ARTICLE IN PRESS

0142-9612/$ - se

doi:10.1016/j.bi

�Correspond

fax: 1 514 340 75

E-mail addr

Biomaterials 26 (2005) 5587–5593

www.elsevier.com/locate/biomaterials

Effect of cobalt and chromium ions on MMP-1, TIMP-1, and TNF-agene expression in human U937 macrophages:

A role for tyrosine kinases

Li Luoa, Alain Petita, John Antonioua, David J. Zukora, Olga L. Huka, Roger C.W. Liub,Franc-oise M. Winnikb, Fackson Mwalea,�

aDivision of Orthopaedic Surgery, McGill University, Lady Davis Institute for Medical Research, SMBD-Jewish General Hospital,

3755 Chemin de la Cote Ste-Catherine, Montreal, Quebec, Canada H3T 1E2bDepartment of Chemistry and Faculty of Pharmacy, University of Montreal, CP 6128, Succursale Centre Ville, Montreal, Quebec, Canada H3C 3J7

Received 8 October 2004; accepted 8 February 2005

Available online 7 April 2005

Abstract

Previous reports have suggested that the imbalance of matrix metalloproteinases (MMPs) and tissue inhibitors of

metalloproteinases (TIMPs) activity may contribute to prosthetic loosening. However, the mechanisms controlling these enzymes

in the periprosthetic environment is unknown. We examined the effect of Co2+ and Cr3+ ions on the expression of genes encoding

MMP-1, one of the principal proteinases capable of degrading native fibrillar collagens in the extracellular matrix (ECM), its

inhibitor TIMP-1, and TNF-a, a cytokine that plays a central role in the induction of implant osteolysis. Human U937 macrophages

were incubated in suspension or on phosphorylcholine (PC)-polymer coated surfaces for 24 h with Co2+ and Cr3+ ions. The level of

mRNAs was determined by reverse transcription-polymerase chain reaction (RT–PCR). Results show that both Co2+ and Cr3+

ions induce the expression of MMP-1, TIMP-1, and TNF-a mRNA in a dose-dependent manner in cell suspensions. Tyrosine kinase

inhibitors have different effects on these stimulatory effects. Indeed, genistein has only partial inhibitory effect on MMP-1 and

TIMP-1, with even less effect on TNF-a expression. In contrast, herbimycin A completely blocks MMP-1 and TNF-a while partially

inhibiting TIMP-1. However, Co2+ and Cr3+ ions had no effect on the expression of MMP-1 and TIMP-1 in macrophages cultured

on the PC-polymer, suggesting that the attachment of U937 macrophages to the PC-polymer surfaces may modify their gene

expression. In fact, MMP-1 and TIMP-1 seems to be constitutively up-regulated in this condition. However, the effect of Co2+ and

Cr3+ ions on macrophages cultured on PC-polymer coated surfaces is similar to what was observed in suspension. Together, these

findings indicate that activation of MMP-1, TIMP-1, and TNF-a by Co2+ and Cr3+ ions is regulated by tyrosine kinases.

r 2005 Elsevier Ltd. All rights reserved.

Keywords: Cell adhesion; Hip replacement prosthesis; Macrophage; Matrix metalloproteinase; Metal ions; Phosphorylcholine

1. Introduction

The most common cause of failure of total hiparthroplasty is aseptic loosening of the prosthesis [1,2].The adverse tissue response to prosthesis wear particles isan important contributor to bone loss around implants[3–5]. Clinical observations suggest that macrophages are

e front matter r 2005 Elsevier Ltd. All rights reserved.

omaterials.2005.02.013

ing author. Tel.: 1 514 340 8222x2948;

02.

ess: fmwale@ldi.jgh.mcgill.ca (F. Mwale).

involved in the pathogenesis of aseptic loosening due tobone destruction around the prosthesis (periprostheticosteolysis), but the exact mechanisms by which theseinflammatory cells respond to wear particles as well astheir interaction with bone cells remains poorly under-stood [6,7]. Previous reports have suggested that theimbalance of matrix metalloproteinases (MMPs) andtissue inhibitors of metalloproteinases (TIMPs) activitymay contribute to prosthetic loosening [8–11]. However,the mechanisms controlling the activity of these enzymesin the periprosthetic environment is unknown.

ARTICLE IN PRESSL. Luo et al. / Biomaterials 26 (2005) 5587–55935588

Cobalt (Co) and chromium (Cr) ions, two corrosionproducts of metal-on-metal (MM) hip prostheses, areknown to induce the production of cytokines, which havethe ability to regulate the expression of several MMPsand TIMPs [12]. However, no study has been directedtowards the signaling pathways mediating the inductionof MMPs and TIMPs by Co2+ and Cr3+ ions. In thepresent study, we investigated the modulation by Co2+

and Cr3+ ions on the expression of genes encodingMMP-1, one of the principal proteinases capable ofdegrading native fibrillar collagens in the extracellularmatrix (ECM) [13], and its inhibitor TIMP-1. Theirexpression was studied in relation to the expression ofTNF-a, a cytokine that plays a central role in theinduction of implant osteolysis [14–16], in order to gaininsight into the regulation of ECM degradation andtissue remodeling around hip prostheses.

On the other hand, we have recently developed a newtype of amphiphilic phosphorylcholine (PC)-polymerthat allows the attachment and the proliferation of U937macrophages on culture surfaces [17]. Results showedthat Co2+ and Cr3+ ions stimulated TNF-a expressionin a similar manner in suspension and on PC-polymercoated surfaces. The concentrations necessary to stimu-late TNF-a expression were similar to those previouslyreported for the stimulation of TNF-a release in mouseJ774 macrophages [18] or for the stimulation of caspasesin human U937 macrophages [19]. In the present study,we also compared the effect of Co2+ and Cr3+ ions onMMP-1 and TIMP-1 expression in suspension andin culture on PC-polymer to better understand theunique features of the PC-polymer and/or the U937macrophages that are responsible for the attachment ofthese cells.

2. Materials and methods

2.1. Synthesis of phosphorylcholine-polymer and

preparation of PC-polymer surfaces

The PC-polymer is a random copolymer of N-isopropylacrylamide (45%, mol), N-(PC)-N0-(ethylene-dioxy-bis (ethyl)) acrylamide (41%) and the hydrophobicmonomer N-(n-octadecyl) acrylamide (14%) and wasprepared as previously described [20]. Culture dishes35� 10mm were coated with the polymer solution (1%,w/v in methanol) by spreading uniformly at the bottomof the dish. After air drying, the coated surfaces wereused for cell culture as previously described [17].

2.2. Cell culture

Human U937 macrophages (ATCC, Rockville, MD)were cultured in suspension or on PC-polymer inDMEM high-glucose supplemented with 10% fetal

bovine serum (FBS), 100 U/ml penicillin, and 100 mg/ml streptomycin (HyClone, Logan, UT). Macrophageswere incubated for 24 h with 0–10 ppm Co2+ (CoCl2,Fisher Scientific, Ville St-Laurent, QC) and 0–200 ppmCr3+ (CrCl3, Sigma-Aldrich, Oakville, ON) ions.Macrophages alone served as a negative control.Incubations were conducted at 37 1C in 5% humidifiedCO2 environment. The U937 macrophages have com-parable responses to polyethylene particles [21] andmetal ions [22] to primary macrophages in terms ofcytokine release.

In experiments involving tyrosine kinase inhibitors,genistein (50 mM) and herbimycin A (1 mM) (Sigma-Aldrich, Oakville, ON) were added to the cell suspen-sion 24 h prior to the addition of ions as previouslydescribed [23]. At the end of experiments, macrophagescultured on PC-polymer were detached by trypsinization(0.05% Trypsin–0.53 mM EDTA; Medicorp, Montreal,Quebec, Canada).

2.3. Western blot analysis

The expression of MMP-1 protein was measured byWestern blot as previously described [19]. Briefly, cellswere lysed in 50 ml of caspase assay lysis buffer fromBioSource (Nivelles, Belgium). Proteins were separatedon 4–20% acrylamide gels, and transferred to nitrocel-lulose membrane. Proteins were then detected byWestern blot using a rabbit polyclonal anti-MMP-1antibody as previously described [24]. Actin (NeoMar-kers, Fremont, CA) expression served as an internalcontrol for protein loading. Proteins were detected usingNEN Renaissance chemiluminescence reagents (PerkinElmer, Boston, MA, USA) and analyzed using Bio-RadVersaDoc equipped with a cooled CCD 12 bit camera.

2.4. Total RNA isolation

Total RNA was extracted from U937 macrophages bya modification of the method of Chomcynski and Sacchi[25] using TRIzol reagent (Invitrogen, Burlington, ON).After centrifugation for 15 min at 12 000g at 4 1C, theaqueous phase was precipitated in 1 volume isopropa-nol, incubated for 20 min at room temperature, andcentrifuged for 15 min at 12 000g at 4 1C. The resultingRNA pellet was air dried, resuspended in 40 ml ofdiethypyrocarbonate-treated water and 5 ml was assayedfor concentration and purity of RNA by measuringA260=A280:

2.5. Reverse transcriptase– polymerase chain reaction

(RT– PCR)

The RT reaction was performed using 1 mg total RNAisolated from the macrophages in a total volume of20 ml, containing 50 mM Tris-HCl (pH 8.3), 75 mM KCl,

ARTICLE IN PRESS

Table 1

Primer sequences for PCR analyses

Matrix Metalloproteinase 1 (MMP-1):

50 Forward: AAAGGGAATAAGTACTGGG

30 Reverse: CTGAGGAAAACACTGGAAAAAC

Tissue Inhibitor of Metalloproteinase 1 (TIMP-1):

50 Forward: CAATTCCGACCTCGTCATC

30 Reverse: CACCAAGACCTACACTGTTG

Tumor Necrosis Factor Alpha (TNF-a):50 Forward: AAGCCTGTAGCCCATGTTGTAGC

30 Reverse: GAAGACCCCTCCCAGATAGATG

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH):

50 Forward: GCTCTCCAGAACATCATCCCTGCC

30 Reverse: AGCTCATTTCCTGGTATGACAACG

Fig. 1. Effect of Co2+ and Cr3+ ions on MMP-1 protein expression in

U937 macrophages. Human U937 macrophages were incubated with

Co2+ and Cr3+ ions for 24 h in suspension. MMP-1 protein expression

was measured by Western blot. Actin expression served as a control for

protein loading. Results are representative of three different experi-

ments.

L. Luo et al. / Biomaterials 26 (2005) 5587–5593 5589

3mM MgCl2, 10 mM DTT, 50 mM each of dATP, dGTP,dCTP, and dTTP, and 200 units of Superscript IIRNAseH reverse transcriptase (Invitrogen, Burlington,ON).

PCR was performed in a total volume of 25 mlcontaining 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2,0.4 mM each of dATP, dGTP, dCTP,and dTTP, 0.8 mM

of each primer, 1 ml RT mixture and 2.5 U of Taqpolymerase (Invitrogen, Burlington, ON). The 35 cyclesof PCR included denaturation (95 1C, 30 s), annealing(50 1C, 45 s), and extension (72 1C, 45 s). PCR productswere visualized by ethidium bromide staining andanalyzed using a Bio-Rad VersaDoc equipped with acooled CCD 12 bit camera (Bio-Rad, Mississauga, ON).Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)was used as reference for gel loading. The primersequences used for PCR are shown in Table 1.

Fig. 2. Effect of Co2+ ions on gene expression in U937 macrophages.

Human U937 macrophages were incubated in suspension (A) and on

PC-polymer coated surfaces (B) with Co2+ ions for 24 h, in the absence

or presence of tyrosine kinase inhibitors. Gene expression was

measured by RT–PCR. GAPDH was used as a house-keeping gene.

Results are representative of three different experiments.

3. Results

Fig. 1 shows that Co2+ and Cr3+ ions induced theexpression of MMP-1 protein in U937 macrophagescultured in suspension. The induction reached 5- and 11-fold with 5 and 10 ppm Co2+ ions, respectively. WithCr3+ ions, the induction reached 3.6- and 4.9-fold with100 and 200 ppm, respectively.

Further, we decided to confirm our results byexamining the effect of Co2+ and Cr3+ ions on geneexpression of not only MMP-1 but of its inhibitorTIMP-1, and TNF-a. Figs. 2 and 3 show the effect ofCo2+ ions on the expression of MMP-1, TIMP-1, andTNF-a mRNA in U937 macrophages in suspension andcultured on PC-polymer coated surfaces. In suspension,Co2+ ions induced the expression of these genes in adose-dependent manner (Figs. 2A and 3A). This Co2+

induced gene expression is partially inhibited bygenistein while herbimycin A completely inhibitsMMP-1 and TNF-a, and partially inhibits TIMP-1expression (Figs. 2A and 3A). On PC-polymer coatedsurfaces, Co2+ ions had no effect on the expression of

MMP-1 and TIMP-1; their expression seems to be up-regulated in control cells (Figs. 2B and 3B) incomparison with cells in suspension. Genistein andherbimycin A inhibited this up-regulation in a similarmanner to what we observed in suspension for ion-stimulated macrophages. However, the effect of Co2+

ions on TNF-a expression in macrophages cultured onPC-polymer coated surfaces (Figs. 2B and 3B) is similarto what we observed in suspension (Figs. 2A and 3A).

Figs. 4 and 5 show the effect of Cr3+ ions on theexpression of MMP-1, TIMP-1, and TNF-a mRNA inU937 macrophages in suspension and cultured on PC-polymer coated surfaces. In suspension, Cr3+ ions alsoinduced the expression of these genes in a dose-dependent manner (Figs. 4A and 5A). Again, thisCr3+-induced gene expression is partially inhibited by

ARTICLE IN PRESS

0

0.2

0.4

0.6

0.8

1

MMP-1 TIMP-1 TNF

Gen

e ex

pres

sion

(re

lati

ve u

nits

)

Ctl

10 ppm

10 ppm + Gen

10 ppm + Herb.

0

0.2

0.4

0.6

0.8

1

MMP-1 TIMP-1 TNF

Gen

e ex

pres

sion

(re

lati

ve u

nits

)

Ctl

10 ppm

10 ppm + Gen.

10 ppm + Herb.

(A)

(B)

Suspension

Culture on PC-Polymer

Fig. 3. Quantification of the effect of Co2+ ions on gene expression in

U937 macrophages. Human U937 macrophages were incubated in

suspension (A) and on PC-polymer coated surfaces (B) with Co2+ ions

for 24 h, in the absence or presence of tyrosine kinase inhibitors.

Results are the mean of three experiments as shown in Fig. 2.

Fig. 4. Effect of Cr3+ ions on gene expression in U937 macrophages.

Human U937 macrophages were incubated in suspension (A) and on

PC-polymer coated surfaces (B) with Cr23 ions for 24 h, in the absence

or presence of tyrosine kinase inhibitors. Gene expression was

measured by RT–PCR. GAPDH was used as a house-keeping gene.

Results are representative of three different experiments.

L. Luo et al. / Biomaterials 26 (2005) 5587–55935590

genistein while herbimycin A completely inhibits MMP-1 and TNF-a, and partially inhibits TIMP-1 expression(Figs. 4A and 5A). On PC-polymer coated surfaces,Cr3+ ions had no effect on the expression of MMP-1and TIMP-1; their expression seems to be up-regulatedin control cells (Figs. 4B and 5B) in comparison withcells in suspension. Genistein and herbimycin Ainhibited this up-regulation in a manner similar to whatwe observed in suspension for ion-stimulated macro-phages. However, the effect of Cr3+ ions on TNF-a geneexpression in macrophages cultured on PC-polymercoated surfaces (Figs. 4B and 5B) is similar to what wasobserved in suspension (Figs. 4A and 5A).

4. Discussion

Previous reports have shown that Co2+ and Cr3+

ions can stimulate TNF-a expression [17] and induceapoptosis [19] in U937 macrophages. The present studyextends our knowledge on the cellular effect of thesemetal ions by providing for the first time evidence thatCo2+ and Cr3+ ions can act directly on U937macrophages to stimulate MMP-1 and TIMP-1 in vitro.Our results also suggest a requirement for proteintyrosine kinases in this process.

The biocompatibility of total hip prostheses has beenthe subject of debate for at least three decades, andcurrently it appears as though the loosening oftechnically well-inserted prostheses is in part due tocellular responses in periprosthetic tissues [26–28].Despite intensive research, however, the precise biolo-gical mechanisms responsible for the loosening of totalhip joints are not well understood. The expression ofMMP-1 and TIMP-1 in the periprosthetic tissues[8–11,29–31] have led to the the hypothesis that theirimbalance could contribute to the loosening of total hipprosthesis [32,33]. However, all these gene expressionand immunohistochemical studies are from retrievedtissues and cannot discriminate on the effect of thedifferent wear products on their expression and theirmechanism of regulation. Results of the present studyshow for the first time in vitro that metal ions, mainlyCo2+ and Cr3+, can up-regulate the MMP-1 expressionreported in vivo. The implication of the other wear

ARTICLE IN PRESS

0

0.2

0.4

0.6

0.8

1

MMP-1 TIMP-1 TNF

Gen

e ex

pres

sion

(re

lati

ve u

nits

)

Ctl

200 ppm

200 ppm+ Gen

200 ppm+ Herb.

0

0.2

0.4

0.6

0.8

1

MMP-1 TIMP-1 TNF

Gen

e ex

pres

sion

(re

lati

ve u

nits

)

Ctl

200 ppm

200 ppm+ Gen.

200 ppm+ Herb.

(A)

(B)

Suspension

Culture on PC-Polymer

Fig. 5. Quantification of the effect of Cr3+ ions on gene expression in

U937 macrophages. Human U937 macrophages were incubated in

suspension (A) and on PC-polymer coated surfaces (B) with Cr3+ ions

for 24 h, in the absence or presence of tyrosine kinase inhibitors.

Results are the mean of three experiments as shown in Fig. 4.

L. Luo et al. / Biomaterials 26 (2005) 5587–5593 5591

products remains to be investigated. Even though our invitro results support the in vivo data, the induction ofMMP-1 and its inhibitor TIMP-1 may also reflect aremodeling of periprosthetic tissues that is not related tothe loosening of prostheses.

The inhibitory effect of genistein and herbimycin A,two inhibitors of tyrosine kinases, also suggest for thefirst time the implication of tyrosine kinases in theinduction of MMP-1 and TIMP-1 expression by Co2+

and Cr3+ ions. This is in agreement with the reportedinhibition of MMP-1 by tyrosine kinase inhibitors infibroblasts induced by three-dimensional collagen[34,35]. As observed in the present study, these results

show a more potent effect of herbimycin A compared togenistein, probably due to the specificity and selectivityof these inhibitors, which have both common anddifferent targets [36]. Finally, further studies arenecessary to document on the specific identification ofthe tyrosine kinase(s) implicated in the modulation ofMMP-1 and TIMP-1 expression by Co2+ and Cr3+ andon the implication of other kinases such as serine/threonine kinases.

Our results also show that the adhesion of macro-phages to the PC-polymer coated surfaces stimulated theexpression of MMP-1 and TIMP-1, suggesting that celladhesion induces a remodeling of the macrophageECM. This kind of materials-stimulated expression ofgenes implicated in ECM remodeling was also observedin fibroblasts induced by three-dimensional collagen[34,35]. The inhibition of this gene expression bygenistein and herbimycin A suggest that tyrosine kinasesare also implicated in this remodeling. Interestingly, ithas been reported that tyrosine phosphorylation isimplicated in the adhesion of U937 macrophages inthe presence of phorbol myristate acetate [37], suggest-ing that the expression of several genes regulated bytyrosine kinase activity, such as MMP-1 and TIMP-1,may be modified during all kinds of adhesion processes.Whether this is the same mechanism by which genes areup-regulated by PC remains to be established.

Finally, the effect of tyrosine kinase inhibitors on ion-induced TNF-a expression in macrophages in suspen-sion is very similar to what was observed for MMP-1,suggesting that common pathways are implicated in themodulation of these genes by Co2+ and Cr3+ ions.However, contrary to the results on MMP-1 and TIMP-1, the expression of TNF-a is not modified by theadhesion of macrophages to PC-polymer, suggestingthat the effect of macrophage adhesion to PC-polymeron gene expression is specific for proteins of the ECM,or at least specific for certain genes. Therefore, eventhough tyrosine kinases seem implicated in the inductionof MMP-1, TIMP-1, and TNF-a expression, our resultssuggest that other pathways may be implicated in theregulation of the expression of these genes. This remainsto be investigated.

Contrary to polyethylene (UHMWPE) particles frommetal-on polyethylene prosthesis that are restricted tothe immediate environment of the prosthesis, the metalwear products (particles and ions) of the MM bearinghave the inconvenience of being released into the bloodstream and affect distant cells. Indeed, numerous studieshave measured elevated serum levels of Co and Cr inpatients with MM prosthesis [38–42]. While there is noevidence that these particles and ions have a directcarcinogenic effect, there is cause for concern regardingtheir potential effects [40,43,44]. In this regard, chro-mosomal changes have been reported in the environ-ment of the prosthesis after surgery for joint

ARTICLE IN PRESSL. Luo et al. / Biomaterials 26 (2005) 5587–55935592

replacement [45]. In the present study, we showed thatCo2+ and Cr3+ ions can stimulate protein tyrosinekinases. These kinases have been shown to play a causalrole in cellular transformation and many cancers,reflecting their function as entry points and initiatorsof diverse growth and survival-promoting stimuli [36].Further studies are therefore required to better under-stand the cellular effects of metal ions liberated from thearticular surface of prostheses. Finally, other ionsreleased from hip prostheses, such as titanium [46] andnickel [47], have been shown to stimulate TNF-a in amanner similar to Co and Cr, suggesting that other ionsmay also modulate tyrosine kinase activity. This remainsto be investigated.

5. Conclusion

Our results suggest that tyrosine kinases play anessential role in the signalling pathways regulating theremodeling of macrophage ECM by Co2+ and Cr3+

ions in the periprosthetic environment. This may serveas a target for selective inhibition of periprostheticosteolysis.

Acknowledgment

This work was supported by a grant from Valorisa-tion Recherche Quebec (NanoQuebec) to FM andFMW.

References

[1] Howie DW, Haynes DR, Rogers SD, McGee MA, Pearcy MJ.

The response to particulate debris. Orthop Clin North Am

1993;24:571–81.

[2] Creighton MG, Callaghan JJ, Olejniczak JP, Johnston RC. Total

hip arthroplasty with cement in patients who have rheumatoid

arthritis. A minimum ten-year follow-up study. J Bone Jt Surg

Am 1998;80:1439–46.

[3] Revell PA, al-Saffar N, Kobayashi A. Biological reaction to

debris in relation to joint prostheses. Proc Inst Mech Eng [H]

1997;21:187–97.

[4] Catelas I, Bobyn JD, Medley JJ, Zukor DJ, Petit A, Huk OL.

Effects of digestion protocols on the isolation and characteriza-

tion of metal–metal wear particles. II. Analysis of ion release and

particle composition. J Biomed Mater Res 2001;55:330–7.

[5] Catelas I, Petit A, Zukor DJ, Antoniou J, Huk OL. TNF-asecretion and macrophage mortality induced by cobalt and

chromium ions in vitro-qualitative analysis of apoptosis. Bioma-

terials 2003;24:383–91.

[6] Murray DW, Rushton N. Macrophages stimulate bone resorption

when they phagocytose particles. J Bone Jt Surg [Br] 1990;

72:988–92.

[7] Gonzalez O, Smith RL, Goodman SB. Effect of size, concentra-

tion, surface area, and volume of polymethylmethacrylate

particles on human macrophages in vitro. J Biomed Mater Res

1996;30:463–73.

[8] Takagi M, Konttinen YT, Santavirta S, Sorsa T, Eisen AZ,

Nordsletten L, Suda A. Extracellular matrix metalloproteinases

around loose total hip prostheses. Acta Orthop Scand 1994;

65:281–6.

[9] Yokohama Y, Matsumoto Y, Hirakawa M, Kuroki Y, Fujimoto

N, Imai K, Okada Y. Production of matrix metalloproteinases at

the bone–implant interface in loose total hip replacements. Lab

Invest 1995;73:899–911.

[10] Takagi M, Kontinnen YT, Kemppinen P, Sorsa T, Tschesche H,

Blaser J, Suda A, Santavirta S. Tissue inhibitor of metallopro-

teinase 1, collagenolytic and gelatinolytic activity in loose hip

endoprostheses. J Rheumatol 1995;22:2285–90.

[11] Takei I, Takagi M, Santavirta S, Ida H, Ishii M, Ogino T, Ainola

M, Konttinen YT. Messenger ribonucleic acid expression of 16

matrix metalloproteinases in bone–implant interface tissues of

loose artificial hip joints. J Biomed Mater Res 2000;52:613–20.

[12] Kahari VM, Saarialho-Kere U. Metalloproteinases in skin. Exp

Dermatol 1997;6:199–213.

[13] Vincenti MP, Brinckerhoff CE. Transcriptional regulation of

collagenase (MMP-1, MMP-13) genes in arthritis: integration of

complex signalling pathways for the recruitment of gene-specific

transcription factors. Arthritis Res 2002;4:157–64.

[14] Algan SM, Purdon M, Horowitz SM. Role of tumor necrosis

factor alpha in particle-induced bone resorption. J Orthop Res

1996;14:30–5.

[15] Merkel KD, Erdmann JM, McHugh KP, Abu-Amer Y, Ross FP,

Teitelbaum SL. Tumor necrosis factor-alpha mediates orthopae-

dic implant osteolysis. Am J Pathol 1999;154:203–10.

[16] Stea S, Visentin M, Granchi D, Ciapetti G, Donati ME, Sudanese

A, Zanotti C, Toni A. Cytokines and osteolysis around total hip

prostheses. Cytokine 2000;12:1575–9.

[17] Gong Y- K, Luo L, Petit A, Zukor DJ, Huk OL, Antoniou J,

Winnik FM, Mwale F. Adhesion of human U937 macrophages to

phosphorylcholine coated surfaces. J Biomed Mater Res—Part A

2005;72A:1–9.

[18] Catelas I, Petit A, Zukor DJ, Antoniou J, Huk OL. TNF-asecretion and macrophage mortality induced by cobalt and

chromium ions in vitro-qualitative analysis of apoptosis. Bioma-

terials 2003;24:383–91.

[19] Petit A, Mwale F, Zukor D, Catelas I, Antoniou J, Huk O. Effect

of cobalt and chromium ions on bcl2, bax, caspase 3 and caspase-

8 expression in human U937 macrophages. Biomaterials 2004;

25:2013–8.

[20] Miyazawa K, Winnik FM. Solution properties of phosphorylcho-

line-based hydrophobically modified polybetaines in water and

mixed solvents. Macromolecules 2002;35:6536–44.

[21] Mattews JB, Green TR, Stone MH, Wroblewski BM, Fisher J,

Ingham E. Comparison of the response of three human monocytic

cell lines to challenge polyethylene particles of known size and

dose. J Mater Sci—Mater Med 2001;12:249–58.

[22] Wang JY, Wicklund BH, Gustilo RB, Tsukayama DT. Titanium,

chromium, and cobalt ions modulate the release of bone-

associated cytokines by human monocytes/macrophages in vitro.

Biomaterials 1996;17:2233–40.

[23] Ravanti L, Heino J, Lopez-Otin C, Kahari VM. Induction of

collagenase-3 (MMP-13) expression in human skin fibroblasts by

three-dimensional collagen is mediated by p38 mitogen-activated

protein kinase. J Biol Chem 1999;74:2446–55.

[24] Wu CW, Tchetina EV, Mwale F, Hasty K, Pidoux I, Reiner A,

Chen J, Van W, Poole AR. Proteolysis involving matrix

metalloproteinase 13 (collagenase-3) is required for chondrocyte

differentiation that is associated with matrix mineralization.

J Bone Miner Res 2002;17:639–51.

[25] Chomczynski P, Sacchi N. Single-step method of RNA isolation

by acid guanidium thiocyanate–phenol–chloroform extraction.

Anal Biochem 1987;162:156–9.

ARTICLE IN PRESSL. Luo et al. / Biomaterials 26 (2005) 5587–5593 5593

[26] Goldring SR, Jasty M, Roelky MS, Rourke CM, Bringhurst FR,

Harris WH. Formation of a synovial-like membrane at the

bone–cement interface. Its role in bone resorption and implant

loosening after total hip replacement. Arthritis Rheum 1986;

29:836–42.

[27] Jasty M, Maloney WJ, Brafdon CR, Haire T, Harris WH.

Histomorphological studies of the long-term skeletal responses to

well fixed cemented femoral components. J Bone Jt Surg [Am]

1990;72A:1220–9.

[28] Santavirta S, Konttinen YT, Hoikka V, Eskola A. Immuno-

pathological response to loose cementless acetabular components.

J Bone Jt Surg [Br] 1991;73B:38–42.

[29] Sasaki K, Takagi M, Mandelin J, Takei I, Santavirta S, Ida H,

Ogino T, Kottinen YT. Quantitative analysis of mRNA expres-

sion of TIMPs in the periprosthetic interface tissue of loose hips

by real-time PCR system. J Biomed Mater Res (Appl Biomater)

2001;58:605–12.

[30] Ishiguro N, Ito T, Kurokouchi K, Iwahori Y, Nagaya I,

Hasegawa Y, Iwata H. mRNA expression of matrix metallopro-

teinases and tissue inhibitors of metalloproteinase in interface

tissue around implants in loosening total hip arthroplasty.

J Biomed Mater Res 1996;32:611–7.

[31] Yang RS, Liu TK. Immunohistochemical analysis of matrix

proteolytic enzymes in the periprosthetic tissue in the patients

with loosening prostheses. Tohoku J Exp Med 1998;184:99–111.

[32] Takagi M, Santavirta S, Ida H, Ishii M, Akimoto K, Saotome K,

Konttinen YT. The membrane-type-matrix metalloproteinase/

matrix metalloproteinase-2/tissue inhibitor of metalloproteinase-2

system in the periprosthetic connective-tissue remodeling in loose

total-hip prostheses. Lab Invest 1998;78:735–42.

[33] Takagi M. Neutral proteinases and their inhibitors in the

loosening of total hip prostheses. Acta Orthop Scand 1996;

271(Suppl):3–29.

[34] Langholz O, Rockel D, Mauch C, Kozlowska E, Bank I, Krieg T,

Eckes B. Collagen and collagenase gene expression on three-

dimensional collagen lattices are differentially regulated by a1b1

and a2b1 integrins. J Cell Biol 1995;131:1903–15.

[35] Ravanti L, Heino J, Lopez-Otın C, Kaharin V-M. Induction of

collagenase-3 (MMP-13) expression in human skin fibroblasts by

three-dimensional collagen is mediated by p38 mitogen-activated

protein kinase. J Biol Chem 1999;274:2446–55.

[36] Martin GS. Cell signalling and cancer. Cancer Cell 2003;4:167–74.

[37] Chen X, Zuckerman ST, Kao WJ. Intracellular protein phos-

phorylation in adherent U937 monocytes mediated by various

culture conditions and fibronectin-derived surfacve ligands.

Biomaterials 2005;26:873–82.

[38] Case CP, Ellis L, Turner JC, Fairman B. Development of a

routine method for the determination of trace metals in whole

blood by magnetic sector inductively coupled plasma mass

spectrometry with particular relevance to patients with total hip

and knee arthroplasty. Clin Chem 2001;47:275–80.

[39] Gleizes V, Poupon J, Lazennec J-Y, Chamberlin B, Saillant G.

Advantages and limits of determining serum cobalt levels in

patients with metal on metal articulating surfaces. Rev Chir

Orthop 1999;85:217–25.

[40] MacDonald SJ, McCalden RW, Chess DG, Bourne RB,

Rorabeck CH, Cleland D, Leung F. Metal-on-metal versus

polyethylene in hip arthroplasty: a randomized clinical trial. Clin

Orthop Relat Res 2003;406:282–96.

[41] Savarino L, Granchi D, Ciapetti G, Cenni E, Pantoli AN, Rotini

R, Veronesi CA, Baldini N, Giunti A. Ion release in patients with

metal-on-metal hip bearings in total joint replacement: a

comparison with metal-on-polyethylene bearings. J Biomed

Mater Res (Appl Biomater) 2002;63:467–74.

[42] Schaffer AW, Pilger A, Engelhardt C, Zweymueller K, Ruediger

HW. Increased blood cobalt and chromium after total hip

replacement. J Toxicol—Clin Toxicol 1999;37:839–44.

[43] Paavolainen P, Pukkala E, Pulkkinen P, Visuri T. Cancer

incidence in Finnish hip replacement patients from 1980 to

1995: a nationwide cohort study involving 31,651 patients.

J Arthroplasty 1999;14:272–80.

[44] Visuri T, Pukkala E, Paavolainen P, Pulkkinen P, Riska EB.

Cancer risk after metal on metal and polyethylene on metal total

hip arthroplasty. Clin Orthop Relat Res 1996;329:S280–9.

[45] Case CP. Chromosomal changes after surgery for joint replace-

ment. J Bone Jt Surg [Br] 2001;83B:1093–5.

[46] Wang JY, Wicklund BH, Gustilo RB, Tsukayama DT. Titanium,

chromium and cobalt ions modulate the release of bone-

associated cytokines by human monocytes/macrophages in vitro.

Biomaterials 1996;17:2233–40.

[47] Niki Y, Matsumoto H, Suda Y, Otani T, Fujikawa K, Toyama Y,

Hisamori N, Nozue A. Metal ions induce bone resorbing cytokine

production through the redox pathway in synoviocytes and bone

marrow macrophages. Biomaterials 2003;24:1447–57.