1

Neisseria meningitidis polynucleotide phosphorylase affects 1 aggregation, adhesion and virulence 2 3 Running title: Neisseria meningitidis PNPase regulates aggregation 4 5 Jakob Engman1, Aurel Negrea1, Sara Sigurlásdóttir1, Miriam Geörg1,2, Jens 6 Eriksson1,3, Olaspers Sara Eriksson1, Asaomi Kuwae1,4, Hong Sjölinder1 and Ann-7 Beth Jonsson1# 8 9 1Department of Molecular Biosciences, The Wenner-Gren Institute, Stockholm 10 University, Stockholm, Sweden 11 2Present address: Department of Laboratory Medicine, Division of Clinical 12 Microbiology, Västmanland hospital, Västerås, Sweden 13 3Present address: Advanced Light Microscopy Core Facility, Oslo University 14 Hospital, Oslo Norway 15 4Present address: Laboratory of Bacterial Infection, Graduate School of Infection 16 Control Sciences, Kitasato University, Minato-ku, Tokyo, Japan 17 18 #Corresponding author: Ann-Beth Jonsson, Department of Molecular Biosciences, 19 The Wenner-Gren Institute, Stockholm University, SE-10691 Stockholm, Sweden. 20 Phone: 468 164154. Fax: 468 164315. E-mail: ann-beth.jonsson@su.se. 21 22 23

IAI Accepted Manuscript Posted Online 29 February 2016Infect. Immun. doi:10.1128/IAI.01463-15Copyright © 2016, American Society for Microbiology. All Rights Reserved.

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

2

Abstract 24 25 Neisseria meningitidis auto-aggregation is an important step during attachment 26 to human cells. Aggregation is mediated by type IV pili and can be modulated by 27 accessory pili proteins, such as PilX, and posttranslational modifications of the 28 major pilus subunit PilE. The mechanisms underlying the regulation of 29 aggregation remain poorly characterized. Polynucleotide phosphorylase 30 (PNPase) is a 3’–5’ exonuclease that is involved in RNA turnover and the 31 regulation of small RNAs. In this study, we biochemically confirm that NMC0710 32 is the N. meningitidis PNPase, and we characterize its role in N. meningitidis 33 pathogenesis. We show that deletion of the gene encoding PNPase leads to 34 hyper-aggregation and increased adhesion to epithelial cells. The induced 35 aggregation was found to be dependent on pili and mediated by excessive pili 36 bundling. The expression of PNPase was induced following bacterial attachment 37 to human cells. The deletion of PNPase led to global transcriptional changes and 38 the differential regulation of 469 genes. We also demonstrate that PNPase is 39 required for full virulence in an in vivo model of N. meningitis infection. The 40 present study shows that PNPase negatively affects aggregation, adhesion and 41 virulence in N. meningitidis. 42 43

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

3

Introduction 44 45 Neisseria meningitidis is a Gram-negative, encapsulated diplococcus with the 46 potential to cause life-threatening epidemic disease. The human nasopharynx, 47 where the bacteria typically resides during asymptomatic periods, is the only 48 natural reservoir of N. meningitidis. However, the bacteria occasionally invade 49 the mucosa, gain access to the bloodstream, and cross the blood-brain barrier to 50 reach the cerebrospinal fluid. This pathologic process clinically presents as 51 severe sepsis and/or meningitis (1). To facilitate its colonization of the 52 nasopharynx and its survival in circulation, N. meningitidis has evolved intricate 53 mechanisms to evade innate immune defenses (2). Specifically, the bacteria 54 express or modify multiple surface structures, such as the polysaccharide 55 capsule, lipopolysaccharides (LPSs), Neisseria hia homolog A (NhhA) and 56 proteins that bind to human complement regulators, to protect themselves from 57 complement attack complexes (3-9). 58 59 A key virulence feature of N. meningitidis is type IV pili, which are thin 60 membrane-spanning filaments that are involved in adhesion to human cells, 61 bacterial aggregation, twitching motility and competence (10-13). Bacterial 62 aggregation is primarily driven by type IV pili-mediated contact between 63 bacteria, but these interactions can be modified by multiple factors, including the 64 minor pilin PilX and posttranslational modifications of the major pilus subunit 65 PilE (14-16). The formation of organized aggregates greatly increases initial 66 adhesion to cells and protects the bacteria from shear stress (17). After the 67

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

4

initial adhesion, the aggregates disperse, allowing a more intimate adhesion that 68 is characterized by the down-regulation of pili and the capsule (18). The 69 regulation of aggregation and the regulation of dispersion remain poorly 70 characterized processes. 71 72 Polynucleotide phosphorylase (PNPase) is a 3’-5’ exonuclease that is involved in 73 RNA degradation (19). It is expressed in both pro- and eukaryotic cells, with the 74 exception of fungi (20). In proteobacteria, PNPase is part of the RNA 75 degradosome, as are RNase E, enolase and a RNA helicase (21). In Escherichia 76 coli, RNA degradation is initiated by endonucleic cleavage by RNase E. This 77 exposes a free 3’ RNA end, at which PNPase and other 3’ ribonucleases proceed 78 to degrade the RNA (22). In addition to mRNA, PNPase has also been shown to be 79 important for the stability of small RNAs (sRNA)(23). Because of its role in the 80 regulation of mRNA and sRNA half-lives, PNPase is important for the regulation 81 of many genes. PNPase is required for bacterial adaptation to cold shock (e.g., in 82 E. coli, Salmonella enterica subsp. enterica Serovar Typhimurium (S. 83 typhimurium), Yersinia enterocolitica and Campylobacter jejuni) (24-27). 84 Importantly, PNPase is also involved in the regulation of virulence-associated 85 gene expression. In S. typhimurium, PNPase suppresses the expression of genes 86 encoded by the Salmonella pathogenicity islands and by the SpvR virulence 87 plasmid (27, 28). In Yersinia, PNPase positively regulated the activity of the type 88 III secretion system and thereby enhanced both resistance to macrophage-89 mediated killing and virulence in a mouse model (29, 30). In addition, PNPase 90 negatively regulated bacterial biofilm formation in E. coli and S. typhimurium, 91 twitching motility and virulence in Dichelobacter nodosus, and swimming 92

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

5

motility in C. jejuni (31-34). In N. meningitidis, the PNPase homologue has been 93 shown to be up-regulated during long-term colonization of human epithelial cells 94 in vitro (35). 95 96 In this study, we show that N. meningitidis PNPase affects global gene regulation, 97 and negatively affects aggregation and adhesion to epithelial cells. The hyper-98 aggregation observed in PNPase-deficient mutants depended on pili and 99 involved increased bundling of pili. Finally, we show that PNPase is required for 100 full bacteremia in an in vivo model of N. meningitis infection. 101

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

6

Materials and Methods 102 103 Bacterial strains and growth conditions 104 105 The strains and plasmids used in this paper are presented in Table 1. The 106 encapsulated N. meningitidis serogroup C strain FAM20 (36) was used in 107 experiments and is referred to as ‘wild-type’. N. meningitidis strains were grown 108 on GC agar (Acumedia) plates or in GC broth with 1% Kellogg’s supplement (37) 109 in a humidified environment at 37°C and 5% CO2. Bacteria were lifted on GC 110 plates two days prior to the experiments and restreaked once at 16–18 h prior to 111 the experiments. The E. coli strain DH5α was used as the host for cloning and 112 plasmid propagation, and it was grown in lysogeny broth (LB) or on LB agar 113 plates (Acumedia). To select for plasmids in E. coli, ampicillin (Amp) or 114 kanamycin (Kan) was added at 100 µg/ml or 50 µg/ml, respectively. To select N. 115 meningitidis transformants, Kan, chloramphenicol (Cap) or tetracycline (Tet) 116 (Sigma Aldrich) was added to the culture media at a concentration of 50 μg/ml, 5 117 μg/ml and 1 μg/ml, respectively. When specified, isopropyl β-D-1-118 thiogalactopyranoside (IPTG) was added at a concentration of 0.5 mM. 119 120 Cell lines and culture conditions 121 122 The FaDu human pharyngeal epithelial cell line (ATCC HTB-43) was maintained 123 in Dulbecco's modified Eagle's medium (DMEM) with GlutaMAX and pyruvate 124 (Invitrogen) that was supplemented with 10% heat-inactivated fetal bovine 125

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

7

serum (FBS) (Sigma-Aldrich) and maintained in a humidified environment at 126 37°C and 5% CO2. For these experiments, FaDu cells were grown in 48-well 127 plates in DMEM/10% FBS until 80% confluence was achieved. 128 129 Purification of PNPase 130 131 PNPase was amplified from FAM20 genomic DNA using the PNPpurfw and 132 PNPpurrev primers (Table 2). A PCR product was cloned into the pTrcHis vector 133 (Invitrogen) according to the manufacturer’s instructions, yielding a PNPase 134 protein that was fused to an N-terminal His-tag. The resulting plasmid was 135 transformed into DH5α cells. The correct sequence was confirmed by 136 sequencing, and the plasmid was then moved into the expression strain BL21. To 137 induce the expression of PNPase, the bacteria were grown to log phase in LB 138 with ampicillin, and 1 mM IPTG was added. The bacteria were harvested after 5 139 hours of induction. The bacteria were resuspended in resuspention buffer 140 (100mM MOPS, 500mM NaCl pH 7.4). The bacteria were lysed using sonication 141 and lysozyme treatment. The lysed bacteria were centrifuged at 100000x G for 1 142 hour at 4 °C to obtain the soluble fraction containing PNPase. The soluble 143 fraction was purified twice in a Talon metal affinity resin (Clontech) and finally 144 dialyzed against 50 mM Tris-HCl (pH 7.4) at 4 °C overnight. The purity of the 145 samples was verified using Coomassie staining of proteins that were separated 146 on a SDS-PAGE gel. 147 148 Measurement of PNPase enzymatic activity 149 150

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

8

PNPase enzymatic activity was measured using a pyruvate kinase/ lactate 151 dehydrogenase linked assay, as previously described for E. coli PNPase (38). 152 Briefly, poly (A) RNA (Sigma) and phosphate were added as substrates for 153 PNPase to yield ADP as a product. ADP was then used by pyruvate kinase with 154 phosphoenolpyruvate (PEP) to obtain ATP and pyruvate. This pyruvate is itself 155 used by lactate dehydrogenase to oxidize NADH to NAD+. The decrease in NADH 156 was measured at 340 nm. Baseline activity was determined by running the 157 reaction without phosphate. A 5 mM MgCl2 stock solution was used for all of the 158 experiments. The experiments were performed at 28 °C using 0.5, 1, 2 or 4 mM 159 phosphate. 160 161 Generation of mutant strains 162 163 Invitrogen’s MultiSite Gateway Three-Fragment Cloning system (Invitrogen) was 164 used to construct pDEST-Δpnp, pDEST-ΔpilE, pDEST-natPNP and pDEST-indPNP 165 plasmids. PCR amplification was performed using high-fidelity Phusion DNA 166 polymerase (Thermo Scientific), and the primers used are presented in Table 2. 167 Briefly, the separated fragments were cloned into pDONR vectors. Three 168 separate pDONR vectors containing the fragments of interest were cloned into 169 the pDEST vector in the correct order using the LR Clonase Plus enzyme. The pnp 170 deletion mutation sequences that corresponded to the sequences upstream and 171 downstream of pnp were amplified from FAM20 chromosomal DNA using the 172 primers P1:P2 and P3:P4, respectively. A kanamycin resistance cassette was 173 amplified from the pDONR P4-P1R (39) vector using the primers K1:K2. The 174

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

9

three PCR products were cloned into pDONR vectors and fused into pDEST in the 175 following order: pnpUHS, kanR, and pnpDHS to create pDEST-Δpnp. 176 For the pilE deletion, mutation sequences corresponding to the sequences 177 upstream and downstream of pilE were amplified from FAM20 chromosomal 178 DNA using the primers PilEUHSfw:PilEUHSrev and PilEDHSfw:PilEDHSrev, 179 respectively. The tetracycline resistance cassette was amplified from pACYC184 180 using the primers attB1_Tet_fw and attB2_Tet_rev. The three PCR products were 181 then cloned into pDONR vectors and fused into pDEST in the order pilEUHS then 182 TetR-pilEDHS to create pDEST-ΔpilE. 183 To create plasmids for complementation to Δpnp, a downstream homologous 184 sequence was amplified into the non-coding genomic region between NMC0075 185 and NMC0080 in FAM20 chromosomal DNA using the primers P5:P6 and cloned 186 into pDONR. The downstream fragment together with a chloramphenicol 187 resistance cassette was obtained from the previously described pDONR P4-P1R 188 (39). To obtain the pnp sequence under the native promoter, the pnp gene, 189 including a 243-bp upstream region containing its endogenous promoter, was 190 amplified from FAM20 using the primers P7:P8 and cloned into pDEST. To obtain 191 an IPTG-inducible copy of pnp, the lac promoter was amplified from pBAD-lacI 192 using the primers Lac_up and Lac-PNPrev, and the PNPase coding sequence was 193 sequenced from FAM20 using the primers Lac-pnpfw and Pnp-down. The two 194 fragments were joined using fusion PCR with the primers attB1-lac and attB2-195 pnp and cloned into pDEST. To obtain the final pDEST plasmids, the upstream 196 and downstream pDONR plasmids were combined with either pDONR-natPNP or 197 pDONR-indPNP to create pDEST-natPNP and pDEST-indPNP. 198 199

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

10

ΔsiaD was constructed using fusion PCR. Because siaD is a part of the sacA-siaB-200 siaC-siaD-NMC0050 operon, we sought to construct a deletion mutant that 201 allowed the native expression of NMC0050. To achieve this, the fusion PCR was 202 performed in 2 steps. In the first step, the tetracycline resistance cassettes in 203 pACYC184 and NMC0050 were amplified using the TetRfw and TetRrev and the 204 NMC50fw and NMC50rev primer pairs. Because the primers contain overlapping 205 sequences, a fused NMC0050-Tet fragment was obtained from a PCR using the 206 separate fragments as the template and NMC50fw and TetRrev as the primers. In 207 the second fusion PCR, the downstream SiaC region and the upstream NMC0049 208 region were amplified using SiaCfw and SiaCrev and using NMC49fw and 209 NMC49rev, respectively. The NMC0050-Tet fragment was amplified using the 210 SiaE-Tetfw and SiaE-Tetrev primers resulting in overlapping regions in the 211 flanking fragments. In the final step, the SiaC, NMC0050-Tet and NMC0049 212 fragments were joined and amplified using the SiaCfw and 49rev primers. The 213 resulting siaC-NMC0050-tetR-NMC0049 fragment was cloned into pTOPO-ZeroII 214 Blunt to yield pTOPO-ΔsiaD. 215 216 The constructs were integrated into the genome of N. meningitidis FAM20 using 217 homologous allelic replacement following liquid or spot transformation with 218 plasmid DNA (40). Mutants were selected by plating the bacteria on GC plates 219 with the appropriate antibiotics. Because we were not able to transform Δpnp, 220 the complemented strains were constructed by first integrating the 221 complementation construct and then introducing the pnp mutation. For the 222

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

11

double mutants, ΔsiaD and ΔpilE were introduced into the Δpnp/indPNP 223 complemented strain in the presence of IPTG. 224 225 Generation of anti-PNPase antibodies 226 227 Anti-PNPase antibodies were generated by EZBiolabs. Three peptides were 228 synthesized to match the following predicted domains of the N. meningitidis 229 PNPase: P1, C-KHLEADVVRSQILDGQPRIDGRDTRTVRP-NH2; P2, 230 C-FFKREGKQSEKEILT-NH2 and P3, C-KALLDAPAREENAAE-COOH. Two rabbits 231 were immunized per peptide, and the sera were then collected and pooled. 232 Antisera (i.e., anti-P1, anti-P2 and anti-P3) were precipitated using 33% 233 (NH4)2SO4, and the precipitates were dissolved in PBS. The solution was dialyzed 234 against PBS buffer and lyophilized. To perform affinity purification, the antisera 235 were purified using peptide affinity chromatography and subsequently dialyzed 236 against PBS buffer and lyophilized. Lyophilized antisera and affinity-purified 237 antibodies were dissolved in PBS, and the aliquots were stored at -20 °C. All 238 three antibodies yielded a PNPase-specific signal (data not shown). 239 240 Live-cell microscopy to analyze aggregation 241 242 Bacteria were suspended in DMEM/1% FBS, filtered through 5-μm filters to 243 eliminate large aggregates, and diluted to 1x 107 CFU/ml. They were then seeded 244 into glass-bottom dishes (MatTek). Bacterial aggregation during growth was 245 imaged using an inverted Axio Observer Z1 microscope (Carl Zeiss) at 37°C in 246 5% CO2. Images were captured after 30 to 240 min of incubation and processed 247

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

12

using AxioVision software version 4.7 (Carl Zeiss). Live microscopy was 248 performed more than two times for each setting. 249 250 Spectrophotometric quantification of bacterial aggregation 251 252 Aggregation assays were performed, as previously described (14). Briefly, the 253 bacteria were suspended in DMEM/1% FBS, filtered through 5-μm filters to 254 eliminate large aggregates, and adjusted to an OD600 of 0.5. The bacteria were 255 then grown to an OD600 of 1 at 37°C in 5% CO2 with agitation. Bacterial 256 suspensions were subsequently transferred to room temperature and left to 257 sediment under static conditions. The OD600 of the supernatants was measured at 258 20 min intervals for 3 h. Aggregation assays were performed three times using 259 duplicate samples. 260 261 Adherence assays 262 263 Adherence assays were performed as previously described (3). Briefly, the 264 bacteria were suspended in serum-free DMEM and added to FaDu cells at a 265 multiplicity of infection of 100. Infected cells were incubated at 37°C in 5% CO2. 266 After 2 h, the cells were gently washed five times with PBS to remove unbound 267 bacteria. Eukaryotic cells were lysed using freshly prepared 1% Saponin in PBS. 268 The number of attached colony forming units (CFU) was subsequently 269 determined by serial dilution and by plating the bacteria on GC plates. The 270 bacteria were vortexed thoroughly before plating to break up aggregates. 271 Adherence assays were performed three times in triplicate samples. 272

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

13

273 Preparation of cell lysates and Western blot analysis 274 275 To measure protein expression, the bacteria were suspended in DMEM 276 supplemented with 1 or 10% FBS to obtain an optical density at 600 nm (OD600) 277 of 0.1. They were then grown while being agitated at 37°C in 5% CO2 for 4 h, 278 unless stated otherwise. Bacteria attached to the FaDu cells were washed 4 times 279 in pre-warmed DMEM to remove unbound bacteria. The cells were lysed in PBS 280 containing 1% saponin and complete protease inhibitor (Roche) on ice to release 281 the bacteria. The samples were vortexed to break up aggregates and then filtered 282 (5 µm pore size) to remove FaDu cell debris. The bacteria were collected using 283 centrifugation and resuspended in PBS, and the samples were adjusted to an 284 OD600 of 1.0. The samples were diluted in 4x sample buffer containing 1% β-285 mercaptoethanol, separated on 12% SDS-PAGE gels and transferred to 286 Immobilon-P transfer membranes (Millipore) according to the manufacturer’s 287 instructions. PNPase was detected using the P1 rabbit polyclonal anti-peptide 288 antibody (described above). PilC, PilE, and PilT were detected using polyclonal 289 rabbit antibodies. Opa proteins were detected using monoclonal mouse 290 antibodies 4B12/C11 and H.22.1 detecting all Opa proteins and Opa 540 + Opa 291 1800 respectively as previously described (41). For quantification of protein 292 expression levels, a monoclonal EF-Tu antibody (Hycult Biotech) was used as a 293 normalization control. Primary antibodies were detected using infrared (IR)-294 reactive dye-conjugated goat anti-mouse 680LT and/or goat anti-rabbit 800CW 295 secondary antibodies (Li-Cor) and visualized using an Odyssey IR scanner (Li-296 Cor). Alternatively, primary antibodies were detected using peroxidase-297

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

14

conjugated anti-rabbit antibodies (Bio-Rad) and a SuperSignal chemiluminescent 298 detection kit (Pierce Biotechnology). A Precision Plus All Blue prestained protein 299 standard (Bio-Rad) or a Page Ruler Plus prestained protein ladder (Fermentas) 300 was used as a molecular mass marker. Analyses of raw image data files were 301 performed using ImageJ analysis software (version 1.43). Protein expression was 302 quantified from 3-6 biological replicates. 303 304 Analysis of pnp expression by Quantitative real-time PCR (qPCR) 305 306 To measure mRNA levels of PNPase the bacteria were grown in DMEM/1 % FBS 307 to OD600 = 0.3 with agitation at 37°C in 5% CO2. The log phase bacteria were 308 added to FaDu cells at a MOI of 100 and incubated in static conditions. After 2 h, 309 the cells were gently washed four times with serum free DMEM to remove 310 unbound bacteria. As a control, log phase bacteria were incubated under static 311 conditions in cell culture plates without FaDu cells. To obtain bacteria before and 312 after dispersion the bacterial infection was performed in an inverted Axio 313 Observer Z1 microscope (Carl Zeiss) at 37°C in 5% CO2. Before and after 314 dispersion unattached cells were washed twice in pre-warmed DMEM. To 315 stabilize RNA, RNAprotect (Qiagen) was added to the cultures. RNAprotect also 316 lysed the FaDu cells allowing the collection of the attached bacteria. The bacteria 317 were collected by centrifugation at 5000 x G for 10 min. The bacterial pellet was 318 treated with 15mg/ml lysozyme (Sigma) and Protease K (Qiagen) for 10 min to 319 lyse the bacteria. RNA was isolated with the RNeasy plus mini kit (Qiagen). 200 320 ng RNA was reverse transcribed using the SuperScript VILO Master Mix (Thermo 321 Fisher). PCR amplification was performed using a Roche Lightcycler 480 322

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

15

machine with LightCycler 480 SYBR Green I Master Mix (Roche Diagnostics) and 323 primer pairs specific for pnp, pilN, pilO, pilW and S10 (NMC0129). The primer 324 sequences are presented in Table 2. The PCR program was adapted from Roche’s 325 LightCycler 480 SYBR Green I Master Mix instructions, with 40 cycles of 326 amplification and an annealing temperature of 60°C. The Ct values were 327 determined using the second derivative max method. Relative expression was 328 analyzed with the LightCycler 480 Software 1.5, using S10 as an internal 329 standard, and was normalized to log phase bacteria. Specificity of the primers 330 was verified by melting curve analysis. mRNA expression was analyzed in three 331 biological replicates with triplicate samples. 332 333 Microarray analysis 334 335 Log phase cultures grown in GC were harvested, and RNA was immediately 336 stabilized using 2% phenol/38% ethanol solution for 30 min at 4 °C. The bacteria 337 were then collected by centrifugation and lysed with 50 mg/ml of lysozyme in 338 Tris-EDTA buffer for 5 min at room temperature. RNA was isolated using a SV 339 Total RNA Purification kit (Promega), including an on-column DNase I digest, 340 and eluted in 100 μL of H2O. RNA concentration and purity were analyzed using a 341 NanoDrop spectrophotometer, and RNA integrity was confirmed using 342 denaturing agarose gel electrophoresis. cDNA synthesis and microarray analyses 343 were performed by Roche’s NimbleGen Gene Expression Services using a 344 custom-made whole genome ORF expression array for N. meningitidis FAM18 345 (NC_008767), with a 2.1MK 12-plex array format that contained 10 probes per 346 gene (18780 probes) with 7 replicates (131460 probes in total on the final 347

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

16

array). Gene expression data were analyzed using DNASTAR ArrayStarR 348 software. Normalized expression values were generated using quantile 349 normalization and the Robust Multichip Average (RMA) algorithm (43-45) with a 350 fold-change cut-off of ≥ 2.0. Microarray analyses were performed using six 351 replicates for each sample. One wild-type sample was excluded from the 352 analysis. The genes were clustered into COG categories according to the COG 353 classification for FAM18 on the NeMeSys web site(46). 354 355 Capsule ELISA 356 357 Capsular polysaccharides were quantified using whole cell enzyme-linked 358 immunosorbent assays (ELISA) with a monoclonal anti-serogroup C capsule 359 antibody (National Institute for Biological Standards and Control, code 95/678), 360 as previously described (42). Purified serogroup C polysaccharides (National 361 Institute for Biological Standards and Control, code 07/318) were used as the 362 positive control. The ELISA plates were coated with 100 µl of bacteria in PBS and 363 incubated overnight at 4 °C. The plates were subsequently blocked in 5% BSA for 364 2 h and incubated with a 1:400 dilution of capsule monoclonal antibody 365 overnight at 4 °C. For detection, the plates were incubated with a 1:5000 dilution 366 of horseradish peroxidase-conjugated goat anti-mouse immunoglobulin G for 1 h. 367 Plate-bound peroxidase was detected using 3,3',5,5'-tetramethylbenzidine 368 (TMB) (Invitrogen), and absorbance was measured at 490 nm. Capsule 369 expression was assayed once using triplicate samples. 370 371 Microbial adhesion to solvents (MATS) 372

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

17

373 MATS was performed using the modified procedures described in Ly et al (47). 374 N. meningitidis were harvested following overnight growth on GC agar plates, 375 resuspended in PBS and filtered through a 5-µm filter to remove clumps. The 376 OD600 was measured and the cell suspensions were equalized to an OD600 of 0.4. 377 The bacteria were pelleted using centrifugation at 3000× g and resuspended in 378 PBS. Bacterial suspensions were mixed at a 4:1 ratio with hexadecane in 379 microcentrifuge tubes, vortexed for 30 sec to thoroughly mix the two phases and 380 left to stand at room temperature for 15 min to allow the phases to separate. An 381 aliquot of the aqueous phase was measured at OD600 nm. The percentage of 382 hydrophobicity was calculated using the formula (1-(Abs2/Abs1))×100%. 383 Hydrophobicity was assayed three times using triplicate samples. 384 385 Biofilm assay 386 387 Bacteria were grown on GC agar overnight. Bacteria were resuspended in GC 388 liquid with 1% Kellogg’s to an OD of 0.05 in 96-well microtiter plates and 389 allowed to grow for 24 hours at 37°C in 5% CO2. Unbound bacteria were washed 390 away by washing the samples 2 times with PBS, and bacteria was then stained 391 for 2 min with 0.3% Crystal violet. Unbound dye was removed by washing the 392 samples 2 times in PBS. The stained biofilms were finally resuspended in 33% 393 acetic acid, and absorbance was measured at 630 nm. Biofilm formation was 394 assayed three times using triplicate samples. 395 396 LOS detection 397

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

18

LOS was isolated, separated on tricine SDS-PAGE and visualized by silver 398 staining as previously described (48) 399 400 Electron microscopy 401 402 To stain the bacteria, we used a previously described protocol (49). Briefly, the 403 bacteria were gently suspended in PBS and then added to formvar-coated grids 404 for 5 min. They were then fixed in 1% glutaraldehyde for 5 min. The grids were 405 washed twice with water, incubated with 1% ammonium molybdate for 20 s, air-406 dried and analyzed using a TECNAI G2 Sprint BioTWIN electron microscope 407 (FEI). Quantification of pili bundling was manually performed using 75 frames 408 (34 wild-type and 41 ∆pnp) using ImageJ (NIH, Bethesda, MD, USA). The 409 quantifications were performed in a blinded manner. 410 411 Mouse model of infection 412 413 The hCD46Ge transgenic mouse line (CD46+/+) harbors the complete human 414 CD46 gene and expresses CD46 in a human-like pattern (41, 50, 51). To study the 415 clearance of bacteria from the blood, transgenic mice (n = 7) were challenged 416 intraperitoneally with 5 x 107 CFU bacteria suspended in 100 μl PBS. Blood 417 samples were obtained from the tail vein at different time points after infection 418 (2 h, 6 h and 24 h). Bacterial counts were determined by plating serial dilutions 419 of the samples on GC plates. The bacteria were vortexed thoroughly before 420 plating to break up aggregates. The mouse experiments described in the present 421 study were conducted at the animal facility of Stockholm University. Animal care 422

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

19

and experiments were performed according to institutional guidelines. All 423 protocols were approved by the Swedish Ethical Committee on Animal 424 Experiments. 425 426 Motility 427 428 Motility was analyzed as previously described (52). Briefly, bacteria were 429 suspended in 3 ml of pre-warmed GC broth containing 10% Kellogg’s 430 supplement in 35-mm poly-D-lysine-coated glass bottom dishes (MatTek) and 431 incubated for 1 h prior to microscopy. The cell culture dishes were transferred to 432 a humidified incubation chamber (37°C, 5% CO2) connected to an inverted 433 fluorescence microscope (Cell observer Z1, Carl Zeiss). The images captured 434 during the time-lapse experiments were further processed using AxioVision 435 software (Carl Zeiss). The tracking of bacteria was performed using an automatic 436 tracking module in the AxioVision software suite, version 4.7, and each 437 individual track was manually inspected for automatic tracking errors. The 438 velocity distributions of n = 37 individual 60 s tracks were analyzed. 439 440 Statistical analysis 441 442 Differences between two groups were analyzed using Student’s t-test. 443 Differences between multiple groups were analyzed using ANOVA (analysis of 444 variance) followed by the Bonferroni post hoc test. Significant differences 445 between ratios or percentages were analyzed after log transformation of the 446

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

20

data. P values below 0.05 were considered statistically significant. Statistical 447 analyses were performed using Graph Pad Prism 5 software. 448

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

21

Results 449 450 NMC0710 is a PNPase homolog 451 452 A blast search was performed using E. coli PNPase as a query. It yielded a 453 potential PNPase homolog at the meningococcal locus NMC0710. The proteins 454 share 62.55% identity and are of a similar size (Fig. 1A). To confirm that 455 NMC0710 has the same enzymatic function as PNPase, a His-tagged version of 456 NMC0710 was overexpressed in E. coli. Following metal affinity purification, a 457 single band with a size that was similar to that of the expected protein was 458 visible on a Coomassie-stained gel (Fig. 1B). Similar to the E. coli protein N. 459 meningitidis, NMC0710 was predicted to have no transmembrane segments and 460 no translocation signals. During the purification N. meningitidis, His6-NMC0710 461 was found in the soluble fraction, suggesting that it is not membrane associated. 462 PNPase can degrade RNA polymers by phosphorolysis to release nucleotide 463 diphosphates. This activity was determined for NMC0710 using an enzymatic 464 assay in which the formation of ADP from poly(A) was linked to NADH reduction 465 through lactate dehydrogenase and pyruvate kinase, as previously described 466 (38). The reaction is shown in Figure 1C. The Km and Vmax were estimated to be 467 0.50 mM and 5.55 U/mg, respectively, by varying the phosphate concentration 468 and plotting the inversed concentrations and activities in a Hill plot (Fig. 1D). 469 While the Km was similar to the 0.7 mM that was reported in E. coli, the Vmax was 470 substantially faster than the 0.7 U/mg that was previously reported (53). In 471

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

22

summary, these data show that NM0710 has PNPase activity. Consequently, in 472 this report, NMC0710 will be referred to as the PNPase of N. meningitidis. 473 474 PNPase is required for optimal growth 475 476 With the PNPase enzymatic activity of NMC0710 established, a PNPase deletion 477 mutant (Δpnp) was created in the N. meningitidis FAM20 background to 478 investigate the role of PNPase in meningococcal physiology and pathogenesis. A 479 complemented strain, Δpnp/pnp, which contained a copy of the pnp gene under 480 the control of its native promoter at a separate chromosomal location was also 481 constructed. To detect PNPase levels, antibodies were raised against 3 peptides 482 in the protein sequence (for peptide regions, see Figure 1 and the Materials and 483 Methods section). These antibodies confirmed that the Δpnp mutant lacked the 484 PNPase protein and that the Δpnp/pnp strain had PNPase levels that were 485 similar to those in the wild-type strain (Fig. S1A). During the cloning 486 experiments, it was observed that the Δpnp mutant formed smaller colonies on 487 the plates than the wild-type strain. To analyze these data in more detail, a 488 growth curve analysis was performed. The growth curve confirmed that the 489 Δpnp mutant had a slower growth rate than the wild-type (Fig. 2). The doubling 490 time was increased from 50 to 85 in the Δpnp mutant. This was similar to a 491 situation in which E. coli containing a PNPase deletion mutant increased the 492 doubling time from 30 to 60 minutes (54). The growth rate of the Δpnp/pnp 493 strain was similar to that of the wild-type. Because the Δpnp mutant showed 494 altered growth properties, we speculated that the expression of PNPase might be 495 differentially regulated during different growth phases. The expression of 496

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

23

PNPase was, however, shown to be stable throughout the growth phases (Fig. 497 S1B). Taken together, the PNPase-deficient meningococci displayed a decreased 498 growth rate, but the wild-type bacteria expressed stable amounts of PNPase 499 during different growth phases in liquid medium. 500 501 PNPase negatively regulates bacterial aggregation 502 503 During the growth studies, it was observed in visual inspections that the Δpnp 504 mutant cultures had a tendency to aggregate. To confirm this observation, 505 aggregation was analyzed using live-cell microscopy and culture sedimentation. 506 Live-cell microscopy of growing bacteria revealed that the Δpnp mutants formed 507 larger aggregates than the wild-type and the Δpnp/pnp strain at the same time 508 points (Fig. 3A). To analyze sedimentation, the bacteria were grown to an OD600 509 of 1 with agitation. The cultures were then transferred to static conditions, and 510 the OD of the surface layer was measured over time. As shown in Figure 3B, the 511 Δpnp mutant sedimented faster than the wild-type and the Δpnp/pnp strain, 512 confirming the observations made under microscopy. To determine whether the 513 observed phenotypes were caused by the inactivation of PNPase and not by a 514 secondary mutation that could potentially have arisen in a slow-growing mutant, 515 the Δpnp mutant was complemented with a copy of pnp under the control of an 516 IPTG-inducible promoter. The growth and aggregation of Δpnp/indPNP was 517 similar to the Δpnp mutant when grown in the absence of IPTG. When IPTG was 518 added, the bacteria again grew normally (Fig. S2), and no excessive aggregation 519 was observed (data not shown). These data show that PNPase deficiency leads to 520 increased aggregation of N. meningitidis. 521

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

24

522 Lack of PNPase leads to increased adhesion 523 524 The formation of aggregates is believed to be important during the initial stage of 525 infection when the bacteria attempt to adhere to human cells (14). Therefore, the 526 increased aggregation of the Δpnp mutant may also influence its ability to 527 adhere. To investigate this, adhesion assays with human epithelial FaDu cells 528 were performed. The cells were infected at a MOI of 100 with exponentially 529 growing bacteria for 2 h, and unbound bacteria were washed away. The bound 530 bacteria were plated to obtain viable counts. The results shown in Figure 3C 531 demonstrate that the Δpnp mutant adhere significantly better to the host cells 532 than the wild-type and Δpnp/pnp strains. Because PNPase negatively affects 533 aggregation and adhesion, we wanted to investigate the expression of PNPase 534 before and after attachment to cells. When planktonic bacteria and bacteria 535 attached to epithelial cells were compared, we found that PNPase expression 536 was higher in the attached bacteria than in the planktonic bacteria at both the 537 mRNA level (Fig. 4A) and the protein level (Fig. 4B). Attached bacteria also 538 expressed increased amounts PNPase mRNA after aggregate dispersion (Fig. S3). 539 These data suggest that PNPase-deficient meningococci adhered in larger 540 numbers than wild-type bacteria to epithelial host cells and that PNPase was up-541 regulated in the bacteria attached to host cells. 542 543 PNPase affects global gene expression in N. meningitidis 544 545

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

25

In E. coli, PNPase regulates the expression levels of many genes through its roles 546 in mRNA degradation (54) and sRNA regulation (23). To investigate whether 547 PNPase also plays a major role in gene regulation in N. meningitidis, a microarray 548 analysis of wild-type and Δpnp mutant bacteria was performed using log phase 549 cultures grown in GC liquid. The microarray revealed 469 differentially 550 expressed genes (> 2-fold change in expression), 263 of which were up-regulated 551 and 206 of which were down-regulated. A summary of the expression changes 552 based on the clusters of orthologous groups (COG) classification of all of the 553 genes is presented in Table 3. The full list of all of the differentially expressed 554 genes is presented in Table S1. The transcriptomic data revealed that there were 555 dramatic changes in the expression of genes involved in central metabolism. In 556 the COG group, ‘Energy production and conversion’, 25 of the 120 genes were 557 down-regulated, especially those affecting the Krebs cycle. Conversly, the 558 increased expression of genes involved in the glycolytic Entner Doudoroff 559 pathway suggested that the Δpnp mutants utilize this alternative ATP generating 560 pathway to compensate for the low Krebs cycle activity and increased glycolytic 561 activity. Additionally, there were also many down-regulated genes in the COG 562 group Amino acid transport and metabolism. Among the up-regulated genes, 563 those in the ‘Translation, ribosomal structure and biogenesis’ COG class stood 564 out, with nearly one-third (49 of 159) of the genes up-regulated. 565 566 Bacterial surface properties are unchanged in Δpnp mutants 567 568 The microarray revealed that several genes involved in capsule synthesis, 569 including siaD (6.7 times), sacA (2.4 times), ctrA (2.05 times) and ctrD (2.29 570

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

26

times), were up-regulated in the Δpnp mutant. Because the capsule is an 571 important factor during adhesion to both biotic and abiotic surfaces (55), we 572 sought to further investigate the status of the capsule. To measure whether these 573 changes in expression affected the capsule in the Δpnp mutant, the amount of 574 capsule was measured using whole-cell ELISA, as previously described (42). The 575 ELISA revealed that there was no significant change in the amount of capsule 576 present on the bacterial surface (Fig. 5A). Because the capsule is much more 577 hydrophilic than the underlying bacterial cell surface, the degree of capsulation 578 can also be measured by measuring cellular hydrophobicity (55). We measured 579 hydrophobicity using microbial adhesion to solvents (MATS) assays (47). In 580 these assays, the bacteria were suspended in a buffered aqueous (polar) solution 581 and mixed with a non-polar n-alkene, hexadecane. The percentage of bacteria 582 present in the polar phase was measured after phase separation. The results 583 showed that there was no significant difference between the Δpnp mutant and 584 the wild-type or the Δpnp/pnp strain. The capsule-negative ΔsiaD mutant was 585 significantly more hydrophobic as a result of the loss of its capsule (Fig. 5B). 586 Because the Δpnp mutants showed an increased ability to adhere to human cells, 587 we also wanted to investigate whether this ability extended to abiotic surfaces 588 and to examine the ability of the bacteria to form biofilms, as in the E. coli 589 PNPase mutant (56). There was, however, no change in the ability of the Δpnp 590 mutant to form stationary biofilms (Fig. 5C). This correlates well with previous 591 studies that have shown that changes in aggregation did not increase binding to 592 plastic surfaces in N. meningitidis (17). 593 594

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

27

To directly analyze the role of the capsule in Δpnp aggregation, a Δpnp/indPNP 595 ΔsiaD double mutant strain was analyzed using time-lapse microscopy in the 596 absence of IPTG (Fig. S4). The aggregation in the double mutant was similar to 597 that observed in the Δpnp mutant, showing direct evidence that the capsule was 598 not involved in the observed aggregation. 599 The levels of Opa proteins were also analyzed (Fig. 5D) because they play roles in 600 adhesion and because they are prone to antigenic shifts (57). The microarray 601 also showed that the opacity protein OpaB (NMC1551) was up-regulated 3.3-fold 602 in the Δpnp mutant (for details see Table S1). The total level of Opa proteins was 603 detected using immunoblotting, but it was not significantly affected, neither was 604 the level of Opa 1800 and Opa 540 (Fig. S5). This indicates that changes in Opa 605 expression did not increase adhesion to host cells. The LOS pattern of the Δpnp 606 mutant was also investigated and found to be similar to that of the wild-type 607 (Fig. S5). Taken together, these results show that the Δpnp mutants retained 608 capsule levels, hydrophobicity, biofilm formation Opa expression and LOS 609 pattern compared to wild-type. 610 611 Pili bundling is increased in Δpnp mutants 612 613 The process of aggregation and adhesion in N. meningitidis is dependent on type 614 IV pili (58-60). To investigate whether the aggregation of Δpnp was dependent 615 on pili formation, a Δpnp/indPNP ΔpilE double mutant strain was monitored 616 using time-lapse microscopy in the absence of IPTG. The double mutant 617 presented a dramatically reduction in aggregate formation compared to the 618 Δpnp/indPNP strain, as expected (Fig. 6). At later time points, some aggregates 619

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

28

were observed, but these might result from improper cell division or 620 segregation. This is supported by the fact that many bacteria showed aberrant 621 cell shapes and were present as small clusters that did not resemble normal 622 aggregates. Growth curve analysis of the Δpnp/indPNP ΔpilE double mutant also 623 revealed that it grew slower than the Δpnp mutant (Fig. S6), showing that the 624 growth defect of the Δpnp mutant is not related to hyper-aggregation. Overall, 625 these data show that the pili are important, if not essential, for aggregate 626 formation in the Δpnp mutant. To exclude that the observed phenotypes was 627 caused by phase variation of pilE, the pilE gene of the Δpnp mutant was 628 sequenced and found to be identical to the that of the wild-type. To find out 629 whether the Δpnp mutants showed altered pilation, the pili were visualized using 630 transmission electron microscopy. The electron micrographs shown in Figure 7A 631 demonstrate that the Δpnp mutant is pilated and that it displays an increased 632 number of pili bundles. The quantification of pili bundling (Fig. 7B) showed that 633 the majority of the pili were present in bundles in the Δpnp mutant, whereas the 634 majority were present as single pili (non-bundled) in the wild-type cells. 635 Previous data showing that increased pili bundling is correlated with increased 636 aggregation and adhesion might explain the changes observed in these 637 properties (39). The Δpnp mutant bacteria were also shown to retain their 638 twitching motility (Fig. S7), which is also dependent on pili (61). The speed of the 639 twitching mobility was, however, slightly reduced in the mutant. To assess 640 whether the bundling of pili in the Δpnp mutant could be explained by changes in 641 pili proteins, the major pilin subunit PilE, the tip protein PilC and the retraction 642 ATPase PilT were investigated using western blot analysis. A slight increase in 643 the level of PilE was indeed observed, and this might have contributed to the 644

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

29

observed phenotype (Fig. 8A). No significant differences were observed in the 645 levels of PilC and PilT (Fig. 8B-C). The transcription data (Table S1) showed that 646 the three pilus assembly proteins were up-regulated in the Δpnp mutant: pilN 647 (2.45-fold), pilO (2.07-fold) and pilW (2.48-fold). While PilN and PilO are 648 involved in early pilus assembly, PilW functions to stabilize the pilus and pili 649 bundles (12). In the absence of pilW. the pili are unable to form bundles, 650 preventing aggregation (62). The expression of pilN, pilO and pilW was however 651 found to be up-regulated during attachment to FaDu cells, at the same time as 652 pnp, suggesting that PNPase does not directly inhibit their expression (Fig. S3). 653 Taken together, these results show that the excessive aggregation observed in 654 the Δpnp mutants is dependent on pili and is correlated with increased pili 655 bundling and elevated PilE expression levels. 656 657 Virulence of Δpnp is attenuated in vivo 658 659 To evaluate the importance of PNPase in vivo, we analyzed survival of the Δpnp 660 mutants in a mouse model of meningococcal infection. Mice were infected 661 intraperitoneally with 5 x 107 CFU of either wild-type or Δpnp bacteria. Venous 662 blood samples were collected after 2, 6 and 24 h to determine the level of 663 bacteremia The Δpnp mutants presented significantly lower bacterial counts in 664 the blood than the wild-type strain at 6 h post-infection (Fig. 9). A non-significant 665 decrease was also observed at 24 hours post-infection. At 2 hours post-infection, 666 there was however no change in bacterial numbers between the strains. This 667 shows that the Δpnp mutant showed a reduced ability to sustain bacteremia in 668 vivo. 669

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

30

Discussion 670 671 PNPase plays a central role in RNA turnover and regulation in most bacteria. 672 PNPase has previously been shown to regulate virulence properties in several 673 species of bacteria (24-34). The results presented in this paper show that 674 PNPase plays an important role in regulating aggregation, adhesion and 675 virulence in N. meningitidis. The phenotypes observed in the mutants in this 676 study were different from those previously described in PNPase mutants. This is 677 not surprising given the wide range of phenotypes associated with these 678 mutants. These results demonstrate that although the enzymatic function of 679 PNPase is conserved, its downstream targets vary considerably between 680 different bacteria. 681 682 In this study, we purified the protein encoded by the locus NMC0710 of FAM20 683 and confirmed PNPase enzyme activity. In E. coli PNPase controls the mRNA 684 level of a large number of genes by regulating their half-life, and is required for a 685 optimal growth rate (54). Similar to these findings, a PNPase-deficient strain of 686 N. meningitidis showed an impaired growth rate and a microarray analysis 687 revealed 469 differentially expressed genes in the PNPase mutant. Large 688 transcriptional changes were found in genes associated with central metabolism, 689 which is interesting because these processes are also affected in PNPase mutants 690 in E. coli. Indeed PNPase enzymatic activity is in turn regulated by both citrate 691 and ATP in E. coli, providing feedback from metabolic pathways (53, 63). A 692 recent study described a set of 98 putative sRNA molecules that were 693

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

31

transcribed in N. meningitidis, some of which might be involved in the regulatory 694 changes observed in the pnp mutant (64). Because the microarray in this study 695 only included predicted protein coding genes and not sRNAs, analyzing the 696 contributions of these genes was not within the scope of this study. 697 698 Deletion of PNPase in meningococci resulted in increased bacterial aggregation 699 and pilus bundling. N. meningitidis aggregation and dispersion are regulated 700 processes that are thought to be important for host colonization. In the 701 literature, there are many examples of mutations that abolish aggregation, and 702 these alterations most notably involve markers related to pilus biogenesis, such 703 as PilE, PilW and PilX (14, 62). There are also examples of mutations that 704 increase aggregation. Most of these are also involved in pili function and 705 modification. Notable examples include the pili retraction ATPase PilT (62) and 706 the pili phosphoglycerol ligase pptB (15). In these mutants, increased 707 aggregation was associated with increased pili bundling. It has also been shown 708 that glycosylation plays a role in pili bundling because purified pili from a PilE 709 S63A mutant that lacks glycosylation at S63 that site forms more insoluble 710 aggregates than the wild-type (16). Mutations in genes encoding proteins that do 711 not have any known interaction with the pilus, such as NafA, have also been 712 shown to result in excessive aggregation (39). Our results show that there was 713 an up-regulation of PilE protein levels in the Δpnp mutant that might have either 714 contributed to or been a result of increased pili bundling. The microarray data 715 showed that the pili assembly genes pilN, pilO and pilW were up-regulated, which 716 might also have contributed to the observed increase in bundling. 717

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

32

Despite the existence of studies of different aggregation mutants, the underlying 718 regulation of pili bundling is largely unknown. In this paper, we show that 719 PNPase, which is unlikely to be directly involved in pili-related functions, acts as 720 an anti-aggregation factor by suppressing excessive pili bundling. 721 722 The Δpnp mutant attached more efficiently to epithelial host cells than the wild-723 type strain. N. meningitidis adhere to human cells either in microcolonies or as 724 single diplococci that subsequently join together or grow to form microcolonies. 725 In this study we show that the PNPase mutant attach in greater numbers than 726 the wild-type, which could occur either directly through increased bacteria-cell 727 binding or indirectly through increased bacteria-bacteria interactions leading to 728 attachment of larger aggregates. After the initial adhesion, the microcolonies 729 break up, allowing for more intimate adhesion (65). In wild-type meningococci, 730 PNPase expression was induced in bacteria adhering to epithelial cells compared 731 to planktonic bacteria. This PNPase up-regulation might destabilize the 732 aggregates, paving the way toward more intimate adhesions and subsequent 733 bacterial invasion. Indeed we show that the expression of PNPase is higher in 734 attached bacteria after aggregate dispersion. It is also interesting that PNPase 735 acts as a negative regulator of several genes known to be involved in capsule 736 synthesis (Table S1), a process that has been shown to be down-regulated upon 737 intimate adhesion (18). 738 739 In this study, we show that infecting mice with the ∆pnp mutant led to less 740 bacteremia than infection with the wild-type strain. While this shows that 741 PNPase is required for full virulence in this mouse model, the mechanism for the 742

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

33

decreased bacterial survival is unclear. Previous studies of bacteremia that used 743 the hyper-aggregative nafA and pilT deficient N. meningitidis mutants showed 744 that these mutants also displayed decreased survival (39, 66). We cannot 745 exclude that the decreased bacterial blood counts might have been due to an 746 increase in bacteria binding to host cells as a result of excessive aggregation. 747 Indeed, it has been shown that the hyper-aggregative pptB mutant releases 748 significantly fewer cells out into the media after attachment than the wild-type 749 (15). An important factor to consider is that the growth rate of the Δpnp mutant 750 is decreased compared to that of the wild-type bacteria, which places it at a 751 disadvantage to the host in an in vivo setting. The fact that the bacterial numbers 752 in the blood did not differ at 2 h post-infection suggests that the mutant was not 753 hindered from entering the bloodstream. 754 755 In conclusion, we have showed that PNPase negatively affects aggregation and 756 adhesion in N. meningitidis. Aggregation was shown to be dependent on pili and 757 likely to be mediated by increased pili bundling. PNPase was also shown to be 758 required for full survival of the bacteria in an in vivo setting in a mouse model of 759 infection. 760 761

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

34

Funding information 762 763 This work was supported by the Swedish Research Council, the Swedish Cancer 764 Society, Torsten Söderbergs Stiftelse and Ragnar Söderbergs Stiftelse. 765 766

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

35

References 767 1. Stephens DS. 2009. Biology and pathogenesis of the evolutionarily 768 successful, obligate human bacterium Neisseria meningitidis. Vaccine 27 769

Suppl 2:B71-77. 770 2. Lo H, Tang CM, Exley RM. 2009. Mechanisms of avoidance of host 771 immunity by Neisseria meningitidis and its effect on vaccine 772 development. The Lancet infectious diseases 9:418-427. 773 3. Sjolinder H, Eriksson J, Maudsdotter L, Aro H, Jonsson AB. 2008. 774 Meningococcal outer membrane protein NhhA is essential for 775 colonization and disease by preventing phagocytosis and complement 776 attack. Infect Immun 76:5412-5420. 777 4. Lewis LA, Ngampasutadol J, Wallace R, Reid JE, Vogel U, Ram S. 2010. 778 The meningococcal vaccine candidate neisserial surface protein A (NspA) 779 binds to factor H and enhances meningococcal resistance to complement. 780 PLoS ONE 6:e1001027. 781 5. Seib KL, Serruto D, Oriente F, Delany I, Adu-Bobie J, Veggi D, Arico B, 782 Rappuoli R, Pizza M. 2009. Factor H-binding protein is important for 783 meningococcal survival in human whole blood and serum and in the 784 presence of the antimicrobial peptide LL-37. Infect Immun 77:292-299. 785 6. Lewis LA, Shafer WM, Dutta Ray T, Ram S, Rice PA. 2013. 786 Phosphoethanolamine residues on the lipid A moiety of Neisseria 787 gonorrhoeae lipooligosaccharide modulate binding of complement 788 inhibitors and resistance to complement killing. Infect Immun 81:33-42. 789 7. Jarva H, Ram S, Vogel U, Blom AM, Meri S. 2005. Binding of the 790 complement inhibitor C4bp to serogroup B Neisseria meningitidis. J 791 Immunol 174:6299-6307. 792 8. Vogel U, Weinberger A, Frank R, Muller A, Kohl J, Atkinson JP, Frosch 793 M. 1997. Complement factor C3 deposition and serum resistance in 794 isogenic capsule and lipooligosaccharide sialic acid mutants of serogroup 795 B Neisseria meningitidis. InfectImmun 65:4022-4029. 796 9. Kahler CM, Martin LE, Shih GC, Rahman MM, Carlson RW, Stephens 797 DS. 1998. The (α2→8)-Linked Polysialic Acid Capsule and 798 Lipooligosaccharide Structure Both Contribute to the Ability of Serogroup 799 B Neisseria meningitidis To Resist the Bactericidal Activity of Normal 800 Human Serum. Infect Immun 66:5939-5947. 801 10. Virji M, Kayhty H, Ferguson DJ, Alexandrescu C, Heckels JE, Moxon 802 ER. 1991. The role of pili in the interactions of pathogenic Neisseria with 803 cultured human endothelial cells. Mol Microbiol 5:1831-1841. 804 11. Wall D, Kaiser D. 1999. Type IV pili and cell motility. Mol Microbiol 805 32:01-10. 806 12. Carbonnelle E, Helaine S, Nassif X, Pelicic V. 2006. A systematic genetic 807 analysis in Neisseria meningitidis defines the Pil proteins required for 808 assembly, functionality, stabilization and export of type IV pili. Mol 809 Microbiol 61:1510-1522. 810 13. Rudel T, Facius D, Barten R, Scheuerpflug I, Nonnenmacher E, Meyer 811 TF. 1995. Role of pili and the phase-variable PilC protein in natural 812

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

36

competence for transformation of Neisseria gonorrhoeae. Proc Natl Acad 813 Sci U S A 92:7986-7990. 814 14. Hélaine S, Carbonnelle E, Prouvensier L, Beretti J-L, Nassif X, Pelicic 815 V. 2005. PilX, a pilus-associated protein essential for bacterial 816 aggregation, is a key to pilus-facilitated attachment of Neisseria 817 meningitidis to human cells. Mol Microbiol 55:65-77. 818 15. Chamot-Rooke J, Mikaty G, Malosse C, Soyer M, Dumont A, Gault J, 819 Imhaus AF, Martin P, Trellet M, Clary G, Chafey P, Camoin L, Nilges M, 820 Nassif X, Dumenil G. 2011. Posttranslational modification of pili upon 821 cell contact triggers N. meningitidis dissemination. Science 331:778-782. 822 16. Marceau M, Forest K, Béretti J-L, Tainer J, Nassif X. 1998. 823 Consequences of the loss of O-linked glycosylation of meningococcal type 824 IV pilin on piliation and pilus-mediated adhesion. Mol Microbiol 27:705-825 715. 826 17. Mikaty G, Soyer M, Mairey E, Henry N, Dyer D, Forest KT, Morand P, 827 Guadagnini S, Prévost MC, Nassif X, Duménil G. 2009. Extracellular 828 Bacterial Pathogen Induces Host Cell Surface Reorganization to Resist 829 Shear Stress. PLoS Pathog 5:e1000314. 830 18. Deghmane A-E, Giorgini D, Larribe M, Alonso J-M, Taha M-K. 2002. 831 Down-regulation of pili and capsule of Neisseria meningitidis upon 832 contact with epithelial cells is mediated by CrgA regulatory protein. Mol 833 Microbiol 43:1555-1564. 834 19. Donovan WP, Kushner SR. 1986. Polynucleotide phosphorylase and 835 ribonuclease II are required for cell viability and mRNA turnover in 836 Escherichia coli K-12. Proc Natl Acad Sci U S A 83:120-124. 837 20. Sarkar D, Fisher PB. 2006. Polynucleotide phosphorylase: an 838 evolutionary conserved gene with an expanding repertoire of functions. 839 Pharmacol Ther 112:243-263. 840 21. Bandyra KJ, Bouvier M, Carpousis AJ, Luisi BF. 2013. The social fabric 841 of the RNA degradosome. Biochimica et Biophysica Acta (BBA) - Gene 842 Regulatory Mechanisms 1829:514-522. 843 22. Stead MB, Marshburn S, Mohanty BK, Mitra J, Castillo LP, Ray D, van 844 Bakel H, Hughes TR, Kushner SR. 2011. Analysis of Escherichia coli 845 RNase E and RNase III activity in vivo using tiling microarrays. Nucleic 846 Acids Res 39:3188-3203. 847 23. De Lay N, Gottesman S. 2011. Role of polynucleotide phosphorylase in 848 sRNA function in Escherichia coli. RNA 17:1172-1189. 849 24. Yamanaka K, Inouye M. 2001. Selective mRNA degradation by 850 polynucleotide phosphorylase in cold shock adaptation in Escherichia 851 coli. J Bacteriol 183:2808-2816. 852 25. Haddad N, Burns CM, Bolla JM, Prévost H, Fédérighi M, Drider D, 853 Cappelier JM. 2009. Long-term survival of Campylobacter jejuni at low 854 temperatures is dependent on polynucleotide phosphorylase activity. 855 Appl Environ Microbiol 75:7310-7318. 856 26. Henry A, Shanks J, van Hoof A, Rosenzweig JA. 2012. The Yersinia 857 pseudotuberculosis degradosome is required for oxidative stress, while 858 its PNPase subunit plays a degradosome-independent role in cold growth. 859 FEMS Microbiol Lett 336:139-147. 860

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

37

27. Clements MO, Eriksson S, Thompson A, Lucchini S, Hinton JC, 861 Normark S, Rhen M. 2002. Polynucleotide phosphorylase is a global 862 regulator of virulence and persistency in Salmonella enterica. Proc Natl 863 Acad Sci U S A 99:8784-8789. 864 28. Ygberg SE, Clements MO, Rytkonen A, Thompson A, Holden DW, 865 Hinton JC, Rhen M. 2006. Polynucleotide phosphorylase negatively 866 controls spv virulence gene expression in Salmonella enterica. Infect 867 Immun 74:1243-1254. 868 29. Rosenzweig JA, Weltman G, Plano GV, Schesser K. 2005. Modulation of 869 yersinia type three secretion system by the S1 domain of polynucleotide 870 phosphorylase. J Biol Chem 280:156-163. 871 30. Rosenzweig JA, Chromy B, Echeverry A, Yang J, Adkins B, Plano GV, 872 McCutchen-Maloney S, Schesser K. 2007. Polynucleotide phosphorylase 873 independently controls virulence factor expression levels and export in 874 Yersinia spp. FEMS Microbiol Lett 270:255-264. 875 31. Haddad N, Tresse O, Rivoal K, Chevret D, Nonglaton Q, Burns CM, 876 Prévost H, Cappelier JM. 2012. Polynucleotide phosphorylase has an 877 impact on cell biology of Campylobacter jejuni. Front Cell Infect Microbiol 878 2:30. 879 32. Palanisamy SK, Fletcher C, Tanjung L, Katz ME, Cheetham BF. 2010. 880 Deletion of the C-terminus of polynucleotide phosphorylase increases 881 twitching motility, a virulence characteristic of the anaerobic bacterial 882 pathogen Dichelobacter nodosus. FEMS Microbiol Lett 302:39-45. 883 33. Rouf SF, Ahmad I, Anwar N, Vodnala SK, Kader A, Römling U, Rhen M. 884 2011. Opposing contributions of polynucleotide phosphorylase and the 885 membrane protein NlpI to biofilm formation by Salmonella enterica 886 serovar Typhimurium. J Bacteriol 193:580-582. 887 34. Carzaniga T, Antoniani D, Dehò G, Briani F, Landini P. 2012. The RNA 888 processing enzyme polynucleotide phosphorylase negatively controls 889 biofilm formation by repressing poly-N-acetylglucosamine (PNAG) 890 production in Escherichia coli C. BMC Microbiol 12:270. 891 35. Hey A, Li M-S, Hudson MJ, Langford PR, Kroll JS. 2013. Transcriptional 892 Profiling of Neisseria meningitidis Interacting with Human Epithelial Cells 893 in a Long-Term In Vitro Colonization Model. Infect Immun 81:4149-4159. 894 36. Rahman M, Kallstrom H, Normark S, Jonsson AB. 1997. PilC of 895 pathogenic Neisseria is associated with the bacterial cell surface. 896 MolMicrobiol 25:11-25. 897 37. Kellogg DS, Jr., Cohen IR, Norins LC, Schroeter AL, Reising G. 1968. 898 Neisseria gonorrhoeae. II. Colonial variation and pathogenicity during 35 899 months in vitro. J Bacteriol 96:596-605. 900 38. Fontanella L, Pozzuolo S, Costanzo A, Favaro R, Dehò G, Tortora P. 901 1999. Photometric Assay for Polynucleotide Phosphorylase. Anal Biochem 902 269:353-358. 903 39. Kuwae A, Sjölinder H, Eriksson J, Eriksson S, Chen Y, Jonsson AB. 904 2011. NafA negatively controls Neisseria meningitidis piliation. PLoS One 905 6:e21749. 906 40. Elkins C, Thomas CE, Seifert HS, Sparling PF. 1991. Species-specific 907 uptake of DNA by gonococci is mediated by a 10-base-pair sequence. J 908 Bacteriol 173:3911-3913. 909

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

38

41. Sjolinder H, Jonsson AB. 2007. Imaging of disease dynamics during 910 meningococcal sepsis. PLoS ONE 2:e241. 911 42. Jones A, Geörg M, Maudsdotter L, Jonsson AB. 2009. Endotoxin, 912 capsule, and bacterial attachment contribute to Neisseria meningitidis 913 resistance to the human antimicrobial peptide LL-37. J Bacteriol 914 191:3861-3868. 915 43. Bolstad BM, Irizarry RA, Åstrand M, Speed TP. 2003. A comparison of 916 normalization methods for high density oligonucleotide array data based 917 on variance and bias. Bioinformatics 19:185-193. 918 44. Irizarry RA, Hobbs B, Collin F, Beazer‐Barclay YD, Antonellis KJ, 919 Scherf U, Speed TP. 2003. Exploration, normalization, and summaries of 920 high density oligonucleotide array probe level data. Biostatistics 4:249-921 264. 922 45. Irizarry RA, Bolstad BM, Collin F, Cope LM, Hobbs B, Speed TP. 2003. 923 Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res 924 31:e15. 925 46. Rusniok C, Vallenet D, Floquet S, Ewles H, Mouze-Soulama C, Brown 926 D, Lajus A, Buchrieser C, Medigue C, Glaser P, Pelicic V. 2009. 927 NeMeSys: a biological resource for narrowing the gap between sequence 928 and function in the human pathogen Neisseria meningitidis. Genome Biol 929 10:R110. 930 47. Ly MH, Vo NH, Le TM, Belin JM, Waché Y. 2006. Diversity of the surface 931 properties of Lactococci and consequences on adhesion to food 932 components. Colloids and Surfaces B: Biointerfaces 52:149-153. 933 48. Albiger B, Johansson L, Jonsson A-B. 2003. Lipooligosaccharide-934 Deficient Neisseria meningitidis Shows Altered Pilus-Associated 935 Characteristics. Infect Immun 71:155-162. 936 49. Helaine S, Carbonnelle E, Prouvensier L, Beretti JL, Nassif X, Pelicic V. 937 2005. PilX, a pilus-associated protein essential for bacterial aggregation, is 938 a key to pilus-facilitated attachment of Neisseria meningitidis to human 939 cells. Mol Microbiol 55:65-77. 940 50. Johansson L, Rytkonen A, Bergman P, Albiger B, Kallstrom H, Hokfelt 941 T, Agerberth B, Cattaneo R, Jonsson AB. 2003. CD46 in meningococcal 942 disease. Science 301:373-375. 943 51. Johansson L, Rytkonen A, Wan H, Bergman P, Plant L, Agerberth B, 944 Hokfelt T, Jonsson AB. 2005. Human-like immune responses in CD46 945 transgenic mice. J Immunol 175:433-440. 946 52. Eriksson J, Eriksson OS, Maudsdotter L, Palm O, Engman J, Sarkissian 947 T, Aro H, Wallin M, Jonsson A-B. 2015. Characterization of motility and 948 piliation in pathogenic Neisseria. BMC Microbiol 15:92. 949 53. Del Favero M, Mazzantini E, Briani F, Zangrossi S, Tortora P, Dehò G. 950 2008. Regulation of Escherichia coli Polynucleotide Phosphorylase by 951 ATP. J Biol Chem 283:27355-27359. 952 54. Mohanty BK, Kushner SR. 2003. Genomic analysis in Escherichia coli 953 demonstrates differential roles for polynucleotide phosphorylase and 954 RNase II in mRNA abundance and decay. Mol Microbiol 50:645-658. 955 55. Bartley SN, Tzeng Y-L, Heel K, Lee CW, Mowlaboccus S, Seemann T, Lu 956 W, Lin Y-H, Ryan CS, Peacock C, Stephens DS, Davies JK, Kahler CM. 957 2013. Attachment and Invasion of Neisseria meningitidis to Host Cells Is 958

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

39

Related to Surface Hydrophobicity, Bacterial Cell Size and Capsule. PLOS 959 ONE 8:e55798. 960 56. Carzaniga T, Antoniani D, Deho G, Briani F, Landini P. 2012. The RNA 961 processing enzyme polynucleotide phosphorylase negatively controls 962 biofilm formation by repressing poly-N-acetylglucosamine (PNAG) 963 production in Escherichia coli C. BMC Microbiol 12:270. 964 57. Virji M, Makepeace K, Ferguson DJP, Achtman M, Moxon ER. 1993. 965 Meningococcal Opa and Opc proteins: their role in colonization and 966 invasion of human epithelial and endothelial cells. Mol Microbiol 10:499-967 510. 968 58. Virji M, Makepeace K, Peak IRA, Ferguson DJP, Jennings MP, Moxon 969 ER. 1995. Opc- and pilus-dependent interactions of meningococci with 970 human endothelial cells: molecular mechanisms and modulation by 971 surface polysaccharides. Mol Microbiol 18:741-754. 972 59. Imhaus A-F, Duménil G. 2014. The number of Neisseria meningitidis 973 type IV pili determines host cell interaction. EMBO J 33:1767-1783. 974 60. Taktikos J, Lin YT, Stark H, Biais N, Zaburdaev V. 2015. Pili-Induced 975 Clustering of N. gonorrhoeae Bacteria. PLoS ONE 10:e0137661. 976 61. Merz AJ, So M, Sheetz MP. 2000. Pilus retraction powers bacterial 977 twitching motility. Nature 407:98-102. 978 62. Carbonnelle E, Hélaine S, Prouvensier L, Nassif X, Pelicic V. 2005. 979 Type IV pilus biogenesis in Neisseria meningitidis: PilW is involved in a 980 step occurring after pilus assembly, essential for fibre stability and 981 function. Mol Microbiol 55:54-64. 982 63. Nurmohamed S, Vincent HA, Titman CM, Chandran V, Pears MR, Du 983 D, Griffin JL, Callaghan AJ, Luisi BF. 2011. Polynucleotide Phosphorylase 984 Activity May Be Modulated by Metabolites in Escherichia coli. J Biol Chem 985 286:14315-14323. 986 64. Fagnocchi L, Bottini S, Golfieri G, Fantappiè L, Ferlicca F, Antunes A, 987 Guadagnuolo S, Del Tordello E, Siena E, Serruto D, Scarlato V, Muzzi 988 A, Delany I. 2015. Global Transcriptome Analysis Reveals Small RNAs 989 Affecting Neisseria meningitidis Bacteremia. PLoS ONE 10:e0126325. 990 65. Pujol C, Eugène E, Marceau M, Nassif X. 1999. The meningococcal PilT 991 protein is required for induction of intimate attachment to epithelial cells 992 following pilus-mediated adhesion. Proc Natl Acad Sci U S A 96:4017-993 4022. 994 66. Eriksson J, Eriksson OS, Jonsson A-B. 2012. Loss of Meningococcal PilU 995 Delays Microcolony Formation and Attenuates Virulence In Vivo. Infect 996 Immun 80:2538-2547. 997 67. Rahman M, Källström H, Normark S, Jonsson A-B. 1997. PilC of 998 pathogenic Neisseria is associated with the bacterial cell surface. Mol 999 Microbiol 25:11-25. 1000 1001 1002

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

40

Table 1. Primers used in this study 1003 Primer Sequence (5’-3’) Cloning P1 ATAGAAAAGTTGAGCGATTCAGCTTTATAC P2 TGTACAAACTTGAATACCGCACTGCTAAAAC P3 TGTACAAAGTGGCGCTTAGGGTGAAAGTGC P4 ATAATAAAGTTGGATACTCGGATTAATCGG P5 ATAGAAAAGTTGATGCCGTCTGAAAATTAAGTTAGAATTATC

CC P6 GGGGACTGCTTTTTTGTACAAACTTGAAATCCAAAATCATAC

TG P7 GGGGACAAGTTTGTACAAAAAAGCAGGCTGACTTTGCTGA

CTCAGGATT P8 GGGGACCACTTTGTACAAGAAAGCTGGGTAAATACCGTCT

GAAACCTG K1 AAAAAGCAGGCTGTATTAGTGACCTGTAGAATTCGAGC K2 AGAAAGCTGGGTTTAGAAAAACTCATCGAGCATCAAATG Lac-pnpfw TAACAATTTCACACAGGAAACAGCTTTGAAAGGAACAATAA

TGTTCAATAA Pnp-down CATTCATTCCCGATACCCGTAAAAA Lac_up TCCCCATCGGTGATGTCGTATAAGA Lac-PNPrev TTATTGAACATTATTGTTCCTTTCAAAGCTGTTTCCTGTGTG

AAATTGTTA PilEUHSfw ATAGAAAAGTTGAGGCGGATGTGTAAGGTAGATG PilEUHSrev TGTACAAACTTGCGATCAGGGTGAAACCTT AAACCTT PilEDHSfw CTTGTACAAAGTGGACCTGCCGCACCAAATAA PilEDHSrev ATAATAAAGTTGGCAGGGAAATGGGTAGGGA attB1_Tet_fw AAAAAGCAGGCTACCTTTCCGAACAAGA attB2_Tet_rev CAAGAAAGCTGGGTTTCAGACGGCATTGGGT TetRfw TTTTTTTCAAACGAAGTCAGCCCCATACGATATAAG TetRrev TTCCATTCAGGTCGAGGTGGCC NMC50fw ATGTCAATCAATACGTTTGAAACCTTTATTTACG NMC50rev GGGCTGACTTCGTTTGAAAAAAAAGCGTG SiaCfw ATGCCGTCTGAATATGAACGATTTATCTGAAGC SiaCrev GATGAATAAGACTCCAGCTTAAATATATTTATTCAATATCAG

TTTTTTTG NMC49fw ACCTGAATGGAATCAACTATTTCTTCTTCTAAACCATTTAG

NMC49rev TTGACAATAGAGCGAAAAAGTACCGCG SiaE-Tetfw ATATATTTAAGCTGGAGTCTTATTCATCATGTCAATCAATAC

GTTTG SiaE-Tetrev AGAAATAGTTGATTCCATTCAGGTCGAGGTG PNPpurfw TTGAAAGGAACAATAATGTTCAATAAACAC PNPpurrev TTACTCGGCGGCATTTTC

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

41

qPCR PNP_qPCR_fw TTGGGCGACGAAGACCACTT PNP_qPCR_rev TGTGCAGACGCGCTTCTTTG S10_qPCR_fw TTGGAAATCCGCACCCACTT S10_qPCR_rev TACATCAACACCGGCCGACAAA PilN_qPCR_fw GAGATGAACAAGCGCAAACA PilN_qPCR_rev AAGTGTGCGATGGAGGTTTC PilO_qPCR_fw CAGATGGAATCCCTTGAGGA PilO_qPCR_rev GAACCTGCCTGATGAAGCTC PilW_qPCR_fw AACTACGGCTGGTTCCTGTG PilW_qPCR_rev GTGCGCGCCAGTTCTTTAAA 1004 1005

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

42

Table 2: Bacterial strains and plasmids used in this study 1006 Strain Genotype Resistance

markers Reference

N. meningitidis Strains Fam20 (wild-type) (67) Δpnp pnp::kan KanR, This study Δpnp/pnp pnp::kan, pnp

complemented native promoter

KanR, CapR This study

ΔsiaD siaD::tet TetR This study ΔpilE pilE::tet TetR This study PNPind pnp IPTG inducible CapR This study Δpnp/PNPind pnp::kan, pnp IPTG

inducible KanR, CapR, TetR

This study

Δpnp/PNPind ΔsiaD pnp::kan, siaD::tet, pnp IPTG inducible

KanR, CapR, TetR

This study

Δpnp/PNPind ΔpilE pnp::kan, pilE::tet ,pnp IPTG inducible

KanR, CapR, TetR

This study

E. coli strains DH5α F- endA1 glnV44 thi-1 recA1

relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK

- mK

+), λ–

BL21 F- dcm ompT hsdS(rB- mB-) gal [malB+]K-12(λS)

Stratagene

Plasmids pTrcHis AmpR Invitrogen pTrcHis-PNP AmpR This study pBAD-lacI AmpR DNA2.0 pDEST-Δpnp AmpR, KanR This studypDEST-natPNP AmpR, CapR This study pDEST-indPNP AmpR, CapR This studypDEST-ΔpilE AmpR, TetR This study pTOPO-ΔsiaD KanR, TetR This study 1007 1008 1009

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

43

Table 3: Differentially regulated genes in the pnp mutant. 1010 Differentially regulated genes were analyzed based on their COG classification. 1011 The genes were clustered into COG categories according to the COG classification 1012 for FAM18 at the NeMeSys web site. The total number of genes in each COG class 1013 is listed for comparison. The full list of genes can be found in Table S1. 1014

1015

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

44

Figure 1: NMC0710 is a N. meningitidis PNPase. 1016 A) Alignment of the protein sequences for PNPase in Escherichia coli and 1017 Neisseria meningitidis FAM20. The alignment was constructed using Clustal 1018 Omega and visualized using Jalview. The alignment is color coded according to 1019 Blossum62 scores of amino acid conservation (Deep blue = identical, white = low 1020 conservation). The peptides used to produce the antibodies are highlighted in 1021 red (See Materials and Methods for details). B) Coomassie-stained SDS-PAGE gel 1022 showing the His-tagged N. meningitidis PNPase that was purified from E. coli. C) 1023 Schematic picture of the reaction used to assay the phosphorolytic activity of 1024 PNPase. In this assay, the production of ADP was coupled to the oxidation of 1025 NADH via pyruvate kinase and lactate dehydrogenase, and the loss of NADH was 1026 measured at 340 nm. Phosphoenolpyruvate (PEP) and NADH were added in 1027 excess to ensure that the PNPase reaction was rate-limiting. D) Hill plot showing 1028 the relation between the concentration of phosphate and activity. 1029 1030 on A

pril 12, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

45

Figure 2: PNPase deficiency leads to a reduced growth rate. 1031 Wild-type FAM20 and the Δpnp mutant were inoculated to OD600 = 0.1 and 1032 grown in GC supplemented with 1% Kellogg’s solution at 37°C in 5% CO2 while 1033 shaking. Growth was monitored for 24 hours by measuring the OD at 600 nm. 1034 1035 1036

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

46

Figure 3: Aggregation and adhesion is enhanced in ∆pnp. 1037 A) Live-cell microscopy of wild-type, ∆pnp and ∆pnp/pnp bacteria. The bacteria 1038 were imaged after 30, 60 and 120 minutes. Representative pictures are shown in 1039 the figure. The scale bar represents 10 µm. B) Sedimentation in wild-type, ∆pnp 1040 and ∆pnp/pnp bacteria in liquid cultures. The bacteria were grown while shaking 1041 to OD600 = 1 (T0) and subsequently moved to static conditions. The OD600 of the 1042 upper layer of the culture was measured every 20 min. C) Adhesion by wild-type, 1043 ∆pnp and ∆pnp/pnp bacteria to FaDu epithelial cells. FaDu cells were grown to 1044 80% confluence and then infected with log-phase bacteria to a MOI of 100 for 2 1045 h. Unbound bacteria were washed away, and bound bacteria were released by 1046 treating the cells with saponin. The bound bacteria were quantified using viable 1047 counting on GC plates. Statistical significance is indicated as follows: **, P < 0.01 1048 (ANOVA followed by Bonferroni post hoc test). 1049 1050 1051 on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

47

Figure 4: PNPase expression is induced by host attachment. 1052 Expression of PNPase in wild-type bacteria was measured at the mRNA level 1053 using qPCR (A) and at the protein level using quantitative immunoblotting (B). 1054 S10 expression was used as an internal control for the qPCR and EF-Tu 1055 expression was used as an internal control for the immunoblot. The expression 1056 levels are normalized to the 0 h sample. The bacteria were grown in DMEM/1% 1057 FBS either to log phase while shaking, to log phase followed by 2 hours under 1058 static conditions, or to log phase followed by 2 hours under static conditions 1059 while attached to FaDu cells. Statistical significance is indicated as follows: ns, P 1060 > 0.05; *, P < 0.05; **, P < 0.01 (ANOVA followed by Bonferroni post hoc test). 1061 1062 1063

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

48

Figure 5: Bacterial surface properties remain unchanged in ∆pnp. 1064 A) Quantification of capsular polysaccharides was performed using ELISA with 1065 anti-serogroup C capsule antibodies. B) Surface hydrophobicity of wild-type, 1066 ∆pnp and ∆pnp/pnp bacteria was assayed using the MATS assay. The ∆siaD 1067 mutant was included as a capsule-negative control. C) The formation of static 1068 biofilms by wild-type, ∆pnp and ∆pnp/pnp bacteria. Bacteria were incubated for 1069 24 h in GC liquid + 1% Kellogg’s at 37°C in 5% CO2 under static conditions. The 1070 ∆siaD mutant was included as a capsule-negative control. D) The expression of 1071 Opa protein in wild-type, ∆pnp and ∆pnp/pnp bacteria was measured using 1072 quantitative immunoblotting. EF-Tu expression was used as an internal control. 1073 Statistical significance is indicated as follows: ns, P > 0.05; *, P < 0.05 (ANOVA 1074 followed by Bonferroni post hoc test). 1075 1076 1077 on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

49

Figure 6: Pili are required for ∆pnp induced aggregation 1078 Live-cell microscopy of wild-type, ∆pnp/PNPind, ∆pnp/PNPind ∆pilE and ∆pilE 1079 bacteria. The bacteria were imaged after 30, 60, 120 and 240 minutes. 1080 Representative pictures are shown in the figure. The scale bar represents 10 µm. 1081

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

50

Figure 7: Pili bundling is increased in ∆pnp. 1082 A) Electron micrographs of wild-type and ∆pnp bacteria at 125000 X 1083 magnification. The micrographs shown are representative examples. B) 1084 Quantification of pili bundling was analyzed by determining the number of pili in 1085 bundles compared to the number of unbundled pili. A total of 74 frames were 1086 analyzed (34 wild-type and 40 ∆pnp). 1087 1088 1089

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

51

Figure 8: Quantification of pili protein expression. 1090 Quantitative immunoblots were analyzed using antibodies against A) PilE, B) 1091 PilC and C) PilT. The expression of EF-Tu was used as an internal control. 1092 Statistical significance is indicated as follows: ns, P > 0.05; *, P < 0.05; **, P < 0.01 1093 (ANOVA followed by Bonferroni post hoc test). 1094 1095 1096

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

52

Figure 9: Reduced bacteremia of ∆pnp in a CD46 in vivo mouse model of 1097 bacterial infection. 1098 hCD46Ge transgenic mice (n = 7 per group) were challenged intraperitoneally 1099 with 5 x 107 CFU of either wild-type or ∆pnp. Blood samples were obtained from 1100 the tail vein at 2, 6 and 24 h post-infection, and bacteria were quantified by 1101 determining the number of viable bacteria on GC plates. Statistical significance is 1102 indicated as follows: **, P < 0.01 (ANOVA followed by Bonferroni post hoc test). 1103 1104

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

on April 12, 2020 by guest

http://iai.asm.org/

Dow

nloaded from