF-b
The cloned TGF-b fragment was 750 nt in length and shared 98%identity with deer mouse and 93% with house mouse nucleotidesequences. The cDNA encoded for a 246 amino acid precursorwhich represented nucleotides 38-282 of the house mouse and63% of its coding region [28]. The predicted TGF-b polypeptidehad the highest level of homology with their orthologs. It shared97% identity with the house mouse and possessed 84% identityand 91% similarity with human TGF-b. The RGD domain involvedin the cell attachment and the three conserved asparagines whichare potential glycosylation sites are present in TGF-b P. yucatanicussequence (Fig. 5).
3.6. TNF
The 668 nt cDNA fragment of TNF shared 97% identity with deermouse, 88% with house mouse and 82% with human nucleotide se-quence. The 216 amino acid sequence represented 92% of thehouse mouse coding region and shared 99% and 84% with deermouse and brown rat proteins, respectively (Fig. 6). The P. yucata-nicus TNF polypeptide possessed nine of 20 amino acids of the sig-
nal sequence, which are highly conserved in all aligned sequencesand included consecutive hydrophobic residues which is thoughtto be the transmembrane domain [29]. The polypeptide was 87%identical and 94% similar to house mouse TNF. The deduced aminoacid sequence contained 95% of the soluble polypeptide which is77% identical and 89% similar to human TNF [30]. The sequencepossessed two conserved cysteines that form intrachain disulfidebonds and a histidine residue which is required for cytotoxic activ-ity [31,32].
4. Discussion
Recently, we have suggested the use of P. yucatanicus as a novelexperimental model to study CL cause by L. (L.) mexicana [20].These wild cricetid rodents develop lesions with clinical and histo-pathological picture as observed in human patients and produceNO when infected with L. (L.) mexicana [20,21]. However immuno-logical studies in P. yucatanicus have been limited by the lack ofspecific reagents. In the present study, we targeted the mostimportant cytokines involved in the immune response to L. (L.)mexicana in murine models. We described for the first time cloningand sequence analysis of the P. yucatanicus IL-4, IL-10, IL-12p35,IFN-c, TNF and TGF-b cDNAs, as a first step towards to the charac-terization of the immune response during pathogenic and non-pathogenic L. (L.) mexicana infections in P. yucatanicus.
Fig. 4. Amino acid alignment of IFN-c sequences. The alignment of the deduced amino acid sequences of the cloned P. yucatanicus (Pyuc) IFN-c cDNA with those of the deermouse (Pman), house mouse (Mus), brown rat (Rattus) and human (Homo) homologs are shown. The Gen Bank accession numbers used in the sequence comparison were asfollows: Pman, AAG30262.1; Mus, ACR22511.1; Rattus, NP620235.1; Homo, NP000610.2. The sequences were truncated to align with the cloned P. yucatanicus fragment.Identical amino acids are represented with an asterisk, similar amino acids with a colon and the less conserved substitutions with a dot. The line represents the C-terminalregion involved with receptor binding in the house mouse.
Fig. 5. Amino acid alignment of TGF-b sequences. The alignment of the deduced amino acid sequences of the cloned P. yucatanicus (Pyuc) TGF-b cDNA with those of the deermouse (Pman), house mouse (Mus), brown rat (Rattus) and human (Homo) homologs are shown. The Gen Bank accession numbers used in the sequence comparison were asfollows: Pman, AAR21579.1 ; Mus, NP_035707.1 ; Rattus, NP_067589.1; Homo, NP_000651.3. Identical amino acids are represented with an asterisk, similar amino acids witha colon and the less conserved substitutions with a dot. Conserved asparagine residues are indicated by a dagger (�). The line represents the RGD domain which is involved incell attachment.
52 E.N. Loria-Cervera et al. / Cytokine 65 (2014) 48–55
The cloned P. yucatanicus cDNAs showed the greatest homology(over 90%), at both nucleotide and amino acid level, to P. manicul-atus sequences [33,34]. The fact that these two species belong tosame Peromyscus genus (family: Cricetidae) and shared high-sequence homology allowed us to amplify P. yucatanicus cytokinesusing already existing P. maniculatus primers. Thus, we confirmedthat P. maniculatus primers could be used for future examinationsof cytokine expression in P. yucatanicus infected by L. (L.) mexicana
and potentially for the study of immune response to a variety ofinfectious diseases in other members of the Cricetidae family. Theevolutionary distance (�50 million years ago) between Muridae(such as Mus and Rattus) and Cricetidae rodents [35] highlightthe need to develop the immunological tools such as primers, anti-bodies and T-cell lines which could facilitate the use of P. yucatani-cus as a model of CL caused by L. (L.) mexicana. Thus, in this workwe took advantage of the availability of P. maniculatus primers,
Fig. 6. Amino acid alignment of TNF sequences. The alignment of the deduced amino acid sequences of the cloned P. yucatanicus (Pyuc) TNF cDNA with those of the deermouse (Pman), house mouse (Mus), rat (Rattus) and human (Homo) homologs are shown. The Gen Bank accession numbers used in the sequence comparison were as follows:Pman, AAG30264.1; Mus, AAB65593.1; Rattus, ADV31545.1; Homo, ACO37640.1. Identical amino acids are represented with an asterisk, similar amino acids with a colon andthe less conserved substitutions with a dot. Conserved cysteine residues are indicated by a double dagger (�) and the conserve histidine by a square (h). (A) the portion of theleader peptide. (B) the putative transmembrane domain.
E.N. Loria-Cervera et al. / Cytokine 65 (2014) 48–55 53
designed for amplifying cytokines involve in the infection with SinNombre virus, as a strategy to clone and sequence P. yucatanicusorthologs.
Interleukin-4 is a 17 kDa monomeric glycoprotein with immu-noregulatory functions, mainly secreted by Th2 cells, mast cellsand basophils [36]. In murine cutaneous leishmaniasis IL-4 hasan important role in the development of a Th2 response and sus-ceptibility to Leishmania (L.) major [37]. However, the role of IL-4in human leishmaniasis progression remains controversial [38].Analysis of the deduced amino acid sequence revealed that IL-4had substantially less homology to the mouse, rat and human pro-teins compared with the other cytokines analyzed in this study.This low degree of sequence homology of IL-4 between Muridaeand human has previously been reported [39–42]. Previous studieshave remarked that IL-4 and IL-4 receptor alpha (IL4Ra) have expe-rienced recent episodes of diversifying selection; however this ge-netic variation is functionally neutral with respect to both IL4Rabinding and signaling [43].
Interleukin-10, a cytokine with anti-inflammatory properties,is produced by activated macrophages, dendritic cells, Th2 andT regulatory cells [44]. During Leishmania infection, IL-10 has arole in disease progression and parasite persistence in susceptiblemice [45,46]. Although IL-10 has been closely related to lesionchronicity in different clinical presentations of human leishman-iasis, its production has been associated to the control of the im-mune response and the prevention of skin tissue damage insubclinical Leishmania infection [47–50]. The important role ofIL-10 in regulation of the immune response makes the studyof this cytokine important to understand the immunopathologyof leishmaniasis. In this work, we cloned most of the codingregion of P. yucatanicus IL-10. The high level of homology withhouse mouse and human proteins and the identification ofresidues with important biological functions confirm the identityof P. yucatanicus IL-10 cDNA.
Interleukin-12 is a heterodimeric pro-inflammatory cytokinethat induces the production of interferon-c (IFN-c) favouring thedifferentiation of Th1 cells and forming a link between innateresistance and adaptive immunity [51]. In resistant mice infectedwith L. (L.) major, IL-12 is crucial in protective immunity and main-tenance of Th1 response [10,52]. The administration of recombi-nant IL-12 to susceptible animals is enough to render themresistant to L. (L.) major infection [53]. In humans, the expressionof IL-12 mRNA has been observed in chronic CL lesions, indicatingthat the expression of this cytokine alone was not sufficient to in-duce healing [16]. To investigate the role of IL-12 in the outcome ofdisease in P. yucatanicus infected by L. (L.) mexicana, we clonedpartial cDNA of IL-12p35 (subunit alpha). The identification of anarginine, which plays a role in the interchain disulfide bond withIL-12p40 (subunit beta), confirms the sequence identity of theP. yucatanicus cloned IL-12p35 cDNA.
The IFN-c is responsible for macrophage activation leading toleishmanicidal mechanisms. In resistant mice, IFN-c stimulatesthe expression of iNOS, which induces the production of NO, a po-tent cytotoxin involved in the killing of Leishmania parasites [12].Similarly, IFN-c increases the leishmanicidal activity in humanmacrophages. Peripheral blood mononuclear cells from CL patientswith active lesions and/or scars produced large amounts of IFN-cin response to soluble leishmanial antigen, whereas no or lowIFN-c production was observed in non-healing donors [54]. Thefragment of IFN-c that we cloned encoded most of the C-terminaland N-terminal a helices, regions which are involved in the bind-ing to IFN-c receptor in the house mouse [27].
The TGF-b is a homodimeric cytokine with diverse effects oncells of the immune system, including down-regulation of certainmacrophage functions [55]. The TGF-b has been associated withsusceptibility to experimental Leishmania infection [56]. Becauseof their inhibitory effect on macrophage function, the expressionof TGF-b may play a role in the immunopathogenesis of chronic
54 E.N. Loria-Cervera et al. / Cytokine 65 (2014) 48–55
CL in humans [15]. Some studies have suggested an important roleof TGF-b in human leishmaniasis through its effects of enhancingparasite survival in the early stages of the disease [57,58]. We clonethe cDNA that includes most of the coding region of TGF-b fromP. yucatanicus. This cytokine showed the highest homology to thehouse mouse and human proteins. This high level of homologyhas been observed between human and murine TGF-b polypeptidesequences. This striking sequence conservation suggests a strongevolutionary pressure and may suggest that all parts of the mole-cule are essential for the cytokine biological activities [28].
The TNF plays a protective role in experimental murine CLthrough enhancement of macrophage leishmanicidal activity med-iated by nitric oxide production [59]. In contrast, elevated TNF le-vel in human CL, mainly in severe cutaneous and mucocutaneouscases, suggests that overproduction of this cytokine could be re-lated to damage tissue and aggravation of the disease [38,60]. Thiscytokine is primarily produced as a type II transmembrane proteinarranged in stable homotrimers. The active form of this cytokine isreleased via proteolytic cleavage by a metalloprotease [61]. ThecDNA of TNF from P. yucatanicus encoded part of the signal peptideand the transmembrane domain of the cytokine which were highlyconserved.
In general, we found a high degree of homology in the aminoacid sequences of P. yucatanicus cytokines compared to theirorthologous proteins. Moreover, we identified the presence of con-served amino acids with possible biological function which con-firmed the identity of the sequences cloned in this work. Theavailability of these sequences will permit future examination ofthe immune response during pathogenic and nonpathogenicL. (L.) mexicana infections in its reservoir species, P. yucatanicus.
Although the laboratory house mouse model of CL is consideredto be the best immunological model for the study of Leishmaniainfection (i. e., the role of cytokines in the outcome of the disease),it presents a series of significant differences in relation to humandisease limiting the possibility of extrapolations. Laboratory stud-ies using the natural host, P. yucatanicus, could provide a suitableindication of their importance as L. (L.) mexicana reservoir and al-lowed us to develop a CL model that more closely resembles hu-man infections. This experimental model may be moreappropriated for studying the host-pathogen relationships and im-mune response against L. (L.) mexicana infection. Importantly, con-sidering the substantial genetic similarities between P. yucatanicusand P. maniculatus, the rapid development of molecular assays ispossible for understanding leishmanial infection of Yucatan deermice experimental model, since the deer mouse genome is avail-able and software to exploit it has recently been developed [62].
5. Conclusion
We have cloned P. yucatanicus IL-4, IL-10, IL-12p35, IFN-c, TGF-b and TNF partial cDNAs. This work will allow analyzing cytokinemRNA expression in P. yucatanicus infected by L. (L.) mexicanaand as so advancing in the creation of a new experimental model.A sound CL model is essential to identify possible targets for drugtherapy for human CL, and to evaluate vaccine candidates.
Acknowledgments
We are grateful to Dra. Karla Acosta Vianna for her continuinghelp during the experiment and to the personnel from the animalhousing facilities of the ‘‘Centro de Investigaciones Regionales Dr.Hideyo Noguchi’’ of the‘‘Universidad Autónoma de Yucatán’’ fortheir valuable work. This work was supported by funds WHO, Reg-istration 22818-0.
References
[1] World Health Organization: Report of a meeting of the WHO ExpertCommittee on the Control of Leishmaniases, Geneva, 22-26 March 2010.[http://apps.who.int/iris/bitstream/10665/44412/1/WHO_TRS_949_eng.pdf].
[2] Alvar J, Velez ID, Bern C, Herrero M, Desjeux P, Cano J, et al. Leishmaniasisworldwide and global estimates of its incidence. PLoS ONE 2012;7:e35671.
[3] Canto-Lara SB, Cardenas-Marrufo MF, Vargas-Gonzalez A, Andrade-Narvaez F.Isoenzyme characterization of Leishmania isolated from human cases withLocalized Cutaneous Leishmaniasis from the State of Campeche, YucatanPeninsula, Mexico. Am J Trop Med Hyg 1998;58:444–7.
[4] Andrade-Narvaez FJ, Canto-Lara SB, Van Wynsberge NR, Rebollar Tellez EA,Vargas-Gonzalez A, Albertos-Alpuche NE. Seasonal transmission of Leishmania(Leishmania) mexicana in the state of Campeche, Yucatan Peninsula, Mexico.Mem Inst Oswaldo Cruz 2003;98:995–8.
[5] Andrade-Narvaez FJ, Simmonds-Diaz E, Aguilar-Rico S, Andrade-Narvaez M,Palomo-Cetina A, Canto-Lara SB, et al. Incidence of localized cutaneousleishmaniasis (chiclero’s ulcer) in Mexico. Trans R Soc Trop Med Hyg1990;84:219–20.
[6] Arjona-Villicaña RD. Prevalencia de infección subclínica por Leishmania en unapoblación de alto riesgo de leishmaniosis cutánea en el estado de Campeche.MD thesis. Universidad Autónoma de Yucatán; 2002.
[7] Andrade-Narvaez FJ, Vargas-Gonzalez A, Canto-Lara SB, Damian-Centeno AG.Clinical picture of cutaneous Leishmaniases due to Leishmania (Leishmania)mexicana in the Yucatan Peninsula, Mexico. Mem Inst Oswaldo Cruz2001;96:163–7.
[8] Gumy A, Louis JA, Launois P. The murine model of infection with Leishmaniamajor and its importance for the deciphering of mechanisms underlyingdifferences in Th cell differentiation in mice from different geneticbackgrounds. Int J Parasitol 2004;34:433–44.
[9] Aguilar-Torrentera F, Carlier Y. Immunological factors governing resistanceand susceptibility of mice to Leishmania major infection. Rev LatinoamMicrobiol 2001;43:135–42.
[10] Mattner F, di Padova K, Alber G. Interleukin-12 is indispensable for protectiveimmunity against Leishmania major. Infect Immun 1997;65:4378–83.
[11] Seder RA, Gazzinelli R, Sher A, Paul WE. Interleukin 12 acts directly on CD4+ Tcells to enhance priming for interferon c production and diminishesinterleukin-4 inhibition of such priming. Proc Natl Acad Sci1993;90:10188–92.
[12] Liew FY, Li Y, Millott S. Tumor necrosis factor-a synergizes with IFN-gamma inmediating killing of Leishmania major through the induction of nitric oxide. JImmunol 1990;145:4306–10.
[13] Sacks D, Noben-Trauth N. The immunology of susceptibility and resistance toLeishmania major in mice. Nat Rev Immunol 2002;2:845–58.
[14] McMahon-Pratt D, Alexander J. Does the Leishmania major paradigm ofpathogenesis and protection hold for New World cutaneous leishmaniasesor the visceral disease? Immunol Rev 2004;201:204–24.
[15] Melby PC, Andrade-Narvaez FJ, Darnell BJ, Valencia-Pacheco G, Tryon VV,Palomo-Cetina A. Increased expression of proinflammatory cytokines inchronic lesions of human cutaneous leishmaniasis. Infect Immun1994;62:837–42.
[16] Melby PC, Andrade-Narvaez FJ, Darnell BJ, Valencia-Pacheco G. In situexpression of interleukin-10 and interleukin-12 in active human cutaneousleishmaniasis. FEMS Immunol Med Microbiol 1996;15:101–7.
[17] Guenet JL, Bonhomme F. Wild mice: an ever-increasing contribution to apopular mammalian model. Trends Genet 2003;19:24–31.
[18] Dewey MJ, Dawson WD. Deer mice: ‘‘The drosophila of North Americanmammalogy’’. Genesis 2001;29:105–9.
[19] Van Wynsberghe NR, Canto-Lara SB, Damian-Centeno AG, Itza-Ortiz M,Andrade-Narvaez FJ. Retention of Leishmania (Leishmania) mexicana innaturally infected rodents from the State of Campeche, Mexico. Mem InstOswaldo Cruz 2000;95:595–600.
[20] Sosa-Bibiano EI, Van Wynsberghe NR, Canto-Lara SB, Andrade-Narvaez FJ.Preliminary study towards a novel experimental model to study localizedcutaneous leishmaniasis caused by Leishmania (Leishmania) mexicana. Rev InstMed Trop Sao Paulo 2012;54:165–9.
[21] Loria-Cervera EN, Sosa-Bibiano EI, Villanueva-Lizama LE, Van Wynsberghe NR,Canto-Lara SB, Batun-Cutz JL, et al. Nitric oxide production by Peromyscusyucatanicus (Rodentia) infected with Leishmania (Leishmania) mexicana. MemInst Oswaldo Cruz 2013;108:172–7.
[22] Vaughn J, Schountz T. Discrimination of Peromyscus maniculatus leucocytes byflow cytometry. BIOS 2003;74:79–86.
[23] Norma Oficial Mexicana: NOM-062-ZOO-1999, Especificaciones técnicas parala producción, cuidado y uso de los animales de laboratorio [fmvz.unam.mx/fmvz/principal/archivos/062ZOO.PDF].
[24] National Research Council: Guide for the Care and Use of Laboratory Animals.Institute of Laboratory Animal Resources; 1996 [nap.edu/openbook.php?record_id=5140].
[25] Windsor WT, Syto R, Tsarbopoulos A, Zhang R, Durkin J, Baldwin S, et al.Disulfide bond assignments and secondary structure analysis of human andmurine interleukin 10. Biochemistry 1993;32:8807–15.
[26] Yoon C, Johnston SC, Tang J, Stahl M, Tobin JF, Somers WS. Charged residuesdominate a unique interlocking topography in the heterodimeric cytokineinterleukin-12. EMBO J 2000;19:3530–41.
E.N. Loria-Cervera et al. / Cytokine 65 (2014) 48–55 55
[27] Griggs ND, Jarpe MA, Pace JL, Russell SW, Johnson HM. The N-terminus andC-terminus of IFN-gamma are binding domains for cloned solubleIFN-gamma receptor. J Immunol 1992;149:517–20.
[28] Derynck R, Jarrett JA, Chen EY, Goeddel DV. The murine transforming growthfactor-b precursor. J Biol Chem 1986;261:4377–9.
[29] Pennica D, Hayflick JS, Bringman TS, Palladino MA, Goeddel DV. Cloning andexpression in Escherichia coli of the cDNA for murine tumor necrosis factor.Proc Natl Acad Sci USA 1985;82:6060–4.
[30] Pennica D, Nedwin GE, Hayflick JS, Seeburg PH, Derynck R, Palladino MA, et al.Human tumour necrosis factor: precursor structure, expression and homologyto lymphotoxin. Nature 1984;312:724–9.
[31] Narachi MA, Davis JM, Hsu YR, Arakawa T. Role of single disulfide inrecombinant human tumor necrosis factor-alpha. J Biol Chem1987;262:13107–10.
[32] Yamamoto R, Wang A, Vitt CR, Lin LS. Histidine-15: an important role in thecytotoxic activity of human tumor necrosis factor. Protein Eng 1989;2:553–8.
[33] Herbst MM, Prescott J, Palmer AD, Schountz T. Sequence and expressionanalysis of deer mouse interferon-c, interleukin-10, tumor necrosis factor, andlymphotoxin-a. Cytokine 2002;17:203–13.
[34] Schountz T, Green R, Davenport B, Buniger A, Richens T, Root JJ, et al. Cloningand characterization of deer mouse (Peromyscus maniculatus) cytokine andchemokine cDNA. BMC Immunol 2004;5:1.
[35] Crew MD, Bates LM, Douglass CA, York JL. Expressed Peromyscus maniculatus(Pema) MHC class I genes: evolutionary implications and the identification of agene encoding a Qa1-like antigen. Immunogenetics 1996;44:177–85.
[36] Brown MA, Hural J. Functions of IL-4 and control of its expression. Crit RevImmunol 1997;17:1–32.
[37] Kopf M, Brombacher F, Köhler G, Kienzle G, Widmann K, Lefrang K, et al. IL-4-deficient Balb/c mice resistant infection with Leishmania major. J Exp Med1996;184:1127–36.
[38] Ribeiro-de-Jesus A, Almeida RP, Lessa H, Bacellar O, Carvalho EM. Cytokineprofile and pathology in human leishmaniasis. Braz J Med Biol Res1998;31:143–8.
[39] Melby P, Tryon V, Chandrasekar V, Freeman G. Cloning of Syrian hamster(Mesocricetus auratus) cytokine cDNAs and analysis of cytokine mRNAexpression in experimental visceral leishmaniasis. Infec Immun1998;66:2135–42.
[40] Otsuka T, Villaret D, Yokota T, Takebe Y, Lee F, Arai N, et al. Structural analysisof the mouse chromosomal gene encoding interleukin 4 which expresses Bcell, T cell and mast cell stimulating activities. Nucleic Acids Res1987;15:333–44.
[41] McKnight AJ, Barclay AN, Mason DW. Molecular cloning of rat interleukin 4cDNA and analysis of the cytokine repertoire of subsets of CD4+ T cells. Eur JImmunol 1991;21:1187–94.
[42] Yokota T, Otsuka T, Mosmann T, Banchereau J, DeFrance T, Blanchard D, et al.Isolation and characterization of a human interleukin cDNA clone, homologousto mouse B-cell stimulatory factor 1, that expresses B-cell- and T-cell-stimulating activities. Proc Natl Acad Sci USA 1986;83:5894–8.
[43] Koyanagi M, Kerns JA, Chung L, Zhang Y, Brown S, Moldoveanu T, et al.Diversifying selection and functional analysis of interleukin-4 suggestsantagonism-driven evolution at receptor-binding interfaces. BMC Evol Biol2010;10:223.
[44] Couper KN, Blount DG, Riley EM. IL-10: the master regulator of immunity toinfection. J Immunol 2008;180:5771–7.
[45] Kane MM, Mosser DM. The role of IL-10 in promoting disease progression inLeishmaniasis. J Immunol 2001;166:1141–7.
[46] Belkaid YKF, Hoffman KF, Mendez S, Kamhawi S, Udey MC, Wynn TA, et al. Therole of interleukin (IL)-10 in the persistence of Leishmania major in the skinafter healing and the therapeutic potential of anti-IL-10 receptor antibody forsterile cure. J Exp Med 2001;194:1497–506.
[47] Ghalib HW, Piuvezam MR, Skeiky YA, Sidding FA, Hashim FA, El-Hassan AM,et al. Interleukin 10 production correlates with pathology in humanLeishmania donovani infections. J Clin Invest 1993;92:324–9.
[48] Anderson CF, Oukka M, Kuchroo VJ, Sacks D. CD4+CD25�Foxp3� Th1 cells arethe source of IL-10-mediated immune suppression in chronic cutaneousleishmaniasis. J Exp Med 2007;204:285–7.
[49] Bittar RC, Nogueira RS, Vieira-Gonçalves R, Pinho-Ribeiro V, Mattos MS,Oliveira-Neto MP, et al. T-cell responses associated with resistance toLeishmania infection in individuals from endemic areas for Leishmania(Viannia) braziliensis. Mem Inst Oswaldo Cruz 2007;102:625–30.
[50] Gomez Silva A, Cássia Bittar R, dos Santo Nogueira R, Amato VS, Oliveira-NetoMP, Coutinho SG, et al. Can interferon-c and interleukin-10 balance beassociated with severity of human Leishmania (Viannia) braziliensis infection.Clin Exp Immunol 2007;149:440–4.
[51] Trinchieri G. Interleukin-12 and the regulation of innate resistance andadaptive immunity. Nat Rev 2003;3:133–46.
[52] Park AY, Hodowicz BD, Kopf M, Scott P. The role of IL-12 in maintainingresistance to Leishmania major. J Immunol 2002;168:5771–7.
[53] Heinzel FP, Schoenhaut DS, Rerko RM, Rosser LE, Gately MK. Recombinantinterleukin 12 cures mice infected with Leishmania major. J Exp Med1993;177:1505–9.
[54] Ajdary S, Alimohammadian MH, Eslami MB, Kemp K, Kharazmi A. Comparisonof the immune profile of nonhealing cutaneous leishmaniasis patients withthose with active lesions and those who have recovered form infection. InfectImmun 2000;68:1760–4.
[55] Li MO, Wan YY, Sanjabi S, Robertson AL, Flavell RA. Transforming growthfactor-b regulation of immune responses. Annu Rev Immunol2006;24:99–146.
[56] Barral-Netto M, Barral A, Brownell CE, Skeiky YAW, Ellingsworth LR, TwardzikDR, et al. Transforming growth factor-b in leishmanial infection: a parasiteescape mechanism. Science 1992;257:545–8.
[57] Barral A, Texeira M, Reis P, Vinhas V, Costa J, Lessa H, et al. Transforminggrowth factor-b in human cutaneous leishmaniasis. Am J Pathol1995;147:947–54.
[58] Gantt KR, Schultz-Cherry S, Rodriguez N, Jeronimo SMB, Nascimento ET,Goldman TL, et al. Activation of TGF-b by Leishmania chagasi: importance forparasite survival in macrophages. J Immunol 2003;170:2613–20.
[59] Liew FY, Li Y, Millott S. Tumor necrosis factor (TNFa) in leishmaniasis. II. TNF-a-induced macrophage leishmanicidal activities mediated by nitric oxide fromL-arginine. Immunology 1990;71:556–9.
[60] Da-Cruz AM, Pereira de Oliveira M, Mello de Luca P, Mendonca SCF, CoutinhoSG. Tumor necrosis factor-a in human American tegumentary leishmaniasis.Mem Inst Oswaldo Cruz 1996;91:225–9.
[61] Vilaek J, Lee TH. Tumor necrosis factor new insights into the molecularmechanisms of its multiple actions. J Biol Chem 1991;266:7313–6.
[62] Schountz T, Shaw TI, Glenn TC, Feldmann H, Prescott J. Expression profiling oflymph node cells from deer mice infected with Andes virus. BMC Immunol2013;14:18.
