Upload
others
View
4
Download
1
Embed Size (px)
Citation preview
i
EFFECTS OF LIGHT EMITTING DIODE (LED)
IRRADIATION AT NIGHT ON ABSCISIC ACID
METABOLISM AND ANTHOCYANIN
SYNTHESIS IN GRAPES
January 2016
ABHICHARTBUT RODYOUNG
Graduate School of Horticulture
CHIBA UNIVERSITY
ii
(千葉大学学位申請論文)
EFFECTS OF LIGHT EMITTING DIODE (LED)
IRRADIATION AT NIGHT ON ABSCISIC ACID
METABOLISM AND ANTHOCYANIN
SYNTHESIS IN GRAPES
2016 年 1月
ABHICHARTBUT RODYOUNG
Graduate School of Horticulture
CHIBA UNIVERSITY
i
TABLE OF CONTENTS
Page
Table of contents i
List of Tables v
List of Figures vi
List of Abbreviations ix
Chapter 1 General introduction and literature review
1.1 General introduction 2
1.2 Literature review
1.2.1 Grape 5
1.2.2 Stage of grape fruit development 6
1.2.3 Grape skin color 8
1.2.4 Anthocyanin biosynthesis in grapes 8
1.2.5 Regulated genes of anthocyanin accumulation in grape berries 11
1.2.6 Factors affect anthocyanin biosynthesis in grapes
1.2.6.1 Plant hormone 13
1.2.6.2 Environmental Factors 16
1.2.6.3 Viticulture practices 19
1.2.7 Light 20
1.2.8 Light emitting diodes (LEDs) 24
1.2.9 Sugar induction of anthocyanin accumulation 26
ii
1.2.10 Interaction between sugar and ABA on anthocyanin
accumulation
27
Chapter 2 Effect of blue- and red-LED at night on endogenous abscisic
acid, anthocyanin and sugar syntheses in delayed-start cultured
grapes under double cropping cultivation system
2.1 Introduction
2.2 Materials and methods
2.2.1 Plant materials
2.2.2 Quantitative analysis of ABA
2.2.3 RNA extraction, cDNA synthesis, and
quantitative real-time RT-PCR analysis
2.2.4 Anthocyanin analysis
2.2.5 Sugar analysis
2.2.6 Statistical analysis
2.3 Results
2.3.1 Endogenous ABA concentration and the
expressions of VvNCED1 and VvCYP707A1 genes
2.3.2 Total anthocyanin concentrations and the
expressions of VvUFGT, VlMYBA1-2, and VlMYBA2
2.3.3 Sugar concentrations
2.3.4 Fruit qualities at harvesting (106 DAFB)
2.4 Discussion
29
31
32
36
39
39
40
42
44
46
48
52
iii
Chapter 3 Effect of blue- and red-LED at night on endogenous abscisic
acid, anthocyanin and sugar syntheses in early-heating cultured
grapes under double cropping cultivation system and the effect
of the irradiating position of blue and red LED to enhance
anthocyanin syntheses in grape
3.1 Introduction
3.2 Materials and methods
3.2.1 Plant materials
3.2.2 Quantitative analysis of ABA
3.2.3 RNA extraction, cDNA synthesis, and
quantitative real-time RT-PCR analysis
3.2.4 Anthocyanin analysis
3.2.5 Sugar analysis
3.2.6 Statistical analysis
3.3 Results
3.3.1 Endogenous ABA concentration and the
expressions of VvNCED1 and VvCYP707A1
3.3.2 Total anthocyanin concentration and the
expressions of VvUFGT, VlMYBA1-2, and VlMYBA2
3.3.3 Sugar concentrations
3.3.4 Fruit qualities at harvesting (97 DAFB in Exp. 1
and 99 DAFB in Exp. 2)
3.4 Discussion
55
57
59
59
59
60
60
62
64
67
69
75
iv
General discussion 79
Summary 83
Acknowledgements 84
References 85
v
LIST OF TABLES
Page
Table 2.1. Primers used for real-time RT-PCR. 38
Table 2.2. Effect of LED irradiation on berry length, berry width, berry
weight, soluble solid and tartaric acid concentration in early harvest at 106 DAFB.
49
Table 2.3. Effect of LED irradiation on skin color in L*, a*, b* and Hue angle
at 106 DAFB.
50
Table 3.1. Effect of LED irradiation on berry length, berry width, berry
weight, soluble solid and tartaric acid concentration at harvest (97 DAFB). (Exp. 1)
70
Table 3.2. Effect of LED irradiation on skin color in L*, a*, b* and Hue angle
at harvest (97 DAFB). (Exp. 1)
71
Table 3.3. Effect of LED irradiation on berry length, berry width, berry
weight,, soluble solid and tartaric acid concentration at harvest (99 DAFB). (Exp. 2)
72
Table 3.4. Effect of LED irradiation on skin color in L*, a*, b* and Hue angle
at harvest (99 DAFB). (Exp. 2)
73
vi
LIST OF FIGURES
Page
Figure 1.1. Diagram of a typical double-sigmoid pattern of growth by a grape
berry, from anthesis to harvest.
7
Figure 1.2. Anthocyanin biosynthesis pathway and its branches. 10
Figure 1.3. Absorption spectrum of chlorophyll and antenna pigments. 20
Figure 1.4. The spectrum of solar radiation reaching from gamma rays to radio
waves with view on visible wavelengths and plant photoreceptors absorbing
specific wavelength. Cry, cryptochromes; Phy, phytochromes; Phot,
phototropins; UV, ultraviolet; UVR8, UV-B photoreceptor.
21
Figure 1.5. Red and far-red light mediated conversion of phytochromes. 22
Figure 1.6. COP1 acts as a repressor in light signaling pathway by interacting
directly with photoreceptors to mediate different light-regulated plant
developmental process in darkness (A) and in visible light (B).
24
Figure 2.1. Flow chart of Quatitative analysis of ABA. 33
Figure 2.2. Retention time and mass spectrum profile showing selected ions in
the ABA-containing fraction in standard and sample.
34
Figure 2.3. Retention time and mass spectrum profile showing selected ions in
the ABA-containing fraction in sample.
35
Figure 2.4. Flow chart of RNA preparation. 37
Figure 2.5. Change of temperature in greenhouse. 41
Figure 2.6. Endogenous ABA concentrations in red or blue LED-treated skin. 42
vii
Figure 2.7. Quantitative real time RT-PCR analysis of VlMYBA1-2 and
VlMYBA2 in red or blue LED-treated skin.
43
Figure 2.8. Changes of total anthocyanin concentration in red or blue LED-
treated skin.
44
Figure 2.9. Changes of quantitative real time RT-PCR analysis of VvUFGT ,
VlMYBA1-2 and VlMYBA2 in red or blue LED-treated skin.
45
Figure 2.10. Changes of total sugar in red or blue LED-treated skin. 46
Figure 2.11. Changes of glucose and fructose concentrations in red or blue
LED-treated skin.
47
Figure 2.12. Effect of LED irradiation on grapes harvested at 106 DAFB. 51
Figure 3.1. Changes in the temperature in the greenhouse under the early-
heating culture (Exp. 1) (a) and in the ordinary growing season (Exp. 2) (b).
LED irradiation (−) shows the average temperature during LED irradiation
61
Figure 3.2. Endogenous ABA concentrations and the expression of VvNCED1
and VvCYP707A1 under the early-heating culture (Exp. 1) (A) and in the
ordinary growing season (Exp. 2) (B). The experimental values are plotted in
comparison to the control (Ubiquitin) value. Data are the means ± SE of three
replications. Different letters indicate significant difference by Tukey-Kramer
test at P ≤ 0.05. Red or blue-LED cluster treatment: red (C), blue (C). Red or
blue-LED leaf treatment: red (L), blue (L).
63
Figure 3.3. Changes in the total anthocyanin concentrations under the early-
heating culture (Exp. 1) (A) and in the ordinary growing season (Exp. 2) (B).
Data are the mean ± SE of three replications. Different letters indicate
65
viii
significant difference by Tukey–Kramer test at P ≤ 0.05. Red or blue-LED
cluster treatment: red (C), blue (C). Red or blue-LED leaf treatment: red (L),
blue (L)
Figure 3.4. Changes in the expressions of VvUFGT, VlMYBA1-2, and
VlMYBA2 under the early-heating culture (Exp. 1) (A) and in the ordinary
growing season (Exp. 2) (B). Data are the mean ± SE of three replications.
Different letters indicate significant difference by Tukey–Kramer test at P ≤
0.05. Red or blue-LED cluster treatment: red (C), blue (C). Red or blue-LED
leaf treatment: red (L), blue (L)
66
Figure 3.5. Changes in total sugar, glucose, and fructose concentrations under
the early-heating culture (Exp. 1) (A) and in the ordinary growing season (Exp.
2) (B). Data are the mean ± SE of three replications. Different letters indicate
significant difference by Tukey–Kramer test at P ≤ 0.05. Red or blue-LED
cluster treatment: red (C), blue (C). Red or blue-LED leaf treatment: red (L),
blue (L)
68
Figure 3.6. Effect of LED irradiation on grapes harvested at 97 DAFB. (Exp. 1) 74
Figure 3.7. Effect of LED irradiation on grapes harvested at 99 DAFB. (Exp. 2) 74
ix
LIST OF ABBREVIATIONS
ºC degree Celsius
µg microgram
µL microliter
µmol kg-1
micromole per kilogram
µM micromolar
% percentage
ABA abscisic acid
cm centimetre
DAFB days after full bloom
DNA deoxyribonucleic acid
et al. exampli gratia (Latin), for example
FB full bloom
FW fresh weight
GA3 gibberellic acid
GC-MS-SIM gas chromatography-mass spectrometry-
selected ion monitoring
g gram
HPLC high performance liquid chromatography
L liter
LED light emitting diode
M molar
x
m meter
mg L-1
milligram per liter
Mg milligram
min minute
mL milliliter
mm millimeter
mM millimolar
m/s mass/charge ratio
nm nanometre
OD optical density
pH power of hydrogen ion
PPF the photosynthetic photon flux density
ppm part per million
RNA ribonucleic acid
rpm revolution per minute
RI a refractive index
RT-PCR reverse transcription-polymerase chain
reaction
sec second
UV ultraviolet
V volt
v volume
VvNCED1 9-cis-epoxycarotenoid dioxygenase
xi
VvCYP707A1 ABA 8'-hydroxylase
VvUFGT UDP-glucose-flavonoid 3-O-
glucosyltranferase
v/v volume by volume
w/v weight by volume
s second
SE standard error
Chapter 1: General introduction and literature review
1
CHAPTER 1
GENERAL INTRODUCTION AND LITERATURE REVIEW
Chapter 1: General introduction and literature review
2
1.1 GENERAL INTRODUCTION
Grape skin color which is one of the most important fruit qualities is mainly
determined by anthocyanin synthesis during the maturation process. The
accumulation of anthocyanin during grape berry development requires a complicated
interaction between developmental and environmental factor. Abscisic acid (ABA)
has been considered as plant hormone that regulates berry development in
grapes. Its concentration increases significantly at veraison and then declines to low levels
at ripening stage. In addition, ABA application to grape berries can induce the
expression of anthocyanin biosynthetic genes. In plant, ABA plays important roles in
environmental stress such as low temperature and drought stress. The ABA accumulation
is regulated by the balance of biosynthesis and catabolism (Kushiro et al., 2004). The
9-cis-epoxycarotenoid dioxigenase (NCED) is a key enzyme in ABA biosynthesis,
and ABA is catabolized by 8'-hydrocylase (CYP707A) (Kondo et al., 2012). However,
effect of ABA on the grape berry ripening is less well understood.
Anthocyanins which belong to flavonoids are secondary plant metabolites that
accumulate in grape berries. They play important roles in resistance to UV light and
in attraction of animal pollinators. They have been also studied for their beneficial
effects on human health including antioxidant activity, prevention of coronary heart
disease, anticancer activity, and others. The biosynthesis pathway of anthocyanins in
grapes has been investigated. Boss et al. (1996a, b) showed that the expression of
flavonoid 3-O-glucosyltransferase (UFGT) which was detected only in the berry skins
of red cultivars is critical for anthocyanin biosynthesis. There are three regulatory
proteins that activate the structural genes in the anthocyanin pathway including MYB,
Chapter 1: General introduction and literature review
3
bHLH, and WD40 (Koes et al., 2005). In Vitis × Vitis labrusca grapes, some MYB-related
transcriptional factor genes have been isolated and shown to regulate anthocyanin
biosynthesis genes including VlMYBA1-2, VlMYBA1-3 and VlMYBA2 (Azuma et al.,
2011, 2008; Kobayashi et al., 2002). Temperature and light are important
environmental factors that affect anthocyanin synthesis in grapes. It has been reported
low temperature at night between 10 and 20°C developed the strongest coloration of
‘Tokay’ grapes (Kliewer and Torres, 1972), whereas high temperature such as 30 ºC
decreased the expressions of anthocyanin biosynthesis-related gene and anthocyanin
accumulation (Mori et al., 2005a; Yamane et al., 2006). Several studies showed that
exposure of grape clusters to light significantly increased the accumulation of
flavonoid and the expression of their biosynthesis genes, whereas they was reduced
by shading treatment (Fujita et al., 2006; Jeong et al., 2004; Matus et al., 2009).
In Japan, double-cropping system has been developed to enhance grape
production since 1960. In general, the first harvest is in late June or early July, and the
second one is in December or January. In this cultivation technique, supplementary
light treatment, temperature control, breaking of dormancy, pruning, and CO2
application are important factors to improve berry quality. Light emitting diodes
(LEDs) are used as a supplement light in a plant factory. They can reduce the
production cost, long durability, and low heat generation (Kwon and Lim, 2011).
It has been reported that LED treatment to grape at night increased the expression of
anthocyanin biosynthesis-related genes (Azuma et al., 2012a; Kondo et al., 2014).
However, there is little information on the effect of LED irradiation on ABA
concentrations, anthocyanin production, their related gene expressions, and sugar
synthesis in grape berries in greenhouse. The objective of this study is as follows:
Chapter 1: General introduction and literature review
4
1) To clarify the effect of red- and blue- LED irradiation at night to vines on
anthocyanin accumulation in greenhouse in the double-cropping system
which the proportion of blue and red light in sunshine differs with season.
2) To clarify the effect of the irradiating position (leaf or cluster) of red or blue
LED on anthocyanin synthesis in grape berries.
Chapter 1: General introduction and literature review
5
1.2 LITERATURE REVIEW
1.2.1 Grape
Grapes have a large fruit crop production with approximately 77.1 million
metric tons in the world in 2013 (FAOSTAT, 2013). About 80% of the total crop is
used in wine production, and approximately 13% is consumed as table grapes. Most
grapes are grown in China, Italy, USA, and France (Karlsson, 2013). There are two
major types of grapes including European grapes with the species Vitis vinifera L.,
and North American grapes with two main species V. labrusca and V. rotundifolia.
Almost 95% of Vitis vinifera such as ‘Cabernet Sauvigon’ and ‘Chardonnay’ are
cultivated for wine. Both V. labrusca and V. rotundifolia species of North American
grapes can be consumed as table or processed grapes as juice or wine. The most
important variety is ‘Concord’ with large purple berries. The important aspects of
table grapes are large, tasty and, having an attractive color. The anthocyanins are
primary substances for grape coloration. Their amount in red grapes varies with the
species, variety, maturity, seasonal conditions, production area, and yield of fruit
(Mazza and Miniati, 1993).
In 2013, the total grape production in Japan was almost 190,000 metric tons
(FAOSTAT, 2013), and most vineyards in Japan product are table grapes. ‘Kyoho’,
which is a cross variety between Vitis vinifera and Vitis labrusca, is one of the main
cultivar in Japan. ‘Kyoho’ produces large sized berries, strong sweetness, and good
flavor. ‘Kyoho’ harvested in late August has a dark purple or almost black color skin
that is easily separated from the fruit. Fruit qualities including bunch appearance, skin
Chapter 1: General introduction and literature review
6
color, and sugar contents are quite important for the market of table grapes in ‘Kyoho’
in Japan (Morinaga, 2001).
1.2.2 Stage of grape fruit development
Grapes are classified into non-climacteric fruits whose respiration rates do not
show large peaks during maturation and ripening (Giovannoni, 2001). To date, the
method that control ripening of non-climacteric fruits has not been well understood.
The hormonal control of non-climacteric fruits such as grapes and strawberries
appears to be complicated, whereas in climacteric fruits, ripening pathways is
primarily regulated by ethylene (Gazzarrini and McCourt, 2001; Pech et al., 2008;
Yokotani et al., 2009). However, it has been found that grapes and strawberries
exhibit an increase in ethylene development at ripening (Chervin et al., 2004; Iannetta
et al., 2006). Iannetta et al. (2006) has reported that there is a small rise in respiration
in strawberries at ripening. On the other hand, ABA has been implicated in the control
of grape ripening (Jia et al., 2011; Wheeler et al., 2009). Endogenous ABA
concentrations coincide with the accumulation of sugars and anthocyanin during the
onset of ripening (Geny et al., 2006; Wheeler et al., 2009).
Grape exhibits a double sigmoid pattern, and there are three stages of berry
development (Figure.1.1 ) (Keller, 2015). The first stage is the cell division which
begins 5−10 days before anthesis and continues for approximately 25 days (Coombe,
2001; Harris et al., 1968). At this stage, the berry expands in volume and accumulates
organic acids including tartaric and malic acids, and tannins. The hydroxycinnamic
acid in the flesh and skin is accumulated at this time. Endogenous ABA
concentrations in the berry is high during early development and then declines as the
Chapter 1: General introduction and literature review
7
berry expands (Davies and Böttcher, 2009). The cell division phase is followed by lag
phase or phase II which pauses in berry growth. Berry turgor pressure also declines
during lag phase (Matthews and Shackel, 2005). The length of this period about one
to six weeks depends on the cultivar. After the lag phase, about 60 day after anthesis,
phase III the ripening process begins. At the beginning of this phase, viticulturists call
the onset of ripening as veraison when the transition from green to red skin in berries
of red grape varieties occurs. Endogenous ABA concentrations increase rapidly after
veraison, then decrase to low levels at ripeness (Davies et al., 1997; Owen et al.,
2009). During this phase, the berry expands and several changes occur. The ripening
process involves a coordinated shift in fruit development which leads to berry
softening, malic acid reduction, and accumulation of sugars and anthocyanins. The
accumulations of sugars and anthocyanin are dependent on the different factors such
as environmental factors and viticulture practices.
Figure 1.1. Diagram of a typical double-sigmoid pattern of growth by a grape berry,
from anthesis to harvest. (Coombe, 2001.)
Chapter 1: General introduction and literature review
8
1.2.3 Grape skin color
Color is an important factor for the red grape cultivars since consumers
generally prefer well pigmented grapes. Grape skin color is mainly determined by the
content of anthocyanins which belong to flavonoids compound family (Baranac et al.,
1997). Anthocyanins are secondary plant metabolites which accumulate in fruit or
skin, and its synthesis occurs during the maturation process. In the red cultivars,
anthocyanins was synthesized and accumulated in their berry skin (Shiraishi and
Watanabe, 1994) whereas the white cultivars regularly do not produce any
anthocyanins in their fruits (P. Boss et al., 1996). In addition, the accumulation of
anthocyanins in red cultivars is often influenced by many factors such as
phytohormone and environment.
Anthocyanins are important in biological roles such as protection against UV
light, resistance against pathogens and attraction of predators for pollination (Chalker-
Scott, 1999; Schaefer et al., 2004; Takahama, 2004). Moreover, the beneficial effects
of anthocyanins on human health including antioxidant activity, antimicrobial activity,
anticancer, and prevention of coronary heart diseases have been suggested (Ross and
Kasum, 2002). For these reasons, anthocyanin accumulation in grape is one aspect of
currently active researches.
1.2.4 Anthocyanin biosynthesis in grapes
Anthocyanin that is predominant pigments in the red or purple colors in grape
berries commences at veraison, and sugar accumulation begins and continues
throughout berry ripening (Boss et al., 1996). Anthocyanin is glycoside of
polyhydroxy and polymethoxy derivatives of 2-phenylbenzopyrylium
Chapter 1: General introduction and literature review
9
(anthocyanidins). Among pelargonidin, cyanidin, delphinidin, peonidin, petunidin,
and malvidin which are the common anthocyanidins found in grapes, and malvidin is
usually the predominant anthocyanidin in most red vines (Mazza and Francis, 1995).
The proportion and amount of each anthocyanidin varies among cultivar and
viticulture.
In Figure 1.2, anthocyanin in grape berries is synthesized via flavonoid
pathway which can be divided into two sections. One is the upstream flavonoid
pathway which large gene encoded the enzymes that act earlier in the flavonoid
pathway. The other is downstream anthocyanin pathway in which the enzymes that
are encoded by one single active gene. (Sparvoli et al., 1994). Phenylalanine as a
direct precursor for the synthesis of anthocyanidins is converted to anthocyanine by a
series of enzyme-catalyzed reaction. Firstly, phenylalanine transformed to trans-
cinnamic acid by phenylalanine ammonia lyase (PAL). Then trans-cinnamic acid
changes into 4-coumaroyl-CoA by cinnamate 4-hydroxylase (C4H) and 4-coumarate-
CoA ligase (4CL). One molecular of 4-coumaroyl-CoA including three molecules of
malonyl-CoA is catalyzed by chalcone synthase (CHS) from naringenin chalcone
rapidly isomerized to naringenin by chalcone isomerase (CHI). Narigenin is
hydroxylated at the 3-position by flavanone 3-hydroxylase (F3H) and converts to
dihydroflavonols which is reduced to leucoanthocyanidin by dihydroflavonol 4-
reductase (DFR). Then leucoanthocyanins as substrate for the synthesis of
corresponding colored anthosyanidins are catalyzed by anthocyanidin synthase (ANS).
Finally, the hydroxyl group at C3 of anthocyanidins is glycosylated by the action of
UDPG-flavonoid-3-O-glucosyltransferase (UFGT) and anthocyanins are finally stored
in the vacuole (Xie et al., 2011).
Chapter 1: General introduction and literature review
10
Figure 1.2. Anthocyanin biosynthesis pathway and its branches. (Xie et al., 2011)
Do
wnst
ream
anth
ocyanin
Acetic acid
3 × malonyl-CoA
A
The Krebs
cycle
p
athw
ay
Cinnamic acid
Phenylalanin
p-coumaric acid
4-coumaroyl-CoA
Naringenin chalcone
Narigenin
Dihydroflavonols
Leucoanthocyanidins
Anthocyanidins
Anthocyanins
PAL
C4H
4CL
CHS
CHI
F3H
DFR
ANS
UFGT
Lignin C3H
Proanthocyanidins
ANR
FLS
LAR
Flavonols Upst
ream
fla
vo
no
id p
athw
ay
Chapter 1: General introduction and literature review
11
1.2.5 Anthocyanin accumulation and related genes in grape berries
Anthocyanin, the secondary metabolite of the flavonoid pathway, is
synthesized under the regulation of multiple regulatory genes at the transcriptional
level (Koes et al., 1994; Springob et al., 2003).
In flavonoid upstream pathway, the structural genes of the anthocyanin
biosynthesis were regulated by a transcription complex composed of three regulatory
proteins belonging to MYB transcriptional factors, MYC transcriptional factors
encoding basic helix-loop-helix proteins (bHLH), and WD40-like proteins playing
important roles in the regulation of other flavonoid products such as flavonols and
proanthocyanidins (Koes et al., 2005). In Arabidopsis thaliana with low
proanthocyanidin levels or low levels of both anthocyanins and proanthocyanidins,
three regulatory genes regulate the expression of the structural genes, which are
involved in the flavonoid synthesis, such as CHI, CHS, F3H, and DFR (Abrahams et
al., 2002; Gonzalez et al., 2008; He et al., 2008; Ramsay et al., 2003).
In grapes, MYB transcriptional factors have been involved in the control of
different branch of the phenylpropanoid pathway, such as anthocyanins, flavonols,
proanthocyanidins, and lignins. On the contrary, several transcriptional factors of
MYC family and the WD40-like proteins have been found in grapes, but there is no
detailed information on the anthocyanin synthesis (Czemmel et al., 2009; Stracke et
al., 2007).
For the specific downstream branches in anthocyanin synthesis pathway,
anthocyanin formation through glycosylation and subsequent modification of
Chapter 1: General introduction and literature review
12
methylation and acylation was regulated by some MYB related transcription factors.
Three MYB related transcriptional factors including VlMYBA1-1, VlMYBA1-2, and
VlMYBA2 in the Vitis labrusca grapes were identified as particularly regulating
anthocyanin accumulation, and those greatly facilitated the investigation of the
regulation of anthocyanin biosynthesis in Vitis vinifera grapes (Cutanda-Perez et al.,
2009; Kobayashi et al., 2002; Koshita et al., 2008).
Azuma et al. (2012b) showed that the three MYB related genes (VlMYBA1-3,
VlMYBA1-2, and VlMYBA2) in the Vitis × labrascana grapes responded to
temperature and light differently, although the products of those genes had the ability
to regulate anthocyanin biosynthesis pathway genes. They reported that VlMYBA1-3
was strongly and significantly affected by both temperature and light conditions,
whereas VlMYBA1-2 as well as VlMYBA2 was affected primarily by light and
temperature, respectively.
In red Vitis vinifera grapes, VvMYBA regulator genes including VvMYBA1,
VvMYBA2, and VvMYBA3 from grapes have been isolated (Kobayashi et al., 2005).
Only, VvMYBA1 is expressed in berry skin after veraison and regulates anthocyanin
biosynthesis during ripening by control of the expression of UFGT, critical
anthocyanin biosynthesis genes, and it is not expressed in the young leaves and stem
epidermis of grapes normally colored (Jeong et al., 2006).
Chapter 1: General introduction and literature review
13
1.2.6 Factors affect anthocyanin biosynthesis in grapes
1.2.6.1 Plant hormone
Abscisic acid (ABA)
Abscisic acid (ABA) is a phytohormone that plays important roles involved in
many phases of the plant’s life cycle, including seed development and dormancy.
ABA responds to various environmental stress such as salt, low temperature, and
drought stress (Kondo et al., 2012; Seo and Koshiba, 2002; Yoshikawa et al., 2007;
Zeevaart and Creelman, 1988). When plants encounter environment stress, ABA
levels increase as a signal transduction substance of secondary metabolism against
stresses (Cutler et al., 2010). ABA biosynthesis involves the oxidative cleavage of
carotenoids, and 9-cis-epoxycarotenoids (NCED) is known as the key enzyme in the
biosynthesis pathway of ABA (Nambara and Marion-Poll, 2005; Setha et al., 2004).
On the other hand, the expression of NCED gene is always not consistent with ABA
levels, indicating that the mechanism of ABA accumulation is complicated. The
endogenous ABA level is modulated by the specific balance between biosynthesis and
catabolism of NCEDs and ABA 8'-hydroxylase (CYP707As) transcripts.
ABA is degraded through the irreversible pathway by CYP707As (Sun et al., 2010;
Zhou et al., 2004).
In non-climacteric fruits such as strawberry and grape, ABA is associated with
fruit ripening (Jia et al., 2011; Wheeler et al., 2009). Endogenous ABA concentration
increases sharply during the onset of the ripening when berries begin to accumulate
Chapter 1: General introduction and literature review
14
sugars and anthocyanin (Geny et al., 2006; Wheeler et al., 2009), suggesting a
possible role in the onset of ripening.
It has been reported that ABA application to grape could increase the
anthocyanin content in grape skin and enhanced the coloration of grapes (Kataoka et
al., 1982). On the usage of ABA as a culture solution in grape cell suspension culture,
Hiratsuka et al. (2001) reported that ABA can highly promote anthocyanin
accumulation and the expression of chalcone isomerase (CHI), an essential enzyme in
the flavonoid pathway for anthocyanin biosynthesis. Furthermore, ABA application
not only increased the anthocyanin accumulation in grape skin but also the expression
of chalcone synthase (CHS), CHI, dihydroflavonol 4-reductase (DFR), and UDP-
glucose-flavonoid-3-O-glucosyl-transferase (UFGT) genes in the anthocyanin
biosynthesis pathway, and the expression of VvmybA1, regulatory factors (Ban et al.,
2003; Jeong et al., 2004). On the other hand, ABA application to grape increased
coloration rather than enhancement of sugar accumulation. (Cantín et al., 2007; Mori
et al., 2005a; Peppi and Fidelibus, 2008)
Ethylene
Ethylene acts as a plant hormone that controls many aspects of fruit ripening.
It seems to play a role in regulation of some genes expressed during non-climacteric
fruit ripening (Delgado et al., 2002; El-Kereamy et al., 2003; Tira-Umphon et al.,
2007). Application of the ethylene-releasing compound, 2-chloroethylphosphonic acid
(2-CEPA) to grape berries in some cases can promote the accumulation of
anthocyanins and/or sugar levels in grape skin (Delgado et al., 2002; El-Kereamy et
al., 2003; Tira-Umphon et al., 2007). In addition, 2-CEPA treatment to grape berries
Chapter 1: General introduction and literature review
15
stimulated the expression of CHS, flavonoid-3-hydroxylase (F3H), anthocyanidid
synthase (ANS) and UFGT except DFR (El-Kereamy et al., 2003). Moreover, the
treatment of berries with 1-methylcyclopropene (1-MCP), an ethylene inhibitor,
inhibited grape ripening (Chervin et al., 2004). Besides, Iannetta et al. (2006) reported
that strawberries underwent a small rise in respiration at ripening. These results
indicate that ethylene may play a role in grape berry ripening.
Jasmonic acid (JA) and Salicylic acid
Usually, plant produces Jasmonic acid (JA), methyl jasmonate (MeJA), and
salicylic acid in the response to many biotic and abiotic stresses. In apple and grape,
jasmonate has been found to affect color development, possibly through interaction
with ethylene biosynthesis (Fan et al., 1998; Rudell et al., 2005). It was reported that
JA application to grape cell suspension cultures which were irradiated with light
enhances anthocyanin production (Zhang et al., 2002). Moreover, MeJA application
in combination with carbohydrates in grape cell suspension cultures stimulated the
expressions of CHS and UFGT and triggered anthocyanin accumulation (Belhadj et
al., 2008).
In grape berries, salicylic acid can induce the expression of phenylalanine
ammonia-lyase (PAL) which is an important gene for phenylpropanoid metabolism.
Thus, salicylic acid may indirectly enhance anthocyanin biosynthesis (Wen et al.,
2005).
Chapter 1: General introduction and literature review
16
Auxin
Auxin is a plant growth hormone that stimulates differential growth in
response to gravity or light. It was reported that the applications of 2,4-
dichlorophenoxyacetic acid (2,4-D) or 1-naphthaleneacetic acid (1-NAA), a synthetic
auxin, to grape berries inhibited the accumulation of anthocyanin and the expression
of anthocyanin biosynthetic genes and suppressed VvMYBA1, a regulatory gene of
anthocyanin biosynthesis (Ban et al., 2003; Jeong et al., 2004).
1.2.6.2 Environmental Factors
Anthocyanin biosynthesis is generally influenced by many environmental
factors, such as sunlight exposure, UV irradiation, temperature, and water. These
environmental factors can significantly modify the content and the composition of
anthocyanins in grape berry by affecting the expressions of the structural and
regulatory genes (Mazza and Francis, 1995).
Light and temperature
Light is an important factor controls anthocyanin biosynthesis (Chalker-Scott,
1999). Many studies have shown that the anthocyanin biosynthesis in fruit skin can be
increased by light exposure and decreased by shading (Azuma et al., 2012a; Takos et
al., 2006). Light treatment induced higher expression of flavonoid biosynthetic genes
in grape berry skin such as CHS, CHI, F3H, flavonoid 3,5-hydroxylase (F3'5'H), DFR,
O-methyltransferase (OMT) as well as UFGT (Azuma et al., 2012b). Shading
treatment reduced the mRNA accumulation of VvMYBA1, a regulatory gene, and the
expression of several structural genes in anthocyanin biosynthesis, such as CHS, CHI,
Chapter 1: General introduction and literature review
17
F3H, and UFGT (Jeong et al., 2004), but upregulated the expression level of MYB4,
which is the repressor of UFGT (Azuma et al., 2012b).
In addition to light quantity (intensity) as well as light duration (photoperiod),
light quality (spectral distribution) including UV light and blue light affects the
anthocyanin biosynthesis in fruits by promoting the expression of related anthocyanin
biosynthesis enzymes (Li et al., 2013; M et al., 2012; Ubi et al., 2006). However,
excessive sunlight caused sunburn in grape berries to reduce anthocyanin
accumulation (Chorti et al., 2010).
Apart from light exposure, temperature is another important environmental
factor that influences anthocyanin biosynthesis (Tarara et al., 2008). Usually, low
temperatures promote the anthocyanin biosynthesis. For example, in ‘Tokay’ grapes,
the strongest fruit color development was found under day temperatures between 15
and 25°C and night temperatures between 10 and 20°C (Kliewer and Torres, 1972).
Furthermore, a lower temperature (15°C) around the berry clusters affected color
development more strongly than higher cluster temperatures in ‘Delaware’ and
‘Kyoho’ grpaes (Tomana et al., 1979). On the other hand, many studies have been
shown that high temperatures (30–35ºC) decreased anthocyanin concentration in the
skin of apple and grape berries (Azuma et al., 2012b; Lin-Wang et al., 2011; Mori et
al., 2007). In grape berries, high night temperatures about 30ºC inhibit the gene
expression of CHS, F3H, DFR, ANS, and UFGT at the early stages of ripening and
dramatically reduce the activity of UFGT, resulting in poor anthocyanin accumulation
(Mori et al., 2005b; Yamane et al., 2006). Also, changes in quantitative and/or
qualitative anthocyanin profile of grape berries, apples, and bilberries have been
Chapter 1: General introduction and literature review
18
reported in different temperature treatments (Azuma et al., 2012b; Uleberg et al.,
2012; Xie et al., 2012). Moreover, the combination of low temperature and light
treatment has been known to induce anthocyanin biosynthesis in the skin of apple,
pear, and grape (Azuma et al., 2012b; Steyn et al., 2009)
It has been reported that MYB genes that is related to flavonoid biosynthesis in
fruits react to environmental factors such as light or temperature in a different manner
(Azuma et al., 2012; Czemmel et al., 2009; Takos et al., 2006). In grape berry skins,
the expression of MYB related transcription factor genes in anthocyanin biosynthesis
such as VlMYBA1-3, VlMYBA2, VlMYBA1-2 varied in light or temperature treatment.
The expression of VlMYBA1-3 was strongly affected by both temperature and light
treatment, whereas the expression of VlMYBA2 as well as VlMYBA1-2 was affected
mainly by light and temperature, respectively. However, some other examined MYB
related flavonoid biosynthesis genes such as MYB5a and MYB5b did not react to light
or temperature treatment. Interestingly, the highest ABA contents were detected with
the low temperature (15 °C) in light or dark treatment, indicating that ABA might
have a role in temperature that controls flavonoid synthesis (Azuma et al., 2012b).
Water
Besides light and temperature, water status is important environmental factor
affects anthocyanin biosynthesis. Under water deficit conditions during grape
maturation, anthocyanin synthesis was highly stimulated. Moreover, the related
anthocyanin biosynthetic genes such as CHS, F3H, F3'5'H, OMT, and UFGT could
also be stimulated in grape berries under water deficit conditions. Drought conditions
enhance the production of the hydroxylated and methoxylated anthocyanins
Chapter 1: General introduction and literature review
19
(Castellarin et al., 2007b). Apart from anthocyanin accumulation, water deficit limited
the expression of the structural genes involved in the synthesis of proanthocyanidins
and other flavonols and their accumulation (Castellarin et al., 2007a).
1.2.6.3 Viticulture practices
The composition and concentration of anthocyanin in grape is complicated and
varies as an outcome of the many viticultural factors including cultivar, climate,
seasonal effects, canopy management, fertilizer, and irrigation (Mazza and Francis,
1995).
Thinning technique can improve yield and fruit composition at harvest.
Cluster thinning in order to reduce the bunch numbers can advance fruit maturation,
increase weight of bunch and berry, enhance the anthocyanin accumulation, and
improve fruit quality (Petrie and Clingeleffer, 2006). On the contrary, cluster thinning
at veraison had a little effect on maturation and the weight of grape skins; however it
resulted in a lower total acidity in berry skin (Peña Neira et al., 2007). Girdling
technique before veraison can improve coloration by enhancing sugar in berries
(Koshita et al., 2011; Yamane and Shibayama, 2007, 2006). In contrast, shading of
the leaves or defoliation reduces it (Kliewer, 1970). Moreover, excesses of nitrogen
fertilizer found to decrease the anthocyanin accumulation of fruit as well as other
phenolic compounds (Stefanelli et al., 2010). Root restriction can improve berry
quality in grape and increase the anthocyanin levels in berry skin at harvest (Wang et
al., 2012).
Chapter 1: General introduction and literature review
20
1.2.7 Light
Plants do not absorb all spectrum of solar radiation; they selectively absorb
the proper wavelengths according to their requirements. The most important part of
the light wavelengths is visible light laid in the range between 400 and 700 nm
which is known as photosynthetically active radiation (PAR). Chlorophylls
(chlorophyll a and b) and photosynthetic pigments, for example the carotenoids
β-carotene, zeaxanthin, lycopene, and lutein play an important role in the
photosynthesis. (Figure 1.3).
Figure 1.3. Absorption spectrum of chlorophyll and antenna pigments. (Singh et al., 2014.)
Plant pigments including chlorophylls and carotenoids begin absorption
in 380–400 nm (ultraviolet A/visible light), and peak absorption by chlorophylls
occurs in 400–520 nm range containing violet, blue, and green wavelengths which has
a strong influence on vegetative growth and photosynthesis. In 520–610 nm
containing green, yellow, and orange bands, this range is less absorbed by the plant
Chapter 1: General introduction and literature review
21
pigments. A large amount of absorption occurs at 610−720 nm including red
wavelength. This wavelength strongly affects the vegetative growth, photosynthesis,
flowering, and budding (Singh et al., 2014).
Photoreceptors
Higher plants accurately perceive solar radiation from UV-B to far-red
wavelengths by photoreceptors including phytochrome absorbing red/far-red light
as well as cryptochromes, and phototropins sensing UV-A/blue light, and UV-B
photoreceptor UV RESISTENCE LOCUS8 (UVR8) (Casal, 2013; Favory et al.,
2009; Möglich et al., 2010; Rizzini et al., 2011).
Figure 1.4. The spectrum of solar radiation reaching from gamma rays to radio waves
with view on visible wavelengths and plant photoreceptors absorbing specific
wavelength. CRY, cryptochromes; PHY, phytochromes; PHOT, phototropins; UV,
ultraviolet; UVR8, UV-B photoreceptor. (Zoratti et al., 2014.)
Chapter 1: General introduction and literature review
22
Phytochromes with in two forms such as Pr that responds to red light and Pfr
that responds to far-red light regulate flowering in plants. These two pigments (Pr
and Pfr) convert back and forward. Under red light (660 nm), Pr is converted into Pfr
which is the active form triggering flowering, in contrast Pfr into Pr with far-red light
(Figure 1.5) (Downs and Thomas, 1982; Evans, 1976; Shinomura et al., 2000; Smith,
1982). Phytochromes move to the nucleus that was activated by light. Two different
forms of phytochrome function as a detection of circadian rhythms and seasonal
changes in light conditions (Casal, 2013; Reed, 1999).
Figure 1.5. Red and far-red light mediated conversion of phytochromes. (Singh et al., 2014)
Cryptochromes are photoreceptors for blue, green, and UV-A light. They are
involved in sensing circadian rhythms and control of various developmental processes
including secondary metabolic biosynthesis, such as flavonoids (Giliberto et al., 2005;
Lopez et al., 2012). Phototropins also absorb blue and UV-A light. In Fragaria ×
ananassa fruits, Kadomura-Ishikawa et al. (2013) has shown that blue light increased
anthocyanin accumulation through FaPHOT2, a phototropin2 and the expression of
FaCHS after four days of treatment.
Chapter 1: General introduction and literature review
23
Recently, an important piece of the puzzle in the mechanism which light
controls anthocyanin synthesis in fruits has been reported at post-translational level.
MdMYB1 protein accumulates in light, but is degraded in the dark through an
ubiquitin-dependent pathway. The ubiquitin E3 ligase CONSTITUTIVE
PHOTOMORPHOGENIC1 (COP1), a suppressor of phytochromes, functions as a
negative regulator of light signaling directly at the downstream of the photoreceptors
in controlling different light-regulated plant development processes by adjustment of
its subcellular localization (Lau and Deng, 2012). Li et al. (2012) showed that in apple,
the MdMYB1 protein which is a positive regulator of light-induced anthocyanin
synthesis could interact directly with MdCOP1 protein acting as a molecular switch of
light-induced plant processes.
In the dark, COP1 is localized in the nucleus, where it interacts with the subset
of specific key positive regulators including MYB and ELANGATED
HYPOCOTYL5 (HY5), a transcription factor promoting photomorphogensis, which
is a direct target of COP1 (Lee et al., 2007) in Figure 1.6 A.
In light, COP1 can interact with activated photoreceptors including
phytochromes and cryptochromes leading to the inhibition of COP function by
dissociation of COP1 from the complex and exportation from the nucleus. After
COP1 protein is removed from nucleus by activated photoreceptors, HY5 is stabilized
and links to activation of the MYBs and key structural flavonoid biosynthesis genes as
well as the accumulation of flavonoids in response to light in Arabidopsis and apple
(Hardtke et al., 2000; Maier et al., 2013; Peng et al., 2013; Shin et al., 2013; Stracke
et al., 2010) in Figure 1.6 B.
Chapter 1: General introduction and literature review
24
Figure 1.6. COP1 acts as a repressor in light signaling pathway by interacting directly
with photoreceptors to mediate different light-regulated plant developmental process
in darkness (A) and in visible light (B). (Lau and Deng, 2012; Zoratti et al., 2014.)
1.2.8 Light emitting diodes (LEDs)
As mention above, plants do not absorb all wavelengths of solar radiation. The
wavelengths in 400–520 nm containing blue wavelengths and in 610–720 nm
containing red wavelengths are mostly important for plant growth. LEDs can easily
generate the red and blue wavelengths that are consistent with the maximum
absorption of chlorophyll for the photosynthesis.
Nowadays, LEDs have been used effectively as a light source for growing
plants in a plant factory. They can replace fluorescent lights or high-pressure sodium
lamps (Ono and Watanabe, 2010; Watanabe, 2011). LEDs allow reduction of the
production cost, low electricity consumption, long durability, and low heat generation
Chapter 1: General introduction and literature review
25
(Kwon and Lim, 2011). Red wavelength is required for the development of the
photosynthesis, whereas blue wavelength is important for the synthesis of chlorophyll,
chloroplast development, stomatal opening, photomorphogenesis as well as
biosynthesis of secondary metabolites such as flavonoids (Akoyunoglou and Anni,
1984; Giliberto et al., 2005; Sæbø et al., 1995; Senger, 1982).
In grape, blue or red LED irradiation treatment enhanced the expression of
anthocyanin biosynthesis-related genes including MYB transcription factor genes,
resulting in anthocyanin accumulation. Moreover, the effect of blue LED treatment
was stronger than red LED treatment (Azuma et al., 2012a; Kondo et al., 2014). It has
been reported that the expression of FaPHOT2, a phototropin2, corresponded with
increasing in anthocyanin content in strawberry (Fragaria × ananassa, cv. Sachinoka).
Consequently, light sensing may have a role in sensing blue light, and mediating
anthocyanin biosynthesis in fruits (Kadomura-Ishikawa et al., 2013). Phytochromes, a
red light receptors, activate signal pathways leading to seed germination, seed
production, shade avoidance, and flowering (Quail et al., 1995; Stutte, 2009), whereas
Cryptochromes, a blue-ultraviolet light receptors, including cyp1 and cyp2 control the
inhibition of hypocotyl elongation, stimulation of cotyledon opening, and floral
development (Ahmad and Cashmore, 1993; Guo et al., 1998; Lin et al., 1998, 1996).
Moreover, it has been shown that cry1 can stimulate anthocyanin accumulation
(Ahmad et al., 1995; Chatterjee et al., 2006). It was reported that the elongation effect
of the main stem in leaf lettuce was promoted by a red LED but suppressed by blue
LED treatment (Hirai et al., 2006; Shimokawa et al., 2014).
Chapter 1: General introduction and literature review
26
However, the growth that is influenced by the red or blue LED treatment
might have depend on plant species (Goins et al., 2001; Li et al., 2012; Sims and
Pearcy, 1992).
1.2.9 Sugar induction of anthocyanin accumulation
Sugars not only act as energy sources but also act as signaling molecules
involved in the growth and development of higher plants (Finkelstein and Gibson,
2002; Smeekens, 2000). It was reported that in Arabidopsis, anthocyanin synthesis in
cotyledons or leaves increased when seedlings were grown in a sugar-containing
medium (Mita et al., 1997; Ohto et al., 2001). Moreover, a similar phenomenon was
observed in grape cells (Larronde et al., 1998) and radish hypocotyls (Hara et al.,
2003). Solfanelli et al. (2006) reported that in Arabidopsis, exogenous sucrose
treatment increased the expression of enzymes acting at the downstream of CHS,
including CHS, CHI, F3H, F3′H, FLS, DFR, leucoanthocyanidin dioxygenase
(LDOX), and UFGT. In grape berry skin, sucrose triggers the expression of
anthocyanin biosynthesis genes (Boss et al., 1996). It was also reported that sugars
enhanced anthocyanin accumulation and induced the expression of F3H in grape
berries (Zheng et al., 2009). In addition, light is required for sugar to induce the
anthocyanin accumulation (Jeong et al., 2010).
Chapter 1: General introduction and literature review
27
1.2.10 Interaction between sugar and ABA on anthocyanin accumulation
It has been reported that ABA treatment can induce anthocyanin accumulation
in maize kernels and grape (Kim et al., 2006; Lee et al., 1997; Mori et al., 2005a). In
Arabidopsis seedlings, ABA showed a synergistic effect with sucrose on anthocyanin
accumulation, resulting in a significant increase in the transcript levels of biosynthesis
genes including CHS, DFR, LDOX, UFGT, and cinnamate 4-hydroxylase (C4H)
(Loreti et al., 2008). However, the expression of the DFR gene in the ABA-deficient
mutant and in the ABA-insensitive abi1-1 mutant was no effect on anthocyanin
accumulation, regardless of the presence of sugar. It has been suggested that ABA is
not strictly required for sucrose-induced anthocyanin biosynthesis (Loreti et al., 2008).
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
28
CHAPTER 2
EFFECT OF BLUE- AND RED-LED IRRADIATION AT NIGHT
ON ENDOGENOUS ABSCISIC ACID (ABA), ANTHOCYANIN
AND SUGAR SYNTHESES IN DELAYED-START CULTURED
GRAPES UNDER DOUBLE CROPPING CULTIVATION SYSTEM
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
29
2.1 INTRODUCTION
Most vineyards in Japan product table grapes, and there are various cropping
techniques to cultivate grapevines such as early-heating culture or delayed-start
culture in greenhouses besides open-field culture. The grapes under early-heating
culture are harvested in late June or early July, and the grapes in the delayed-start
culture are harvested in December or January, when grapes are high prices. However,
generally the coloration or sugar concentrations in early-heating or delayed-start
grapes are inferior to those in grapes cultured in the open filed, because the duration
of sunshine or the amount of solar radiation are not always enough for the growing
period. In these cultivation techniques, long-day treatment by supplement light,
temperature control, breaking of dormancy, pruning, and enhanced CO2 application
are important to produce good qualities. Light emitting diodes (LEDs) have been used
as a supplement light for growing plants in a plant factory. Recently, Kondo et al.
(2014) showed that blue LED irradiation at night was effective in increasing
anthocyanin and sugar concentrations in grape berries that were harvested at the same
time as grapes cultured in the open field. Furthermore, anthocyanin synthesis in
grapes can be promoted by exogenous abscisic acid (ABA) treatment (Ovadia et al.,
2013), but Kondo et al. (2014) found that another factor besides ABA might
significantly influence anthocyanin formation in grape berries. There is little
information on the effect of LED irradiation on anthocyanin and sugar syntheses in
grape berries in the delayed-start culture system, in which the percentage of blue light
in sunshine gradually decreases and that of red light in the sunshine gradually
increases (Kamuro et al., 2003).
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
30
In the present study, the author examined the effects of red and blue LED
irradiation at night on endogenous ABA, anthocyanin synthesis, their related gene
expressions, and sugar synthesis in grape berries in delayed-start cultured grapes
under double cropping cultivation system.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
31
2.2 MATERIALS AND METHODS
2.2.1 Plant materials
Twelve 8-year-old ‘Kyoho’ grapevines [Vitis labrusca×V. vinifera] grafted
onto ‘Teleki-Kober 5BB’ rootstocks [V. berlandieri×V.riparia hybrids] and
underwent a delayed start under a double-cropping cultivation system, were planted in
a 45-L plastic pot and grown in a greenhouse covered with polyvinyl film (90%
transmittancy) at Chiba University located at 35° N Lat, 140° E Long, and at an
altitude of 37 m. The width of each vine was 165 ± 6.5 standard error (SE) cm and the
vine height was 135 ± 10 cm. Each vine has six clusters with 35 berries. To produce
seedless fruit, each cluster was treated with a 25 mg L-1
solution of gibberellic acid
(GA3) at full bloom (FB) and again 10 days after FB. Each plastic pot was watered 20
L per day. Three test groups of four vines each were irradiated with a red LED (peak
wavelength 660 nm) for three hours before sunrise and three hours after sunset, from
full bloom to 106 days after full bloom (DAFB). Vines in the second group were
irradiated with a blue LED (peak wavelength 450 nm) on the same schedule. The
third group consisted of untreated controls. The photosynthetic photon flux density
(PPF) of the red and blue LEDs was adjusted to 50 µmol m-2
s-1
at a distance of 10 cm
from the light. The PPF measured at each cluster was 19-12 µmol m-2
s-1
.
Sixty berries from each test group (15 berries from each cluster of one
representative vine per group) were sampled immediately after dawn at 61, 76, 91,
and 106 DAFB for the analysis of endogenous ABA, the 9-cis-
epoxycarotenoiddioxygenase (VvNCED1), ABA 8'-hydroxylase (VvCYP707A1),
UDP-glucose-flavonoid 3-O-glucosyltransferase (VvUFGT), VlMYBA1-2, and
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
32
VlMYBA2 genes, and anthocyanin and sugar concentrations. Ten berries from each
test group were sampled to analyze fruit qualities including length, width, weight, and
soluble solid and acid contents and thirty berries from each test group were sampled
to analyze skin color in L*, a*, b* and hue angle at harvesting (106 DAFB). After the
skin of the berries was peeled, the skins were immediately frozen in liquid nitrogen
and stored at −80°C until analysis.
2.2.2 Quantitative analysis of ABA
Endogenous ABA in the frozen skin samples was analyzed according to a
previous report (Kondo et al., 2014) (Fig. 2.1). The frozen skin samples [1 g fresh
weight (FW)] were homogenized in 20 mL cold 80 % (v/v) methanol with 0.2 µg
ABA-d6 as an internal standard. After homogenation and filtration of the
sample, the solution was subjected to a preparative high performance liquid
chromatograph (HPLC; model PU-980 Gulliver series; Japan Spectroscopic, Tokyo,
Japan; flow rate, 1.5 mL min−1
; detection at 254 nm) equipped with a Mightysil
RP-18 octadecylsilyl (ODS) column (Kanto Chemical, Tokyo, Japan; 4.6 mm
i.d. × 25 cm) eluted with a gradient of 4.8–9.6 M acetonitrile containing
20 mM acetic acid, over a period of 30 min, then held at 9.6 M acetonitrile for 5 min.
Fractions containing ABA were collected, dried in vacuo, and methylated using
ethereal diazomethane for 10 min. The methyl ester of ABA was analyzed by gas
chromatography-mass spectrometry-selected ion monitoring (GC-MS-SIM; model
QP5000; Shimadzu, Kyoto, Japan). The column temperature was a step gradient of
60°C for 2 min, then 60–270°C at 10°C min−1
, and 270°C for 35 min. The ions were
measured as ABA-d0 methyl ester/ABA-d6 methyl ester at m/z 190, 260, 194. The
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
33
ABA concentration was calculated from the ratio of peak areas for m/z 190 (d0)/194
(d6). To identify ABA methyl ester in the samples, its fragment ion pattern was
compared with chemical standards in the total ion monitoring (TIM) mode (Figure 2.2
and Figure 2.3).
Samples 1 gram were homogenized in 20 mL cold 80% (v/v) methanol with 0.2 µg
ABA-d6 as an internal standard
The homogenate was filtered
Washed with 20 mL cold 80% (v/v) methanol
Concentrated to an aqueous solution in vacuo
The aqueous phase was adjusted to pH 2.5 with 0.1 M phosphoric acid
Extracted three times with 20 mL 100% (v/v) ethyl acetate
Concentrated to dryness
Redissolved in 1 mL 4.8 M acetonitrile
The solution was subjected to HPLC
Fractions containing ABA was collected
Dried in vacuo
Methylated using ethereal diazomethane for 10 min
The methyl ester of ABA was analyzed by GC-MS-SIM
Figure 2.1. Flowchart of Quatitative analysis of ABA.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
34
Rela
tive
abu
ndance
(m/z)
d6-ABA
d0-ABA
d0-ABA
ABA standard
190 (d0-ABA)
260 (d0-ABA)
194 (d6-ABA)
Time (min)
Retention time profile showing selected ions in the ABA-containing fraction in standard
Mass spectrum of d6-ABA and d0-ABA in standard
Figure 2.2. Retention time and mass spectrum profile showing selected ions in the
ABA-containing fraction in standard and sample.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
35
Sample
d0-ABA
d6-ABA
Retention time profile showing selected ions in the ABA-containing fraction in sample
Mass spectrum of d6-ABA and d0-ABA in sample
Rela
tive
abu
ndance
d6-ABA
d0-ABA
d0-ABA
Time (min)
Figure 2.3. Retention time and mass spectrum profile showing selected ions in the
ABA-containing fraction in sample.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
36
2.2.3 RNA extraction, cDNA synthesis, and quantitative real-time RT-PCR analysis
Total RNA was extracted from the skin (1 g FW; three replications of 20 berries) as
described by Kondo et al. 2012) (Figure 2.4). A 2-µg aliquot of total RNA was treated
with 5 U of DNaseI (Takara Bio, Inc., Otsu, Japan) and used for first-strand cDNA
synthesis. For reverse transcription-polymerase chain reaction (RT-PCR), cDNA was
synthesized in a 20 µL reaction volume using ReverTraAce (Toyobo Co., Ltd., Osaka,
Japan) following the manufacturer’s instructions. RNA extraction and cDNA
synthesis were performed three times on each sampling date. Quantitative real-time
PCR was performed using a KAPA SYBR FAST Master Mix (Kapa
Biosystems,Boston, MA, USA) with Applied Biosystems StepOnePlus
(LifeTechnologies Co., Tokyo, Japan) following the instruction manual. Gene-
specific primers for each gene (Table 2.1) were used for RT-PCR. Primers for the
VvNCED1 and VvCYP707A1 genes were constructed according to previous report
(Kondo et al., 2014). The relative expression level of each gene was determined by a
relative standard curvemethod. The expression level was normalized to that of the
VvUbiquitin gene (Fujita et al., 2007).
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
37
Samples 1 gram were ground to a fine powder in liquid nitrogen using a mortar and pestle.
The powder was added to pre-warmed (65ºC) extraction buffer at 20 mL g-1
Incubated in a 65ºC water bath for 10 min
Extracted twice with equal volumes chloroform:isoamyl alcohol (24:1)
centrifuged at 9,000 rpm for 10 min at 4ºC
The aqueous layer was transferred to a new tube
centrifuged at 9,000 rpm for 10 min at 4ºC
Added 0.1 v 3 M NaOAc and 0.6 v isopropanal
Mixed and stored at −80ºC for 30 min
Centrifuged at 3,500 rpm for 30 min at 4ºC to collected nucleic acid pallets
The pallet was dissolved in 1 mL TE and transferred to a microcentrifuge tube
Added 0.3 v of 10 M LiCl to selectively precipitate the RNA
Stored overnight at 4ºC
Centrifuged at 20,000 rpm for 30 min at 4ºC to pellet RNA
Washed with cold 70% EtOH, air dired, and dissolved in 30 µL MilliQ
Total RNA extraction
Figure 2.4. Flowchart of RNA preparation.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
38
Table 2.1. Primers used for real-time RT-PCR.
Gene Forward/reverse primer (5'-3') Reference
VvNCED1 (F) GGTGGTGAGCCTCTGTTCCT Sun et al. (2010)
(R) CTGTAAATTCGTGGCGTTCACT
VvCYP707A1 (F) GAAACATTCACCACAGTCCAGA Sun et al. (2010)
(R) AGCAAAAGGGCCATACTGAATA
VlMYBA1-2 (F) TGGTCACCACTTGAAAAAGA Azuma et al. (2012a,b)
(R) GAATGTGTTAGGGGTTTATT
VlMYBA2 (F) GCTGAGCATGCTCAAATGGAT Azuma et al. (2012a,b)
(R) TCCCACCATATGATGTCACCC
VvUFGT (F) GGGATGGTAATGGCTGTGG Jeong et al. (2004)
(R) ACATGGGTGGAGAGTGAGTT
VvUbiquitin (F) TCTGAGGCTTCGTGGTGGTA Fujita et al. (2007)
(R) AGGCGTGCATAACATTTGCG
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
39
2.2.4 Anthocyanin
The Anthocyanin analysis was performed as described by Kondo et al. (2014).
The total anthocyanin concentrations were expressed as malvidin-3-O-glucoside
equivalents. The frozen skins samples (0.5 g FW; three replications of 20 berries)
were diluted with 2% (v/v) formic acid of 5 mL for 24 hours at 4ºC in the dark. After
filtration, Anthocyanin was analyzed by HPLC mass spectrometer (LC-MS; model
LCMS-2010 EV; Shimadzu) with a Mightysil RP-18 ODS column following
the method described by Wang et al. (2012) with a slight modification. Solvent
A was 2% formic acid and solvent B was composed of 2% formic acid and
acetonitrile. The starting conditions were 94% A and 6% B, then a linear gradient to
0% A and 100% B for 40 min, then a return to the initial conditions within 5 min. A
column at 40ºC with a flow rate of 1 mL min−1
and an ultraviolet/visible light
(UV/VIS) detector at 525 nm were used.
2.2.5 Sugar analysis
The sugar analysis was performed as described by Kondo et al. (2014).
The frozen skins samples (1 g FW; three replications of 20 berries) in 10 mL
80% (v/v) ethanol were heated at 60ºC for 10 min and homogenized after cooling.
The homogenate was filtered, evaporated, and analyzed by HPLC (model L-6200;
Hitachi, Tokyo, Japan) with a Shodex ODP2 HP-4E column [Showa Denko, Tokyo,
Japan; 4.6 mm i.d. × 25 cm]. A column at 30ºC with a flow rate of 1 mL min−1
at 75%
(v/v) acetonitrile and a refractive index (RI) detector were used.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
40
2.2.6 Statistical analysis
Data are shown as means ± SE of three replications. The SAS analysis of
variance procedure (version 8.2, SAS Institute, Cary, NC, USA) was used to
determine the treatment effects, and the mean separation was analyzed by Tukey-
Kramer test at P ≤ 0.05.
.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
41
2.3 Results
The average temperatures from full bloom to harvest (106 DAFB) during
LED irradiation in delayed-start cultured grapes are shown in Figure 2.5. The average
temperature in the greenhouse was similar to that in the open field until 61 DAFB
(veraison). Although the temperatures in the open field gradually decreased after 61
DAFB, those in greenhouse were kept about 15ºC until 106 DAFB (havest).
Figure 2.5. Change of temperature in greenhouse.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
42
2.3.1 Endogenous ABA concentration and the expressions of VvNCED1 and
VvCYP707A1
Endogenous ABA concentrations in blue- and red-LED-treated skin at 61, 91,
and 106 DAFB were higher than those in the untreated control. However, endogenous
ABA in blue and red LED-treated skin was not significantly different (Figure 2.6).
The expressions of VvNCED1 in the blue- and red-LED-treated skin at 61 and 106
DAFB were higher than those in the untreated control. However, the expressions of
VvNCED1 in blue and red LED-treated skin were not significantly different. The
expressions of VvCYP707A1 showed changes similar to those in the expressions of
VvNCED1 at each date (Figure 2.7).
Figure 2.6. Endogenous ABA concentrations in red or blue LED-treated skin.
Different letters indicate significant difference by Tukey–Kramer test at P ≤ 0.05.
ns, not significant.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
43
Figure 2.7. Quantitative real time RT-PCR analysis of VlMYBA1-2 and VlMYBA2 in
red or blue LED-treated skin. Different letters indicate significant difference by
Tukey–Kramer test at P ≤ 0.05. ns, not significant.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
44
2.3.2 Total anthocyanin concentration and the expressions of VvUFGT,
VlMYBA1-2, and VlMYBA2
Total anthocyanin concentrations in blue- and red-LED-treated skin were
significantly higher than those in the untreated control at each measurement data
(Figure. 2.8). The expressions of VvUFGT in the blue- and red-LED-treated skin were
significantly higher than those in the untreated control, and at 91 and 106 DAFB those
in the blue-LED-treated skin were higher than those in red-LED-treated skin. The
expression of VlMYBA1-2 in red- and blue-LED-treated skin were higher than those in
the untreated control at 61 DAFB, but those in the untreated control were highest at
91 and 106 DAFB. The expressions of VlMYBA2 in blue- and red- treated skin at 61
and 76 DAFB were higher than those in the untreated control (Figure. 2.9).
Figure 2.8. Changes of total anthocyanin concentration in red or blue LED-treated
skin. Different letters indicate significant difference by Tukey–Kramer test at P ≤ 0.05.
ns, not significant.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
45
Figure 2.9. Changes of quantitative real time RT-PCR analysis of VvUFGT ,
VlMYBA1-2, and VlMYBA2 in red or blue LED-treated skin. Different letters indicate
significant difference by Tukey–Kramer test at P ≤ 0.05. ns, not significant.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
46
2.3.3 Sugar concentrations
Total sugar, glucose, and fructose concentrations in blue- and red-LED-
treated skin at each date were significantly higher than those in the untreated control.
However, total sugar, glucose, and fructose concentrations in blue and red LED-
treated skin at 61, 76, and harvesting (106 DAFB) were not significantly different
(Figure 2.10 and 2.11).
Figure 2.10. Changes of total sugar in red or blue LED-treated skin. Different letters
indicate significant difference by Tukey–Kramer test at P ≤ 0.05. ns, not significant.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
47
Figure 2.11. Changes of glucose and fructose concentrations in red or blue LED-
treated skin. Different letters indicate significant difference by Tukey–Kramer test at
P ≤ 0.05. ns, not significant.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
48
2.3.4 Fruit qualities at harvest (106 DAFB)
The sugar concentrations in blue- and red-LED-treated skin were found to be
higher than those in the untreated control at (106 DAFB). Furthermore, acid content
in blue- and red-LED-treated skin was lower than that in the untreated control. There
was no significant difference in berry weight between LED- treated skin and the
untreated control. Length in the untreated control was higher than blue- and red-LED-
treated skin however there was no significant difference in wide among treatments
(Table 2.2). Skin color in L* and a* in blue- and red-LED-treated skin was higher
than that in the untreated control. On the other hand, skin color in b* in the untreated
control was higher than that in LED treatment. There was no significant difference in
hue angle between LED-treated skin and the untreated control (Table 2.3). Effect of
LED irradiation on grapes harvested at 106 DAFB was shown in Figure 2.12.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA, anthocyanin and sugar syntheses in delayed-start cultured
grapes
49
Table 2.2. Effect of LED irradiation on berry length, width, weight, and soluble solids and tartaric acid concentration
in early harvest at 106 DAFB.
Treatment
Berry length
(mm)
Berry width
(mm)
Berry weight
(g)
Soluble solids
(°Brix)
Tartaric acid
(g/100mL)
Red LED 29.14±0.26 a 24.02±0.19 a 10.54±0.22 a 16.62±0.10 b 0.74±0.01 a
Blue LED 28.48±0.31 a 23.80±0.19 a 9.96±0.22 b 17.68±0.13 a 0.76.±0.07 a
Untreated control 30.79±0.29 b 24.10±0.22 a 10.7±0.28 a 12.42±0.20 c 1.23±0.05 b
There are significant differences between different alphabet (significant level is 5 %) by Tukey's Multiple comparison
statistics. Data are the mean ± SE (n=10). ns, not significant.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA, anthocyanin and sugar syntheses in delayed-start cultured grapes
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA, anthocyanin and sugar syntheses in delayed-start cultured
grapes
50
Table 2.3. Effect of LED Irradiation on skin color in L*, a*, b* and Hue angle at 106 DAFB.
Treatment
L*
a*
b*
Hue angle
Red LED 29.07±0.20 a 2.39±0.17 a 1.11±0.17 a 23.69±4.05 a
Blue LED 28.99±0.38 a 1.90±0.15 a 0.94±0.19 a 19.80±5.47 a
Untreated control 32.81±0.31 b 0.17±0.28 b 3.36±0.27 b 3.65±13.50 a
\
There are significant differences between different alphabet (significant level is 5 %) by Tukey's
Multiple comparison statistics. Data are the mean ± SE (n=30). ns, not significant.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA, anthocyanin and sugar syntheses in delayed-start cultured grapes
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
51
Figure 2.12. Effect of LED irradiation on grapes harvested at 106 DAFB.
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
52
2.4 Discussion
The result of the current study showed that endogenous ABA concentrations
in blue- and red-LED-treated skin in delayed-start cultured grapes under double
cropping cultivation system were not significantly different. However, Kondo et al.
(2014) showed that endogenous ABA increased in red-LED-treated grape berries
that were harvested at the same time as grapes cultured in the open field. This
result suggests that natural changes over the course of the growing season in the
proportions of blue and red light present in sunlight might influence endogenous ABA
concentrations. In the result of the current study, endogenous ABA and the
expressions of VvNCED1, an upstream enzyme for ABA synthesis, in blue- and red-
LED-treated skin were significantly higher than in the untreated control. Therefore,
LED-treated skin may be effective for increasing endogenous ABA through the
expressions of VvNCED1 in grape berries. Sun et al. (2010) showed that the specific
balance between the biosynthesis and catabolism of NCEDs and CYP707As regulates
the endogenous ABA concentration. Therefore, the high expressions of VvNCED1
and VvCYP707A1 at veraison may influence the increase in endogenous ABA
concentrations in grapes.
In the present study, blue- and red-LED irradiat ions at night significantly
increased anthocyanin concentration. The expressions of VvUFGT gene in blue- and
red-LED-treated skin were generally similar to the total anthocyanin concentrations.
However, the expressions of VlMYBA1-2 and VlMYBA2 were not necessarily
correlated with the blue and red irradiation. Azuma et al. (2011) concluded that
Chapter 2: Effect of blue- and red-LED at night on endogenous ABA,
anthocyanin and sugar syntheses in delayed-start cultured grapes
53
the final anthocyanin concentrations in grape skin cannot be determined solely by the
expression of MYB-related genes. The result of this study suggests that the
expressions of VlMYBA1-2 and VlMYBA2 at veraison (61 DAFB) may be
significantly associated with anthocyanin production.
The results of this study showed that sugar concentrations in the skin
increased by the blue- and red-LED irradiations. The compensation point in grape is
3.7−37 µmol m-2
s-1
, although this varies with temperature (Shiraishi et al., 1997). The
action of enzymes on the sugar metabolism in grape berries differs according to
growing conditions (Xie et al., 2009). It has been reported that the sucrose phosphate
synthase genes in rice (Oryza sativa L. cv. Nipponbare) were controlled by light
(Yonekura et al., 2013). Therefore, an increase in sugar in blue- or red-LED-treated
skin at night may depend on the promotion of the photosynthesis rate in leaves or the
activation of the enzymes in the sugar metabolism. The results of this study also
suggest complex interactions among endogenous ABA, anthocyanin synthesis, and
sugar accumulation.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA, anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
54
CHAPTER 3
EFFECT OF BLUE- AND RED-LED IRRADIATION AT NIGHT
ON ENDOGENOUS ABSCISIC ACID (ABA), ANTHOCYANIN
AND SUGAR SYNTHESES IN EARLY-HEATING CULTURED
GRAPES UNDER DOUBLE CROPPING CULTIVATION SYSTEM
AND THE EFFECT OF THE IRRADIATING POSITION OF
BLUE- AND RED- LED TO ENHANCE ANTHOCYANIN SYNTHESES IN
GRAPE
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
55
3.1 INTRODUCTION
In Japan, the ratio of blue light in sunshine gradually increases toward the
summer solstice (June) but decreases toward the winter solstice (December), whereas
that of red light changes oppositely (Kamuro et al. 2003). The spectral composition of
solar radiation including red and blue light that changes with the season may
influence flowering and pigmentation in plants (Kamuro et al., 2003). Anthocyanins,
which are the predominant pigment in grapes, accumulate at the beginning of
maturation. It has been found that abscisic acid (ABA) can regulate berry
development in grapes. For instance, in grape skins, endogenous ABA concentrations
increased at veraison (the onset of berry maturation) when berries began to
accumulate sugars and anthocyanin (Wheeler et al., 2009). Furthermore, ABA
application stimulated berry maturation processes such as anthocyanin biosynthesis
with the increase of the expression of UDP-glucose:flavonoid 3-O-glucosyltransferase
(UFGT), which is the key gene in the anthocyanin pathway (Roberto et al., 2012). In
addition, grape berries which were incubated with sugar significantly accumulated
anthocyanin, and the addition of sugar elevated the expression of flavanone 3-
hydroxylase (F3H), which is pivotal at the bifurcation of the anthocyanins and
flavonols branches (Zheng et al., 2009). In contrast, leaf-shading reduced sugar
accumulation in the berry (Morrison and Noble, 1990). The positive effects of light
emitting diode (LED) irradiation on anthocyanin accumulation have been reported in
strawberries (Fragaria × ananassa Duch.) (Xu et al., 2014), leaf baby lettuce
(Lactuca sativa L.) (Samuolienė et al., 2012) and grapes (Kondo et al., 2014). These
findings suggest that interactions exist among light, ABA, sugar, and anthocyanin.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
56
The author examined the effects of red- or blue-LED irradiation at night on
anthocyanin synthesis in grape berries in an early-heating culture system, in which the
percentage of red light in sunshine gradually decreases and that of blue light in
sunshine gradually increases, and in the ordinary growing season, in which the
percentage of red light in sunlight gradually increases and that of blue light in
sunshine gradually decreases (Kamuro et al., 2003). The author also examined the
effect of the irradiating position (leaf or cluster) of the red or blue LED. At the same
time, endogenous ABA, the expression of anthocyanin and ABA biosynthesis-related
genes, and sugar synthesis in grape berries were also analyzed.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
57
3.2 MATERIALS AND METHODS
3.2.1 Plant materials
‘Kyoho’ grapevines [Vitis labrusca × V. vinifera] grafted onto ‘Teleki-Kober
5BB’ rootstocks [V. berlandieri × V. ripariahybrids] were planted in a 45 L plastic
pot and grown in a greenhouse covered with polyvinyl film (90% transmittancy)
at Chiba University, located at 35º N Lat, 140º E Long, and at an altitude of 37 m.
The width of each vine was 175 ± 6.3 standard error (SE) cm and the vine height was
138 ± 10 (SE) cm. Each vine had six clusters with 35 berries. To produce seedless
fruit, each cluster was treated with a 25 mg L−1
solution of gibberellic acid (GA3) at
full bloom (FB) and again 10 days after FB. Each plastic pot was watered 20 L per
day. A lighting system consisting of a red LED (Shibasaki, Inc., Saitama, Japan; peak
wavelength 660 nm) and a blue LED (Shibasaki; peak wavelength 450 nm) with a
length of 147 cm and a width of 4 cm was placed to irradiate the vines. The
photosynthetic photon flux density (PPF) of the red and blue LEDs was adjusted to 50
µmol m−2
s−1
(the compensation point in grapes : 3.7−37 µmol m−2
s−1
(Shiraishi et al.,
1997)) at a distance of 10 cm from the light using a photosynthetic active radiation
meter (Apogee Instruments, Inc., Logan, UT, USA).
Experiment 1 (Exp. 1) was conducted under an early-heating culture in 2013.
Three test groups of four 8-year-old vines each were created. Vines in the first group
were irradiated with a red LED for 3 h before sunrise and 3 h after sunset from bud
brake to harvest (97 days after full bloom (DAFB)). Vines in the second group were
irradiated with a blue LED on the same schedule. The third group consisted of the
untreated control.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
58
In Experiment 2 (Exp. 2), vines were cultured in the ordinary growing season
in 2014. Each vine had six clusters with 35 berries. Five test groups of two 9-year-old
vines each were created in order to investigate the effect of the irradiating position of
the LED, such as on the leaf or the cluster only. Each group was irradiated with a red
or blue LED for 3 h before sunrise and 3 h after sunset from 25 to 99 DAFB. In the
first group, vine clusters only were irradiated with a red LED. In the second group,
vine clusters only were irradiated with a blue LED. In the third group, vine leaves
only were irradiated with a red LED. In the fourth group, vine leaves only were
irradiated with a blue LED. The fifth group consisted of the untreated controls. In
each treatment, four LEDs were placed around the cluster only or above the leaves
only. Black polyvinyl was used to eliminate unnecessary LED light when clusters or
leaves were irradiated with LED. In both Exp. 1 and Exp. 2, berries from each test
group were sampled for the analysis of endogenous ABA, the expressions of the 9-
cis-epoxycarotenoid dioxygenase (VvNCED1), ABA 8'-hydroxylase (VvCYP707A1),
UDP-glucose-flavonoid-3-O-glucosyltransferase (VvUFGT), VlMYBA1-2, and
VlMYBA2 genes, and anthocyanin and sugar concentrations. In Exp. 1, three berries
from each cluster (72 berries in total) of one vine per group were randomly sampled
at 55, 65, 75, 85, and 97 DAFB; in Exp. 2, five berries from each cluster (60 berries in
total) of one vine per group were randomly sampled immediately after dawn at 25, 53,
67, and 99 DAFB. Eight berries from each test group were sampled to analyze fruit
qualities including berry length, width, weight, and soluble solid and acid contents
and twenty four berries from each test group were sampled to analyze skin color in
L*, a*, b*, and hue angle at harvesting (97 DAFB in Exp. 1 and 99 DAFB in Exp. 2).
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
59
After the skin of the berries was peeled, the skins were immediately frozen in liquid
nitrogen and stored at −80 ºC until analysis.
3.2.2 Quantitative analysis of ABA
Endogenous ABA in the frozen skin samples was analyzed according to
the procedure described in chapter 2.
3.2.3 RNA extraction, cDNA synthesis, and quantitative real-time RT-PCR analysis
Total RNA was extracted from the skin (1 g FW; three replications of 20
berries) as described in chapter 2. Gene-specific primers for each gene were used for
RT-PCR. Primers for the VvNCED1 and VvCYP707A1 genes were constructed
according to previous report (Kondo et al., 2014). The relative expression level of
each gene was determined by a relative standard curvemethod. The expression level
was normalized to that of the VvUbiquitin gene (Fujita et al., 2007).
3.2.4 Anthocyanin
The Anthocyanin analysis from the skin (1 g FW; three replications of 20
berries) was performed as described in chapter 2. The total anthocyanin
concentrations were expressed as malvidin-3-O-glucoside equivalents. The frozen
skin samples (0.5 g FW; three replications of 20 berries) were diluted with 2% (v/v)
formic acid of 5 mL for 24 hours at 4ºC in the dark. After filtration, anthocyanin was
analyzed by liquid chromatography mass spectrometer (LC-MS; model LCMS-2010
EV; Shimadzu) with a Mightysil RP-18 ODS column.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
60
3.2.5 Sugar analysis
The sugar analysis from the skin (1 g FW; three replications of 20 berries)
was performed as described in chapter 2.
3.2.6 Statistical analysis
Data are shown as mean ± SE of three replications. The SAS analysis of
variance procedure (Version 8.02; SAS Institute, Cary, NC, USA) was used to
determine the treatment effects, and the mean separation was analyzed by Tukey–
Kramer test at P ≤ 0.05.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
61
3.3 Results
The average temperature from full bloom to harvest during LED irradiation
under the early-heating culture (Exp. 1) was between 11 and 25°C, and that in the
ordinary growing season (Exp. 2) was between 16 and 27°C (Figure 3.1).
Figure 3.1. Changes in the temperature in the greenhouse under the early-heating
culture (Exp. 1) (A) and in the ordinary growing season (Exp. 2) (B). LED irradiation
(−) shows the average temperature during LED irradiation.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
62
3.3.1 Endogenous ABA concentration and the expressions of VvNCED1 and
VvCYP707A1
The endogenous ABA concentrations in the skin differed in Exp. 1 and Exp. 2
(Figure 3.2). In Exp. 1, the endogenous ABA concentrations in blue-LED-treated skin
at 65 DAFB and 75 DAFB were significantly higher than those in red-LED-treated
skin. In each treatment, the endogenous ABA concentrations were highest at 65
DAFB. In Exp. 2, the endogenous ABA concentrations in the red-LED cluster
treatment increased toward 67 DAFB, and those in the red-LED cluster treatment at
53 DAFB were significantly higher than the others. There were no significant
differences between the LED leaf treatments and the untreated control in terms of the
ABA concentration in the skin. In Exp. 1, the expressions of VvNCED1 in the red-
and blue-LED cluster treatments at 97 DAFB were higher than those in the untreated
control. In Exp. 2, the expressions of VvNCED1 at 53 and 99 DAFB in the red- and
blue-LED cluster treatments were significantly higher than those in the untreated
control. However, the VvNCED1 expressions in the LED leaf treatments were not
different from those in the untreated control. In Exp. 1, the expressions of
VvCYP707A1 showed changes similar to those in the expressions of VvNCED1 at
each date. In Exp. 2, the expressions of VvCYP707A1 at 53 DAFB in the red- and
blue-LED cluster treatments were significantly higher than those in the untreated
control, and those in the red- and blue-LED cluster treatments at 67 DAFB were
significantly higher than those in the other treatments.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
63
Figure 3.2. Endogenous ABA concentrations and the expressions of VvNCED1 and
VvCYP707A1 under the early-heating culture (Exp. 1) (A) and in the ordinary
growing season (Exp. 2) (B). The experimental values are plotted in comparison to
the control (Ubiquitin) value. Data are the means ± SE of three replications. Different
letters indicate significant difference by Tukey-Kramer test at P ≤ 0.05. ns, not
significant. Red- or blue-LED cluster treatment: red (C), blue (C). Red- or blue-LED
leaf treatment: red (L), blue (L).
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
64
3.3.2 Total anthocyanin concentration and the expressions of VvUFGT,
VlMYBA1-2, and VlMYBA2
In Exp. 1, the total anthocyanin concentrations in blue- and red-LED-treated
skin after veraison (55 DAFB) were significantly higher than those in the untreated
control. In Exp. 2, the total anthocyanin concentrations in the blue- and red-LED
cluster treatments after veraison (53 DAFB) were significantly higher than those in
the untreated control and LED leaf treatments. Anthocyanin concentrations in the
blue-LED cluster treatment at 67 DAFB were higher than those in the red-LED
cluster treatment (Figure 3.3). In Exp. 1, the expressions of VvUFGT, VlMYBA1-2,
and VlMYBA2 in red- and blue-LED-treated skin were significantly higher than those
in the untreated control at 75 DAFB and 97 DAFB, but there was no significant
difference between treatments at 55 DAFB. In Exp. 2, the expressions of VvUFGT
were generally similar to the total anthocyanin concentrations. That is, the expressions
of VvUFGT in the blue- and red-LED cluster treatments at veraison (53 DAFB) were
significantly higher than those in the untreated control, and at 67 DAFB those in the
blue-LED cluster treatment were higher than those in the other treatments. The
expressions of VlMYBA1-2 and VlMYBA2 at 67 DAFB in the red- and blue-LED
cluster treatments were significantly higher than those in the untreated control. In
general, there were no significant differences in the expressions of VvUFGT,
VlMYBA1-2, and VlMYBA2 between the LED leaf treatments and the untreated
control (Figure 3.4).
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
65
Figure 3.3. Changes in the total anthocyanin concentrations under the early-heating
culture (Exp. 1) (A) and in the ordinary growing season (Exp. 2) (B). Data are the
mean ± SE of three replications. Different letters indicate significant difference by
Tukey–Kramer test at P ≤ 0.05. Red- or blue-LED cluster treatment: red (C), blue (C).
Red- or blue-LED leaf treatment: red (L), blue (L)
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
66
Figure 3.4. Changes in the expressions of VvUFGT, VlMYBA1-2, and VlMYBA2
under the early-heating culture (Exp. 1) (A) and in the ordinary growing season
(Exp. 2) (B). Data are the mean ± SE of three replications. Different letters indicate
significant difference by Tukey-Kramer test at P ≤ 0.05. ns, not significant. Red- or blue-
LED cluster treatment: red (C), blue (C). Red- or blue-LED leaf treatment: red (L), blue (L)
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
67
3.3.3 Sugar concentrations
In Exp. 1, the total sugar concentrations at 55 DAFB in blue-LED-treated
skin were significantly higher than those in the other treatments, and the glucose and
fructose concentrations in blue-LED-treated skin were also significantly higher than
those in the other treatments (Fig. 3.5). At 97 DAFB, the total sugar, glucose and
fructose concentrations in red-LED-treated skin were the highest, followed by the
blue-LED-treated skin and the untreated control. In Exp. 2, the total sugar, glucose
and fructose concentrations at 99 DAFB were highest in the blue-LED cluster
treatment, followed by the red-LED cluster treatment. The sugar concentrations in the
grapes in which only the leaves were irradiated by a red or blue LED were not
significantly different from those of the untreated control.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
68
Figure 3.5. Changes in total sugar, glucose, and fructose concentrations under the
early-heating culture (Exp. 1) (A) and in the ordinary growing season (Exp. 2) (B).
Data are the mean ± SE of three replications. Different letters indicate significant
difference by Tukey–Kramer test at P ≤ 0.05. Red- or blue-LED cluster treatment: red
(C), blue (C). Red- or blue-LED leaf treatment: red (L), blue (L).
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
69
3.3.4 Fruit qualities at harvesting (97 DAFB in Exp. 1 and 99 DAFB in Exp. 2)
In Exp. 1, the sugar concentrations in the flesh of red- or blue-LED-treated
grapes were found to be higher than those in the untreated control at 97 DAFB. There
were no significant differences in tartaric acid concentration, length and berry weight
between blue- or red-LED-treated skin and the untreated control (Table 3.1). Skin
color in L*, a*, b* and hue angle was no significant differences between blue- or red-
LED-treated skin and the untreated control (Table 3.2).
In Exp. 2, the sugar concentrations in the grape flesh of red- or blue-LED
cluster treatment were higher than those evident in the other treatments; furthermore,
tartaric acid in the grape flesh of red- or blue-LED cluster treatment were lower than
those evident in the other treatments at 99 DAFB. There were no significant
differences in berry length and weight between blue- or red-LED treatment and the
untreated control (Table 3.3). Skin color in L*, b*, and hue angle of red or blue-LED
cluster treatment was lower than that in the other treatments (Table 3.4). Effect of
LED irradiation on grapes in Exp.1 and Exp. 2 was shown in Figures 3.6 and 3.7
respectively.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and sugar syntheses in early-heating cultured and
effect of the irradiating position
70
Table 3.1. Effect of LED Irradiation on berry length, width, weight, and soluble solids and tartaric acid
concentration at harvest (97 DAFB). (Exp. 1)
Treatment Berry length
(mm)
Berry width
(mm)
Berry weight
(g)
Soluble solids
(°Brix)
Tartaric acid
(g/100mL)
Red LED 30.1±0.49 a 24.2±0.34 a 10.8±0.62 a 16.00±0.26 a 0.465±0.01 a
Blue LED 29.6±0.40 a 24.1±0.26 a 9.94±0.45 a 16.05±0.34 a 0.407±0.02 a
Untreated control 32.4±0.65 a 24.6±0.26 a 11.2±0.67 a 13.95±0.31 b 0.466±0.01 a
There are significant differences between different alphabet (significant level is 5 %) by Tukey's Multiple
comparison statistics. Data are the mean ± SE (n=8).
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and sugar syntheses in early-heating cultured and effect
of the irradiating position
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and sugar syntheses in early-heating cultured and
effect of the irradiating position
71
Table 3.2. Effect of LED Irradiation on skin color in L*, a*, b*, and Hue angle at
harvest (97 DAFB). (Exp. 1)
Treatment L* a* b* Hue angle
Red LED 31.06±0.10 a 2.69±0.17 a -0.97±0.09 a 338.2±2.5 a
Blue LED 31.14±0.11 a 2.11±0.19 a -0.93±0.06 a 331.3±3.6 a
Untreated control 31.15±0.20 a 2.23±0.25 a -0.75±0.14 a 336.0±3.4 a
There are significant differences between different alphabet (significant level is 5 %)
by Tukey's Multiple comparison statistics. Data are the mean ± SE (n=24).
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and sugar syntheses in early-heating cultured and effect
of the irradiating position
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and sugar syntheses in early-heating cultured and
effect of the irradiating position
72
Table 3.3. Effect of LED irradiation on berry length, width, and weight, and soluble solids and tartaric acid concentration
at harvest (99 DAFB). (Exp. 2)
Treatment Berry length
(mm)
Berry width
(mm)
Berry weight
(g)
Soluble solids
(0Brix)
Tartaric acid
(g/100mL)
Red (C) 30.68±0.30 a 24.48±0.15 a 10.53±0.28 a 20.85±0.03 a 0.428±0.007 b
Blue LED (C) 29.45±0.61 a 24.38±0.22 a 9.84±0.72 a 19.97±0.57 a 0.410±0.019 b
Red LED (L) 30.86±0.59 a 25.27±0.33 a 10.91±0.32 a 18.87±0.02 b 0.523±0.010 a
Blue LED (L) 30.68±0.34 a 25.24±0.18 a 10.68±0.31 a 18.42±0.08 b 0.501±0.009 a
Untreated control 30.70±0.48 a 25.27±0.20 a 10.87±0.35 a 17.80±0.28 b 0.520±0.012 a
There are significant differences between different alphabet (significant level is 5 %) by Tukey's Multiple comparison
statistics. Data are the mean ± SE (n=8).
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and sugar syntheses in early-heating cultured and effect
of the irradiating position
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and sugar syntheses in early-heating cultured and
effect of the irradiating position
73
Table 3.4. Effect of LED Irradiation on skin color in L*, a*, b* and Hue angle at harvest (99 DAFB). (Exp. 2)
Treatment
L*
a*
b*
Hue angle
Red (C) 28.99±0.15 b 5.26±0.16 a 0.44±0.05 a 4.37±0.53 a
Blue (C) 29.62±0.42 b 5.29±0.24 a 1.02±0.19 a 10.58±2.43 ab
Red LED (L) 32.54±0.30 a 6.32±0.24 a 2.48±0.23 b 22.45±2.49 c
Blue LED (L) 32.93±0.32 a 5.19±0.42 a 2.71±0.23 b 24.70±4.83 c
Untreated control 32.51±0.30 a 5.56±0.31 a 2.69±0.24 b 27.21±3.40 c
There are significant differences between different alphabet (significant level is 5 %) by Tukey's Multiple comparison
statistics. Data are the mean ± SE (n=24).
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and sugar syntheses in early-heating cultured and effect
of the irradiating position
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
74
Figure 3.6. Effect of LED irradiation on grapes harvested at 97 DAFB. (Exp. 1)
Figure 3.7. Effect of LED irradiation on grapes harvested at 99 DAFB. (Exp. 2)
Chapter 3: Effect of blue and red-Led at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
75
3.4 Discussion
In the early-heating culture, endogenous ABA concentrations in blue-LED-
treated skin were higher than those in red-LED-treated skin. In contrast, in the
ordinary growing season, the ABA concentrations were higher in the red-LED cluster
treatment than in the blue-LED cluster treatment, a finding that was consistent with
our previous report (Kondo et al. 2014). This result suggests that endogenous ABA in
grapes might be influenced by the proportions of blue and red light in sunshine that
differ with the season (Kamuro et al. 2003) in addition to the LED irradiation
administered at night. Previous studies showed that ABA in the leaves may be
transported to the clusters via the phloem vessels (Antolín et al., 2003; Shiozaki et al.,
1999). However, in this study, endogenous ABA and the expressions of VvNCED1, an
upstream enzyme for ABA synthesis, in the red-LED treatment administered to the
cluster were significantly higher than in the LED treatment administered to the leaves.
Therefore, LED treatment of the cluster may be effective for increasing endogenous
ABA through the expressions of VvNCED1 in grape berries.
It is possible that ABA regulates the maturation involving anthocyanin
biosynthesis in non-climateric fruit such as the bilberry (Vaccinium myrtillus L.),
blueberries (V. corymbosum), sweet cherries (Prunus avium L.), and grapes
(Karppinen et al., 2013; Ren et al., 2010; Wheeler et al., 2009; Zifkin et al., 2012).
In grapes, endogenous ABA concentrations increase sharply at veraison when the
berries accumulate anthocyanin, and then gradually decrease toward harvest (Wheeler
et al., 2009). In this study, the expressions of VvNCED1 and VvCYP707A1 were high
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
76
at veraison (55 DAFB in Exp. 1 and 53 DAFB in Exp. 2), and the endogenous ABA
concentration was high at 65 DAFB in Exp. 1 and at 67 DAFB in Exp. 2.
The endogenous ABA concentration is modulated by the specific balance between the
biosynthesis and catabolism of NCEDs and CYP707As (Sun et al., 2010; Zhou et al.,
2004). Therefore, the high expressions of VvNCED1 and VvCYP707A1 at veraison
may be associated with the increase in endogenous ABA concentrations in grapes.
ABA application enhanced anthocyanin accumulation in grapes (Peppi et al., 2006).
However, the endogenous ABA concentrations after veraison and the anthocyanin
concentrations during maturation in the skin did not always coincide in Exp. 2.
It has been reported that sugar can induce anthocyanin synthesis in the absence of
ABA application in grape berries (Dai et al., 2014). Thus, anthocyanin synthesis in
grape skin might be affected by another factor in addition to endogenous ABA.
It has been shown that a low temperature increased anthocyanin accumulation
with the expression of anthocyanin-biosynthesis-related genes including CHS, CHI,
F3H, F3′5′H, DFR, OMT, and UFGT as well as VlMYBA2, which is a transcription
factor gene in grapes (Azuma et al., 2012a, b). In turnip seedlings (Brassica rapa),
cabbages (Brassica oleracea), and Chinese bayberries (Myrica rubra Sieb.),
anthocyanin was induced by irradiating blue light (Mancinelli et al., 1975; Shi et al.,
2014; Siegelman and Hendricks, 1957; Wang et al., 2012). In strawberries, it has been
demonstrated that blue light induces anthocyanin accumulation through a FaPHOT2
of phototropin 2 (Kadomura-Ishikawa et al., 2013). In this study, the anthocyanin
concentrations in the blue-LED treatment were the highest in both seasons. Moreover,
the anthocyanin concentrations were higher in grape berries under the early-heating
culture, which involved a lower temperature than the ordinary growing season.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
77
The results of this study agree with those of the previous reports in showing that low
temperature and blue light affect anthocyanin accumulation. In this study, the
expressions of VvUFGT, VlMYBA1-2, and VlMYBA2 increased in red- and blue-LED-
treated skin, though the expressions of these genes were not necessarily correlated
with anthocyanin concentrations. For instance, anthocyanin concentrations in blue-
LED-treated skin were significantly higher than those in red-LED-treated skin at 67 DAFB
in Exp. 2, but the expressions of VlMYBA1-2 and VlMYBA2 genes were not
significantly different in blue- and red-LED-treated skins. It has been concluded that
final anthocyanin concentrations in grape skin cannot be determined solely by the
expression levels of MYB-related genes (Azuma et al., 2011). In this study, blue LED
irradiation promoted anthocyanin accumulation regardless of the growing season. It
has been shown that a wavelength of around 400 nm is effective at inducing
anthocyanin formation in fruits (Proctor, 1974). Blue LED irradiation may therefore
be effective at inducing anthocyanin production in grapes across differing seasons.
The results of this study showed that sugar concentrations in grape berries
were increased in blue- and red-LED-treated skin at night. Hexose accumulation
commences with enzyme activation at veraison and continues throughout maturation
(Davies and Robinson, 1996; Xie et al., 2009). Yonekura et al. (2013) reported that
the sucrose phosphate synthase genes in rice (Oryza sativa L. cv. Nipponbare) were
controlled by light. These results suggest that blue- and red-LED treatments may
activate the enzymes in the sugar metabolism in berries because the sugar
concentrations were not significantly different between the LED leaf treatment and
the untreated control.
Chapter 3: Effect of blue- and red-LED at night on endogenous ABA,anthocyanin and
sugar syntheses in early-heating cultured and effect of the irradiating position
78
In summary, blue-LED irradiation at night increased anthocyanin
accumulation and enhanced the expressions of the VvUFGT, VlMYBA1-2, and
VlMYBA2 regardless of the growing season. Blue- and red-LED irradiation of the
cluster increased the sugar concentrations in the berry skin.
General discussion
79
GENERAL DISSUSSION
Grape skin color is an important factor for fruit qualities because consumers
prefer well pigmented grapes. The skin color is mainly determined by anthocyanin
synthesis which requires a complicated interaction between development and
environmental factor such as plant hormone, temperature, and light. In this study, the
effects of red- and blue-LED irradiation at night to vines on anthocyanin
accumulation were investigated in the double-cropping cultivation system including
an early-heating culture system, in which the percentage of red light in sunshine
gradually decreases and that of blue light in sunshine gradually increases and delayed-
start culture system, in which the percentage of blue light in sunshine is the lowest
decrease and that of red light in sunshine is the highest increase. The author also
investigated the effects of red- and blue-LED irradiation at night to vines on
anthocyanin accumulation in the ordinary growing season, in which the percentage of
red light in sunlight gradually increases and that of blue light in sunshine gradually
decreases and examined the effect of the irradiating position (leaf or cluster) of the red
or blue LED. At the same time, endogenous ABA, the expression of anthocyanin and
ABA biosynthesis-related genes, and sugar synthesis in grape were also analyzed.
In this study, results of ABA concentrations showed that in the early-heating
culture, endogenous ABA concentrations in blue-LED-treated skin were higher than
those in red-LED-treated skin. In contrast, in the ordinary growing season, the ABA
concentrations were higher in the red-LED cluster treatment than in the blue-LED
cluster treatment and in delayed-start cultured grapes, endogenous ABA
General discussion
80
concentrations in blue- and red-LED-treated skin were not significantly different. This
result suggests that endogenous ABA in grapes might be influenced by the
proportions of blue and red light in sunshine that differ with the season (Kamuro et al.
2003) in addition to the LED irradiation administered at night.
The expressions of VvNCED1, an upstream enzyme for ABA synthesis, in
blue- and red-LED-treated skin were higher than those in the untreated control in
delayed-start culture system, and those in the red-LED treatment administered to the
cluster were significantly higher than in the LED treatment administered to the leaves.
Therefore, LED treatment of the cluster may be effective for increasing endogenous
ABA through the expressions of VvNCED1 in grape berries.
It has been reported that ABA application enhanced anthocyanin
accumulation in grapes (Peppi et al., 2006). The results of this study in the ordinary
growing season found that the endogenous ABA concentrations after veraison were
higher in the red-LED cluster treatment than the others, whereas the anthocyanin
concentrations during maturation in the skin were high in blue-LED cluster treatment.
Moreover, it has been reported that sugar can induce anthocyanin synthesis in the
absence of ABA application in grape berries (Dai et al., 2014).Thus, anthocyanin
synthesis in grape skin might be affected by another factor in addition to endogenous
ABA.
It has been reported that a low temperature increased anthocyanin
accumulation with the expression of anthocyanin-biosynthesis-related genes including
UFGT as well as VlMYBA2 in grapes (Azuma et al., 2012a, b). The results of this
study showed that the anthocyanin concentrations were higher in grape berries under
the early-heating culture, which involved a lower temperature than the ordinary
General discussion
81
growing season. Thus, the results of this study agree with those of the previous
reports in showing that low temperature and blue light affect anthocyanin
accumulation.
The expressions of VvUFGT in the blue- and red-LED-treated skin were
higher than those in the untreated control, and those were similar to the total
anthocyanin concentrations in three different growing seasons. However, the
expressions of VlMYBA1-2, and VlMYBA2 were not necessarily correlated with
anthocyanin concentrations. For instance, anthocyanin concentrations in blue-LED-
treated skin were significantly higher than those in red-LED-treated skin at 67 DAFB
but the expressions of VlMYBA1-2 and VlMYBA2 were not significantly different in
blue- and red-LED-treated skins in the ordinary growing season. It has been
concluded that final anthocyanin concentrations in grape skin cannot be determined
solely by the expression levels of MYB-related genes (Azuma et al., 2011).
In three different growing seasons, blue LED irradiation promoted
anthocyanin accumulation regardless of the growing season. A wavelength of around
400 nm is effective at inducing anthocyanin formation in fruits (Proctor, 1974). Then,
blue LED irradiation may be effective at inducing anthocyanin production in grapes
across differing seasons.
The results of this study showed that sugar concentrations in grape berries
were increased in blue- and red-LED-treated skin at night in three different growing
seasons. The action of enzymes on the sugar metabolism in grape berries differs
according to growing conditions (Xie et al., 2009). The sucrose phosphate synthase
genes in rice (Oryza sativa L. cv. Nipponbare) were controlled by light (Yonekura et
General discussion
82
al., 2013). These results suggest that blue-and red-LED treatments may activate the
enzymes in the sugar metabolism in grape berries.
These results suggest that blue-LED irradiation at night may be effective in
increasing anthocyanin accumulation and enhanced the expressions of the VvUFGT,
VlMYBA1-2, and VlMYBA2 regardless of the growing season. Blue- and red-LED
irradiation to grape skin increased the sugar concentrations in the grape berries.
Summary
83
SUMMARY
The effects of red- and blue-light irradiation at night on abscisic acid (ABA)
synthesis and anthocyanin and sugar concentrations were examined in grape vines,
which were grown in three different seasons. The ABA concentrations in light
emitting diode (LED) treatment were higher than those in the untreated control. In
grapes cultivated with early heating, the ABA concentrations were highest in blue-
LED-treated skin; however, those in grapes cultivated in the ordinary growing season
were highest in red-LED-treated skin. In delayed-start cultured grapes, the ABA
concentrations increased in skin treated with blue and red LED. The expressions of 9-
cis-epoxycarotenoid dioxygenase (VvNCED1) and ABA 8′-hydroxylase
(VvCYP707A1) were high in each treatment at veraison regardless of the growing
season. In three seasons, anthocyanin concentrations were highest under the blue-LED
treatment, followed by the red-LED treatment. The expressions of VlMYBA1-2,
VlMYBA2, and VvUFGT coincided with anthocyanin concentrations. Sugar
concentrations were increased by the blue- or red-LED treatment dependent on the
growing season. The results suggest that blue- or red-LED irradiation at night may
influence the ABA and anthocyanin metabolism including VvNCED1, VlMYBA1-2,
and VlMYBA2 and sugar synthesis in grape berries, although the degree of the effects
differs with the growing season.
Acknowledgments
84
ACKNOWLEDGEMENTS
It would not have been possible to complete this thesis without the support
and assistance from my advisor, Professor Satoru Kondo who has the attitude and the
substance of a genius: he continually and convincingly conveyed a spirit of adventure
in regard to research and scholarship. I would like to express the deepest appreciation
to him.
I would like to deeply thank my committee members, Professor Eiji Goto,
Professor Yukari Egashira and Professor Hitoshi Ohara, for their valuable advice,
comments and suggestions for the completeness of this thesis.
I would like to thank to Ministry of Education, Culture, Sport, Science and
Technology of Japan (MONBUKAGAKUSHO) for supporting a scholarship
throughout my study in Japan. I also express my warm gratitude and cordial thanks
Associate Professor Sirichai Kanlayanarat and Associate Professor Varit Srilaong at
King Mongkut’s University of Technology Thonburi, Thailand, for giving me the
opportunity to further study in Japan.
I thank profusely all members of Professor Kondo’s Laboratory for their
helpful corporations and friendship during my research.
Finally, I am very grateful to my family for their encouragement throughout
my research period.
References
85
REFERENCES
References
86
Abrahams, S., Tanner, G.J., Larkin, P.J., Ashton, A.R., 2002. Identification and
biochemical characterization of mutants in the proanthocyanidin pathway in
Arabidopsis. Plant Physiol. 130: 561–576. DOI:10.1104/pp.006189.
Ahmad, M., Cashmore, A.R., 1993. HY4 gene of A. thaliana encodes a protein with
characteristics of a blue-light photoreceptor. Nature 366: 162–166.
DOI:10.1038/366162a0.
Ahmad, M., Lin, C., Cashmore, A.R., 1995. Mutations throughout an Arabidopsis
blue-light photoreceptor impair blue-light-responsive anthocyanin
accumulation and inhibition of hypocotyl elongation. Plant J. Cell Mol. Biol.
8: 653–658.
Akoyunoglou, G., Anni, H., 1984. Blue light Effect on chloroplast development in
higher plants. pp. 397–406. In: Senger, P.D.H. (Ed.), blue light effects in
biological systems, proceedings in life sciences. Springer, Berlin Heidelberg.
Antolín, M.C., Baigorri, H., Luis, I.D., Aguirrezábal, F., Geny, L., Broquedis, M.,
Sánchez-Díaz, M., 2003. ABA during reproductive development in non-
irrigated grapevines (Vitis vinifera L. cv. Tempranillo). Aust. J. Grape Wine
Res. 9: 169–176. DOI:10.1111/j.1755-0238.2003.tb00266.x.
Azuma, A., Kobayashi, S., Mitani, N., Shiraishi, M., Yamada, M., Ueno, T., Kono, A.,
Yakushiji, H., Koshita, Y., 2008. Genomic and genetic analysis of myb-related
genes that regulate anthocyanin biosynthesis in grape berry skin. Theor. Appl.
Genet. 117: 1009–1019. DOI:10.1007/s00122-008-0840-1.
Azuma, A., Udo, Y., Sato, A., Mitani, N., Kono, A., Ban, Y., Yakushiji, H., Koshita,
Y., Kobayashi, S., 2011. Haplotype composition at the color locus is a major
genetic determinant of skin color variation in Vitis × labruscana grapes. TAG
References
87
Theor. Appl. Genet. Theor. Angew. Genet. 122: 1427–1438:
DOI:10.1007/s00122-011-1542-7.
Azuma, A., Ito, A., Moriguchi, T., Yakushiji, H., Kobayashi, S., 2012a. Light
emitting diode irradiation at night accelerates anthocyanin accumulation in
grape skin. Acta Hortic. 956: 341–347.
Azuma, A., Yakushiji, H., Koshita, Y., Kobayashi, S., 2012b. Flavonoid biosynthesis-
related genes in grape skin are differentially regulated by temperature and
light conditions. Planta 236: 1067–1080. DOI:10.1007/s00425-012-1650-x.
Ban, T., Ishimaru, M., Kobayashi, S., Shiozaki, S., Goto-Yamamoto, N., Horiuchi, S.,
2003. Abscisic acid and 2,4-dichlorophenoxyacetic acid affect the expression
of anthocyanin biosynthetic pathway genes in ‘Kyoho’ grape berries. J. Hortic.
Sci. Biotechnol. 78: 586–589.
Baranac, J.M., Petranović, N.A., Dimitrić-Marković, J.M., 1997. Spectrophotometric
study of anthocyan copigmentation reactions. 2. malvin and the
nonglycosidized flavone quercetin. J. Agric. Food Chem. 45: 1694–1697.
DOI:10.1021/jf9606114.
Belhadj, A., Telef, N., Saigne, C., Cluzet, S., Barrieu, F., Hamdi, S., Mérillon, J.-M.,
2008. Effect of methyl jasmonate in combination with carbohydrates on gene
expression of PR proteins, stilbene and anthocyanin accumulation in grapevine
cell cultures. Plant Physiol. Biochem. PPB Société Fr. Physiol. Végétale 46:
493–499. DOI:10.1016/j.plaphy.2007.12.001.
Boss, P., Davies, C., Robinson, S., 1996. Expression of anthocyanin biosynthesis
pathway genes in red and white grapes. Plant Mol. Biol. 32: 565–569.
DOI:10.1007/BF00019111.
References
88
Boss, P. k., Davies, C., Robinson, S.P., 1996. Anthocyanin composition and
anthocyanin pathway gene expression in grapevine sports differing in berry
skin colour. Aust. J. Grape Wine Res. 2: 163–170. DOI:10.1111/j.1755-
0238.1996.tb00104.x.
Cantín, C.M., Fidelibus, M.W., Crisosto, C.H., 2007. Application of abscisic acid
(ABA) at veraison advanced red color development and maintained
postharvest quality of ‘Crimson Seedless’ grapes. Postharvest Biol. Technol.
46: 237–241. DOI:10.1016/j.postharvbio.2007.05.017.
Casal, J.J., 2013. Photoreceptor signaling networks in plant responses to shade. Annu.
Rev. Plant Biol. 64: 403–427. DOI:10.1146/annurev-arplant-050312-120221.
Castellarin, S.D., Matthews, M.A., Di Gaspero, G., Gambetta, G.A., 2007a. Water
deficits accelerate ripening and induce changes in gene expression regulating
flavonoid biosynthesis in grape berries. Planta 227: 101–112:.DOI:10.1007/s00425-
007-0598-8.
Castellarin, S.D., Pfeiffer, A., Sivilotti, P., Degan, M., Peterlunger, E., Di Gaspero, G.,
2007b. Transcriptional regulation of anthocyanin biosynthesis in ripening
fruits of grapevine under seasonal water deficit. Plant Cell Environ. 30: 1381–
1399. DOI:10.1111/j.1365-3040.2007.01716.x.
Chalker-Scott, L., 1999. Environmental significance of anthocyanins in plant stress
responses. Photochem. Photobiol. 70: 1–9. DOI:10.1111/j.1751-1097.1999.tb01944.x.
Chatterjee, M., Sharma, P., Khurana, J.P., 2006. Cryptochrome 1 from Brassica napus
is up-regulated by blue light and controls hypocotyl/stem growth and
anthocyanin accumulation. Plant Physiol. 141: 61–74. DOI:10.1104/pp.105.076323.
References
89
Chervin, C., El-Kereamy, A., Roustan, J.-P., Latché, A., Lamon, J., Bouzayen, M., 2004.
Ethylene seems required for the berry development and ripening in grape, a non-
climacteric fruit. Plant Sci. 167: 1301–1305. DOI:10.1016/j.plantsci.2004.06.026.
Chorti, E., Guidoni, S., Ferrandino, A., Novello, V., 2010. Effect of different cluster
sunlight exposure levels on ripening and anthocyanin accumulation in
‘Nebbiolo’ grapes. Am. J. Enol. Vitic. 61: 23–30.
Coombe, B.G., 2001. Ripening berries: a critical issue. Aust. Vitic. 5: 28–34.
Cutanda-Perez, M.-C., Ageorges, A., Gomez, C., Vialet, S., Terrier, N., Romieu, C.,
Torregrosa, L., 2009. Ectopic expression of VlmybA1 in grapevine activates a
narrow set of genes involved in anthocyanin synthesis and transport. Plant Mol.
Biol. 69: 633–648. DOI:10.1007/s11103-008-9446-x.
Cutler, S.R., Rodriguez, P.L., Finkelstein, R.R., Abrams, S.R., 2010. Abscisic acid:
emergence of a core signaling network. Annu. Rev. Plant Biol. 61: 651–679.
Czemmel, S., Stracke, R., Weisshaar, B., Cordon, N., Harris, N.N., Walker, A.R.,
Robinson, S.P., Bogs, J., 2009. The grapevine R2R3-MYB transcription factor
VvMYBF1 regulates flavonol synthesis in developing grape berries. Plant
Physiol. 151: 1513–1530. DOI:10.1104/pp.109.142059.
Dai, Z.W., Meddar, M., Renaud, C., Merlin, I., Hilbert, G., Delrot, S., Gomès, E.,
2014. Long-term in vitro culture of grape berries and its application to assess
the effects of sugar supply on anthocyanin accumulation. J. Exp. Bot. 65:
4665–4677. DOI:10.1093/jxb/ert489.
Davies, C., Boss, P.K., Robinson, S.P., 1997. Treatment of grape berries, a
nonclimacteric fruit with a synthetic auxin, retards ripening and alters the
expression of developmentally regulated genes. Plant Physiol. 115: 1155–1161.
References
90
Davies, C., Böttcher, C., 2009. Hormonal control of grape berry ripening. pp. 229–
261. In: Roubelakis-Angelakis, P.D.K.A. (Ed.), grapevine molecular
physiology & biotechnology. Springer Netherlands.
Davies, C., Robinson, S.P., 1996. Sugar Accumulation in grape berries (cloning of
two putative vacuolar invertase cDNAs and their expression in grapevine
tissues). Plant Physiol. 111: 275–283. DOI:10.1104/pp.111.1.275.
Delgado, R., Gallegos, J.I., Martín, P., González, M.R., 2002. Influence of ABA and
ethephon treatments on fruit composition of ‘Tempranillo’ grapevines. pp.
321–326. In: XXVI International Horticultural Congress: Viticulture-Living
with Limitations 640.
Downs, R.J., Thomas, J.F., 1982. Phytochrome regulation of flowering in the long-
day plant, Hyoscyamus niger. Plant Physiol. 70: 898–900.
El-Kereamy, A., Chervin, C., Roustan, J.-P., Cheynier, V., Souquet, J.-M., Moutounet,
M., Raynal, J., Ford, C., Latché, A., Pech, J.-C., Bouzayen, M., 2003.
Exogenous ethylene stimulates the long-term expression of genes related to
anthocyanin biosynthesis in grape berries. Physiol. Plant. 119: 175–182.
DOI:10.1034/j.1399-3054.2003.00165.x.
Evans, L., 1976. Inflorescence initiation in lolium temulentum L. XIV. the role of
phytochrome in long day induction. Funct. Plant Biol. 3: 207–217.
Fan, X., Mattheis, J.P., Fellman, J.K., 1998. A role for jasmonates in climacteric fruit
ripening. Planta 204: 444–449. DOI:10.1007/s004250050278.
Faostat, 2013. Grape production quantity in 2013 [WWW Document]. URL
http://faostat3.fao.org/download/Q/QC/E (accessed 3.10.15).
References
91
Favory, J.-J., Stec, A., Gruber, H., Rizzini, L., Oravecz, A., Funk, M., Albert, A.,
Cloix, C., Jenkins, G.I., Oakeley, E.J., Seidlitz, H.K., Nagy, F., Ulm, R., 2009.
Interaction of COP1 and UVR8 regulates UV-B-induced photomorphogenesis
and stress acclimation in Arabidopsis. EMBO J. 28: 591–601.
DOI:10.1038/emboj.2009.4.
Finkelstein, R.R., Gibson, S.I., 2002. ABA and sugar interactions regulating
development: cross-talk or voices in a crowd? Curr. Opin. Plant Biol. 5: 26–32.
Fugita, A., Goto-Yamamoto, N., Aramaki, I., Hashizume, K., 2006. Organ-specific
transcription of putative flavonol synthase genes of grapevine and effects of
plant hormones and shading on flavonol biosynthesis in grape berry skins.
Biosci. Biotechnol. Biochem. 70, 632–638: DOI:10.1271/bbb.70.632.
Fujita, A., Soma, N., Goto-Yamamoto, N., Mizuno, A., Kiso, K., Hashizume, K.,
2007. Effect of shading on proanthocyanidin biosynthesis in the grape berry. J.
Jpn. Soc. Hortic. Sci. 76, 112–119: DOI:10.2503/jjshs.76.112.
Gazzarrini, S., McCourt, P., 2001. Genetic interactions between ABA, ethylene and
sugar signaling pathways. Curr. Opin. Plant Biol. 4: 387–391.
Geny, L., Saucier, C., gagné, S., Deytieux, C., Esteve, K., 2006. Influence of abscisic
acid in triggering ‘véraison’ in grape berry skins of Vitis vinifera L. cv.
cabernet-Sauvignon. J. Int. Sci. Vigne Vin Int. J. Vine Wine Sci. 40: 7–14.
Giliberto, L., Perrotta, G., Pallara, P., Weller, J.L., Fraser, P.D., Bramley, P.M., Fiore,
A., Tavazza, M., Giuliano, G., 2005. Manipulation of the blue light
photoreceptor cryptochrome 2 in tomato affects vegetative development,
flowering time, and fruit antioxidant content. Plant Physiol. 137: 199–208.
DOI:10.1104/pp.104.051987.
References
92
Giovannoni, J., 2001. Molecular biology of fruit maturation and ripening. Annu. Rev. Plant
Physiol. Plant Mol. Biol. 52: 725–749. DOI:10.1146/annurev.arplant.52.1.725.
Goins, G.D., Ruffe, L.M., Cranston, N.A., Yorio, N.C., Wheeler, R.M., Sager, J.C.,
2001. Salad crop production under different wavelengths of red light-emitting
diodes (LEDs) (SAE Technical Paper No. 2001-01-2422). SAE International,
Warrendale, PA.
Gonzalez, A., Zhao, M., Leavitt, J.M., Lloyd, A.M., 2008. Regulation of the
anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional
complex in Arabidopsis seedlings. Plant J. 53: 814–827. DOI:10.1111/j.1365-
313X.2007.03373.x.
Guo, H., Yang, H., Mockler, T.C., Lin, C., 1998. Regulation of flowering time by
Arabidopsis photoreceptors. Science 279: 1360–1363.
Hara, M., Oki, K., Hoshino, K., Kuboi, T., 2003. Enhancement of anthocyanin
biosynthesis by sugar in radish (Raphanus sativus) hypocotyl. Plant Sci. 164:
259–265. DOI:10.1016/S0168-9452(02)00408-9.
Hardtke, C.S., Gohda, K., Osterlund, M.T., Oyama, T., Okada, K., Deng, X.W., 2000.
HY5 stability and activity in Arabidopsis is regulated by phosphorylation in its
COP1 binding domain. EMBO J. 19: 4997–5006. DOI:10.1093/emboj/19.18.4997
Harris, J.M., Kriedemann, P.E., Possingham, J.V., 1968. Anatomical aspects of grape
berry development. Vitis 7: 106–119.
He, F., Pan, Q.-H., Shi, Y., Duan, C.-Q., 2008. Biosynthesis and genetic regulation of
proanthocyanidins in plants. Molecules 13: 2674–2703.
DOI:10.3390/molecules13102674.
References
93
Hirai, T., Amaki, W., Watanabe, H., 2006. Effects of monochromatic light irradiation
by LED on the internodal stem elongation of seedlings in eggplant, leaf lettuce
and sunflower. Shokubutsu Kankyo Kogaku 18: 160–166.
DOI:10.2525/shita.18.160.
Hiratsuka, S., Onodera, H., Kawai, Y., Kubo, T., Itoh, H., Wada, R., 2001. ABA and
sugar effects on anthocyanin formation in grape berry cultured in vitro. Sci.
Hortic. 90: 121–130. DOI:10.1016/S0304-4238(00)00264-8.
Iannetta, P.P., Laarhoven, L.-J., Medina‐Escobar, N., James, E.K., McManus, M.T.,
Davies, H.V., Harren, F.J., 2006. Ethylene and carbon dioxide production by
developing strawberries show a correlative pattern that is indicative of
ripening climacteric fruit. Physiol. Plant. 127: 247–259.
Jeong, S.-T., Goto-Yamamoto, N., Hashizume, K., Kobayashi, S., Esaka, M., 2006.
Expression of VvmybA1 gene and anthocyanin accumulation in various grape
organs. Am. J. Enol. Vitic. 57: 507–510.
Jeong, S.T., Goto-Yamamoto, N., Kobayashi, S., Esaka, M., 2004. Effects of plant
hormones and shading on the accumulation of anthocyanins and the
expression of anthocyanin biosynthetic genes in grape berry skins. Plant Sci.
167: 247–252. DOI:10.1016/j.plantsci.2004.03.021.
Jeong, S.-W., Das, P.K., Jeoung, S.C., Song, J.-Y., Lee, H.K., Kim, Y.-K., Kim, W.J.,
Park, Y.I., Yoo, S.-D., Choi, S.-B., Choi, G., Park, Y.-I., 2010. Ethylene
suppression of sugar-induced anthocyanin pigmentation in Arabidopsis. Plant
Physiol. 154: 1514–1531. DOI:10.1104/pp.110.161869.
References
94
Jia, H.-F., Chai, Y.-M., Li, C.-L., Lu, D., Luo, J.-J., Qin, L., Shen, Y.-Y., 2011.
Abscisic acid plays an important role in the regulation of strawberry fruit
ripening. Plant Physiol. 157: 188–199. DOI:10.1104/pp.111.177311.
Kadomura-Ishikawa, Y., Miyawaki, K., Noji, S., Takahashi, A., 2013. Phototropin 2
is involved in blue light-induced anthocyanin accumulation in Fragaria ×
ananassa fruits. J. Plant Res. 126: 847–857. DOI:10.1007/s10265-013-0582-2.
Kamuro, Y., Tohyama, T., Okabe, K., 2003. New functional photo selective sheets.
Regul. Plant Growth Dev. 38: 132–138.
Karlsson, P., 2013. The world’s grape production 2000-2012. BKWine Mag. URL
http://www.bkwine.com/features/winemaking-viticulture/global-grape-
production-2000-2012/ (accessed 3.10.15).
Karppinen, K., Hirvelä, E., Nevala, T., Sipari, N., Suokas, M., Jaakola, L., 2013.
Changes in the abscisic acid levels and related gene expression during fruit
development and ripening in bilberry (Vaccinium myrtillus L.).
Phytochemistry 95: 127–134. DOI:10.1016/j.phytochem.2013.06.023.
Kataoka, I., Sugiura, A., Utsunomiya, N., Tomana, T., 1982. Effect of abscisic acid
and defoliation on anthocyanin accumulation in Kyoho grapes (Vitis vinifera L.
× Vitis labruscana Bailey). Vitis.
Keller, M., 2015. The Science of grapevines: anatomy and physiology. Academic
Press.
Kim, J.-S., Lee, B.-H., Kim, S.-H., Oh, K.-H., Cho, K.Y., 2006. Responses to
environmental and chemical signals for anthocyanin biosynthesis in non-
chlorophyllous corn (Zea mays L.) leaf. J. Plant Biol. 49: 16–25.
DOI:10.1007/BF03030784.
References
95
Kliewer, W.M., 1970. Effect of time and severity of defoliation on growth and
composition of ‘Thompson Seedless’ Grapes. Am. J. Enol. Vitic. 21: 37–47.
Kliewer, W.M., Torres, R.E., 1972. Effect of controlled day and night temperatures
on grape coloration. Am. J. Enol. Vitic. 23: 71–77.
Kobayashi, S., Goto-Yamamoto, N., Hirochika, H., 2005. Association of VvmybA1
gene expression with anthocyanin production in grape (Vitis vinifera) skin-
color Mutants. J. Jpn. Soc. Hortic. Sci. 74: 196–203.
DOI:10.2503/jjshs.74.196.
Kobayashi, S., Ishimaru, M., Hiraoka, K., Honda, C., 2002. Myb-related genes of the
Kyoho grape ( Vitis labruscana) regulate anthocyanin biosynthesis. Planta
215: 924–933. DOI:10.1007/s00425-002-0830-5.
Koes, R.E., Quattrocchio, F., Mol, J.N.M., 1994. The flavonoid biosynthetic pathway
in plants: Function and evolution. BioEssays 16: 123–132.
DOI:10.1002/bies.950160209.
Koes, R., Verweij, W., Quattrocchio, F., 2005. Flavonoids: a colorful model for the
regulation and evolution of biochemical pathways. Trends Plant Sci. 10: 236–
242. DOI:10.1016/j.tplants.2005.03.002.
Kondo, S., Sugaya, S., Sugawa, S., Ninomiya, M., Kittikorn, M., Okawa, K., Ohara,
H., Ueno, K., Todoroki, Y., Mizutani, M., Hirai, N., 2012. Dehydration
tolerance in apple seedlings is affected by an inhibitor of ABA 8’-hydroxylase
CYP707A. J. Plant Physiol. 169: 234–241. DOI:10.1016/j.jplph.2011.09.007.
Kondo, S., Tomiyama, H., Rodyoung, A., Okawa, K., Ohara, H., Sugaya, S., Terahara,
N., Hirai, N., 2014. Abscisic acid metabolism and anthocyanin synthesis in
References
96
grape skin are affected by light emitting diode (LED) irradiation at night. J.
Plant Physiol. 171: 823–829. DOI:10.1016/j.jplph.2014.01.001.
Koshita, Y., Kobayashi, S., Ishimaru, M., Funamoto, Y., Shiraishi, M., Azuma, A.,
Yakushiji, H., Nakayama, M., 2008. An anthocyanin regulator from grapes,
VlmybA1-2, produces reddish-purple plants. J. Jpn. Soc. Hortic. Sci. 77: 33–37.
Koshita, Y., Yamane, T., Yakushiji, H., Azuma, A., Mitani, N., 2011. Regulation of
skin color in ‘Aki Queen’ grapes: Interactive effects of temperature, girdling,
and leaf shading treatments on coloration and total soluble solids. Sci. Hortic.
129: 98–101. DOI:10.1016/j.scienta.2011.03.014.
Kushiro, T., Okamoto, M., Nakabayashi, K., Yamagishi, K., Kitamura, S., Asami, T.,
Hirai, N., Koshiba, T., Kamiya, Y., Nambara, E., 2004. The Arabidopsis
cytochrome P450 CYP707A encodes ABA 8’-hydroxylases: key enzymes in
ABA catabolism. EMBO J. 23: 1647–1656. DOI:10.1038/sj.emboj.7600121.
Kwon, S., Lim, J., 2011. Improvement of energy efficiency in plant factories through
the Measurement of plant bioelectrical potential, in: Tan, H. (Ed.), informatics
in control, automation and robotics, lecture notes in electrical engineering.
Springer Berlin Heidelberg, pp. 641–648.
Larronde, F., Krisa, S., Decendit, A., Chèze, C., Deffieux, G., Mérillon, J.M., 1998.
Regulation of polyphenol production in Vitis vinifera cell suspension cultures
by sugars. Plant Cell Rep. 17: 946–950. DOI:10.1007/s002990050515.
Lau, O.S., Deng, X.W., 2012. The photomorphogenic repressors COP1 and DET1: 20
years later. Trends Plant Sci. 17: 584–593. DOI:10.1016/j.tplants.2012.05.004.
References
97
Lee, B.M., Smith, J.D., Cobb, B.G., Magill, C.W., Bai, D.G., Paek, N.C., 1997.
Regulatory roles of abscisic acid for anthocyanin synthesis in maize kernels
[Zea mays]. Maydica Italy.
Lee, J., He, K., Stolc, V., Lee, H., Figueroa, P., Gao, Y., Tongprasit, W., Zhao, H.,
Lee, I., Deng, X.W., 2007. Analysis of transcription factor HY5 genomic
binding sites revealed its hierarchical role in light regulation of development.
Plant Cell 19: 731–749. DOI:10.1105/tpc.106.047688.
Li, H., Tang, C., Xu, Z., Liu, X., Han, X., 2012. Effects of different light sources on
the growth of non-heading chinese cabbage (Brassica campestris L.). J. Agric.
Sci. 4: p262. DOI:10.5539/jas.v4n4p262.
Li, Y.-Y., Mao, K., Zhao, C., Zhao, X.-Y., Zhang, H.-L., Shu, H.-R., Hao, Y.-J., 2012.
MdCOP1 ubiquitin E3 ligases interact with MdMYB1 to regulate light-induced
anthocyanin biosynthesis and red fruit coloration in apple. Plant Physiol. 160:
1011–1022. DOI:10.1104/pp.112.199703.
Li, Y.-Y., Mao, K., Zhao, C., Zhao, X.-Y., Zhang, R.-F., Zhang, H.-L., Shu, H.-R.,
Hao, Y.-J., 2013. Molecular cloning and functional analysis of a blue light
receptor gene MdCRY2 from apple (Malus domestica). Plant Cell Rep. 32:
555–566. DOI:10.1007/s00299-013-1387-4.
Lin, C., Ahmad, M., Cashmore, A.R., 1996. Arabidopsis cryptochrome 1 is a soluble
protein mediating blue light-dependent regulation of plant growth and
development. Plant J. Cell Mol. Biol. 10: 893–902.
Lin, C., Yang, H., Guo, H., Mockler, T., Chen, J., Cashmore, A.R., 1998.
Enhancement of blue-light sensitivity of Arabidopsis seedlings by a blue light
receptor cryptochrome 2. Proc. Natl. Acad. Sci. U. S. A. 95: 2686–2690.
References
98
Lin-Wang, K., Micheletti, D., Palmer, J., Volz, R., Lozano, L., Espley, R., Hellens,
R.P., Chagnè, D., Rowan, D.D., Troggio, M., Iglesias, I., Allan, A.C., 2011.
High temperature reduces apple fruit colour via modulation of the anthocyanin
regulatory complex: Temperature and the anthocyanin regulatory complex.
Plant Cell Environ. 34: 1176–1190. DOI:10.1111/j.1365-3040.2011.02316.x.
Lopez, L., Carbone, F., Bianco, L., Giuliano, G., Facella, P., Perrotta, G., 2012.
Tomato plants overexpressing cryptochrome 2 reveal altered expression of
energy and stress-related gene products in response to diurnal cues. Plant Cell
Environ. 35: 994–1012. DOI:10.1111/j.1365-3040.2011.02467.x.
Loreti, E., Povero, G., Novi, G., Solfanelli, C., Alpi, A., Perata, P., 2008. Gibberellins,
jasmonate and abscisic acid modulate the sucrose-induced expression of
anthocyanin biosynthetic genes in Arabidopsis. New Phytol. 179: 1004–1016.
DOI:10.1111/j.1469-8137.2008.02511.x.
Maier, A., Schrader, A., Kokkelink, L., Falke, C., Welter, B., Iniesto, E., Rubio, V.,
Uhrig, J.F., Hülskamp, M., Hoecker, U., 2013. Light and the E3 ubiquitin
ligase COP1/SPA control the protein stability of the MYB transcription factors
PAP1 and PAP2 involved in anthocyanin accumulation in Arabidopsis. Plant J.
Cell Mol. Biol. 74: 638–651. DOI:10.1111/tpj.12153.
Mancinelli, A.L., Yang, C.-P.H., Lindquist, P., Anderson, O.R., Rabino, I., 1975.
Photocontrol of anthocyanin synthesis. Plant Physiol: 55, 251–257.
Matthews, M.A., Shackel, K.A., 2005. Growth and water transport in fleshy fruit.
Vasc. Transp. Plants: 181–197.
Matus, J.T., Loyola, R., Vega, A., Peña-Neira, A., Bordeu, E., Arce-Johnson, P.,
Alcalde, J.A., 2009. Post-veraison sunlight exposure induces MYB-mediated
References
99
transcriptional regulation of anthocyanin and flavonol synthesis in berry skins
of Vitis vinifera. J. Exp. Bot. ern336. DOI:10.1093/jxb/ern336.
Mazza, G., Francis, F.J., 1995. Anthocyanins in grapes and grape products. Crit. Rev.
Food Sci. Nutr. 35: 341–371. DOI:10.1080/10408399509527704.
Mazza, G., Miniati, E., 1993. Anthocyanins in fruits, vegetables, and grains.
Mita, S., Hirano, H., Nakamura, K., 1997. Negative regulation in the expression of a
sugar-inducible gene in Arabidopsis thaliana. A recessive mutation causing
enhanced expression of a gene for beta-amylase. Plant Physiol: 114, 575–582.
Möglich, A., Yang, X., Ayers, R.A., Moffat, K., 2010. Structure and function of plant
photoreceptors. Annu. Rev. Plant Biol. 61: 21–47. DOI:10.1146/annurev-
arplant-042809-112259.
M, O., P, G.-M., Nh, B., Mh, G., P, J., Ja, L., E, V., A, W., P, H., 2012. Development
of colour and firmness in strawberry crops is UV light sensitive, but colour is
not a good predictor of several quality parameters. J Sci Food Agric: 1597–604.
Mori, K., Goto-Yamamoto, N., Kitayama, M., Hashizume, K., 2007. Loss of
anthocyanins in red-wine grape under high temperature. J. Exp. Bot. 58:
1935–1945. DOI:10.1093/jxb/erm055.
Mori, K., Saito, H., Goto-Yamamoto, N., Kitayama, M., Kobayashi, S., Sugaya, S.,
Gemma, H., Hashizume, K., 2005a. Effects of abscisic acid treatment and
night temperatures on anthocyanin composition in Pinot noir grapes. Vitis-
geilweilerhof- 44: 161.
Mori, K., Sugaya, S., Gemma, H., 2005b. Decreased anthocyanin biosynthesis in
grape berries grown under elevated night temperature condition. Sci. Hortic.
105: 319–330. DOI:10.1016/j.scienta.2005.01.032.
References
100
Morinaga, K., 2001. Grape production in the Asia-Pacific region (country report),
Grape production in Japan. Food and Agriculture Organization of the United
Nation, Bangkok, THAILAND.
Morrison, J.C., Noble, A.C., 1990. The effects of leaf and cluster shading on the
composition of cabernet sauvignon grapes and on fruit and wine sensory
properties. Am. J. Enol. Vitic. 41: 193–200.
Nambara, E., Marion-Poll, A., 2005. Abscisic acid biosynthesis and catabolism. Annu.
Rev. Plant Biol. 56: 165–185. DOI:10.1146/annurev.arplant.56.032604.144046.
Ohto, M., Onai, K., Furukawa, Y., Aoki, E., Araki, T., Nakamura, K., 2001. Effects of
sugar on vegetative development and floral transition in Arabidopsis. Plant
Physiol. 127: 252–261. DOI:10.1104/pp.127.1.252.
Ono, Watanabe, 2010. Design and construction of a pilot-scale plant-factory with
multiple lighting sources. american society of agricultural and biological
engineers. DOI:10.13031/2013.29727.
Ovadia, R., Oren-Shamir, M., Kaplunov, T., Zutahy, Y., Lichter, A., Lurie, S., 2013.
Effects of plant growth regulators and high temperature on colour
development in ‘Crimson Seedless’ grapes. J. Hortic. Sci. Biotechnol. 88:
387–392.
Owen, S.J., Lafond, M.D., Bowen, P., Bogdanoff, C., Usher, K., Abrams, S.R., 2009.
Profiles of abscisic acid and its catabolites in developing merlot grape (Vitis
vinifera) berries. Am. J. Enol. Vitic. 60: 277–284.
Pech, J.C., Bouzayen, M., Latché, A., 2008. Climacteric fruit ripening: Ethylene-
dependent and independent regulation of ripening pathways in melon fruit.
Plant Sci., Ethylene Biology 175: 114–120. DOI:10.1016/j.plantsci.2008.01.003.
References
101
Peña Neira, A.I., Cáceres, A., Pastenes, C., 2007. Low molecular weight phenolic and
anthocyanin composition of grape skins from cv. syrah (Vitis vinifera L.) in
the maipo valley (Chile): Effect of clusters thinning and vineyard yield.
Peng, T., Saito, T., Honda, C., Ban, Y., Kondo, S., Liu, J.-H., Hatsuyama, Y.,
Moriguchi, T., 2013. Screening of UV-B-induced genes from apple peels by
SSH: possible involvement of MdCOP1-mediated signaling cascade genes in
anthocyanin accumulation. Physiol. Plant. 148: 432–444. DOI:10.1111/ppl.12002.
Peppi, M.C., Fidelibus, M.W., 2008. Effects of forchlorfenuron and abscisic acid on
the quality of ‘Flame Seedless’ Grapes. HortScience 43: 173–176.
Peppi, M.C., Fidelibus, M.W., Dokoozlian, N., 2006. Abscisic acid application timing
and concentration affect firmness, pigmentation, and color of ‘Flame Seedless’
grapes. HortScience 41: 1440–1445.
Petrie, P.R., Clingeleffer, P.R., 2006. Crop thinning (hand versus mechanical), grape
maturity and anthocyanin concentration: outcomes from irrigated Cabernet
Sauvignon (Vitis vinifera L.) in a warm climate. Aust. J. Grape Wine Res. 12:
21–29. DOI:10.1111/j.1755-0238.2006.tb00040.x.
Proctor, J.T.A., 1974. Color stimulation in attached apples with supplementary light.
Can. J. Plant Sci. 54: 499–503. DOI:10.4141/cjps74-084.
Quail, P.H., Boylan, M.T., Parks, B.M., Short, T.W., Xu, Y., Wagner, D., 1995.
Phytochromes: photosensory perception and signal transduction. Science 268:
675–680.
Ramsay, N.A., Walker, A.R., Mooney, M., Gray, J.C., 2003. Two basic-helix-loop-
helix genes (MYC-146 and GL3) from Arabidopsis can activate anthocyanin
References
102
biosynthesis in a white-flowered Matthiola incana mutant. Plant Mol. Biol. 52:
679–688. DOI:10.1023/A:1024852021124.
Reed, J.W., 1999. Phytochromes are Pr-ipatetic kinases. Curr. Opin. Plant Biol. 2:
393–397. DOI:10.1016/S1369-5266(99)00011-4.
Ren, J., Sun, L., Wu, J., Zhao, S., Wang, C., Wang, Y., Ji, K., Leng, P., 2010. Cloning
and expression analysis of cDNAs for ABA 8’-hydroxylase during sweet
cherry fruit maturation and under stress conditions. J. Plant Physiol. 167:
1486–1493. DOI:10.1016/j.jplph.2010.05.027.
Rizzini, L., Favory, J.-J., Cloix, C., Faggionato, D., O’Hara, A., Kaiserli, E.,
Baumeister, R., Schäfer, E., Nagy, F., Jenkins, G.I., Ulm, R., 2011. Perception
of UV-B by the Arabidopsis UVR8 protein. Science 332: 103–106.
DOI:10.1126/science.1200660.
Roberto, S.R., de Assis, A.M., Yamamoto, L.Y., Miotto, L.C.V., Sato, A.J., Koyama,
R., Genta, W., 2012. Application timing and concentration of abscisic acid
improve color of ‘Benitaka’ table grape. Sci. Hortic. 142: 44–48.
DOI:10.1016/j.scienta.2012.04.028.
Ross, J.A., Kasum, C.M., 2002. Dietary flavonoids: Bioavailability, metabolic effects, and
safety. Annu. Rev. Nutr. 22: 19–34. DOI:10.1146/annurev.nutr.22.111401.144957.
Rudell, D.R., Fellman, J.K., Mattheis, J.P., 2005. Preharvest application of methyl
jasmonate to ‘Fuji’ apples enhances red coloration and affects fruit size,
splitting, and bitter pit incidence. HortScience 40: 1760–1762.
Sæbø, A., Krekling, T., Appelgren, M., 1995. Light quality affects photosynthesis and
leaf anatomy of birch plantlets in vitro. Plant Cell Tissue Organ Cult. 41: 177–
185. DOI:10.1007/BF00051588.
References
103
Samuolienė, G., Sirtautas, R., Brazaitytė, A., Duchovskis, P., 2012. LED lighting and
seasonality effects antioxidant properties of baby leaf lettuce. Food Chem.
134: 1494–1499. DOI:10.1016/j.foodchem.2012.03.061.
Schaefer, H.M., Schaefer, V., Levey, D.J., 2004. How plant–animal interactions
signal new insights in communication. Trends Ecol. Evol. 19: 577–584.
DOI:10.1016/j.tree.2004.08.003.
Senger, H., 1982. The effect of blue light on plants and microorganisms. Photochem.
Photobiol. 35: 911–920. DOI:10.1111/j.1751-1097.1982.tb02668.x.
Seo, M., Koshiba, T., 2002. Complex regulation of ABA biosynthesis in plants.
Trends Plant Sci. 7: 41–48. DOI:10.1016/S1360-1385(01)02187-2.
Setha, S., Kondo, S., Hirai, N., Ohigashi, H., 2004. Xanthoxin, abscisic acid and its
metabolite levels associated with apple fruit development. Plant Sci. 166: 493–
499. DOI:10.1016/j.plantsci.2003.10.020.
Shi, L., Cao, S., Chen, W., Yang, Z., 2014. Blue light induced anthocyanin
accumulation and expression of associated genes in Chinese bayberry fruit.
Sci. Hortic. 179: 98–102. DOI:10.1016/j.scienta.2014.09.022.
Shimokawa, A., Tonooka, Y., Matsumoto, M., Ara, H., Suzuki, H., Yamauchi, N.,
Shigyo, M., 2014. Effect of alternating red and blue light irradiation generated
by light emitting diodes on the growth of leaf lettuce. bioRxiv 003103.
DOI:10.1101/003103.
Shin, D.H., Choi, M., Kim, K., Bang, G., Cho, M., Choi, S.-B., Choi, G., Park, Y.-I.,
2013. HY5 regulates anthocyanin biosynthesis by inducing the transcriptional
activation of the MYB75/PAP1 transcription factor in Arabidopsis. FEBS Lett.
587: 1543–1547. DOI:10.1016/j.febslet.2013.03.037.
References
104
Shinomura, T., Uchida, K., Furuya, M., 2000. Elementary processes of
photoperception by phytochrome A for high-irradiance response of hypocotyl
elongation in Arabidopsis. Plant Physiol. 122: 147–156.
Shiozaki, S., Kamata, Y., Ogata, T., Horiuchi, S., Kawase, K., 1999. Localization of
abscisic acid in grape berry by immunohistochemical techniques. J. Jpn. Soc.
Hortic. Sci. 68: 1–9. DOI:10.2503/jjshs.68.1.
Shiraishi, S., Hsiung, T.C., Shiraishi, M., Kitazaki, M., 1997. Effect of light intensity
on the photosynthetic rate of Vitis. Sci. Bull. Fac. Agric.-Kyushu Univ. Jpn.
Shiraishi, S., Watanabe, Y., 1994. Anthocyanin pigments in the grape skin of cultivars
(Vitis spp.). Sci Bull Fac Agr Kyushu Univ 48: 255–262.
Siegelman, H.W., Hendricks, S.B., 1957. Photocontrol of anthocyanin formation in
turnip and red cabbage seedlings. 1. Plant Physiol. 32: 393–398.
Sims, D.A., Pearcy, R.W., 1992. Response of leaf anatomy and photosynthetic
capacity in alocasia macrorrhiza (Araceae) to a transfer from low to high light.
Am. J. Bot. 79: 449–455. DOI:10.2307/2445158.
Singh, D., Basu, C., Meinhardt-Wollweber, M., Roth, B., 2014. LEDs for energy
efficient greenhouse lighting. ArXiv14063016 Phys. Q-Bio.
Smeekens, S., 2000. Sugar-induced signal transduction in plants. Annu. Rev. Plant
Physiol. Plant Mol. Biol. 51: 49–81. DOI:10.1146/annurev.arplant.51.1.49.
Smith, H., 1982. Light quality, photoperception, and plant strategy. Annu. Rev. Plant
Physiol. 33: 481–518. DOI:10.1146/annurev.pp.33.060182.002405.
Solfanelli, C., Poggi, A., Loreti, E., Alpi, A., Perata, P., 2006. Sucrose-specific
induction of the anthocyanin biosynthetic pathway in Arabidopsis. Plant
Physiol. 140: 637–646. DOI:10.1104/pp.105.072579.
References
105
Sparvoli, F., Martin, C., Scienza, A., Gavazzi, G., Tonelli, C., 1994. Cloning and
molecular analysis of structural genes involved in flavonoid and stilbene
biosynthesis in grape (Vitis vinifera L.). Plant Mol. Biol. 24, 743–755.
Springob, K., Nakajima, J., Yamazaki, M., Saito, K., 2003. Recent advances in the
biosynthesis and accumulation of anthocyanins. Nat. Prod. Rep. 20: 288–303.
DOI:10.1039/B109542K.
Stefanelli, D., Goodwin, I., Jones, R., 2010. Minimal nitrogen and water use in
horticulture: Effects on quality and content of selected nutrients. Food Res.
Int., Climate Change and Food Science 43: 1833–1843.
DOI:10.1016/j.foodres.2010.04.022.
Steyn, W.J., Wand, S.J.E., Jacobs, G., Rosecrance, R.C., Roberts, S.C., 2009.
Evidence for a photoprotective function of low-temperature-induced
anthocyanin accumulation in apple and pear peel. Physiol. Plant. 136: 461–
472. DOI:10.1111/j.1399-3054.2009.01246.x.
Stracke, R., Favory, J.-J., Gruber, H., Bartelniewoehner, L., Bartels, S., Binkert, M.,
Funk, M., Weisshaar, B., Ulm, R., 2010. The Arabidopsis bZIP transcription
factor HY5 regulates expression of the PFG1/MYB12 gene in response to
light and ultraviolet-B radiation. Plant Cell Environ. 33: 88–103.
DOI:10.1111/j.1365-3040.2009.02061.x.
Stracke, R., Ishihara, H., Huep, G., Barsch, A., Mehrtens, F., Niehaus, K., Weisshaar,
B., 2007. Differential regulation of closely related R2R3-MYB transcription
factors controls flavonol accumulation in different parts of the Arabidopsis
thaliana seedling. Plant J. 50: 660–677. DOI:10.1111/j.1365-313X.2007.03078.x.
References
106
Stutte, G.W., 2009. Light-emitting diodes for manipulating the phytochrome
apparatus. HortScience 44: 231–234.
Sun, L., Zhang, M., Ren, J., Qi, J., Zhang, G., Leng, P., 2010. Reciprocity between
abscisic acid and ethylene at the onset of berry ripening and after harvest.
BMC Plant Biol. 10: 257. DOI:10.1186/1471-2229-10-257.
Takahama, U., 2004. Oxidation of vacuolar and apoplastic phenolic substrates by
peroxidase: Physiological significance of the oxidation reactions. Phytochem.
Rev. 3: 207–219. DOI:10.1023/B:PHYT.0000047805.08470.e3.
Takos, A.M., Jaffé, F.W., Jacob, S.R., Bogs, J., Robinson, S.P., Walker, A.R., 2006.
Light-induced expression of a MYB gene regulates anthocyanin biosynthesis
in red apples. Plant Physiol. 142: 1216–1232. DOI:10.1104/pp.106.088104.
Tarara, J.M., Lee, J., Spayd, S.E., Scagel, C.F., 2008. Berry temperature and solar
radiation alter acylation, proportion, and concentration of anthocyanin in
Merlot grapes. Am. J. Enol. Vitic. 59: 235–247.
Tira-Umphon, A., Roustan, J.-P., Chervin, C., 2007. The stimulation by ethylene of
the UDP glucose-flavonoid 3-O-glucosyltransferase (UFGT) in grape tissues
is independent from the MYBA transcription factors. Vitis-geilveilerho- 46:
210.
Tomana, T., Utsunomiya, N., Kataoka, I., 1979. The Effect of environmental
temperatures on fruit ripening on the tree. J. Jpn. Soc. Hortic. Sci. 48: 261–266.
DOI:10.2503/jjshs.48.261.
Ubi, B.E., Honda, C., Bessho, H., Kondo, S., Wada, M., Kobayashi, S., Moriguchi, T.,
2006. Expression analysis of anthocyanin biosynthetic genes in apple skin:
References
107
Effect of UV-B and temperature. Plant Sci. 170: 571–578.
DOI:10.1016/j.plantsci.2005.10.009.
Uleberg, E., Rohloff, J., Jaakola, L., Trôst, K., Junttila, O., Häggman, H., Martinussen, I.,
2012. Effects of temperature and photoperiod on yield and chemical composition
of northern and southern clones of bilberry (Vaccinium myrtillus L.). J. Agric.
Food Chem. 60: 10406–10414. DOI:10.1021/jf302924m.
Wang, B., He, J., Duan, C., Yu, X., Zhu, L., Xie, Z., Zhang, C., Xu, W., Wang, S.,
2012. Root restriction affects anthocyanin accumulation and composition in
berry skin of ‘Kyoho’ grape (Vitis vinifera L. × Vitis labrusca L.) during
ripening. Sci. Hortic. 137: 20–28. DOI:10.1016/j.scienta.2011.10.006.
Watanabe, H., 2011. Light-controlled plant cultivation system in Japan - development
of a vegetable factory using LEDs as a light source for plants. Acta Hortic.
Wen, P.-F., Chen, J.-Y., Kong, W.-F., Pan, Q.-H., Wan, S.-B., Huang, W.-D., 2005.
Salicylic acid induced the expression of phenylalanine ammonia-lyase gene in
grape berry. Plant Sci. 169: 928–934. DOI:10.1016/j.plantsci.2005.06.011.
Wheeler, S., Loveys, B., Ford, C., Davies, C., 2009. The relationship between the
expression of abscisic acid biosynthesis genes, accumulation of abscisic acid
and the promotion of Vitis vinifera L. berry ripening by abscisic acid. Aust. J.
Grape Wine Res. 15: 195–204. DOI:10.1111/j.1755-0238.2008.00045.x.
Xie, R., Zheng, L., He, S., Zheng, Y., Yi, S., Deng, L., 2011. Anthocyanin
biosynthesis in fruit tree crops: Genes and their regulation. Afr. J. Biotechnol.
10: 19890–19897. DOI:10.5897/ajbx11.028.
Xie, X.-B., Li, S., Zhang, R.-F., Zhao, J., Chen, Y.-C., Zhao, Q., Yao, Y.-X., You, C.-
X., Zhang, X.-S., Hao, Y.-J., 2012. The bHLH transcription factor MdbHLH3
References
108
promotes anthocyanin accumulation and fruit colouration in response to low
temperature in apples: MdbHLH3 regulates apple fruit colouration. Plant Cell
Environ. 35: 1884–1897. DOI:10.1111/j.1365-3040.2012.02523.x.
Xie, Z., Li, B., Forney, C.F., Xu, W., Wang, S., 2009. Changes in sugar content and
relative enzyme activity in grape berry in response to root restriction. Sci.
Hortic. 123: 39–45. DOI:10.1016/j.scienta.2009.07.017.
Xu, F., Cao, S., Shi, L., Chen, W., Su, X., Yang, Z., 2014. Blue light irradiation
affects anthocyanin content and enzyme activities involved in postharvest
strawberry fruit. J. Agric. Food Chem. 62: 4778–4783.
DOI:10.1021/jf501120u.
Yamane, T., Jeong, S.T., Goto-Yamamoto, N., Koshita, Y., Kobayashi, S., 2006.
Effects of temperature on anthocyanin biosynthesis in grape berry skins. Am. J.
Enol. Vitic. 57, 54–59.
Yamane, T., Shibayama, K., 2007. Effects of treatment date, width of girdling, and
berry number of girdled shoot on the coloration of grape berries (Vitis sp.).
Hortic. Res. Jpn.
Yamane, T., Shibayama, K., 2006. Effects of trunk girdling and crop load levels on
fruit quality and root elongation in ‘Aki Queen’ grapevines. J. Jpn. Soc. Hortic.
Sci. Jpn.
Yokotani, N., Nakano, R., Imanishi, S., Nagata, M., Inaba, A., Kubo, Y., 2009.
Ripening-associated ethylene biosynthesis in tomato fruit is autocatalytically
and developmentally regulated. J. Exp. Bot. 60: 3433–3442.
DOI:10.1093/jxb/erp185.
References
109
Yonekura, M., Aoki, N., Hirose, T., Onai, K., Ishiura, M., Okamura, M., Ohsugi, R.,
Ohto, C., 2013. The promoter activities of sucrose phosphate synthase genes
in rice, OsSPS1 and OsSPS11, are controlled by light and circadian clock, but
not by sucrose. Front. Plant Sci. 4. DOI:10.3389/fpls.2013.00031.
Yoshikawa, H., Honda, C., Kondo, S., 2007. Effect of low-temperature stress on
abscisic acid, jasmonates, and polyamines in apples. Plant Growth Regul. 52:
199–206. DOI:10.1007/s10725-007-9190-2.
Zeevaart, J.A.D., Creelman, R.A., 1988. Metabolism and physiology of abscisic acid.
Annu. Rev. Plant Physiol. Plant Mol. Biol. 39: 439–473.
DOI:10.1146/annurev.pp.39.060188.002255.
Zhang, W., Curtin, C., Kikuchi, M., Franco, C., 2002. Integration of jasmonic acid
and light irradiation for enhancement of anthocyanin biosynthesis in Vitis
vinifera suspension cultures. Plant Sci. 162: 459–468. DOI:10.1016/S0168-
9452(01)00586-6.
Zheng, Y., Tian, L., Liu, H., Pan, Q., Zhan, J., Huang, W., 2009. Sugars induce
anthocyanin accumulation and flavanone 3-hydroxylase expression in grape
berries. Plant Growth Regul. 58: 251–260. DOI:10.1007/s10725-009-9373-0.
Zhou, R., Cutler, A.J., Ambrose, S.J., Galka, M.M., Nelson, K.M., Squires, T.M.,
Loewen, M.K., Jadhav, A.S., Ross, A.R.S., Taylor, D.C., Abrams, S.R., 2004.
A new abscisic acid catabolic pathway. Plant Physiol. 134: 361–369.
DOI:10.1104/pp.103.030734.
Zifkin, M., Jin, A., Ozga, J.A., Zaharia, L.I., Schernthaner, J.P., Gesell, A., Abrams,
S.R., Kennedy, J.A., Constabel, C.P., 2012. Gene expression and metabolite
profiling of developing highbush blueberry fruit indicates transcriptional
References
110
regulation of flavonoid metabolism and activation of abscisic acid metabolism.
Plant Physiol. 158: 200–224. DOI:10.1104/pp.111.180950.
Zoratti, L., Karppinen, K., Escobar, A.L., Häggman, H., Jaakola, L., 2014. Light-
controlled flavonoid biosynthesis in fruits. Front. Plant Sci. 5.