Differential Production of MacrophageInflammatory Protein-1a, Stromal-Derived Factor-1, and IL-6 by HumanCultured Periodontal Ligament andGingival Fibroblasts Challenged WithLipopolysaccharide From P. gingivalisAna Carolina F. Morandini,* Carla Renata Sipert,† Thaıs Helena Gasparoto,† Sebastiao Luiz A.Greghi,* Euloir Passanezi,* Maria Lucia R. Rezende,* Adriana P. Sant’ana,* Ana Paula Campanelli,†

Gustavo P. Garlet,† and Carlos F. Santos†

Background: Fibroblasts are considered important cells in periodon-titis. When challenged by different agents, they respond through therelease of cytokines that participate in the inflammatory process. Theaim of this study is to evaluate and compare the expression and produc-tion of macrophage inflammatory protein (MIP)-1a, stromal-derived fac-tor (SDF)-1, and interleukin (IL)-6 by human cultured periodontalligament and gingival fibroblasts challenged with lipopolysaccharide(LPS) from Porphyromonas gingivalis.

Methods: Fibroblasts were cultured from biopsies of gingival tissueand periodontal ligament of the same donors and used on the fourth pas-sage. After confluence in 24-well plates, the culture medium alone (con-trol) or with 0.1 to 10 mg/ml of LPS from P. gingivalis was added to thewells, and after 1, 6, and 24 hours, the supernatant and the cells were col-lected and analyzed by enzyme-linked immunosorbent assay and real-time polymerase chain reaction, respectively.

Results: MIP-1a, SDF-1, and IL-6 protein production was significantlygreater in gingival fibroblasts compared to periodontal ligament fibro-blasts. IL-6 was upregulated in a time-dependent manner, mainly in gin-gival fibroblasts (P <0.05), which secreted more MIP-1a in the lowestconcentration of LPS used (0.1 mg/ml). In contrast, a basal productionof SDF-1 that was inhibited with the increase of LPS concentration wasdetected, especially after 24 hours (P <0.05).

Conclusion: The distinct ability of the gingival and periodontal liga-ment fibroblasts to secrete MIP-1a, SDF-1, and IL-6 emphasizes thatthese cells may differently contribute to the balance of cytokines in theLPS-challenged periodontium. J Periodontol 2010;81:310-317.

KEY WORDS

Cytokines; fibroblasts; periodontitis; Porphyromonas gingivalis.

Periodontal diseases areinfectious diseases, inwhich periodontopath-

ogens trigger chronic in-flammatory and immuneresponses that are thoughtto determine the clinical out-come of the disease.1 The pres-ence of periodontopathogens,such as Porphyromonas gin-givalis (called a red-complexbacterium), is considered themajor etiologic agent in peri-odontitis2 and leads to theexpression of proinflamma-tory cytokines, such as mac-rophage inflammatory protein(MIP)-1a and interleukin (IL)-6, which have been associatedwith the immunopathology ofperiodontitis.3-5 MIP-1a hasan important role in the in-duction and modulation ofinflammatory and immune re-sponses6 because, in an inflam-matory condition in periodontaltissues, cells positive for MIP-1a are more prevalent than

* Department of Prosthodontics, Division of Periodontics, Bauru School of Dentistry, University of SaoPaulo, Bauru, SP, Brazil.

† Department of Biological Sciences, Bauru School of Dentistry, University of Sao Paulo.

doi: 10.1902/jop.2009.090375

Volume 81 • Number 2

310

for other chemokines.7 IL-6 is a pleiotropic cytokinewith a broad range of humoral and cellular immuneeffects related to inflammation, host defense, andtissue injury.8 IL-6 is highly inducible and is pro-duced in response to a number of inflammatorystimuli such as IL-1 and tumor necrosis factor-alpha(TNF-a), bacterial products such as endotoxin andlipopolysaccharides (LPS), and viral infection.9

Stromal-derived factor (SDF)-1 is a chemotacticcytokine for leukocytes including neutrophils, mono-cytes, T and B lymphocytes, and hematopoieticprogenitor cells.10-12 There is evidence that SDF-1production can be decreased during the inflammatoryprocess.13,14 When challenged with LPS from P. gingi-valis, gingival fibroblasts were able to release IL-6.15

However, the inhibition of SDF-1 production by LPSfrom P. gingivalis in human gingival fibroblasts wasreported. This may affect the normal periodontaltissue because it seems that these cells produceSDF-1 constitutively.14 Interestingly, the fibroblastis considered an important cellular component inperiodontitis because it is the predominant cell typein the periodontal connective tissue.16 Its participa-tion in the development, maintenance, and repairof periodontal ligament and gingival connective tis-sues is well recognized.17 Studies14,15,18-33 indicateda role for such a cell in the host immune response, as itwas demonstrated that fibroblasts can secrete vari-ous types of cytokines and chemokines to immune-defense cells.

There is scarce information on the participation offibroblasts from different periodontal regions in theimmunoinflammatory response. In this study, weevaluated and compared the expression and produc-tion of MIP-1a, SDF-1, and IL-6 between periodontalligament and gingival fibroblasts from the samedonors.

MATERIALS AND METHODS

Cell CultureHuman periodontal ligament fibroblasts were grownfrom tissue of the middle third of third molar rootsextracted from healthy donors with their written in-formed consent in accordance with the InstitutionalReview Board of the University of Sao Paulo. Biopsieswere obtained from donors (1 male and 2 females; agerange 16 to 26 years) from August to October 2007.Concurrently, gingival biopsies from clinically non-in-flamed tissue were retrieved from the gingival marginof the same donors. Cells were cultured as previouslydescribed.34 Tissue fragments of periodontal liga-ment and gingiva were individually plated in 100 ·10-mm Petri dishes, allowed to attach to the dishes,and covered with 5 ml Dulbecco’s modified Eagle’smedium‡ supplemented with 10% fetal bovine serum(FBS)§ and antibioticsi (600 ml/mlpenicillin, 300 ml/ml

gentamicin sulfate, and 100 ml/ml amphotericin B).The plates were incubated at 37�C in a humidifiedatmosphere of 5% carbon dioxide for 1 week, afterwhich the medium was decanted and replaced withfresh Dulbecco’s modified Eagle’s medium 10%FBS. Studies from a population of periodontal liga-ment and gingival fibroblasts cultured from each ofthree donors are presented in this article. Each pa-tient’s population of periodontal ligament cells wascompared to the same patient’s population of gingivalfibroblasts at the same passage (fourth passage for allexperiments).

LPS From the P. gingivalis Challenge of HumanCultured Periodontal Ligament andGingival FibroblastsFibroblasts were seeded at a density of 5 · 104 cells/well and incubated in the absence (controls) or pres-ence of 0.1, 1, or 10 mg/ml LPS from P. gingivalis¶ induplicates as previously described.14 After the exper-imental times of 1, 6, or 24 hours, the supernatant andcells were collected and analyzed by enzyme-linkedimmunosorbent assay (ELISA) and real-time poly-merase chain reaction (PCR), respectively.

Real-Time PCRComplementary DNA (cDNA) was synthesized using2 mg RNA through a reverse transcription reaction.#

Real-time PCR for quantitative messenger RNA(mRNA) analysis was performed in a sequence detec-tion system** using a system†† for quantification ofamplicons. The standard PCR conditions were 95�C(10 minutes) and then 40 cycles of 95�C (15 sec-onds), 60�C (1 minute), and a final cycle with an in-creasing temperature from 60�C to 95�C (20 minutes)to obtain a standard denaturation curve. The se-quences of primers were designed using software‡‡

based on nucleotide sequences present in the Gen-Bank database. The primer sequences are describedin Table 1. PCR conditions for the targets were con-scientiously optimized with regard to primer con-centration, absence of primer-dimer formation, andefficiency of amplification of the target gene andhousekeeping gene control (b-actin). A PCR mastermix,§§ specific primers, and 2 ml cDNA were used ineach reaction. The relative levels of gene expressionwere calculated according to instructions in referenceto the b-actin in the sample using the cycle threshold

‡ Invitrogen Life Technologies, Carlsbad, CA.§ Cultilab, Campinas, SP, Brazil.i Invitrogen Life Technologies.¶ Invivogen, San Diego, CA.# Invitrogen Life Technologies.** ABI Prism 5700 Sequence Detection System, Applied Biosystems,

Warrington, U.K.†† SYBR-Green fluorescence quantification system, Applied Biosystems.‡‡ PrimerExpress, Applied Biosystems.§§ SYBR Green PCR Master Mix, Applied Biosystems.

J Periodontol • February 2010 Morandini, Sipert, Gasparoto, et al.

311

method.35 Negative controls without RNA and withoutreverse transcriptase were also performed.

ELISAMIP-1a, SDF-1, and IL-6 extracellular levels were de-tected by ELISA according to the manufacturer’s in-structions. Briefly, 96-well plates were coated withanti-human MIP-1a,ii anti-human SDF-1,¶¶ or anti-human IL-6## monoclonal antibodies. After blockingfor 1 hour to avoid non-specific binding, 100 ml stan-dard MIP-1a,*** SDF-1,††† or IL-6‡‡‡ and culture su-pernatants were placed. The cytokines were detectedby horseradish peroxidase-labeled monoclonal anti-body to each target after 100 ml anti-human MIP-1a,§§§ SDF-1,iii or IL-6¶¶¶ biotinylated antibodieswere placed in each well and incubated for 2 hoursat room temperature. The microplate was washedto remove unbound enzyme-labeled antibodies. Theamount of horseradish peroxidase bound to each wellwas determined by the addition of 100 ml substrate so-lution. The reaction was stopped by the addition of100 ml 1 M sulfuric acid, and the plates were read at450 nm.### The concentrations of MIP-1a, SDF-1,or IL-6 were determined by interpolation from a stan-dard curve and presented as picograms per milliliter(– standard error of the mean) for duplicate assaysof duplicate samples of each of the tested conditions.

Statistical AnalysesStatistical analyses were performed with soft-ware**** by the one-way analysis of variance test fol-lowed by the Tukey post test. Values of P <0.05 wereconsidered statistically significant.

RESULTS

Cell CulturePeriodontal ligament and gingival fibroblasts weresuccessfully cultured from the tissue biopsies. Ourcomparison studies were performed in situationswhere human periodontal ligament and gingival fibro-blasts were derived from the same donors. Typically,after 5 days of culture, cells extending from the ex-

plants were observed; after 14days, they were first passaged,and after 21 days, they wereconfluent. Morphologically, asexamined by phase-contrastmicroscopy, periodontal liga-ment and gingival fibroblastsappeared to be similar, havinga spindle-shaped, elongatedappearance characteristic of‘‘fibroblast-like’’ cells as previ-ously described36 (Fig. 1).

MIP-1a, SDF-1, and IL-6mRNA Expression in

Periodontal Ligament and Gingival FibroblastsWe investigated the mRNA expression of MIP-1a,SDF-1, and IL-6. Both chemokines (MIP-1a andSDF-1) and the cytokine (IL-6) were expressed at 1,6, and 24 hours by periodontal ligament and gingivalfibroblasts. For periodontal ligament fibroblasts, MIP-1a and SDF-1 expression was unchanged over timeand not variable with the concentration increase ofLPS from P. gingivalis (Figs. 2A and 2C). On the otherhand, for gingival fibroblasts, both chemokines hada slightly lower expression with 0.1 and 1 mg/ml anti-gen compared to the control and a significantly higherexpression with 10 mg/ml LPS (Figs. 2B and 2D). IL-6levels of mRNA were very similar between the twopopulations of cells and not dramatically affected withthe stimulation of LPS from P. gingivalis (Figs. 2E and2F).

MIP-1a, SDF-1, and IL-6 Production by HumanCultured Periodontal Ligament andGingival FibroblastsAs shown in Figure 3A, a very low amount of thechemokine MIP-1a produced by human periodon-tal ligament fibroblasts was detected, but for gin-gival fibroblasts, a statistically significant increase(P <0.05) was found with the lower concentration ofLPS (0.1 mg/ml), which was not observed with thehigher stimulus concentration (Fig. 3B). For SDF-1,a lower production by periodontal ligament cellswas also observed compared to the gingival fibro-blasts. At 24 hours, the basal production was signifi-cantly and gradually decreased (P <0.05) with theincrease of LPS concentration (Figs. 3C and 3D).

Table 1.

Sequences of Primers Used in the PCR for Amplification of theDifferent Targets and Predicted Size of PCR Products

Target Sense (59–39) Antisense (59–39)

Predicted

Size

MIP-1a TTTGCTCTGAGAGTTCCCCCT TTGGTGCCATGACTGCCTACA 102

SDF-1 GGTTTCCGAAATCAGAAGCGA TGGAACCTGAAACCCTGCTGT 91

IL-6 CAATAACCACCCCTGACCCAA TTGTCATGTCCTGCAGCCACT 84

b-actin CCATCATGAAGTGTGACGTGG TCTGCATCCTGTCGGCAAT 102

ii R&D Systems, Minneapolis, MN.¶¶ DY350, DuoSet kit, R&D Systems.## Catalog # 51-26451-E, BD OptEIA Kit, BD Biosystems, San Diego, CA.*** R&D Systems.††† DY350, DuoSet kit, R&D Systems.‡‡‡ Catalog # 51-26451-E, BD OptEIA Kit, BD Biosystems.§§§ R&D Systems.iii DY350, DuoSet kit, R&D Systems.¶¶¶ Catalog # 51-26451-E, BD OptEIA Kit, BD Biosystems.### ELISA microplate reader, Bio-Rad, Hercules, CA.**** GraphPad Prism 5.0, GraphPad Software, San Diego, CA.

Cytokine Production by Human Fibroblasts Volume 81 • Number 2

312

Differences between the levels of IL-6 secreted byboth cells were also noted. At the first experimentaltime (1 hour), the basal levels of IL-6 were very lowand not affected by the presence of any concentrationof LPS (Figs. 3E and 3F). However, when we analyzedthe levels of production at 6 and 24 hours, a time- andconcentration-dependent secretion of IL-6 by peri-odontal ligament fibroblasts was found (Fig. 3E). Thisdifference was statistically significant compared tothe first hour and also in comparison to the non-stim-ulated controls. Interestingly, for gingival fibroblasts,we did not observe a concentration-dependent pat-tern of IL-6 production despite the remarkable upre-gulation over time (P <0.05; Fig. 3F).

DISCUSSION

The main finding of the present study was that peri-odontal ligament fibroblasts, when stimulated withLPS from P. gingivalis, produced MIP-1a, SDF-1,and IL-6 in a different way compared to gingival fibro-blasts. Indeed, functional differences such as migra-tory capacity, extracellular matrix production anddegradation, and contractility were observed.37 It

was demonstrated that fibroblast regional identity isnot rigidly imprinted but can be transiently modifiedby inflammatory cytokines. For example, upon stim-ulation with inflammatory mediators, such as TNF-a,IL-4, and interferon-g, the fibroblast gene expressioncan be modified. In other words, this suggests that in-flammation can, at least transiently, alter a fibroblast’sgene-expression profile.38

In this study, we demonstrated that the mRNA ex-pression of both gingival and periodontal ligamentfibroblasts had no significant alterations due to thechallenge of LPS from P. gingivalis. In addition, theresults demonstrate a lower protein production ofboth chemokines (MIP-1a and SDF-1) as well as thecytokine (IL-6) by periodontal ligament fibroblastscompared to gingival fibroblasts. The results callattention to the fact that human gingival fibroblastsproduced over two-fold the amounts of cytokinesdetected in periodontal ligament cells in the experi-mental times of 6 and 24 hours.

Recently, a role for MIP-1a as a possible bio-marker for localized aggressive periodontitis was sug-gested.39 MIP-1a production by epithelial gingivalcells was also reported as being part of an importantevent in the beginning of inflammation and in the moreadvanced stages of periodontitis. MIP-1a productionmust be associated with the facilitation of accumula-tion and activation of leukocytes as well as with thepossible signals provided to the formation of multi-nucleated bone cells.40 In the present study, a higherproduction of this chemokine by gingival fibroblastswith the lowest concentration of LPS administeredwas found. The production of MIP-1a with a low con-centration of antigen may be a possible characteristicof a chronic inflammatory response. In higher con-centrations of LPS, MIP-1a production decreased sig-nificantly, which may be related to a compensatorymechanism to the production of other cytokines thatcould be more involved inan acute pattern of response.

Our data showed a production of SDF-1 by non-stimulated periodontal fibroblasts. We observeda basal production mainly in 24 hours, and our find-ings corroborate those by other authors14,41 who alsoshowed a basal mRNA expression and protein pro-duction of SDF-1 by these cells. The challenge withLPS altered the production of this chemokine in a con-centration-dependent manner at 24 hours in gingivaland periodontal ligament fibroblasts as previously re-ported.14 Taking this into account, it is possible thatthe inhibition of SDF-1 production could contributeto the disease process because, as documented inthe present study, the production of other proinflam-matory cytokines, such as IL-6, seems to occur. An-other study42 demonstrated that SDF-1 levels werealtered due to periodontal inflammation, thus corrob-orating our speculation regarding the participation of

Figure 1.Human cultured periodontal ligament and gingival fibroblasts. Theprimary cell culture was obtained from the periodontal ligament (A, C,and E) and gingiva (B, D, and F) of the same donors. Periodontalligament and gingival cells observed at5 days (AandB) andat 14days (Cand D). After 21 days, cells were confluent (E and F). In C, mitosis (arrow)is shown. (Visualization on optical microscopy; original magnification: A, B,E, and F, ·100; C and D, ·300).

J Periodontol • February 2010 Morandini, Sipert, Gasparoto, et al.

313

SDF-1 as an important chemokine in the inflamma-tory microenvironment context.

An upregulation in IL-6 mRNA expression by hu-man gingival fibroblasts was detected in a concen-tration-dependent manner when these cells werestimulated with IL-1b and TNF-a.43 In the same man-ner, primary cell cultures derived from murine gingi-val tissue were exposed to LPS from P. gingivalis,and IL-6 production was significantly elevated as

was the TNF-a secretion.44 The induction of IL-6mRNA expression when cells were challenged byLPS was statistically significant for periodontal liga-ment fibroblasts,45 highlighting the important partic-ipation of this molecule in the inflammatory events ofboth tissues. Conversely, our data did not show thesame induction pattern in periodontal ligament fibro-blasts, but on the other hand, we detected a significantincrease in the IL-6 production by gingival fibroblasts

Figure 2.MIP-1a (A and B), SDF-1 (C and D), and IL-6 (E and F) mRNA expression by human cultured periodontal ligament and gingival fibroblasts challenged withLPS from P. gingivalis. Primary cell cultures were obtained from periodontal tissues from three healthy subjects and, after the fourth passage, were stimulatedwith LPS fromP. gingivalis in concentrations of 0.1, 1, and10 mg/ml. Culturemediumwithout stimuli was usedas the control. Total RNAwasextracted from thecell cultures, and cytokine geneexpressionwasanalyzed by real-timePCR. The mRNAexpression wasquantified in relation to a housekeeping gene (b-actin).*P <0.05 compared to the other concentrations of LPS.

Cytokine Production by Human Fibroblasts Volume 81 • Number 2

314

starting at 6 hours, which was maintained at 24 hours(P <0.05). We observed a remarkable trend of secre-tion depending on the LPS concentration, despite thelack of statistical significance for the different LPSconcentrations in these experimental times for gingi-val fibroblasts. Furthermore, we believe that the non-detection of IL-6 production in the first hour of stimulusoccurred because it was too early for the protein de-tection because we already had the gene-expressionlevels (mRNA) in this experimental time for both

tissues. The results presented in this article showthat periodontal ligament fibroblasts exhibit differentcharacteristics of IL-6 secretion compared to gingivalfibroblasts. In accordance with our findings, otherstudies22,46,47 also showed that these cells presentedspecific functional differences on macromoleculesand protein synthesis despite the fact that they canhave similar growth and morphologic aspects.

It is equally important to reinforce that the differ-ences reported in the present study were consistently

Figure 3.MIP-1a (A and B), SDF-1 (C and D), and IL-6 (E and F) production by human culturedperiodontal ligament and gingival fibroblasts challengedwith LPS fromP. gingivalis. Primary cell cultures were obtained from periodontal tissues from three healthy subjects and, on the fourth passage, were stimulated with LPSfrom P. gingivalis in concentrations of 0.1, 1, and 10 mg/ml. Culture medium without stimuli was used as the control. ELISA was performed for thequantification of the cytokines on the cell culture supernatants. *P <0.05 compared to the other concentrations of LPS; †P <0.05 compared to the otherexperimental times.

J Periodontol • February 2010 Morandini, Sipert, Gasparoto, et al.

315

observed comparing periodontal ligament and gingi-val fibroblasts that came from the same passage, onthe same experimental conditions, and from the samedonors. Various factors could be responsible for thecontrast in these two cell populations. One of the rea-sons concerns the differential expression of surface re-ceptors available to recognize and bind to the antigen.Moreover, it could be due to different mechanisms ofintracellular signaling and distinct pathways that couldmodulate and decide if the cell will secrete a certaincytokine. Evidence of higher levels of Toll-like recep-tor (TLR-4) expression in gingival fibroblasts32,48,49

and TLR-2 in periodontal ligament fibroblasts50 mightbe one of the plausible explanations for the differencesreported in the present study regarding the expressionand production of MIP-1a, SDF-1, and IL-6.

CONCLUSIONS

In the experimental conditions of this study, the gingi-val fibroblasts had a greater contribution to cytokineproduction compared to periodontal ligament fibro-blasts when challenged by LPS from P. gingivalis.The distinct ability of the gingival and periodontal lig-ament fibroblasts to secrete MIP-1a, SDF-1, and IL-6emphasized that these cells may differently contributeto the balance of cytokines in the LPS-challengedperiodontium.

ACKNOWLEDGMENTS

This study was supported by a grant from The Stateof Sao Paulo Research Foundation, Sao Paulo, SP,Brazil, to Dr. Santos (grant 05/60167-0). The authorsreport no conflicts of interest related to this study.

REFERENCES1. Kinane DF, Attstrom R. Advances in the pathogenesis

of periodontitis. Group B consensus report of the fifthEuropean Workshop in Periodontology. J Clin Peri-odontol 2005;32(Suppl. 6):130-131.

2. Feng Z, Weinberg A. Role of bacteria in health anddisease of periodontal tissues. Periodontol 20002006;40:50-76.

3. Nibali L, Ready DR, Parkar M, et al. Gene polymor-phisms and the prevalence of key periodontal patho-gens. J Dent Res 2007;86:416-420.

4. Roodman GD. Regulation of osteoclast differentiation.Ann N Y Acad Sci 2006;1068:100-109.

5. Trevilatto PC, Scarel-Caminaga RM, de Brito RB Jr.,de Souza AP, Line SR. Polymorphism at position -174of IL-6 gene is associated with susceptibility to chronicperiodontitis in a Caucasian Brazilian population.J Clin Periodontol 2003;30:438-442.

6. Maurer M, von Stebut E. Macrophage inflammatoryprotein-1. Int J Biochem Cell Biol 2004;36:1882-1886.

7. Gemmell E, Marshall RI, Seymour GJ. Cytokines andprostaglandins in immune homeostasis and tissuedestruction in periodontal disease. Periodontol 20001997;14:112-143.

8. Papanicolaou DA, Wilder RL, Manolagas SC, ChrousosGP. The pathophysiologic roles of interleukin-6 inhuman disease. Ann Intern Med 1998;128:127-137.

9. Terry CF, Loukaci V, Green FR. Cooperative influenceof genetic polymorphisms on interleukin 6 transcrip-tional regulation. J Biol Chem 2000;275:18138-18144.

10. Aiuti A, Webb IJ, Bleul C, Springer T, Gutierrez-RamosJC. The chemokine SDF-1 is a chemoattractant forhuman CD34+ hematopoietic progenitor cells andprovides a new mechanism to explain the mobilizationof CD34+ progenitors to peripheral blood. J Exp Med1997;185:111-120.

11. Bleul CC, Fuhlbrigge RC, Casasnovas JM, Aiuti A,Springer TA. A highly efficacious lymphocyte chemo-attractant, stromal cell-derived factor 1 (SDF-1). J ExpMed 1996;184:1101-1109.

12. Chan JR, Hyduk SJ, Cybulsky MI. Chemoattractantsinduce a rapid and transient upregulation of monocytealpha4 integrin affinity for vascular cell adhesion mol-ecule 1 which mediates arrest: An early step in the pro-cess of emigration. J Exp Med 2001;193:1149-1158.

13. Fedyk ER, Jones D, Critchley HO, Phipps RP, BliedenTM, Springer TA. Expression of stromal-derived fac-tor-1 is decreased by IL-1 and TNF and in dermalwound healing. J Immunol 2001;166:5749-5754.

14. Hosokawa Y, Hosokawa I, Ozaki K, et al. CXCL12 andCXCR4 expression by human gingival fibroblasts inperiodontal disease. Clin Exp Immunol 2005;141:467-474.

15. Wang PL, Shirasu S, Shinohar M, et al. IL-10 inhibitsPorphyromonas gingivalis LPS-stimulated human gin-gival fibroblasts production of IL-6. Biochem BiophysRes Commun 1999;263:372-377.

16. Koka S, Reinhardt RA. Periodontal pathogen-relatedstimulation indicates unique phenotype of primarycultured human fibroblasts from gingiva and peri-odontal ligament: Implications for oral health disease.J Prosthet Dent 1997;77:191-196.

17. Fiorellini JP, Kim DM, Ishikawa SO. The Gingiva. In:Newman M, Takei H, Carranza FA, Klokkevold PR, eds.Carranza’s Clinical Periodontology, 10th ed. St. Louis:Saunders, Elsevier; 2006:46-63.

18. Almasri A, Wisithphrom K, Windsor LJ, Olson B.Nicotine and lipopolysaccharide affect cytokine ex-pression from gingival fibroblasts. J Periodontol 2007;78:533-541.

19. Ara T, Maeda Y, Fujinami Y, Imamura Y, Hattori T,Wang PL. Preventive effects of a Kampo medicine,Shosaikoto, on inflammatory responses in LPS-treatedhuman gingival fibroblasts. Biol Pharm Bull 2008;31:1141-1144.

20. Gutierrez-Venegas G, Maldonado-Frias S, Ontiveros-Granados A, Kawasaki-Cardenas P. Role of p38 innitric oxide synthase and cyclooxygenase expression,and nitric oxide and PGE2 synthesis in human gingivalfibroblasts stimulated with lipopolysaccharides. LifeSci 2005;77:60-73.

21. Kent LW, Rahemtulla F, Michalek SM. Interleukin (IL)-1 and Porphyromonas gingivalis lipopolysaccharidestimulation of IL-6 production by fibroblasts derivedfrom healthy or periodontally diseased human gingivaltissue. J Periodontol 1999;70:274-282.

22. Kuru L, Parkar MH, Griffiths GS, Newman HN, Olsen I.Flow cytometry analysis of gingival and periodontalligament cells. J Dent Res 1998;77:555-564.

Cytokine Production by Human Fibroblasts Volume 81 • Number 2

316

23. Letzelter C, Croute F, Pianezzi B, Roques C,Soleilhavoup JP. Supernatant cytotoxicity and pro-teolytic activity of selected oral bacteria againsthuman gingival fibroblasts in vitro. Arch Oral Biol1998;43:15-23.

24. Minami T, Kuroishi T, Ozawa A, Shimauchi H, Endo Y,Sugawara S. Histamine amplifies immune response ofgingival fibroblasts. J Dent Res 2007;86:1083-1088.

25. Patil C, Rossa C Jr., Kirkwood KL. Actinobacillusactinomycetemcomitans lipopolysaccharide inducesinterleukin-6 expression through multiple mitogen-activated protein kinase pathways in periodontalligament fibroblasts. Oral Microbiol Immunol 2006;21:392-398.

26. Sugawara S, Sugiyama A, Nemoto E, Rikiishi H, TakadaH. Heterogeneous expression and release of CD14 byhuman gingival fibroblasts: Characterization andCD14-mediated interleukin-8 secretion in responseto lipopolysaccharide. Infect Immun 1998;66:3043-3049.

27. Tabeta K, Yamazaki K, Akashi S, et al. Toll-likereceptors confer responsiveness to lipopolysaccharidefrom Porphyromonas gingivalis in human gingivalfibroblasts. Infect Immun 2000;68:3731-3735.

28. Takashiba S, Naruishi K, Murayama Y. Perspective ofcytokine regulation for periodontal treatment: Fibro-blast biology. J Periodontol 2003;74:103-110.

29. Takashiba S, Takigawa M, Takahashi K, et al. In-terleukin-8 is a major neutrophil chemotactic factorderived from cultured human gingival fibroblastsstimulated with interleukin-1 beta or tumor necrosisfactor alpha. Infect Immun 1992;60:5253-5258.

30. Tamura M, Tokuda M, Nagaoka S, Takada H. Lipo-polysaccharides of Bacteroides intermedius (Prevo-tella intermedia) and Bacteroides (Porphyromonas)gingivalis induce interleukin-8 gene expression inhuman gingival fibroblast cultures. Infect Immun1992;60:4932-4937.

31. Verardi S, Page RC, Ammons WF, Bordin S. Differen-tial chemokine response of fibroblast subtypes tocomplement C1q. J Periodontal Res 2007;42:62-68.

32. Wang PL, Azuma Y, Shinohara M, Ohura K. Toll-likereceptor 4-mediated signal pathway induced by Por-phyromonas gingivalis lipopolysaccharide in humangingival fibroblasts. Biochem Biophys Res Commun2000;273:1161-1167.

33. Yamamoto T, Kita M, Oseko F, Nakamura T, ImanishiJ, Kanamura N. Cytokine production in human peri-odontal ligament cells stimulated with Porphyromonasgingivalis. J Periodontal Res 2006;41:554-559.

34. Santos CF, Akashi AE, Dionisio TJ, et al. Character-ization of a local Renin-Angiotensin system in ratgingival tissue. J Periodontol 2009;80:130-139.

35. Garlet GP, Martins W Jr., Fonseca BA, Ferreira BR,Silva JS. Matrix metalloproteinases, their physiologi-cal inhibitors and osteoclast factors are differentiallyregulated by the cytokine profile in human periodontaldisease. J Clin Periodontol 2004;31:671-679.

36. Somerman MJ, Archer SY, Imm GR, Foster RA. Acomparative study of human periodontal ligamentcells and gingival fibroblasts in vitro. J Dent Res 1988;67:66-70.

37. Fries KM, Blieden T, Looney RJ, et al. Evidence offibroblast heterogeneity and the role of fibroblast sub-populations in fibrosis. Clin Immunol Immunopathol1994;72:283-292.

38. Parsonage G, Falciani F, Burman A, et al. Global geneexpression profiles in fibroblasts from synovial, skinand lymphoid tissue reveals distinct cytokine andchemokine expression patterns. Thromb Haemost2003;90:688-697.

39. Fine DH, Markowitz K, Furgang D, et al. Macrophageinflammatory protein-1 alpha: A salivary biomarker ofbone loss in a longitudinal cohort study of children atrisk for aggressive periodontal disease? J Periodontol2009;80:106-113.

40. Ryu OH, Choi SJ, Linares AM, et al. Gingival epithelialcell expression of macrophage inflammatory protein-1alpha induced by interleukin-1beta and lipopolysac-charide. J Periodontol 2007;78:1627-1634.

41. Luster AD. Chemokines – Chemotactic cytokines thatmediate inflammation. N Engl J Med 1998;338:436-445.

42. Havens AM, Chiu E, Taba M, et al. Stromal-derivedfactor-1alpha (CXCL12) levels increase in periodontaldisease. J Periodontol 2008;79:845-853.

43. Palmqvist P, Lundberg P, Lundgren I, Hanstrom L,Lerner UH. IL-1beta and TNF-alpha regulate IL-6-typecytokines in gingival fibroblasts. J Dent Res 2008;87:558-563.

44. Ekhlassi S, Scruggs LY, Garza T, Montufar-Solis D,Moretti AJ, Klein JR. Porphyromonas gingivalis lipo-polysaccharide induces tumor necrosis factor-alphaand interleukin-6 secretion, and CCL25 gene expres-sion, in mouse primary gingival cell lines: Interleukin-6-driven activation of CCL2. J Periodontal Res 2008;43:431-439.

45. Sun Y, Shu R, Zhang MZ, Wu AP. Toll-like receptor 4signaling plays a role in triggering periodontal in-fection. FEMS Immunol Med Microbiol 2008;52:362-369.

46. Giannopoulou C, Cimasoni G. Functional characteris-tics of gingival and periodontal ligament fibroblasts.J Dent Res 1996;75:895-902.

47. Mariotti A, Cochran DL. Characterization of fibroblastsderived from human periodontal ligament and gingiva.J Periodontol 1990;61:103-111.

48. Gutierrez-Venegas G, Kawasaki-Cardenas P, Cruz-Arroyo SR, Perez-Garzon M, Maldonado-Frias S.Actinobacillus actinomycetemcomitans lipopolysac-charide stimulates the phosphorylation of p44 andp42 MAP kinases through CD14 and TLR-4 receptoractivation in human gingival fibroblasts. Life Sci 2006;78:2577-2583.

49. Wang PL, Ohura K. Porphyromonas gingivalis lipo-polysaccharide signaling in gingival fibroblasts-CD14and Toll-like receptors. Crit Rev Oral Biol Med 2002;13:132-142.

50. Hatakeyama J, Tamai R, Sugiyama A, Akashi S,Sugawara S, Takada H. Contrasting responses ofhuman gingival and periodontal ligament fibroblaststo bacterial cell-surface components through theCD14/Toll-like receptor system. Oral Microbiol Immu-nol 2003;18:14-23.

Correspondence: Dr. Carlos F. Santos, Department ofBiological Sciences, Bauru School of Dentistry, Al. OctavioPinheiro Brisola, 9-75, Bauru, SP, 17012-901, Brazil. Fax:55-14 3223-4679; e-mail: cebola@usp.br.

Submitted July 1, 2009; accepted for publication August14, 2009.

J Periodontol • February 2010 Morandini, Sipert, Gasparoto, et al.

317