Elucidation of the mechanism leading to the onset of ...muscular dystrophies include progressive muscle wasting, limited range of movement, walking difficulty, respiratory difficulty

Kobe University Repository : Thesis

学位論文題目Tit le

Elucidat ion of the mechanism leading to the onset of chicken musculardystrophy(ニワトリ筋ジストロフィー発症機序の解明)

氏名Author Matsumoto, Hirokazu

専攻分野Degree 博士（農学）

学位授与の日付Date of Degree 2010-03-25

資源タイプResource Type Thesis or Dissertat ion / 学位論文

報告番号Report Number 甲4944

権利Rights

JaLCDOI

URL http://www.lib.kobe-u.ac.jp/handle_kernel/D1004944※当コンテンツは神戸大学の学術成果です。無断複製・不正使用等を禁じます。著作権法で認められている範囲内で、適切にご利用ください。

PDF issue: 2020-10-12

Doctoral Dissertation

Elucidation of the mechanism

leading to the onset of

chicken muscular dystrophy

January 2010

Graduate School of Agricultural Science

Kobe University

Hirokazu MATSUMOTO

Doctoral Dissertation

Elucidation of the mechanism

leading to the onset of

chicken muscular dystrophy

January 2010

Graduate School of Agricultural Science

Kobe University

Hirokazu MATSUMOTO

TABLE OF CONTENTS

G ENE RA L I NT ROD UC T ION -----------------------------------------------------------------------1

CHAPTER I Pinpointing the candidate region for muscular dystrophy in chickens with an abnormal muscle gene I n trod u cti 0 n ----------------------------------------------------------------------------5 Mate rials & Meth od s -------------------------------------------------------------7

Res u Its & 0 iscuss io n ------------------------------------------------------------12

CHAPTER II The ubiquitin ligase gene (WWP1) is responsible for the chicken muscular dystrophy I ntrod u ctio n --------------------------------------------------------------------------19

M ate ria Is & Method s -------------------------------------------------------------21

Res u Its ---------------------------------------------------------------------------------27

Dis cu ss ion ----------------------------------------------------------------------------3 2

CHAPTER III Expression pattern of WWP1 in muscular dystrophic and normal chickens I nt rod u ct ion --------------------------------------------------------------------------3 7

Materia Is & Method s -------------------------------------------------------------39

Resu Its & 0 iscussion ------------------------------------------------------------42

CHAPTER IV Mutated WWP1 induces an aberrant expression of myosin heavy chain gene in C2C12 skeletal muscle cells I n trod u cti 0 n --------------------------------------------------------------------------4 7

Mate ri a Is & Meth od s -------------------------------------------------------------49

Res u Its & 0 iscu ssio n ------------------------------------------------------------54

CHAPTER V Overexpression of caveolin-3 protein is limited in damaged muscle in chicken muscular dystrophy I nt rod u cti a n --------------------------------------------------------------------------60

Materia Is & Meth ad s -------------------------------------------------------------63

Res u Its ---------------------------------------------------------------------------------67

Dis cuss ian ----------------------------------------------------------------------------73

G ENE RA L 0 I S CESS ION ----------------------------------------------------------------------------77

A C KN OW L E DG MEN T S ------------------------------------------------------------------------------82

REF ERE N C E -------------------------------------------------------------------------------------------------83

GENERAL INTRODUCTION

Muscular dystrophies are defined as the group of inherited diseases with

progressive weakness and degeneration of skeletal muscle, and there exist

plural genetical backgrounds (Partridge, 1991). Main symptoms of the

muscular dystrophies include progressive muscle wasting, limited range of

movement, walking difficulty, respiratory difficulty and so on. Some types of

muscular dystrophies can also affect the heart, causing cardiomyopathy or

arrhythmias (Nonaka, 1987a). The prognosis for the patients varies widely.

Some patients of muscular dystrophies die in infancy, while others are

affected only moderately and live into adulthood. In addition, the muscles

affected vary according to the type of the disease. Many types of muscular

dystrophies tend to occur in early childhood, though some forms can affect

adults.

In many cases, abnormalities of muscle proteins to compose of the

linkage between sarcolemma and basal lamina can lead the onset of

muscular dystrophies (Imamura et a1., 2000). The most famous and earliest

identified protein responsible for muscular dystrophies is dystrophin.

Mutations in dystrophin gene lead loss or lack of dystrophin protein from

sarcolemma, which results in two types of muscular dystrophies, Duchenne

and Becker muscular dystrophy, accounting for most of the diseases (Nonaka,

1987a). Duchenne muscular dystrophy (dystrophin-deficient) is among the

most severe forms of muscular dystrophies; hence the function of dystrophin

- 1 -

and its related proteins has been intensively studied for these years.

However, numbers of muscular dystrophies and related diseases need

elucidating the responsible genes or the mechanisms (Terri & Kunkel, 2000;

Lisi & Cohn, 2007).

Animal models are very useful tools to examine a pathophysiologic

role of certain molecule, to elucidate a mechanism of a disease and to

promote a therapeutic research. From this perspective, various animal

models for muscular dystrophies have been established and utilized.

Representative models in Japan are mdxmouse (dystrophin-deficient), grmd

dog (dystrophin-deficient), dy mouse (merosin-deficient), muscular

dystrophic hamster (O-sarcoglycan-deficient) and muscular dystrophic

chicken (Nonaka, 1987b). These models are ones with abnormalities of

dystrophin or other related proteins, except for muscular dystrophic chicken.

Thanks to these animal models, the studies about muscular dystrophies

lacking dystrophin and/or its related proteins have been intensively

progressed, while those have not about other types of muscular dystrophies.

Chicken muscular dystrophy with abnormal muscle (Alld) has been

known since 1956 (Asmundson & Julian, 1956), and several strains for this

disease have been established. One of them is New Hampshire 413-strain

(NH-413). This strain was introduced from University of California, Davis to

Japan in 1976 (Kondo et a1., 1982). The phenotype of AM dystrophic chickens

is relatively mild and they are able to breed, which makes it easy to obtain

- 2-

fertilized eggs with AM gene and AlJ1lAMhomozygous chicks. Therefore, this

animal model is regarded as the suitable for a diachronic study to examine

when and how muscular dystrophies start to affect (Nonaka, 1987b). The

disease in NH-413 is transmitted co dominantly by a single gene, and the

phenotype is modified by other backcross genes (Asmundson & Julian, 1956;

Asmundson et ai., 1966; Kikuchi et ai., 1981; Wagner & Peterson, 1970). The

responsible gene has not been identified yet, and dystrophin and/or other

known causative proteins seem not to be responsible gene for this disease

(Saito et a1., 2005), suggesting that chicken muscular dystrophy is the one

triggered by a different mechanism from known muscular dystrophies.

Elucidating the responsible gene and the mechanism leading the onset of

chicken muscular dystrophy would provide new insights to understand

muscular dystrophies and related diseases whose causes are unknown.

In prevlOUS study applying linkage analysis, the AM locus was

mapped to chicken chromosome 2q (Lee et ai., 2002) and the candidate

region was narrowed down to 3.6 Mbp range (Yoshizawa et ai., 2004). This

region included 34 functional genes, some of which functions were unknown.

Therefore, further analyses were required to pinpoint the AM candidate

region, identify the responsible gene and understand the mechanism of

chicken muscular dystrophy.

The aim of this study was to identify the responsible gene for chicken

muscular dystrophy and to elucidate the mechanism leading its onset. By

- 3-

haplotype analysis with F2 resource family for chicken muscular dystrophy,

AM candidate region was reduced to approximately 1 Mbp, including seven

functional genes as candidate genes. Subsequent sequence comparison and

expression analysis of seven candidate genes in normal and dystrophic

chickens revealed that one of candidate genes, WWP1, has the mutation

specific to muscular dystrophic chickens, suggesting that WWPl is the

causative gene of chicken muscular dystrophy. Transfecting mouse WWPl

with the mutation homologous to the responsible mutation for chicken

muscular dystrophy into C2C12 mouse myoblasts resulted in the disturbed

expressions of muscle differentiation markers. Caveolin-3 expression was

analyzed as a candidate protein interacting with WWPl, which suggested

that the amount of caveolin-3 protein is controlled by WWPI and its

aberrant regulation causes the onset of chicken muscular dystrophy.

- 4-

CHAPTER I

Pinpointing the candidate region for muscular dystrophy

in chickens with an abnormal muscle gene

Introduction

Chicken muscular dystrophy with abnormal muscle (.AA1) has been known

for over 50 years (Asmundson & Julian, 1956), but the responsible gene has

not been identified yet. It has been well studied that abnormalities of muscle

proteins to compose of the linkage between sarcolemma and basal lamina,

such as dystrophin, can lead muscular dystrophies in many cases (Imamura

et a1., 2000). However, the expressions of dystrophin and/or its related

proteins seem unaffected in this disease (Saito et a1., 2005). Elucidating the

responsible gene of chicken muscular dystrophy would provide new insights

to understand muscular dystrophies and related diseases whose causes are

unknown.

Previously, the AM locus was mapped to chicken chromosome 2q

using a linkage map constructed with the Kobe University resource family

(Lee et a1., 2002). Chicken consensus map by Schmid et a1. (2000) revealed

that this region was syntenic to the human chromosome 8ql1-24.3,

indicating the genes on this region were candidates for the disease, although

approximately 600 functional genes exist on the human chromosome

8ql1-24.3. Subsequently, the candidate region was narrowed down to 3.6

- 5-

Mbp range on GGA2q, including 34 functional genes (Yoshizawa et ai., 2004).

There did not exist any known causative genes in this region. Therefore,

further analyses are required to identify the responsible gene.

This study attempted to reduce the candidate region of the AMlocus.

The F2 resource family for chicken muscular dystrophy was newly

established. Total of 487 F2 chickens were used for haplotype analysis with

22 genetic markers developed in this study. The candidate region was

successfully reduced to approximately 1 Mbp, including seven functional

genes as candidate genes.

. 6·

Materials & Methods

Genetic resource_ Chicken muscular dystrophy F2 resource family was

established in this study_ F1 generation (AlI17wt), which gained by crossing a

NH-413 male (AlI17.AAd) to a GSP female (wt/wt), was intercrossed to produce

F2 offspring. NH-413 is a New Hampshire muscular dystrophy strain

introduced from California University in 1976 (Kondo et ai., 1982), and GSP

has been established as an inbred strain from Fayoumi breed by Nippon

Institute for Biological Science in 1971. Total of 487 F2 chickens and the

parents as controls were used for haplotype analysis in this study.

To judge the phenotypes among AM homozygous, heterozygous and

normal homozygous chickens, the pectoral muscles, which are selectively

affected by chicken muscular dystrophy, were analyzed histologically. The

pectoral muscles fixed in a commercial rapid fixative (U fix; Sakura Finetek

Japan, Tokyo, Japan) were embedded in paraffin. For pathological

observation (Kikuchi et a1., 1981), paraffin sections were stained with

hematoxylin-eosin (H-E) method (Fig. I-la, b, c) and periodic acid-Schiff

(PAS) reaction (Fig. 1-ld, e, D. The degree of pathological abnormality was

evaluated by vacuolation, PAS-positive deposits and increase of nuclear in a

number within muscle fiber, hypertrophy and necrosis of muscle fiber, and

adipose replacement of muscle. FigurE' 1-la and d are the representative

images of AMlAM chickens' sections, Figure I-Ib and e the representative

ones of AMl wt chickens' and FigurE' I -lc and f the representative ones of

wt/ wt chickens'. In addition to histological judgment, enzymological analyses

- 7-

c Figure 1-1 Histopathological features of pectoral muscles of abnormal muscle (AM) homozygous chicken (a,d), heterozygous chicken (b,e) and normal homozygous chicken (c,f). (a-c) hematoxylin-eosin staining, (d-f) periodic acid-Schiff (PAS) reaction . The inset in e shows a higher magnification of a muscle fiber in e. Though vacuoles (-) were observed in the muscle fibers both .of the abnormal muscle (AM) homozygous and heterozygous chickens, the number of muscle fibers containing vacuoles in the heterozygous chicken is less than that in the AM homozygous chicken. Fatty replacement (*) was observed in the muscle tissue of the AM homozygous chicken. The PAS reaction revealed the presence of granules (arrowhead) in the sarcoplasma of both AM homozygous and heterozygous chickens. Some muscle fibers of the AM homozygous chicken contained many granules in the whole fiber. Scale bar = 120 f.J. m.

- 8-

were carried out measuring concentrations of creatine kinase and pyruvate

kinase using CK-L kit (Serotec, Sapporo, Japan) and PK test-UV kit

(Dainippon Sumitomo Pharma, Osaka, Japan).

Polymorphism searching. Based on the Gallus gallus data of Map Viewer

Database at NCBI (National Center for Biotechnology Information;

http://www.ncbi.nlm.nih.gov/), new polymorphic markers were established in

two ways, micro satellite (MS) and SNPs markers for expressed genes.

The MS region between IMPAl and CBFA2Tl were searched using

chicken genome database. Primers for MS markers were designed to amplify

using OLIGO 4.0 program (Molecular Biology Insights, Cascade, CO, USA).

The polymorphisms detected between the parents were applied to

genotyping for the resource family.

Sequencing for LOC420205, LOC420206, CGI-77 and FLJ20530

using parents' DNA samples was performed with GENE Mate Gelpure DNA

purification Kit (Isc BIO EXPRESS, Kaysville, UT, USA), BigDye®

Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA,

USA), and ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems). The

primers used in this procedure were as follows:

5'-GCTAGGTCCATTGCTTTGCTCAGGTG-3' (LOC420205-F)

5'-GGAACCAACAATCTTAAACAAACGTC-3' (LOC420205-R)

5'-ATGTGTAGGGAAAAGTGAAAAGCAGC-3' (LOC420206-F)

5'-AGTGAGTGTGAGTGATAGGTAGAAAG-3' (LOC420206-R)

5'-GAATTTTGAGCTTGAAGGACGGGAAC-3' (CGI -77-F)

- 9-

5'-AGATGCCTTGCTCCTGTTAAATTTTC-3' (CGI -77-R)

5'-GAGTGTGTTGCCTTCCTGTTAAACTG-3' (FLJ20530- F)

5'-CCCAGAGATCTTTAGCTGTCCTTCTG-3' (FLJ20530-F).

For LOC420205 and LOC420206, long and accurate PCR was applied using

the kit of TaKaRa LA Taq with GC buffer (Takara, Tokyo, Japan). The

condition of long and accurate polymerase chain reaction (PCR) was

following: 14 cycles at 94°C for 20 sec, 68°C for 10 min and 16 cycles at 94 °c

for 20 sec, 68°C for 10 min (+ 15 sec/cycle). For others, PCR was done for 30

cycles at 94°C for 30 sec, 60°C temperatures for 30 sec, 72°C for 1 min

with TaKaRa Ex Taq® Hot Start Version (Takara). The sequences were

analyzed by Chromas 1.45 in Griffith University (http://www.tec

hnelysium.com.au/chromas.htmD, BLAST search in NCBI GenBank

Database, and CLUSTALW of DDBJ homology search system

(http://www.ddbj.nig.ac.jp/search/clustalw-j.htmD. For substitution or

insertion-deletion GndeD events, new primers detecting the polymorphisms

were designed and applied to genotyping for the resource family.

Genotyping. The PCR was done for 30 cycles at 94°C for 30 sec, annealing

temperatures for 30 sec, 72°C for 1 min using TaKaRa Ex Taq® Hot Start

Version (Takara) and TaKaRa LA Taq® with GC buffer (Takara). The primer

sequences of informative gene markers and their annealing temperatures

were shown in Table 1 and 2. PCR products were subjected in electrophoresis

in either an ethidium bromide-added 1 % agarose gel or a 5 %

polyacrylamide gel. For the latter cases, SILVER SEQUENCETM DNA

- 10-

straining reagents (Promega, Madison, WI, USA) was used for DNA to be

visualized.

With the genotypes obtained, haplotypes were constructed manually,

by minimizing the number of recombinants and assuming no mutation of

marker alleles. The candidate region was defined on the basis of observed

ancestral recombination events.

·11·

Results & Discussion

The AMlocus has been mapped to chicken chromosome 2q by previous study

using resource family with 110 backcross offspring (Yoshizawa et ai., 2004).

The result indicated the candidate region located between IMPAl and

CBFA2Tl genes within 3.6 Mbp range on GGA2q. It was difficult to identify

the responsible gene using this family because of the limited number of

offspring. Therefore, we established new chicken muscular dystrophy

resource family with 487 F2 offspring in current study.

At the first step, total of 77 MS markers were developed usmg

information of chicken genome sequences and tested their polymorphisms on

the parents of new resource family. Twenty-five MS markers of them were

polymorphic between the parents and 14 markers were possible to use for

haplotype analysis. In addition, polymorphism searches for two functional

genes, CGI-77 and FLJ20530, were performed to add genetic markers in the

region where MS markers were absent. By sequencing analyses, two indel

polymorphisms were observed in intron regions of both two genes and

utilized as genetic markers. Using these 16 informative markers (Table I-I),

haplotype analysis was carried out for 240 F2 individuals. As a result, the

region between KCAM-006 and KCAM-010 (approximately 1.8 Mbp) was

suggested as AM candidate region and included 21 functional genes.

At second step, further analysis was carried out to reduce the

- 12-

"""" CI:l

Table 1-1 Sixteen informative primer sets used in first step

Markert

KCAM-001 (ADL0114) KCAM-002 (GCTOOO2) KCAM-003 KCAM-004 KCAM-005 KCAM-006 KCAM-007 KCAM-008 KCAM-009 KCAM-010 (CALB1) KCAM-011 KCAM-012 (CG/-77) KCAM-013 (LOC42836!1) KCAM-014 KCAM-015 (MCW0314) KCAM-016 (Ei..J2@0)

Sequence (5'-3') Annealing Forward primer Reverse primer temperature(0C) GGCTCATAACTACCTTTTTT GCTCTACATTCCTTCAGTCA 52 GCAACAGTTAAGGGAAAGG ACAAAGTGGTGAAGCACG 52 GTTGT AACTTTCAGCTCCTCAATGTC TTGTATGAAGAGTAAATCCTGCTATG 60 AA TTGA TTTGGAAGAGCCTGTCTATC AAAGCAGACTGGACAGTTGA TAACAC 65 GTTTGCTTGCTTGTTTTTACTGACCC GTGCTGTGAAATACTATGTCCATACC 59 CTGTTTGTGTATATCCTCTAGGTCTG TCACTGTGGTATGGATTATGTCTATC 57 GGAGTTCAGAATCTACATGTTGCGAG ACAGAACCAGGACAACAGACTT AAGC 66 CGCAGATATAGGTTGGATGGAGAATG AAATGTTCCAGTGTCTCATCATCTCC 68 GCATAATCATTCAGTAGAGGTAAGTC ATTGTAATATAGTCTCCTGATCTGTG 60 GGAACAAGCTCTTTCTTCTTCCCG TCATGGAGGTGCTGGTACAAAGAC 52 TCTTGCTCACAGGTGGGATATGTCTC CTCTTTACATAACTTCTGCTGCCATG 65 GAA TTTTGAGCTTGAAGGACGGGAAC AGATGCCTTGCTCCTGTT AAA TTTTC 61 CACTGAATGTATCTTGCTCTGTCCAG AGCACATGACATCCACCAACTAACAG 66 AA TACAGCACCAACCTTAGACATTCC AAATCTGAATGAGGCACAAGTAGGAG 65 GCCAGGCTACACCTCTTCTAG GTTGGTATGATGGTATGATGC 52 GAGTGTGTTGCCTTCCTGTTAAACTG CCCAGAGATCTTTAGCTGTCCTTCTG 60

tName in parenthesis indicates gene or EST name in the database.

Table 1-2 Six informative primer sets used in second step

Markert Sequence (5'-3') Annealing

Forward primer Reverse primer temperatureeC) KCAM· 101 (L0C420205) AGTGTGGGTGGCTGTCTTTATGGGAG AGCTGACA TTTT AGGGGA TT ACTTTG 63 KCAM·102 (L0C420200) ATGTGTAGGGAAAAGTGAAAAGCAGC TTCCAAATCCTGTTTACTTCATGGTG 62 KCAM· 103 TGTCTAGCAACCCAAGTAATGAGTAGCT GTTCTTCACTGTGCGTCCCAGGTGTC 65 KCAM· 104 CTATGTT ATACCAAGAAATCAAGACC AGAATAAAGGTGTCAAAGAGGAATAC 60 KCAM· 105 (LOC420205) CACGAGGACCCAACTTCCAGAGAAAC CCTGGTGGACGGCTCTGAGTGATGGC 64 KCAM-106 TCAGTACCGTTCTAGTCAGGACAGTC CCCAGTTCACTACAACCTCTCTTCAA 65

tName in parenthesis indicates gene or EST name in the database.

candidate region, so that new genetic markers were developed in the region

between KCAM-006 and KCAM-OI0. Additional 18 MS markers and two

expressed genes of LOC420205 and LOC420206 were tested, resulting that

four MS markers and two indel markers were possible to use for further

haplotype analysis (Table 1-2).

The genotypes of 487 F2 individuals were analyzed using 11 markers

in the region between KCAM-006 and KCAM-OI0 (Fig. 1-2), and then their

haplotypes were constructed. Figure 1-8 reveals representative haplotypes

observed recombination events on candidate region. Owing to two

recombination events in individuals 1460 and 1647, the candidate region was

reduced to approximately 1 Mbp, between KCAM-I04 and KCAM-I06 (Fig.

I -2). On this region, all F2 individuals used in this study showed complete

correspondence between their phenotypes and haplotypes (Tablt: 1-8). Using

information of chicken whole genome sequences, we observed seven

functional genes on this region.

Aberrant glycosylation of a-dystroglycan in the muscular dystrophic

chicken was reported recently (Saito et ai., 2005). This phenomenon is also

detected in some kinds of human muscular dystrophies, including

Fukuyama-type congenital muscular dystrophy (Brockington et ai., 2001;

Muntoni et ai., 2002), muscle-eye-brain disease (Muntoni et ai., 2002;

Patnaik & Stanley, 2005; Yoshida et ai., 2001), Walker-Warburg syndrome

(Akasaka-Manya et ai., 2004; Muntoni et ai., 2002), congenital muscular

- 14-

p-ter q-ter .................................................... ~ ...... ~ ............ .

p-ter q.ter .................... ~ .. ~ .. ~ ................ ~ .......................... .

The AM candidate region (1.25Mbp)

O.1Mbp

Figure 1-2 The abnormal muscle (AM) candidate region and locations of genetic markers used in this study. The region between IMPA 1 and CBFA2T1 is the AM candidate region by Yoshizawa et a/. (2004). The upper figure shows the region of 16 informative gene markers on first step. The lower figure shows reduced AM candidate region by 11 informative gene markers on the second step. The genes underlined are the AM candidate genes.

10 number

Phenotype

KCAM -006 - - - - - - - - - - - - - - - - - -

KCAM -1 0 1 - - - -- - - - - - - - - - - - - -

KCAM -1 02 - - - - - - - - - - -- - - - - --

KCAM -1 03 - - - - - - - - - - - - - - - - - - -

KCAM -1 04 - - - - - - - - - - -- - - - - - - -

parents

AM N

A B KCAM -1 05 - - - - - - - - - - -- - - - - - --

C D

KCAM-007 -------------------

KCAM -008 - - - - - - - - - - -- - - - - - - -

KCAM -009 - - - - - - - - - - - - - - - - - --

KCAM -1 06 - - -- - - ---- -- - - - - ---

KCAM -01 0 -- -- -- - - - - --- -- ----

1460

N

A

D

C

1647 1649 1816 1695

N N N x

C

C D C D C DAD

A - A -- A

Figure 1-3 The haplotype analysis showing the phenotype of abnormal muscle (AM) chickens that are AM: AM homozygous. N, normal homozygous; and X, heterozygous chickens. (A, 8) show the alleles assumed from a NH-413 male and (C, D) the alleles assumed from a GSP female.

- 15 -

1699

x

B

A D

Table 1-3 All F2 individuals'haplotypes on the region between KCAM-104 and KCAM-106

Haplotype

AlB AID CID

Number AM 97 o o

Phenotype x o

259 o

N o o

131 Phenotype of abnormal muscle (AM) chickens; AM, AM homozygous chicken; N, normal homozygous chicken; X, heterozygous chicken. A and B show the alleles from a NH-413 male and C and 0 the alleles from a GSP female.

dystrophy Ie and its allelic limb-girdle muscular dystrophy 21 (Balci et ai.,

2005; Muntoni et ai., 2002), congenital muscular dystrophy ID (Matsumoto

et ai., 2005) and hereditary inclusion body myopathy (Huizing et ai., 2004),

and now they are termed "a -dystroglycanopathy." The

a-dystroglycanopathies are assumed to have common pathological

mechanism that a mutant glycosyltransferase for each disease glycosylates

a -dystroglycan insufficiency, and this imperfect glycosylation disrupts the

connection between a-dystroglycan and its ligands, and triggers onset of the

disease.

This study indicated that seven expressed functional genes are now

strong candidates as a responsible gene of chicken muscular dystrophy.

Although a kind of glycosyltransferase gene had been expected as a

responsible gene for this disease according to a previous study (Saito et ai.,

2005), there are no known glycosyltransferases within reduced candidate

region. Of seven candidates, functions of the two genes, LOC420214 and

LOC428367, have not yet been understood well, but these are unlikely to be

. 16·

glycosyltransferases according to prevIOUS studies (Zhang et a1., 1997;

Tomsig & Creutz, 2002). Functions of LOC420211 and LOC420213 are

utterly unknown. ATP6VOD2is less likely to be the causative gene since the

expression of this gene is severely limited in kidney, osteoclast and lung, and

the expression in muscle was not observed (Smith et a1., 2002).

One of the most likely candidates is MMP16which belongs to Matrix

metalloproteinase (MMP) family. Lattanzi et a1. (2000) reported new model

of human muscular dystrophy that an abnormal MMP breaks a basal lamina

and triggers the disorder. It has been proposed that the processing against

fl'dystroglycan by MMP be disrupted and influence the interactions between

the extracellular matrix and the cytomembrane (Yamada et a1., 2001).

The WWPl is also one of the most likely candidates and belongs to a

member ofE3s (Wood et a1., 1998). Recent studies have reported that some of

ubiquitin ligases (E3) are associated with muscular dystrophies

(Pallares-Trujillo et a1., 1997; Acharyya et ai., 2005; Kudryashova et a1.,

2005). The members of E3s are divided into some classes structurally:

HECT-type E3s, RING-type E3s, PHD-type E3s, U-box-type E3s and others

(Pickarta & Eddins, 2004). The WWPl is classified into HECT-type E3s,

although E3s assumed to have a relationship with muscular dystrophies,

such as Murfl, Trim32 and Cbi-l, are all into RING-type E3s.

In this chapter, we could reduce the candidate regIOn to

- 17-

approximately 1 Mbp on GGA2q and indicate seven functional genes as the

most likely AM candidates. In order to identify a responsible gene of the

chicken muscular dystrophy out of seven candidates, further genetic and

biochemical research was required.

·18·

CHAPTER II

The ubiquitin ligase gene (WWP1) is responsible for

the chicken muscular dystrophy

Introduction

In chapter I, the AM candidate region was narrowed down to approximately

1 Mbp on chicken chromosome 2q. Seven functional genes, A TP6VOD2,

LOC420211, WWP1, LOC420213, LOC420214, LOC428367 and MMPl6, in

this region were the candidate genes for chicken muscular dystrophy

(Matsumoto et aI., 2007). None of the candidates have been determined to be

genes for other muscular dystrophies so far.

Aberrant glycosylation of a-dystroglycan in muscular dystrophic

chicken had been reported (Saito et aI., 2005), suggesting a kind of

glycosyltransferase gene might be a responsible gene for this disease. But,

quite intriguingly, there are no known glycosyltransferases within reduced

candidate region. The functions of four genes among the candidates are not

fully understood, which still leaves the possibility that they belong to some

forms of glycosyltransferases or that they interact with certain

glycosyltransferase for a-dystroglycan. At the same time, it occurred that

aberrant glycosylation of a-dystroglycan in the disease is just a secondary

effect of the pathological change.

- 19·

Accumulating data proposed that MMP16 or WWPl be the most

likely responsible gene for chicken muscular dystrophy, since similar

proteins as them have been reported as the causative of muscular

dystrophies (Lattanzi et a1., 2000; Kudryashova et a1., 2005). However, the

data directly proving one of them is the responsible for chicken muscular

dystrophy is lacking. This chapter attempted to identify the responsible gene

and mutation by sequence comparison and expression analysis in normal

and dystrophic chickens. The mutation was identified in WWP1, detected

only in dystrophic chickens within several tetrapods, suggesting WWP 1 is

the responsible for chicken muscular dystrophy.

- 20-

Materials & Methods

Genetic resource. For sequencing and expression analyses, NH-413 and OPN

strains were tested as dystrophic chickens (Kondo et a1., 1982), and White

Leghorn-F (WL-F) and GSP strains were as normal chickens.

Genomic DNA samples were obtained from total 111 individuals

consisting of 16 strains: 20 White Cornishes, 19 White Plymouth Rocks, 20

broilers (White Cornish x White Plymouth Rock), 20 White Leghorns, and 20

Brown Leghorns, maintained at the Tokushima Forest and Forestry

Research Institute, Japan, an Onagadori, an Ukokkei, a White Leghorn, a

White Plymouth Rock, a Black Minorca, a Fayoumi, a Vietnam native, a

Laos native, an Echigo native, a Tosa native, and two Red Jungle fowls from

Laos and Indonesia. Muscle cDNA libraries of pigeon, alligator, lizard, turtle

and frog, and liver cDNA library of snake, were used to determine partial

sequences of WWPl gene in this study (Mannen et a1., 1996, 1997).

Sequencing for seven candidate genes. Pectoral muscle cDNAs were used as

template DNA to sequence for WWP1, LOC420213, LOC420214 and MMPl6,

while genomic DNA for A TP6VOD2, LOC420211 and LOC428367. In using

cDNA as template, primers were designed to amplify each coding region, and

in using genomic DNA, to amplify each exon. The primer sequences and the

PCR conditions were summarized in Table II-la. Sequencing was performed

with BigDye® Terminator v3.1 Cycle Sequencing Kit and ABI PRISM® 3100

Genetic Analyzer (Applied Biosystems, Foster City, CA). For polymerase

- 21-

chain reaction (PCR), TaKaRa Ex Taq® Hot Start Version or TaKaRa LA

Taq® with GC buffer (Takara, Tokyo, Japan) was used as polymerase.

Genotyping chickens for WfVPl. Genotyping of 111 individuals from 16

strains for WWPl was carried out by PCR-restriction fragment length

polymorphism (RFLP) method. Primer set was established to amplify the

region with a single nucleotide polymorphism (SNP) on WWPl. One of them

was mismatched primer and designed so that the chicken with wild-type

WWPl yielded three DNA fragments and the one with mutated WWPl

yielded two through digestion by a MboI restricted enzyme (Fermentas

International Inc., Ontario, Canada). The primer sequences and the PCR

condition applied were shown in Table II -lb.

WWPl homology search among species_ To obtain WWPl partial sequences

of pigeon, snake, alligator, lizard, turtle and frog, degenerate primers were

designed based on those of chicken (NM_OOI012554), human (NM_007013),

mouse (NM_177327) and rat (NM_OOI024757) published in NCB!. To

amplify each WWPl of snake, alligator and pigeon, WWPld-Fl and

WWPld-R were used as primers, and WWPld-F2 and WWPld-R were used

for other species. The primer sequences and the PCR condition were shown

in Table II-Ie. The amplified bands corresponding to WWPl cDNAs were

extracted from agarose gel and purified with Ultra-Clean™ 15 DNA

Purification Kit (MO BIO Laboratories Inc., Carlsbad, CA). The purified

cDNA fragments were ligated into pGEM-T vectors (Promega Corporation,

- 22-

Madison, wI) and transformed into Escherichia coli JM109 competent cells.

To confirm the sequence integrity, eight independent clones were sequenced.

Expression analysis. For Northern blot analysis, pectorals mRNAs of a

NH -413 and a WL-F strain female were used. 2 pg of mRNAs were resolved

by 1.2 % agarose gel electrophoresis in the presence of formaldehyde and

blotted on to Hybond-N+ membrane (GE Healthcare Bio-Sciences AB,

Uppsala, Sweden). The mRNAs were visualized using digoxigenin (DIG)

reagents (Roche Diagnostics, Basel, Switzerland). The DIG-labeled DNA

probes were prepared by PCR with DIG-dUTP using pectoral cDNA. The

primers used in this procedure were shown in Table II old.

For genes whose expression was not detected by Northern blotting,

reverse transcription (RT)-PCR method was applied with same condition in

Table H-ld.

- 23-

Table 11-1 Sequences of primers and peR conditions for sequencing, genotyping and expression analysis

Name Primer1) Sequence (5'-3')

(a) Primers used for sequencing to produce template DNA ATP6VOD2 ATP6VOD2s-F1 TCTAAAACTATGTGAGCCTGGAGTAG

ATP6VOD2s-R1 CCAAATCACAGTCTACACAATCCTGC

ATP6VOD2s-F2 GACACGTTATAATGGTGCAATAGTGG

ATP6VOD2s-R2 CCAGACCCTATACACAGTAAAGAGTC

ATP6VOD2s-F3 GAGATGGTGATAGTGAGTGAAGGTAC

ATP6VOD2s-R3 TAGAAGTTGTTAATAAATGTTGCCAG

ATP6VOD2s-F4 GCTGCTGCACTGATTGATTCCCTTTG

ATP6VOD2s-R4 TCCAGACTTGCCATCAGCCAGGTGAC

ATP6VOD2s-F5 ATTATGCAGTAGAAACTCAATGGAGC ATP6VOD2s-R5 AAAATGGTAAGGAGCAATAGTCTGAG

ATP6VOD2s-F6 AAGTACGTGTGATTATTGATCCTTAC ATP6VOD2s-R6 ATAGCATTTAACACAGTAAGTGGAAC

A TP6VO D2s-F7 GAAGTTCAGTGCTCTCTATCCAAAGG ATP6VOD2s-R7 TTGGTAAGAGACTACAGCAGCATTAC

ATP6VOD2s-F8 AGTTTCCTAAGTACAGTTGTGATTGC ATP6VOD2s-R8 CATTTAACTTCAGCAACAGGTCACAG

LOC420211 LOC420211 s-F CTGAAGGAGTCCACACGCCCAAGTCA LOC420211 s-R CGAGCAACAGAACTAGCAGACATTCC

WWP1 VVVVP1s-F1 AGGCTCCACATGGGCAGAACTTTGTC

VVVVP1s-R1 TCAAATAGGCAGTACATAGGGTTCAG

VVVVP1s-F2 ACTTGCTCATTTCCGTTACTTGTGTC

VVVVP1s-R2 TTGAAGATTACCTAACATCCTCGTGG

LOC420213 LOC420213s-F CTCGCTCGCACCTTCTCCTCCCCTGG

LOC420213s-R TTCATTTTCCTATGCTGCTTACATCT

LOC420214 LOC420214s-F ATGGCAGCACAGTGTGTGACTAAGGT

LOC420214s-R ATCCCCGCTCAAGAAAGTAACTGATC

LOC428367 LOC428367s-F1 GGGAAGTGAAGGCAAGAGCACCAGGC

LOC428367 s-R1 GAGGAGATTTAGATTAGATGTTAGCA

LOC428367s-F2 CTGCTACAGTATTCCCAGTGAGAGAT

LOC428367s-R2 GATGAGATATAAATGTGGTACAAGTA

- 24-

PCR condition 2)

normal PCR (EX-Taq): 58 <>C, 1 min, 30cycles

normal PCR (EX-Taq): 58 OC, 1 min, 30cycles


normal PCR (EX-Taq): 64°C, 1 min, 30cycles





SH PCR (LA-Taq ): 68 °c, 3min, 27cycles

normal PCR (EX-Taq): 62 OC, 2min, 35cycles

normal PCR (EX-Taq): 65 OC, 2min, 35cycles

SH PCR (EX-Taq): 68 OC, 1 mi n, 40cycles

SH PCR (EX-Taq): 68°C, 2min, 32cycles

normal PCR (EX-Taq): 64°C, 1 min, 30cycles


(continued on next page)

Name Primer1; Sequence (5'-43')

(a) Primers used for sequencing to produce template DNA LOC428367 LOC428367s-F3 ATCATTCTCAGCAATAACCATCTAGT

LOC428367s-R3 TTTCAGATAATCTTGGAGCACTCATA

LOC428367 s-F4 TGAAGAGATAATGGAAGCCAAGTTCT

LOC428367s-R4 TGAATACTGGGTAAATGTGGTTGCCT

LOC428367s-F5 TAATGCTTGACTTCTGCTTGTACTAT

LOC428367s-R5 ATGAGTAAATGTGATGTGGTAAGATA

LOC428367 s-F6 GAAGGTTCCCAAATACTCCATTAACA

LOC428367s-R6 GAAAACATATAATCTCACAATCTGTA

LOC428367s-F7 ATACTGTTTCTTCACTGGAGTAATGA

LOC428367s-R7 CATATGTACTTGAGCAGGTCAGTTGA

LOC428367 s-F8 TCACAGAGTAAATACAGGTGGAGAGC

LOC428367s-R8 CTGCCATCCTTCTAACAGTTCCCAT

LOC428367s-F9 GTCAGTGAGGATATTCTGTTCAATGT

LOC428367s-R9 AGATAAATACTCAGTTTTCTGGTTAA

LOC428367s-F10 TACAGACTGTTTCTTACACAACCAGC

LOC428367s-R10 TCACTGATTACTTAACTGCTTCTGAA

LOC428367s-F11 TCAGTGGAGTATCAACTTCAGAGATT

LOC428367s-R11 AAGCACCTATATGTACTAGCAGACAA

LOC428367s-F12 GTTGTCAGGTGTTCATCCACACATTC

LOC428367s-R12 CTATTTCTCTATCCATCATCCTCTAC

LOC428367 s-F13 TGCTTCTTGGTTGATCTATGCTCTCC

LOC428367s-R13 GGTTTTATTCTGTAGCCGTCTCTCCT

MMP16 MMP16s-F TGAACCTGCGTTACGGGCTCCTCAC

MMP16s-R CCTTGTTTGTTGGAAAATGGCTGTC

(b) Primers used for genotyping

W\'\IP1 VWVP1m-F AGAGAAAATGAGCTATGCAGTATTAC

VWVP1 m-R-mis TATATAAAATTTACCGAATAGAGGGAA

(c) Primers used for identifying WWP1 partial sequence of other species

W\'\IP1 VWVP1 d-F1 AACAACVTGGCAGCGRCCWACHA TGG

WNP1d-R

VWVP1d-F2

WNP1d-R

GTAAVCCTTGRGTTC KWGG RTCTTC

AAYTTTGARCAGTGGCARTCTCAGC

GTAAVCCTTGRGTTCKWGGRTCTTC

- 25-

PCR condition 2)


SH PCR (EX-Taq): 68°C, 2min, 32cycles

normal PCR (EX-Taq): 55OC, 1 min, 30cycles




normal PCR (EX-Taq): 55OC, 1min,30cycles





SH PCR (LA-Taq): 68 OC, 2.5min, 35cycles


DG-PCR (EX-Taq)

DG-PCR (EX-Taq)

(continued on next page)

Name Primerl ) Sequence (5'~3')

(d) Primers used for expression ama/ysis ATP6VOD23) ATP6VOD2p-F ATATTGTATGGATTGCCGAATGC

ATP6VOD2p-R CGAAATGGTCACTGTGGGGAACA

LOC420211 3) LOC420211 p-F AAAGGACTGAATACCATCTGATT

LOC420211 p-R TACAACTGCTAAATGCTCCCTCA

WW'P1 WNP1p-F TCCCTCATAAATGTTGAAAGCAGACA

WNP1p-R GTAATAACCCAAGGTAATATGTAAAC

LOC420213 LOC420213p-F AGTGGCAGAAGTTATAGAGCAAGCAG

LOC420213p-R CGTGTATGTCTTCTCCTGTTTGTCCA

LOC420214 LOC420214p-F TGGTATGAGGTTGATCGCACAGAAAG

LOC420214p-R GGTGCTACAGTTTTGACTTCCTTCGT

LOC4283674) LOC428367p-F TGTCTTCGTCTTCTCCAGCTTAATTG

LOC428367p-R GGCTAATAGGCTGATCTCCCCAAATA

MMP163) MMP16p-F CATAATCTTTCCCAAGTTGTACCAAG

MMP16p-R GCAATATCAGAGTCATCATTTTAGTT

PCR condition 2)

normal-PCR (EX-Taq) : 60 OC, 0.5min, 25, 30, 35cycles


normal-PCR (EX-Taq) : 55°C, 0.5min, 35cycles

normal-PCR (EX-Taq) : 60 OC, 0.5min, 35cycles

normal-PCR (EX-Taq) : 60 OC, 0.5min, 35cycles


lEach columns upper primers are forward primers and lower ones reverse primers.

2Each column shows PCR method (polymerase): annealing temperature, extension time, cyclic number applied by each primer sets. Normal PCR was performed as the following: cyclic number at 94 OC for 30 s, annealing temperature for 30 s, 72 OC for extension time, SH PCR: cyclic number at 98 OC for 10 s, 68 OC for extension time, and DG PCR: 3 cycles at 95 OC for 30 s, 50 OC for 30 s, 72 OC for 30 sand 32 cycles at 95 OC for 30 s, 50 OC for 30 s, 72 OC for 30 s.

3To analyze their expressions, RT-PCR was performed.

4Expression ofthis gene was not confirmed.

·26·

Results

Sequence comparison of seven candidate genes in normal and dystrophic

chickens revealed three synonymous mutations and one missense mutation

specific to the phenotype of muscular dystrophy. Two of the synonymous

mutations were detected in LOC420214 (C660T and CI009A), and the other

in LOC428367 (C954T). The WWPl missense mutation (G1321A) caused

amino acid substitution from arginine to glutamine, leading to the molecular

alteration from a basic side chain to an uncharged polar side chain. We

focused further studies on this missense mutation since it was predicted to

influence the function of the WWPI protein.

The domain structure of human WWPI was determined previously

(Flasza et ai., 2002). It consists of three types of unique domains: one C2

domain, four WW domains and one HECT domain. The amino acid

sequences of human and chicken WWPI share 83% identity, suggesting that

the deduced structure of chicken WWPI was quite similar to that of human's.

According to NCBI database, chicken WWPI possesses one C2 domain, three

WW domains and one HECT domain. The detected mutation lay between

WW domains 1 and 2 (Fig. II-I).

In order to exclude the possibility of strain specificity of WWPl

mutation, this SNP was genotyped in OPN strain to determine if the WWPl

gene has this mutation in any strain with a different genetic background.

- 27·

R441Q

1 y

ww Figure 11-1 The domain structure of chicken WWP1 and the site of missense mutation. Chicken VVWP1 protein is composed of 922 amino acids. Here are shown VVWP1 functional domains: C2 domain, three VVW domains and HECT domain. C in HECT domain indicates an active cysteine residue. The arrow indicates the site of missense mutation detected in this study. VVW domains bind proline-rich region.

PCR-RFLP analysis indicated that OPN dystrophic chickens have the

identical mutation in the WWPl gene. Genotyping was also applied to 111

normal birds from 16 strains with genetically varied backgrounds. None of

the normal birds exhibited this type of substitution. The region of WWPl

including the SNP specific to chicken muscular dystrophy was highly

conserved among normal birds. Additional homology research among

tetrapods was conducted to estimate amino acid conservation in this region.

The sequences of chicken, human, chimpanzee (XP _519843), monkey

(XP _001083173), mouse, rat, dog (XP _535119) and cattle (NP _001032540)

were available in the NCBI database. To obtain further information from

other tetrapod species, we sequenced partial WWPl gene of pigeon, snake,

alligator, lizard, turtle and frog (DDBJ Accession Nos. AB385863 to

AB385868). The amino acid sequence around the region was highly

conserved among these tetrapods (Fig. II-2), suggesting that the region was

- 28-

Chicken Nl)

Chicken A HlJI1anl)

ChiQlanzeel)

Monkeyl)

Mousel)

Rat!)

Dog!)

Cattle!)

Pigeon

Snake

All igator

Lizard

Turtle

frog

* RNOLOGAMQQFNQRYLYSASMLSAENDPLGPLPP6WERRVDSNDRVYFVNHNTKTTQWED

· ............ O ............................................. .

...................... A ..... Y ........ K .... T ................ .

...................... A ..... Y ........ K .... T ................ .

...................... A ..... Y ........ K .... T ................ .

...................... A ..... Y ........ K .... T ................ .

...................... A ..... Y ........ K .... T ................ .

...................... A ..... Y ........ K .... T ................ .

AD .................... A ..... Y ........ K .... T ................ .

· ..................... T .................................... .

...................... T .................................... .

· ..................... T ................... T ................ .

Figure 11-2 Homology study ofWWP1 among tetrapods. Chicken Nand A show amino acid sequences of normal and dystrophic chickens, respectively. R441Q WWP1 mutation is specific to chicken muscular dystrophy, and the amino acid sequence on this region is highly conserved among tetrapods. Dots indicate the same amino acids with above sequences. Asterisk indicates the residue that the substitution was detected in dystrophic chicken. (1) Amino acid sequence published in NCBI.

important for the function ofWWPl.

Expressions of candidate genes were analyzed by Northern blotting.

As depicted in Fig. n·3a, the expression of WWP1, LOC420213 and

LOC420214 in the pectoral muscle of both genotypes derived from both

·29·

a WWPc At N LOC4202t3 LOC420214 CAN CAN

GAPDH CAN

b LOC420211

25 30 35(CXC1es)

A NAN A N

-- .... -MM~

A N 30

A N 35(cyc1e5)

A N

... --

G~

A N 30

A N

Figure 11-3 Expression analysis of candidate genes. Extreme alteration of expression level was not observed in any genes. (a) Northern blotting analysis toward ATP6VOD2, LOC420211, WWP1, LOC420213, LOC420214, MMP16 using chicken pectoral mRNA (2 fJ. g). In any of these genes, there was no difference in size of mRNA between affected and normal birds. The C indicates loaded PCR product which has the same sequence as probe, the A indicates mRNA of dystrophic chickens and the N indicates mRNA of normal chickens, respectively. The arrows indicate the band detected. (b) RT-PCR analysis to'v'Vard ATP6VOD2, LOC420211, MMP16 using chicken pectoral cDNA.

normal and dystrophic chicken could be detected by Northern blotting. There

was no difference in size of mRNA between affected and normal birds in any

of these genes. LOC420213was highly expressed in affected individuals. Two

bands were detected in WWPl and LOC420214. WWPl was expressed

slightly higher in normal than in affected chickens, while a slightly higher

level of expression was exhibited for LOC420214 from affected chickens.

The expression of other genes (ATP6VOD2, MMPl6, LOC420211 and

LOC42836'/) was not detected by Northern blotting. RT-peR analysis in

dystrophic chickens (Fig. II-3b) revealed higher expression of A TP6 VOD2 and

- 30-

35(cycle5)

A N

MMP16 than in normal birds. The pectoral muscles from both genotypes

expressed LOC420211 to identical level. The expression of LOC428367 was

not confirmed in either genotype.

·31 -

Discussion

In chapter I, we narrowed down the AM candidate region to approximately 1

Mbp on GGA2q. Seven functional genes, A TP6VOD2, LOC420211, WWP1,

LOC420213, LOC420214, LOC428367 and MMPl6, in this region were the

candidate genes for chicken muscular dystrophy (Matsumoto et ai., 2007),

but none of them have been determined to be genes for other muscular

dystrophies so far. In this study, sequence comparison of normal and

dystrophic chickens was conducted to detect a mutation responsible for the

disease.

We detected a mutation site specific for the AM phenotype in

G 1321A of the WWPl gene that caused amino acid replacement, from

arginine with a basic side chain (a basic amino acid) to glutamine with an

uncharged polar side chain (a neutral amino acid), which can affect the

function of the WWPI protein. WWPl mutated in the coding region of the

protein, providing the most likely candidate responsible for causing this

disease. This type of mutation was only observed in dystrophic chickens. No

mutation was detected in any normal chickens analyzed. Furthermore, the

amino acid sequence on this region is highly conserved among tetrapods (Fig.

II·2). The region is thus probably critical for the function of WWPl.

The expression patterns of the candidate genes were analyzed in Fig.

II-3. WWP1, LOC420213, A TP6VOD2 and MMP16 exhibited some difference

- 32-

III expreSSlOn level between normal and dystrophic individuals, none of

which were drastic alterations. No difference in mRNA size was observed in

any gene. Since no extreme alteration of expression level and abnormal

splicing were observed, the onset of chicken muscular dystrophy might not

be attributed to aberrant expression of these genes.

The WW domain containing E3 ubiquitin protein ligase 1 (WWPl),

the most likely AM candidate gene found by this study, is classified as a

ubiquitin ligase (E3) that plays an important role in ubiquitin-proteasome

pathway (UPP). Ubiquitination, addition of ubiquitin (Ub) chains to a target

protein, is one of the most common forms of posttranslational modification,

and it controls important aspects of cell functions (Passmore et a1., 2004;

Pickart et a1., 2004). In UPP, at least three types of enzymes are required,

namely, El Ub-activating enzyme, E2 Ub-conjugating enzyme and E3

(Hershko et a1., 1983). E3 recognizes and catalyzes Ub conjugation to specific

protein substrates (Liu, 2004). E3s are structurally divided into several

classes: HECT-type E3s, RING-type E3s and others (Pickarta & Eddins,

2004).

Accumulating data indicate that some E3s are related to muscular

dystrophies (Acharyya et a1., 2005; Kudryashova et a1., 2005; Trujillo et a1.,

1997). E3s that are assumed to be related to muscular dystrophies, such as

Trim32 (Jackson et a1., 2000), are all classified as RING-type E3s, while

WWPI is classified as a HECT-type E3. RING-type E3s facilitate

·33·

ubiquitination indirectly, while HECT-type E3s transfer Db directly to

substrates bound to a non-catalytic domain of themselves (Jackson et a1.,

2000). Though they are structurally and mechanically distinct, their basic

role in DPP is common. Therefore, it is possible for some abnormal

HECT-type E3s to cause muscular dystrophies. Actually, it has been reported

that E6AP, another HECT-type E3, contributes to a severe neurological

disorder, Angelman syndrome (Kishino et a1., 1997; Cooper et a1., 2004)

which exhibits muscular hypotonia (Gillessen-Kaesbach et a1., 1999).

WWPl is expressed ubiquitously but more strongly in liver, bone

marrow, testis, and muscle (Flasza et a1., 2002). Flasza et a1. (2002) also

mentioned at least six splice variants of WWPl. Two of the six products are

commonly observed among multiple tissues, and their expression levels are

higher than the others. The bands detected by Northern blotting (Fig. II-3a)

may correspond to these two major products, but little is known about the

function of these transcript variants.

E6AP is known as the protein responsible for Angelman syndrome

(Kishino et a1., 1997). Cooper et al. reported that two mutations lying in the

non-catalytic amino-terminal portion of E6AP cause Angelman syndrome

(Cooper et a1., 2004): one of them affects E6AP enzymatic activity, and the

other may disturb substrate binding, subcellular localization or protein

stability. The mutation of WWPI detected in this study is located between

WW domains 1 and 2 (Fig. II-I). Though the mutation is outside all domains,

- 34-

it is predicted that the region near the mutation is functionally important

because of its high homology (Fig. 1I-2). The R441Q mutation probably

influences the WWP1 function like Angelman syndrome causative mutations,

so that it triggers the onset. Since the mutation lies between two domains

both of which recognize target proteins (Sudol et a1., 1995), it could alter the

conformation of WWP1 (Verdecia et a1., 2003), the physical relationship

among domains and the preference for substrates.

Aberrant regulation of membrane protein may lead to the onset of

chicken muscular dystrophy. The HECT-type E3s with WW domains

generally regulate membrane proteins (Chen & Matesic, 2007). Though

much remains unclear about WWP1's substrates, it has been demonstrated

that WWP1 could interact with B-dystroglycan, an important muscle protein

consisting of membrane (Pirozzi et a1., 1997). Abnormal glycosylation of

a-dystroglycan in chicken muscular dystrophy was also reported (Saito et a1.,

2005). Some E3s are known to recognize sugar chain (Lederkremer &

Glickman, 2005; Yoshida et a1., 2002, 2003), leading to the hypothesis that

WWP1 might be able to recognize the sugar chain of a-dystroglycan and

regulate the glycosylated molecules, and that insufficiently glycosylated

a-dystroglycan, which originally requires degradation, accumulates and

causes the disease because altered WWP1 can not recognize and degrade it.

However, all known E3s to recognize sugar chain are divided into F-box-type

E3s, therefore it is doubtful that WWP1 should degrade insufficiently

glycosylated a-dystroglycan.

- 35-

The study in this chapter identified R441Q WWPI mutation as being

specific to chicken muscular dystrophy. This is the most likely candidate

mutation responsible for chicken muscular dystrophy because the region

nearby is highly conserved among species and no drastic alteration of

expression patterns of the candidate genes was observed. In order to clarify

the mechanism by which mutated WWPI triggers the onset of chicken

muscular dystrophy, further biochemical research is required .

. 36·

CHAPTER III

Expression pattern of WWP1

in muscular dystrophic and normal chickens

Introduction

The WW domain containing E3 ubiquitin protein ligase 1 (WWP1) IS

classified into a ubiquitin ligase (E3) which plays an important role III

ubiquitin-proteasome pathway (UPp) to degrade unneeded or damaged

proteins (Scheffner & Staub, 2007). E3 recognizes and catalyzes ubiquitin

(Ub) conjugation to specific protein substrates (Liu, 2004). Comparative

genome analysis reveals few genes encoding E 1, tens of E2 encoding genes

and hundreds of E3 encoding genes (Semple et ai., 2003).

The WWPl gene is classified into a HECT (homologous to the E6-AP

~arboxyl terminus)-type E3 which possesses one C2 domain, multiple WW

domains and one HECT domain (Pirozzi et ai., 1997; Flasza et ai., 2002). The

C2 domain binds to the cellular membranes in a Ca2+-dependent manner

(Plant et ai., 1997) and mediates interactions with other proteins (Plant et

ai., 2000; von Poser et ai., 2000; Augustine, 2001). The WW domain has two

conserved tryptophan residues and binds proline-rich region (Sudol et ai.,

1985). HECT domain, similar to E2s structurally, has a cysteine residue as

an active center that transfers the activated Ub from E2 onto first itself, and

then onto its substrates (Jackson et ai., 2000).

- 37-

The WWPl gene was identified as a candidate responsible for the

chicken muscular dystrophy by the linkage analysis in chapter I (Matsumoto

et al., 2007) and the sequence comparison between normal and dystrophic

chickens in chapter II (Matsumoto et al., 2008). The R441Q missense

mutation was found in the WWPl gene to cause the phenotype of muscular

dystrophy.

The WWPls of human (Flasza et al., 2002; Komuro et al., 2004),

mouse (Dallas et al., 2006) and C. elegans (Huang et al., 2000) were

intensively studied and known that the WWP1· gene is expressed

ubiquitously, but strongly in liver, bone marrow, testis and skeletal muscles

(Flasza et al., 2002; Komuro et al., 2004). In chicken, however, the WWPl

expression has not been studied. The expression analysis of WWP 1 gene is

important since it was reported that altered expression of known responsible

gene could lead dystrophic phenotype (Smythe & Rando, 2006).

In this chapter, the mRNA expression of WWP 1 in various skeletal

muscles and other tissues of normal and dystrophic chickens was analyzed

by Northern blotting and reverse transcription (RT)-peR analysis to know

the differences in the general expression pattern between these chickens.

- 38-

Materials & Methods

Chickens. A two-month-old dystrophic chicken (New Hampshire: NH-413)

and an age-matched normal chicken (White Leghorn: WL- F) were used in

this study. The New Hampshire (NH-413) strain is a homozygous dystrophic

line introduced from University of California, Davis to Japan in 1976 (Kondo

et ai., 1982). The disease in this strain is transmitted co-dominantly by a

single gene, but the phenotype is modified by other background genes

(Kikuchi et ai., 1981, 1987; Wilson et al., 1979). The White Leghorn (WL-F)

strain was established in 1970s, and maintained as closed colony in the

Nippon Institute of Biological Science in Yamanashi, Japan. This study was

carried out according to the guidelines of Animal Experimentation of Kobe

University.

Expression analysis_ For Northern blotting, mRNAs were isolated from M

pectoralis superficialis (PS), M tensor fascia lata (TFL), M biceps femoris

(BF), M triceps surae (TS), M peroneus longus (PL), heart (H), brain (B),

liver (L), kidney (K) and whole embryo (E) with PolyATtract mRNA Isolation

kit (Promega, Madison, WI, USA). The 2 llg ofmRNAs, which were measured

with NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies,

Wilmington, DE, USA), were resolved by 1.2 % agarose gel electrophoresis in

the presence of formaldehyde and blotted on to Hybon:d-N+ membrane (GE

Healthcare Bio-Sciences AB, Uppsala, Sweden). The mRNAs were visualized

using digoxigenin (DIG) reagents, and kits for non-radioactive nucleic acid

- 39-

labeling and detection system (Roche Diagnostics, Basel, Switzerland)

according to the procedure specified by the manufacturer excepting that the

washing was done with 4 x SCC 0.1 % SDS at room temperature for 10 min,

4 x SCC 0.1 % SDS at 40°C for 8 min and then 2 x SCC 0.1 % SDS at 40°C

for 8 min twice. The DIG-labeled DNA probes were prepared by PCR using

DIG-dUTP using pectorals cDNA sample of a WL-F strain female as a

template. The prImers applied In this procedure were

5'-TCCCTCATAAATGTTGAAAGCAGACA-3' (WWP1p-F), 5'-GTAATAACCC

AAGGTAATATGTAAAC-3' (WWP1p-R) (NM_001012554), 5'-CCGTGTGCCA

ACCCCCAATGTCTCTG-3' (GAPDHp-F) and 5'-CAGTTTCTATCAGCCTCT

CCCACCTC-3' (GAPDHp-R) (NM_204305). The PCR was done for 35 cycles

at 94°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec (WWP1) and for 35 cycles

at 94°C for 30 sec, 63°C for 30 sec, 72°C for 30 sec (GAPDJ1) using TaKaRa

Ex Taq® Hot Start Version (Takara Bio Inc., Tokyo, Japan). Quantitative

analysis was performed with Scion Image (Scion Corporation, Frederick, MD,

USA).

In order to analyze mRNA expression of WWPl gene in the PS, M

anterior latissimus dorsi (ALD) and H, RT-PCR method was applied. The

concentration of cDNA derived from these muscles was calculated by

NanoDrop ND-1000 (NanoDrop Technologies) and commeasurable cDNAs

were used as template. The prImers applied were

5'-ATTAGGAAGAGCCACTGTAGACT-3' (WWP1r-F) and 5'-TCTGTTGATT

GAGGTTCTGCTGT-3' (WWP1r-R) (NM_001012554). The PCR was done for

35 and 40 cycles at 94°C for 30 sec, 56°C for 30 sec, 72°C for 30 sec using

- 40-

TaKaRa Ex Taq® Hot Start Version (Takara Bio Inc.).

Histology. The PS, ALD and H were snap-frozen in liquid nitrogen-cooled

isopentane and sectioned in a cryostat (Leica Microsystems Japan, Tokyo,

Japan). The histopathology was made by hematoxylin-eosin staining (HE)

method (Kikuchi et a1., 1981).

- 41-


The mRNA expression of WWPl gene was detected by Northern blotting in

various muscles and other tissues of normal and muscular dystrophic

chickens (Fig. III-I). Two bands were detected in all tissues examined, and

revealed almost equally expression level in any muscles and tissues observed.

A Northern blot analysis of WWPl expression in human tissues also

exhibited two bands (Mosser et aI., 1998), and aRT-PCR analysis showed

that human WWPl gene had at least six mRNA isoforms synthesized

through the alternative splicing, two of which were strongly expressed and

commonly observed in various tissues (Flasza et aI., 2002). The mRNA

doublet bands of chicken WWPl by Northern blot analysis might be

equivalent to those two bands of human tissues, while a single band was

observed by RT-PCR analysis in chicken (Fig. III-2a), suggesting that the

amplified region does not include alternative spliced site. Flasza et a1. (2002)

also mentioned that the relative ratio of these isoforms from human WWPl

varied in a tissue-specific manner, but the doublet bands of chicken WWPl

were expressed almost equally in all tissues examined.

In the PS, BF, TS, PL, Band K, WWPl gene was strongly expressed

in normal than in dystrophic chickens (Fig. III-I). The GAPDH gene was

used as an internal control of WWPl expression analysis. In TFL, Land E,

similar WWPl expression level was observed between two phenotypes (Fig.

III-I). The WWPl gene expression in M pectoralis superficialis (PS) of

- 42-

PS TFL BF TS PL H B L K E A NAN AN A NAN ANA NAN A NAN

:= IN\IVP1

~GAPDH

0.6 1.1 0.6 0.6 0.3 0.8 0.1 1.1 0.6 1.2 0.9 0.7 0.8 1.3 1.2 1.1 1.0 1.2 0.7 0.8

Figure 111-1 Expression of chicken WWP1 in various tissues. A WWP1 cDNA probe was used to detect v\-wP1 mRNA transcripts by Northern blotting using blots containing 2 f.J. g of mRNAs from chicken muscles or various other tissues. M. pectoralis superficialis (PS), M. tensor fascia lata (TFL) , M. biceps femoris (BF) , M. triceps surae (TS), M. peroneus longus (PL), heart (H), brain (B), liver (L), kidney (K) and embryo (E) were analyzed. A doublet band is detected at variable levels in all tissues. "A" indicates mRNAs from affected, dystrophic chickens. "N" indicates mRNAs from normal chickens. The numbers below the GAPDH bands represent the relative ratios of IrVvVP1IGAPDH.

dystrophic chicken was less than that of normal chicken (Fig. III-I). The PS

of chicken is a fast twitch muscle composed of two types of fast twitch fibers

(aW and BW). TFL, BF, TS and PL muscles from wing and leg are mixed

muscles co-existing fast twitch (aW and BW) with slow twitch fibers (BR) in a

mosaic pattern (Ashmore & Doerr, 1971a), except that the ALD and M

adductor magnus are composed of slow tonic fibers (ST) innervated multiply

(Ashmore et al. , 1978; Kikuchi et al., 1986). In chicken muscular dystrophy,

fast twitch fibers are initially and most severely affected, while slow twitch

and slow tonic muscles persist relatively harmless throughout the life span

(Ashmore & Doerr, 1971b; Barnard et al. , 1982) .

- 43-

a dystrophic PS ALD H

normal PS ALD H

35 cycles

40 cycles

a; E o c:

PS ALO

Figure 111-2 RT -peR detection of WWP1 gene and histological analysis for three representative muscle types. M. pectoralis superficia/is (PS), M. anterior latissimus dorsi (ALD) and heart (H) expressed WWP11ess in muscular dystrophic chicken, but only dystrophic PS was severely harmed. (a) Expression of WWP1 in PS, ALD and H was analyzed by RT-PCR method. PCR was performed for 35 or 40 cycles. (b) The PS, ALD and H of dystrophic (NH-413) and normal (WL-F) chickens were analyzed with HE staining. Vacuoles (arroVv'S) and fatty infiltration (asterisk) are observed in PS of dystrophic chickens. It is also remarkable that, in dystrophic PS, many muscle fibers have many nuclei in cytoplasm and vary widely in size. These pathological features are not observed in ALD and H of dystrophic chicken. Scale bar = 120 t1 m.

The WWP 1 expression in dystrophic BF, TS and PL showed a similar

downward trend as observed in dystrophic PS (Fig. III-I). These data

indicate that there might not be a causal relationship between the alteration

of WWPl expression level and the severity of muscular dystrophy, since not

only affected muscles but unaffected ones exhibited the same pattern.

Moreover, the alteration of WWPl expression level was observed in other

unaffected tissues, such as Band K (Fig. III-I), which reinforces our

hypothesis that the alteration of WWPl expression levels does not link

directly to the dystrophic phenotype.

To assess the genetic influence of mutant WWPl upon chicken

- 44-

H

muscular dystrophy, we examined WWPl gene expression and histological

changes in three distinct muscle types, PS as a fast twitch type, ALD as a

slow tonic type, and H as a different type of muscle. RT·PCR was applied to

this study since ALD was not enough quantity of mRNA for Northern

blotting. RT·PCR analysis indicated that WWPl gene was expressed in slow

tonicALD, not only in PS and H of both phenotypes (Fig. III-2a).

Figure III-2b shows HE stained sections of PS, ALD and H from

normal and dystrophic chicken. The dystrophic PS was severely affected,

while ALD and heart of dystrophic chicken remained relatively intact as

described in a previous study (Kikuchi et a1., 1981). The pathological findings

in dystrophic PS were characterized by the degenerating fibers with many

vacuoles in cytoplasm, the fatty infiltration into connective tissue, and the

proliferation of nuclei within muscle fibers with large variation in sizes.

However, no such lesions were observed in ALD and H from age-matched

dystrophic chickens (Fig. lII-2b).

The WWPl was expressed even in unaffected muscles and the

downward alteration of WWPl expression was observed commonly in almost

all dystrophic muscles examined (Figs. III-1, 2). The observation suggests

that the alteration of WWPl might not be the cause of the pathological

change in chicken muscular dystrophy. Hence, the mutation identified in

chapter II (Matsumoto et a1., 2008) might playa crucial role in leading the

onset of chicken muscular dystrophy. The detected mutation lay between

- 45-

WW domains, highly conserved region among tetrapods (Matsumoto et a1.,

2008), which has been predicted as substrate binding region (Pirozzi et a1.,

1997; Flasza et a1., 2002). This suggests that mutated WWP1 could not

recognize its substrates.

Many known substrates of the HECT-type E3s including WWP1 are

membrane proteins which aberrations contribute to oncogenesis (Chen &

Matesic, 2007). Though most of known WWP1's substrates have also been

reported as oncogenic proteins, not as muscle-related ones, one of known

proteins interacting with WWP1 is Notch (Flasza et a1., 2006). Kitamura et

a1. (2007) have reported that the ablation of Notch results in abnormality of

muscle differentiation, suggesting that WWP1 play a role in muscle

differentiation process. Moreover, B-dystroglycan, an important muscle

protein consisting of membrane, could undergo proteasomal regulation via

ubiquitinaion by WWP1 (Pirozzi et a1., 1997). The function of WWP1 in

muscle mechanism needs elucidating.

In this chapter, we analyzed the mRNA expression of WWPl in

various skeletal muscles and other tissues of normal and dystrophic chickens.

The results suggest that WWPl expression level lowered in dystrophic

phenotype is not directly related to the cause of disease in chicken muscular

dystrophy, whereas mutated WWPl does not function properly to cause the

onset of chicken muscular dystrophy.

- 46-

CHAPTER IV

Mutated WWP1 induces an aberrant expression of

myosin heavy chain gene in C2C12 skeletal muscle cells

Introduction

The WW domain containing E3 ubiquitin protein ligase 1 (WWP1) IS

classified into a ubiquitin ligase (E3) which plays an important role m

ubiquitin ·proteasome pathway (UPp) to degrade unneeded or damaged

proteins (Scheffner & Staub, 2007). The WWP1 and similar E3 ligases play

important roles in cancer development, bone remodeling and central nervous

system regeneration (Chen & Matesic, 2007; Glimcher et a1., 2007;

Bernassola et a1., 2008; Qin et a1., 2008).

In the previous chapters, we identified WWPl gene as the candidate

gene responsible for the chicken muscular dystrophy, and the R441Q

missense mutation in the WWPl gene was found to be the cause of muscular

dystrophic phenotype (Matsumoto et a1., 2007, 2008). It is generally known

that myosin is the principal protein of the contractile apparatus in muscle,

and myosin diversity is primarily produced by the different expression of

multiple isoforms of myosin heavy chain (MyHC) subunits which undergo

transition during development in a variety of muscle systems (Schiaffino &

Reggiani, 1994). The switching of adult phenotype in fast muscle is inhibited

in chicken muscular dystrophy, resulting in the continued expression of slow

·47·

twitch MyHC isoform in adult fast muscles (Bandman, 1985; Bandman &

Bennett, 1988; Kaprielian et a1., 1991; Tidyman et a1., 1997).

The WWPl gene is expressed strongly in skeletal muscles (Flasza et

a1., 2002; Komuro et a1., 2004; Matsumoto et a1., 2009), but the relationship

between WWP1 and MyHC proteins has not been examined. To investigate

the effects of the overexpression and the expression of mutated WWP 1 gene

on the MyHC genes expressions, we transfected the wild and mutated types

of WWPl gene into C2C12 cells which are myoblasts derived from mice

skeletal muscle. The expression of four muscle-differentiation markers,

Myogenin (Myog) , myogenic differentiation 1 (MyoD) and MyHCs, was

analyzed by real-time PCR. In addition, expression of caveolin-3 (cav-3J and

muscle specific ring finger protein 1 (MuRF1) was analyzed as muscular

dystrophic-phenotype-related genes.

- 48-

Materials & Methods

Cell culture. The C3H murine skeletal muscle cell line C2C12 (CRL-1722) was

commercially obtained from the American Type Culture Collection (ATCC) ,

VA, USA. Cells were cultured in the growth medium: Dulbecco's modified

Eagle's medium (DMEM) (Nissui, Tokyo, Japan) containing 0.2 % sodium

hydrogen carbonate (nakalaitesque, Kyoto, Japan), 0.008 % kanamycin

(Wako, Osaka, Japan) and L-glutamine (10 /lg/ml) (Nissui), supplemented

with 15 % fetal bovine serum (FBS) (Gibco, NY, USA). The cells were

incubated at 37 DC in humidified 95 % air and 5 % C02 atmosphere.

Differentiation of C2C12 cells was initiated by placing 80 % confluent cell

cultures in the differentiation medium: DMEM supplemented with 1 % FBS.

Isolation and mutagenesis ofmouse WWPl sequences. Mouse total RNA was

isolated from ICR strain liver using Sepasol RNAI (nakalaitesque). The

mouse was sacrificed according to the guideline of Animal Experimentation

of Kobe University. The cDNA was generated by reverse transcription using

oligo (dT) primer and SuperScript III Reverse Transcriptase (Invitrogen, CA,

USA). The mouse WWPl sequence was amplified from the cDNA using

primers 5'-ATCGTGTCTTATTCATCTTCGTATCCTCAG-3' (WWP1-full-F)

and 5'-GTGTGTATAAGCTGCTCATTCTGTA-3' (WWP1-full-R) (NM_177327).

The primers were designed to amplify all the CDS of WWPl gene (197-3115).

PfuUltra High-fidelity DNA Polymerase (Stratagene, CA, USA) was applied

as the DNA polymerase. The PCR was as follows: initial denaturation and

. 49'

enzyme activation for 120 sec at 94 ac, followed by 30 cycles of 30 sec

denaturation at 94 ac, 30 sec annealing at 58 ac, and 180 sec elongation at 68

ac. The amplified sequence was ligated into a pGEM®-T Easy Vector

(Promega, WI, USA), and the sequence was verified.

The mutation homologous to the responsible mutation for chicken

muscular dystrophy (R436Q) was introduced by site-directed mutagenesis

using the QuikChange site-directed mutagenesis kit (Stratagene) and the

following primer (upper strand represented with the mutated nucleotide

underlined): M 5'-TTCAACCAACAATACCTCTATTCGG-3'. PfuUltra

High-fidelity DNA Polymerase (Stratagene) was applied and the PCR

condition was as follows: initial denaturation and enzyme activation for 120

sec at 94 ac, followed by 30 cycles of 30 sec denaturation at 94 ac, 30 sec

annealing at 55 ac, and 180 sec elongation at 68 ac. The mutation was

verified by sequencing.

Two types of full WWPl sequence (WT: wild type and R436Q) were

obtained by EcoRI (Takara, Tokyo, Japan) digestion and inserted into the

unique EcoRI site between the CAG promoter and the 3'-flanking sequence

of the rabbit a-globin gene of the pCAGGS expression vector.

Exogenous WJ.VPl expreSSIon In C2C12 cells. Plasmid pCAGGS·empty,

pCAGGS-WT and pCAGGS· R436Q were diluted in Opti· MEM® I Reduced

Serum Medium (Gibco), Plus reagent (Invitrogen) and Lipofectamine™ LTX

(Invitrogen). Cells were incubated in the differentiation medium with each

DNA-Lipofectamine™ LTX complex. The day 24 hours after the transfection

·50·

was counted as day o.

The vector capacity was assessed by RT-PCR method using GAPDH

as internal standard. TaKaRa Ex Taq® Hot Start Version (Takara, Tokyo,

Japan) was used as the DNA polymerase. The primer sequences were

5'-CATAACACCAGAACAACAACC-3' (WWP1rt-F), 5'-AACATGGAAGCCGA

ATAGAGG-3' (WWP1rt-R) (NM_177327), 5'-ATGACAATGAATACGGCT

ACAGCAA-3' (GAPDHrt-F) and 5'-GCAGCGAACTTTATTGATGGTATT-3'

(GAPDHrt-R) (NM_008084). The PCR was as follows: initial denaturation

and enzyme activation for 120 sec at 94 DC, followed by 35 cycles of 30 sec

denaturation at 94 DC, 30 sec annealing at 60 DC, and 30 sec elongation at 72

DC. PCR products were subjected in electrophoresis in an ethidium

bromide-added 1 % agarose gel. The band density was calculated with Scion

Image (Scion Corporation, MD, USA).

, Quantitive RT-PCR. Total RNA was isolated from cells and cDNA was

generated as mentioned above. The cDNA was used as a template in the

subsequent PCR analysis. Gene expression levels were detected by real-time

PCR with SYBR® Premix Ex TaqTM II (Perfect Real Time) (Takara) for seven

genes; WWP1, Myogenin, MyoD, MyHC la, MyHC lIb, caveolin-3 and

MuRFl. In addition, GAPDH was used as internal standard. All of real-time

PCR primer paIrs, designed by Primer Bank

(http://pga.mgh.harvard.edu/primerbank/), are shown in Table IV-I. The

PCR was achieved with initial denaturation and enzyme activation for 20 sec

at 95 DC, followed by 40 cycles of 20 sec denaturation at 95 DC, 8 sec annealing

- 51-

Table IV-1 Primers used for real-time PCR

Name GenBank accession # Seguence(5'-3'} PrimerBank ID # Aml2licon size (bp) WWP1 NM_177327 CCTTGGAGTTCCGAGTTTGGA 2889347a2 175

AGTTCCCCAGTTTGCACTATTC Myog NM_031189 GGTGTGTAAGAGGAAGTCTGTG 13654247a2 184

TAGGCGCTCAATGTACTGGAT MyoD NM_010866 CCACTCCGGGACATAGACTTG 6996932a1 109

AAAAGCGCAGGTCTGGTGAG MyHC la AF009960 CCTGGAGCCCCTAGATGAGG 3378046a1 106

GGGGTTCATTGAGATCACCAC MyHC lib AJ278733 AAACCACCTCAGAGTTGTGGA 9581821a2 172

GTTCCGAAGGTTCCTGATTGC cav-3 NM_007617 GGATCTGGAAGCTCGGATCAT 6680852a1 120

TCCGCAATCACGTCTTCAAAAT MuRF1 AK052911 CCAGGCTGCGAATCCCTAC 26343085a2 295

GCTGAGGTTCTGTCTGCGG GAPDH NM_008084 AGGTCGGTGTGAACGGATTTG 6679937a1 123

TGTAGACCATGTAGTTGAGGTCA

at 60°C, and 30 sec elongation at 72 °C. The last cycle was performed at 95

°C for 10 sec, 60°C for 30 sec and 72 °C for 60 sec. Reactions were run on a

TaKaRa PCR Thermal Cycler Dice® Real Time System (Takara) using cycling

parameters defined by the manufacturer.

Each assay included a standard curve for each gene with five serial

dilution points of a standard cDNA and a no-template control. Expression

levels for each gene were calculated as relative expression levels toward

GAPDH mRNA expression. For each gene, three individual samples were

prepared and reactions were repeated two times for each sample. Statistical

analysis was carried out using Statcel2 (oms-publishing, Tokyo, Japan).

Statistical analysis. Values in this paper represent means +/- S.D.

Differences between two groups were examined for statistical significance

- 52-

using Student's t test. A P value less than 0.05 denoted the presence of a

statistically significant difference.

- 53 .


We transfected the WWPl genes into C2C12 cells to analyze the expressions

of muscle-differentiation markers. To evaluate the vector capacity, the

WWPl expression of each group (pCAGGS-empty-: control, pCAGGS-WT-:

WT and pCAGGS-R436Q-transfected cells: R436Q) was analyzed by RT-PCR

using cells at day 0 (Fig. IV-Ia). Although WT and R436Q groups expressed

3.83 and 5.47 fold higher than control level, clear difference was not observed

in the myotube morphology and the proliferation rate of myoblasts (data not

shown).

FigUrE; IV-Ib shows the diachronic analysis of WWPl expression in

control cells during myogenic differentiation. Since in vitro myogenesis is

completed within a week (Sultan et a1., 2006), WWPl expressions analyzed

by real-time PCR were made at day 0,2,4,6 and 8. The WWPl gene seems

to be expressed stably in each time point, though upward trend was observed

in day 2 and 4.

Subsequently, we analyzed the expreSSIons of the

muscle-differentiation markers by real-time PCR to access the influence of

WWPl overexpression and WWPl with R436Q mutation on the gene

expressions of Myog, MyoD, MyHC Ia and MyHC lIb using C2C12 cells at day

6 (Fig. IV-2). The former two were analyzed as the markers for early stages

(Langlands et a1., 1997) and the latter two for later stages of muscle

- 54-

a

b G) I: 2.5 G) til ....

~ 2.0

'5 1.5 I:

'1 1.0 l5. )( G) 0.5 ~

I 0 2 4 6 8

Figure IV-1 Exogenous and endogenous expression of WWP1 gene in C2C12 cells at day O. (a) The vector capacity was assessed by RT-PCR method using GAPDH as internal standard. Each expression of WWP1 gene in WWP1-transfected cells 0NT and R436Q) was greater than empty vectortransfected cells (control). (b) Endogenous expression of the WWP1 gene in differentiating control cells. The WWP1 expression levels analyzed by realtime PCR were not significantly changed through day 0 to 8. Y-axis indicates relative expression level of WWP1 gene to the GAPDH gene expression. Bars indicate standard deviations.

differentiation (Silberstein et ai., 1986).

The expressions of Myogin WT and R436Q groups were 1.04 fold (±

0.02) higher and 0.64 fold (± 0.26) lower compared to the control group. The

R436Q group was significantly lower than other groups. These results

indicate that R436Q mutation in WWPl gene affects early stages of muscle

differentiation through the reduction of the Myog expression. There was no

clear difference in MyoD gene expression among three groups.

It was, however, interesting to indicate that the WWP 1 gene

overexpression influenced upon MyHC genes expression. The MyRes are

(day)

Q) c Q) Q) c 1.4 Ol 1.4 Q)

.i; Ol

i 1 a a 0 1.2 0

~1 :t 1.0 .... 0 ....

0 c 0.8 0 0 c .~ 0 0 0.6 .~ ~

~ 0 Q. ~ 0.4

~ Q) Q) 0 .~ 0.2

Q)

.~ iii Ri ! Gi control wr R436Q control WT R436Q ...

Q) Q)

c c ~ 4.0

Q)

b Ol

..!!! ~ 5.0

l> 3.5 l>

~ 3.0 ~ 4 .0

'0 2.5 -0 3.0 c 2.0 c 0 a 0

.~ 1.5

.~ 2.0

Q) Q) ... ... ~ 1.0 Q. a x Q) Q) 1.0 Q) 0.5 Q) b

.~ .~ ..... iii III Gi control wr R4360 Gi control wr R4360 ... ...

Figure IV-2 Muscle-differentiation markers in WWP1-transfected (WT and R436Q) and empty vector-transfected (control) C2C12 cells. Expression levels of muscle-differentiation markers (myogen in , MyoD, MyHC fa and MyHC lib) in differentiating day 6 C2C12 cells were analyzed by real-time PCR. The expression of Myogenin in R436Q group was significantly lO'Ner than other groups, while no significant difference was seen in the expression level of MyoD gene. HO'Never, the expression of fast MyHC fa in WWP1-transfected cells was significantly higher than in control cells, while that of slO'N MyHC lib was significantly lO'Nered in WWP1-transfected cells compared to control cells. The R436Q-transfected cells retained the high expression of both fast MyHC fa and slO'N MyHC lib isoforms compared to.control cells. Y-axis indicates relative expression level of each gene to the GAPDH gene expression. Bars indicate standard deviations. Different letters indicate significantly differences (p < 0.05) among column graphs.

among muscle proteins increasing during the course of myogenesls

(Silberstein et a1., 1986), and are divided into two classes, type I composed of

. 56'

fast twitch fibers and type II of slow twitch fibers (Larsson & Salviati, 1989).

The MyHC la expression levels in WT and R436Q groups increased 2.81 (±

0.95) and 2.18 (± 0.24) fold compared to control group, respectively.

The expression level of MyHC la gene in WT group was significantly

higher (2.81 fold ± 0.95) compared to control group, but MyHC lIb gene

expression was significantly lower (0.26 fold ± 0.04) in WT group, indicating

that WWP1 promotes to transform C2C12 cells into fast twitch characteristics.

However, R436Q-transfected cells persisted in the high expression of both

fast MyHC la and slow MyHC lIb isoforms compared to control cells,

suggesting retainment in slow and fast twitch isoforms characteristic.

Additionally, we analyzed the expressions of cav-3 and MuRFl genes

by real-time PCR as muscular dystrophic phenotype-associated genes (Fig.

IV-:3). The expression of cav-3 in both WWP1-transfected cells was

significantly higher (2.56 fold ± 0.16 in WT and 1.87 ± 0.43 in R436Q cells)

than in control cells. The caveolin-3 expression is known to increase by

pathological change of dystrophin-deficient type muscular dystrophy (Vaghy

et a1., 1998; Repetto et a1., 1999), suggesting WWP1-transfected cells might

be affected. However, since the amount of caveolin-3 protein is regulated by

posttranscriptional manner (Galbiati et a1., 2000a), further analysis is

required. Caveolin-3 is also known as the marker for later stages of muscle

differentiation (Schubert et a1., 2007), which suggests that WWP1 promotes

C2C12 cells to differentiate, while the differentiation is suppressed in R436Q

- 57-

Q) c Q) Q) c CI 8, "? b 3.0 .S ..-. b

j & 2.5

~ B '0 2.0 '0 c c 1 0 1.5 .2 a .~ a m ~ 1 ~ ~ ~ Q) Q) Q) 0.5 Q) .~ .~ ni ni li li control OE R436Q .... control OE R436Q ....

Figure IV-3 Dystrophic phenotype-associated genes in WWP1-transfected (WT and R436Q) and empty vector-transfected (control) C2C12 cells. Expression levels of muscular dystrophic phenotype-associated genes (caveolin-3 and MuRF1) in differentiating day 6 C2C12 cells v.tere analyzed by real-time PCR. The expression of caveolin-3 in both WWP1-transfected cells 0NT and R436Q) was significantly higher than in control cells. The expression of MuRF1 in R436Q group was significantly higher than other groups. Y-axis indicates relative expression level of each gene to the GAPDH gene expression. Bars indicate standard deviations. Different letters indicate significantly differences (p < 0.05) among column graphs.

due to the mutation in WWPl gene.

The expressions of the MuRFl in WT and R436Q groups were 1.53

fold (± 0.50) higher and 2.32 fold (± 0.28) higher compared to the control

group. The R436Q group was significantly higher than the other groups.

MuRFl belongs to E3s which degrade MyRCs and known as one of muscle

atrophy markers (Clarke et al., 2007). The data indicate that R436Q

mutation in WWPl gene causes the transfected cells muscle atrophy, though

clear difference was not observed in the myotube morphology and the

proliferation rate (data not shown) .

. 58'

One of known proteins interacting with WWPI is Notch (Flasza et

a1., 2006), whose ablation in skeletal muscle results in increased formation of

fast twitch fibers and altered fiber type distribution at the expense of slow

twitch fibers (Kitamura et a1., 2007). WWPI might control skeletal muscle

fiber types via the regulation of MyHC genes expression by Notch signaling.

The R436Q-transfected cell group showed the highest MyHC lIb expression

(2.80 ± 1.92 fold than control level) among three groups, suggesting that

C2C12 cells persisted in the slow twitch character. Taken together, the R436Q

mutation in WWPl gene seems to inhibit the normal fiber type

differentiation and to induce atrophy. The results suggest that WWPI plays

an important role in myoblasts' differentiating process.

- 59-

CHAPTER V

Overexpression of caveolin-3 protein is limited

in damaged muscle in chicken muscular dystrophy

Introduction

Caveolae are vesicular invaginations of plasma membrane which range

50-100 nm in size (Anderson, 1993). The inner surface of caveolae is coated

with scaffolding protein formed by members of the caveolin family

(caveolin-1, -2 and -3) (Thomas & Smart, 2008). Caveolin-1 and -2 are

coexpressed and form heterooligomers in nonmuscle cells (Scherer et ai.,

1997), whereas caveolin-3 is muscle specific and forms homooligomers in

muscle cells (Song et ai., 1996). Though caveolae are known to regulate

endocytosis, exocytosis, cholesterol homeostasis and signal transduction

(Thomas & Smart, 2008), the role of caveolae and cave olin proteins of the

etiology are not fully understood.

Caveolin-3 co-localizes with elements of the dystrophin complex

(Rahkila et ai., 2001) and is proposed to function with the dystrophin

complex at the cell surface (Song et ai., 1996; Crosbie et ai., 1998). A WW-like

domain in caveolin-3 can recognize and bind a PPXY motif of B-dystroglycan

(Sotgia et ai., 2000). While caveolin-3 is predominantly associated with the

sarcolemma of mature muscle, caveolin-3 in differentiating muscle cells

associates with the developing transverse tubule (T-tubule) system (Parton

- 60-

et a1., 1997; Ralston & Ploug, 1999). Caveolin-3-deficiency leads T-tubule

abnormality, suggesting that caveolin-3 may be involved in the organization

of the T-tubules but is not essential for their formation (Galbiati et a1., 2001).

Accumulating data suggest that caveolin-3 reqUIres an accurate

regulation. Caveolin-3 is known as the responsible gene for limb-girdle

muscular dystrophy type lC (LGMD-IC) and other muscle diseases (Dowling

et a1., 2008). LGMD-IC mutations in caveolin-3 gene result in a loss of

~90-95 % of caveolin-3 protein expression (Galbiati et a1., 2000a). Caveolin-3

deficient transgenic mice also exhibit muscle degeneration (Hagiwara et a1.,

2000). On the other hand, Duchenne muscular dystrophy (DMD) patients

show increase of caveolae and caveolin-3 overexpression (Repetto et a1.,

1999). The concordant phenomenon is observed in dystrophin-deficient mdx

mice (Vaghy et a1., 1998). Conversely, transgenic overexpression of caveolin-3

induces a DMD-like phenotype (Galbiati et a1., 2000b).

In chapter I-III, we identified WWPl (WW domain containing E3

ubiquitin protein ligase 1) gene as the responsible gene for chicken muscular

dystrophy (Matsumoto et a1., 2007, 2008, 2009). The WWPI is classified into

a ubiquitin ligase (E3) to degrade unneeded or damaged proteins (Chen &

Matesic, 2007), suggesting that muscular dystrophic phenotype might be

triggered by aberrant regulation of some WWPl's substrates. An electron

microscopic analysis revealed increase of caveolae in dystrophic chickens

(Costello & Shafiq, 1979). Although increased expression of caveolin-3

- 61-

induces a muscular dystrophic phenotype (Galbiati et ai., 2000b), its

underlying mechanism to cause the onset remains elucidated. Therefore,

molecular biological analysis of caveolae in chickens with muscular

dystrophy has been required.

In this chapter, we analyzed the expression pattern of caveolin-3 and

other caveolae-related proteins in dystrophic chickens. Our result revealed

the correlation between caveolin-3 expression and the severity of dystrophic

phenotype, and gave new insights into the effect of caveolin-3 overexpression

in muscle and the potential role of caveolae in causative role of muscular

dystrophies.

·62·

Materials & Methods

Chickens & Muscles. '!\vo month -old (2M) dystrophic chickens (New

Hampshire, line 413: NH-413) and age-matched normal chickens (White

Leghorn-F: WL- F) were analyzed. For diachronic study, embryonic 7 day-old

(E7), 14 day-old (E14), 1 day-old (lD), 1 week-old (lW) and 2-week old (2W)

chickens were added to them. In each group, more than three birds were

utilized for this study according to the guideline of Animal Experimentation

of Kobe University. The NH-413 strain was a homozygous dystrophic line

introduced from University of California Davis in 1976 (Kondo et a1., 1982).

The disease in this strain is transmitted co-dominantly by a single gene, but

the phenotype is modified by other backcross genes (Wilson et a1., 1979;

Kikuchi et a1., 1981, 1987). The WL-F strain was established around 1971,

and maintained in closed colonies in the Nippon Institute of Biological

Science in Yamanashi, Japan.

M pectoralis superficialis (PS), M anterior latissimus dorsi (ALD)

M anterior tibialis (AT), M soleus (S) and heart (H) were obtained from

chickens and immediately stored in liquid nitrogen. The PS is a fast twitch

muscle composed of two types of fast twitch fibers (aW and 8W) (Ashmore &

Doerr, 1971a). The ALD is composed of slow tonic fibers (ST) innervated

multiply (Ashmore et a1., 1978; Kikuchi et a1., 1986). The AT and S are mixed

muscles of both fibers (Maier, 1993; Matsuoka & Inoue, 2008). In chicken

muscular dystrophy, fast twitch fibers are initially and most severely

affected, while slow twitch and slow tonic muscle fibers persist relatively

- 63-

harmless throughout the life span (Ashmore & Doerr, 1971b; Barnard et a1.,

1982).

Histology. The PS, ALD and H were snap-frozen in cooled isopentane and

sectioned in a cryostat (Leica Microsystems Japan, Tokyo, Japan). For

pathological observation and evaluation, the sections were stained with

hematoxylin and eosin (HE) (Kikuchi et al., 1981).

Antibodies. Antibodies used for the primary incubation were: anti-B-Actin

(ab3280, Abcam, pIc., Cambridge, UK), anti-Akt (#9272, Cell Signaling

Technology, Beverly, MA), anti-phosphorylated Akt (#9271, Cell Signaling

Technology), anti-BinI (B9428, Sigma-Aldrich, St. Louis, MO), anti-caveolin

3 (ab30750, Abcam, pIc.), and anti-PTRF (611258, BD Biosciences, San Jose,

CA). Horseradish peroxidase-conjugated goat anti-rabbit (SAB-300,

Stressgen Bioreagents Corporation, Ann Arbor, MI) and anti -mouse

(HAF007, R&D Systems, Inc., Minneapolis, MN) immunoglobulin G were

applied in the secondary incubation.

Western blotting. Each available muscle sample was lysed in 125 mM

Tris-HCI, pH 6.8, containing 4 % SDS and 20 % glycerol at boiling

temperature. After the addition of B-mercaptoethanol (final concentration:

10 %), commeasurable extracts were separated on a 7.5 % or 10 %

SDS-polyacrylamide gel and electro-blotted onto a PVDF membrane

Immobilon-P (Millipore Inc., Bedford, MA). The blot was blocked in

. 64·

Tris-buffered saline with 0.1 % Tween 20 (TBST) containing 5 % skimmed

milk. All membranes were incubated with primary antibodies at 4 DC

overnight. After labeling, the membranes were washed three times in TBST

for 5 min each and then incubated with appropriate species-specific

horseradish peroxidase-conjugated secondary antibodies for enhanced

chemiluminescence (ECL Western blotting detection kit, Amersham

Pharmacia Biotech, Buckinghamshire, UK). B-actin was used as an internal

control of expression analysis for each protein. Quantitative analysis was

performed with Scion Image (Scion Corporation, Frederick, MD). For each

protein, three individual samples were examined.

RT-PCR. In order to analyze mRNA expression of caveolin-3 gene in the PS,

RT-PCR method was applied. The concentration of cDNA derived from the

PS muscles was calculated by NanoDrop ND-1000 spectrophotometer

(NanoDrop Technologies, Wilmington, DE, USA) and commeasurable cDNAs

were used as template. B-actin was used as an internal control of caveolin-3

expreSSIOn analysis. The prImers applied were 5'-GAGGATCATC

ATCAAGGACCA-3' (caveolin-3r-F), 5'-GATGCGGCTGACACACTGGAT-3'

(caveolin-3r-R) (NM_204370) , 5'-GCGTTACTCCCACAGCCAGCCAT-3'

(B-actinr-F) and 5'-TACCACAGGACTCCATACCCAAG-3' (B-actinr-R)

(NM_205518). The PCR was done for 31, 33 and 35 cycles at 94°C for 30 sec,

60 °c for 30 sec, 72°C for 30 sec using TaKaRa Ex Taq® Hot Start Version

(Takara Bio Inc., Tokyo, Japan). Quantitative analysis was performed as

shown above. For each gene, three individual samples were examined.

- 65-

Statistical analysis. Values in this paper represent means +/- S.D.

Differences between two groups were examined for statistical significance

using Student's t test. A P value less than 0.05 denoted the presence of a

statistically significant difference.

·66·

Results

The expreSSIOn pattern of caveolin-3 protein was assessed by Western

blotting with a specific caveolin-3 antibody in three distinct types (PS, ALD

and H) and two mixed types (AT and S) of muscles from normal and

muscular dystrophic chickens (Fig. V-la). The PS of dystrophic chickens

shows higher caveolin-3 expression than those of age-matched control

chickens. Same tendency as PS was observed in AT. Caveolin-3 expression of

ALD, Sand H was undetectable level in both groups, even though higher

amount of protein extracts were blotted onto the same membrane.

Figure V-lb shows histopathological changes in PS, ALD and H of

normal and dystrophic chickens. The dystrophic PS showed various

pathological lesions such as degenerating fibers with many vacuoles in

cytoplasm, the fatty infiltration into connective tissue, and the nucleic

proliferation within muscle fibers with large variation in sizes. However, the

ALD and H from dystrophic chickens did not exhibit such pathological

alterations. The overexpression of caveolin-3 was obvious only in affected

muscle in dystrophic chickens, which suggested that there is a close

correlation between caveolin-3 overexpression and dystrophic phenotype.

The overexpression of caveolin-3 observed in dystrophic PS was

noted only at the protein level. Although the expression of caveolin-3 was

much higher (7.12 ± 3.31 fold) in dystrophic PS than in normal one at the

- 67-

a PS

PS A

ALD H b N A N A N PS ALD

.... ~

~ - I ~ I caveoIln-3 A

* ~ - -I /i-a~n N

- l~~ -AT S

N A N A N

I caveolin-3

T .. Figure V-1 Expression of caveolin-3 and histopathological observation in three representative and two mixed types of muscles. M. pectoralis superficia/is (PS) expressed higher amount of caveolin-3 protein in muscular dystrophy chicken (A), while the expression in M. anterior latissimus dorsi (ALD) and heart (H) was undetectable as in normal chicken (N). The expression in M. anterior tibialis (AT), one of mixed muscles, was similar as in PS, while that in M. soleus (S), the other one, as in ALD. (a) Expression of caveolin-3 in PS, ALD, H (upper panel), AT and S (lower panel) was analyzed by Western blotting. (b) The PS, ALD and H of dystrophic and normal chickens were analyzed with HE staining. Vacuoles (arrows) and fatty infiltration (asterisk) were noted in PS of dystrophic chickens. It was also remarkable that, in dystrophic PS, many muscle fibers have many nuclei in cytoplasm and vary widely in size. These pathological features are not observed in ALD and H of dystrophic chicken. Scale bar = 120 .Lt m.

protein level (Fig. V-2a, C), our semi-quantitive RT-PCR analysis indicated

that dystrophic PS did not show such higher caveolin-3 expression at the

mRNA level (1.09 ± 0.11 fold) (Fig. V2b, c). The difference of caveolin-3

expression between at protein level and at mRNA expression suggested that

the overexpression of caveolin-3 in dystrophic PS is induced in a

posttranslational manner.

- 68-

H

-

-

protein a A N bAN

mRNA A N A N

c

I I caveolin-3

C? c::

(fold) 12

2 ~ 10 > Q) cu~ o 0 -.- 8 0-£ c:: 0 6 0._ .- .s:::. UJc. UJ 0 CD... 4 0.1;; ~~ ~.5 2

:;:::. cu ~

o

/J -actin ,1,;', ",

.~.,~ ',:_., t-:-f3 -actin

31 33 35 cycles

mRNA

Figure V-2 Enhanced expression of caveolin-3 at protein level, but not at mRNA level. The caveolin-3 expression in M. pectoralis superficialis (PS) was assessed at protein level (a) and mRNA level (b) . Significantly higher expression of caveolin-3 protein was detected in dystrophic PS (7.12 + 3.31 fold) , On the other hand, its mRNA expression was similar level between affected (A) and normal (N) PS (1 .09 + 0.11 fold) . (c) Quantification of caveolin-3 protein and mRNA expression was performed with applying the 13 -actin expression as an internal control. Values are represented as fold changes of the A expressions relative to N levels. Y-axis indicates relative expression level of caveolin-3 to the 13 -actin expression. Bars indicate standard deviations, Asterisk means without a common superscript letter differ (p < 0.05).

The possibility remained that the increase of caveolin-3 protein

might be the secondary event, rather than the primary one, of the

pathological change of chicken muscular dystrophy. To examine this

- 69-

C? c

2 0 > c ~~ _.2 o.s:::. c 0 0.2 .- .s:::. 0a. o 0 ~ a-a.1i) ~~ CD c > .-

+=l «1 "i) a-

a

b (fold)

14

12

10

8

6

4

2 1 -

0

E7 N A

E 14 N A

x

x

x

caveolin-3

x

x

----... --~---------.--------- --------...:----------------.

E7 E 14 1 D 1W 2W 2M

Figure V-3 Diachronic study of caveolin-3 expression in dystrophic muscle. The expression of caveolin-3 protein in M. pectoralis superficialis (PS) was analyzed with embryonic 7 day-old (E7), 14 day-old (E14), 1 dayold (1 D), 1 week-old (1W), 2-week old (m) and 2-month old (2M) individuals. As early as 10 muscular dystrophic chickens expressed higher caveolin-3. (a) Expression of caveolin-3 in PS from dystrophic (A) and normal (N) chickens was analyzed by Western blotting. (b) Quantification of caveolin-3 expression was performed with applying the {3 -actin expression as an internal control. Values are represented as fold changes of the A expressions relative to N levels. Y-axis indicates relative expression level of caveolin-3 to the {3 -actin expression. Sequential line graph indicates average value of three individuals. Each X means actual measurement.

possibility, diachronic study with E7, E14, ID, lW, 2W and 2M chickens was

carried out (Fig. V-8a). Immunoblot analysis revealed that as early as 1

. 70·

day-old muscular dystrophic chickens expressed higher caveolin-3 protein

(Fig. V-iSh). The caveolin-3 expression levels in muscular dystrophic chickens

increased 1.09 (± 0.15) fold at E7, 1.04 (± 0.07) at E14, 4.33 (± 5.85) at ID,

1.57 (± 0.77) at lW, 7.51 (± 6.57) at 2W and 6.84 (± 3.18) at 2M compared to

control group, respectively.

Subsequently, we analyzed the expreSSIOn of other proteins

consisting caveolae such as BinI (bridging integrator 1) and PTRF

(polymerase I and transcript release factor) (Parton et ai., 2006; Thomas &

Smart, 2008). These two caveolae-related proteins showed a similar

expression pattern as in caveolin-3 (Fig. V~4a). Western blotting study

revealed increase of both proteins in fast twitch dystrophic PS muscles, but

not in slow twitch and tonic muscles. BinI of ALD and H from dystrophic and

normal chickens was undetectable level. Nor drastic difference of PTRF was

detected between dystrophic and control groups.

It was speculated that Akt (v-akt murine thymoma viral oncogene

homologs) signal is also influenced by the elevation of caveolin-3 expression

in dystrophic PS. The Akt signal was examined with the antibody detecting

phosphorylated Aktl (S473), Akt2 and Akt3 (the corresponding residues)

(Fig. V-4b). With like caveolin-3 and other caveolae-related proteins,

phosphorylated forms of Akt increased only in dystrophic PS, but not in ALD

and H and in muscles from normal chickens.

-71'

a PS A N

ALD A N

H A N

181n1

~======================~ IpTRF

~--~~==~============~

IJ -actin

b PS A N

ALD A N

H A N

~====================---======~I A~ 1p-AA1

~~==~~==============~ ..... S1_ .. +t_,,..~.., ... -~_-""_ I p-actin

Figure V-4 Enhanced expression of other caveolae-related proteins in dystrophic muscle. (a) The expression of BIN1 and PTRF in M. pectoralis superficialis (PS), M. anterior latissimus dorsi (ALD) and heart (H) was analyzed by Western blotting. The increase of both proteins was observed in dystrophic PS, not in the other types of muscles. BIN1 expression of ALD and H from dystrophic (Al and normal (N) chickens was not confirmed. In ALD and H, no drastic difference of PTRF was observed between dystrophic and control groups either. (b) The expression of Akt and its phospholilation in PS, ALD and H was analyzed by Western blotting . The phosphorylated forms of Akt were observed only in PS from muscular dystrophy chickens, though total Akt protein was detectable in all muscles examined.

·72·

Discussion

Marked elevation of caveolin-3 expression in dystrophic PS was confirmed by

Western blotting analysis with three distinct types of muscles (PS, ALD and

H) (Fig. V-1a). This change was undetectable in the other muscles from

dystrophic chickens. In addition, Western blotting analysis with two mixed

muscles (AT and S) revealed that dystrophic AT expressed higher caveolin-3

than normal counterparts' while caveolin-3 expression in S of both groups

was undetectable as in ALD. AT is a mixed muscle mainly composed of fast

twitch fibers (Maier, 1993) and S is one mainly composed of slow tonic fibers

(Matsuoka & Inoue, 2008), suggesting elevation of caveolin-3 expression

depends on muscle fiber types.

The difference was limited only in the affected muscle of dystrophic

chickens (Fig. V-1b), suggesting that there is a close relationship between the

expression of caveolin-3 and etiology of chicken muscular dystrophy. Since

increased number of caveolae in dystrophic chickens is notable before the

onset (Costello & Shafiq, 1979), the caveolin-3 protein should be expressed

primarily and intensively in this disease. Supporting this hypothesis, the

diachronic study of caveolin-3 expression revealed thatas early as 1 day-old

muscular dystrophic chickens expressed higher caveolin-3 protein (Fig. V-3b).

Since pathological changes in chicken muscular dystrophy can be observed

after 1 week from hatching (Nonaka, 1987b), elevation of caveolin-3 \

expression might play a leading role for the onset of chicken muscular

- 73-

dystrophy.

The comparison between caveolin-3 protein and mRNA expression

suggested that the overexpression of caveolin-3 in dystrophic PS might be a

posttranslational event (Fig. V-2). The LGMD-1C phenotype occurred

through the possible dysfunction of caveolin-3 due to the ubiquitination and

proteasomal degradation (Galbiati et ai., 2000a). Moreover, we previously

identified WWPl gene, a ubiquitin ligase, as the responsible gene for chicken

muscular dystrophy (Matsumoto et ai., 2007, 2008, 2009), and suggested the

mutant WWP1 protein could not ubiquitinate and degrade caveolin-3

properly.

Mutations of caveolin-3 are responsible for muscle diseases

including LGMD-1C, in any of which the caveolin-3 expression is mostly

vanished (Woodman et ai., 2004). Reduction of caveolin-3 has also been

reported in another type of muscular dystrophy, LGMD-2B (Walter et ai.,

2003) and may influence the muscle function negatively and lead to the

muscle degeneration (Hagiwara et ai., 2000). Likewise, forced expression of

caveolin-3 leads to severe muscle damage in mice by decreasing the

expression of dystrophin and B-dystroglycan (Galbiati et ai., 2000b). It was

reported that dystrophin-deficiency leads to the excess expression of

caveolin-3 in human and mouse with muscular dystrophy (Repetto et ai.,

1999; Vaghy et ai., 1998). Smythe & Rando (2006) reported that the effect

upon downstream by aberrant caveolin-3 expression differs depending on

either increased or decreased expression of caveolin-3.

The expression pattern of two other proteins consisting of caveolae,

BinI and PTRF, was similar to that of caveolin-3 and elevated only m

dystrophic PS (Fig. V-4a). It has been proposed that the vacuoles m

cytoplasm observed in degenerating fibers (Fig. V-lb) are derived from

T-tubules (Nonaka, 1987b), and that endocytosis from T-tubules is an early

and essential pathological phenomenon in chicken muscular dystrophy

(Libelius et aI., 1979). Enhanced endocytosis in dystrophic muscle may be

related to the overexpression of BinI which can induce apoptosis via c-Myc

(Galderisi et aI., 1999; DuHadaway et aI., 2001). BinI is known to be

involved in T-tubule biogenesis (Parton et aI., 1997; Lee et aI., 2002) and

mutations in Bini gene are responsible for autosomal recessive

centronuclear myopathy (Nicot et aI., 2007). Although various studies proved

that PTRF is required for caveolae organization and function (Vinten et aI.,

2005; Hill et aI., 2008; Liu & Pilch, 2008), little is known about this molecule.

Total Akt protein was detectable in all muscles examined, but only

dystrophic PS exhibited the activation of Akt (Fig. V-4b). The fact that the

Akt signal is one of the downstreams of caveolin-3 (Fanzani et aI., 2007)

suggests that the Akt activation observed in dystrophic PS was induced by

the elevated caveolin-3 expression, as shown in previous studies (Fanzani et

aI., 2007; Kim et aI., 2008) and in the various muscular dystrophies (Lai et

aI., 2004; Peter & Crosbie, 2006).

- 75-

The study in this chapter indicated 1) caveolin-3 was expressed

higher in damaged muscle of dystrophic chickens, 2) the amount of

caveolin-3 protein was controlled in a posttranslational fashion and 3) the

expression of other caveolae-related proteins showed· similar tendency as

that of caveolin-3_ The overexpression of caveolin-3 protein seems to be

involved in the causative process of chicken muscular dystrophy. The

relationship between the overexpression of caveolin-3 protein and dystrophic

phenotype, and the interaction between WWP1 and caveolin-3 should be

clarified in the future.

- 76-

GENERAL DISCUSSION

Muscular dystrophies, the group of inherited diseases with progressIve

weakness and degeneration of skeletal muscle, are mainly caused by

abnormalities and/or defects of muscle proteins to compose of the linkage

between sarcolemma and basal lamina (Imamura et a1., 2000). Many animal

models corresponding to this type of muscular dystrophies have been

established and utilized intensively all over the world, so that the

understanding of this field has became wider and deeper for these years.

However, many of the diseases need elucidating the responsible genes and

mechanisms to trigger the onsets (Terri & Kunkel, 2000; Lisi & Cohn, 2007).

Muscular dystrophic chicken with abnormal muscle (AAd) is one of

the oldest animal models for the diseases (Asmundson & Julian, 1956). Any

known causative genes are unlikely to cause muscular dystrophic phenotype

in this model animal, according to our previous studies applying linkage

analysis (Lee et a1., 2002; Yoshizawa et a1., 2004), and the expressions of

known causative proteins are not disturbed in this model (Saito et a1., 2005).

Hence, it has been expected that chicken muscular dystrophy is the one with

a different mechanism from known muscular dystrophies. From this

perspective, more precise linkage analysis was carries out to narrow down

the AM candidate region and each candidate gene was examined in chapter

I -III. Subsequent chapters focused on the function of the AM responsible

gene.

-77 -

In chapter I, a resource family for AM gene was established with 487

F2 individuals and 22 gene markers, including micro satellite and

insertion-deletion markers, were developed. The haplotypes were analyzed

with these markers for the candidate region of GGA2q described m a

previous study (Yoshizawa et ai., 2004). The candidate region was

successfully narrowed down to approximately 1 Mbp. The region included

seven functional genes predicted as the most likely AM candidates.

Sequence comparison and gene expression analysis to elucidate the

responsible gene was performed in chapter II. One missense mutation was

detected in AM candidate genes, while no remarkable alteration of

expression patterns was observed. The mutation was identified in WWP1,

detected only in dystrophic chickens within several tetrapods. These results

suggested WWPl (WW domain containing E3 ubiquitin protein ligase 1) is

responsible for chicken muscular dystrophy.

In chapter III, we analyzed the WWPl expression in various muscles

and tissues of normal chickens, and compared with those from muscular

dystrophic chickens. Two mRNA isoforms were detected in all tissues

examined and revealed almost equal expression level. The WWPl expression

of dystrophic chickens was decreased in almost all skeletal muscles including

unaffected muscles. These data indicate that there might not be a causal

relationship between the alteration of WWPl expression level and the

. 78-

severity of muscular dystrophy, and that mutated WWPl does not function

normally to cause the onset of chicken muscular dystrophy.

Despite of intensive studies on its oncogenic characters, the role of

WWPl, an enzyme to degrade unneeded or damaged proteins, to muscular

diseases has not yet been fully understood. Since it is generally known that

the switching of myosin heavy chain (MyHC) isoforms from neonatal isoform

to adult one is inhibited in chicken muscular dystrophy, we transfected

either of wild and mutated types of WWPl gene into C2C12 cells to monitor

the expression pattern of muscle-differentiation markers including MyHCs

by real-time PCR in chapter IV. Excessive WWP 1 expression enhanced the

expression of MyHC Ia gene but lowered the expression of MyHC lIb gene.

On the other hand, mutated WWPl gene transfected into myoblasts was

distinct from these cases in that MyHC gene or genes expression inhibited

the normal myoblast differentiation. These data suggest that WWPl

promotes myoblast differentiation from embryonic into fast twitch phase

while mutation in WWPl results to retain slow and fast twitch isoforms

characteristic of dystrophic fast twitch muscles.

In chapter V, caveolin-3 expression was analyzed as the most likely

substrate of WWPl. The caveolin-3 protein is the· main component of

caveolae in skeletal muscle. Caveolin-3 deficiency induces a muscular

dystrophic phenotype, while its overexpression also does harm to muscle

tissue. In chicken muscular dystrophy, increase of caveolae was observed by

- 79-

an electron microscopic analysis, but its underlying mechanism to cause the

onset remains elucidated. Therefore, we analyzed the expression of

caveolin-3 and other caveolae-related proteins in dystrophic chickens.

Western blotting and semi-quantitive RT-PCR analysis revealed 1)

caveolin-3 is expressed higher in damaged muscle of dystrophic chickens, 2)

the amount of caveolin-3 protein is controlled in a posttranslational fashion

and 3) the expression of other caveolae-related proteins shows similar

tendency as that of caveolin-3. The results indicated that the overexpression

of caveolin-3 protein seems to be involved in the causative process of chicken

muscular dystrophy.

This study identified WWPl as the causative gene of chicken

muscular dystrophy. All E3 ubiquitin ligases involved in muscular

dystrophies reported so far are classified into RING-type E3

(Pallares-Trujillo et ai., 1997; Acharyya et ai., 2005; Kudryashova et ai.,

2005); this is the first report all over the world that WWP1, a HECT-type E3

can cause a muscular dystrophy. This information will provide a new aspect

to understand the function of WWPl gene, famous for its oncogenic

character.

Furthermore, this study showed that the aberration of WWPl gene

influences myoblast differentiation and indicated that abnormal regulation

of caveolin-3 protein leads the onset of chicken muscular dystrophy. It is

proposed that vacuoles in degenerating fibers of muscular dystrophic

- 80-

chickens (Fig. I-I, III-2, V-lh) be derived from abnormal proliferation, fusion,

enlargement of T-tubules (Nonaka, 1987b) and that the muscle degeneration

in this disease start with this vacuole formation (Libelius et al., 1979). BinI

consisting of caveolae with caveolin-3 plays a leading role in T-tubule

biogenesis (Parton et al., 1997; Lee et al., 2002). Since caveolin-3 undergoes

ubiquitination and proteasomal degradation (Galbiati et a1., 2000a), we are

currently hypothesizing 1) excessive amount of caveolin-3 proteins retain on

sarcolemma due to dysfunction of WWPl, 2) caveolin-3 overexpression

results in increase of caveolae, which causes an abnormality in T-tubule

biogenesis, 3) endocytosis from T-tubules is hyper-activated and leads the

onset of chicken muscular dystrophy.

In the future, the relationship between the overexpreSSlOn of

caveolin-3 protein and dystrophic phenotype, and the interaction between

WWPI and caveolin-3 should be clarified. The mechanism leading the onset

by excess amount of caveolin-3 protein needs also elucidating. These

information will contribute to the study of chicken muscular dystrophy and

the corresponding human dystrophies.

- 81-

ACKNOWLEDGMENTS

I would like to express my sincere gratitude to Prof. H. Mannen and

Prof. F. Mukai for giving me an opportunity to undertake this study and lots

of helpful suggestions. I also gratefully acknowledge helpful discussions with

Dr. S. Sasazaki on many points in this study.

This study owes much to the thoughtful and helpful comments of

Prof. T. Kikuchi, Prof. A. Nakamura and Prof. M. Imamura of National

Institute of Neuroscience.

Appreciation is expressed to Prof. N. Ichihara of Azabu University

and Dr. A. Fujiwara of Nippon Institute for Biological Science for providing

me with great technical helps.

Thanks are extended to members of laboratory for their invaluable

encouragements.

Finally, I thank my family, Ryoma, Hiroka and Minatsu, who have

always supported and understood me and my dream.

·82·

REFERENCE

Acharyya S, Butchbach ME, Sahenk Z, Wang H, Saji M, Carathers M, Ringel

MD, Skipworth RJ, Fearon KCH, Hollingsworth MA, Muscarella P,

Burghes AH, Rafael-Fortney JA, Guttridge DC. (2005) Dystrophin

glycoprotein complex dysfunction: A regulatory link between muscular

dystrophy and cancer cachexia. Cancer Cell 8, 421-432.

Akasaka-Manya K, Manya H, Endo T. (2004) Mutations of the POMTl gene

found in patients with Walker-Warburg syndrome lead to a defect of

protein O-mannosylation. Biochemical and Biophysical Research

Communications 325, 75-79.

Anderson RG. (1993) Caveolae: where incoming and outgoing messengers

meet. Proceedings of the National Academy of Sciences of the United

States of America 90,10909-10913.

Ashmore CR, Doerr L. (1971a) Comparative aspects of muscle fiber types in

different species. Experimental Neurology 31, 408-418.

Ashmore CR, Doerr L. (1971b) Postnatal development of fiber types in

normal and dystrophic skeletal muscle of the chick. Experimental

Neurology 30, 431-446.

Ashmore CR, Kikuchi T, Doerr L. (1978) Some observations on the

innervation patterns of different fiber types of chick muscle.

Experimental Neurology 58, 272-284.

Asmundson VS, Julian LM. (1956) Inherited muscle abnormality In the

domestic fowl. Journal of Heredity 47, 248-252.

Asmundson VS, Kratzer FH, Julian LM. (1966) Inherited myopathy in the

chicken. Annual Review of the New York Academic Science 138, 49-60.

Augustine GJ. (2001) How does calcium trigger neurotransmitter rele.ase?

Current Opinion in Neurobiology 11, 320-326.

- 83-

Balci B, Vyanik G, Dincer P, Gross C, Willer T, Talim B, Haliloglu G, Kale G,

Hehr V, Winkler J, Topaloglu H. (2005) An autosomal recessive limb

girdle muscular dystrophy (LGMD2) with mild mental retardation is

allelic to Walker-Warburg syndrome (WWS) caused by a mutation in the

POMTl gene. Neuromuscular Disorders 15,271-275.

Bandman E. (1985) Continued expression of neonatal myosin heavy chain in

adult dystrophic skeletal muscle. Science 227, 780-782.

Bandman E, Bennett T. (1988) Diversity of fast myosin heavy chain

expression during development of gastrocnemius, bicep brachii, and

posterior latissimus dorsi muscles in normal and dystrophic chickens.

Developmental biology 130, 220-231.

Barnard EA, Lyles JM, Pizzey JA. (1982) Fibre types in chicken skeletal

muscles and their changes in muscular dystrophy. The Journal of

Physiology 331, 333-354.

Bernassola F, Karin M, Ciechanover A, Melino G. (2008) The HECT family of

E3 ubiquitin ligases: multiple players in cancer development. Cancer

Cell 14, 10-21.

Brockington M, Blake DJ, Prandini P, Brown SC, Torelli S, Benson MA,

Ponting CP, Estournet B, Romero NB, Mercuri E, Voit T, Sewry CA,

Guicheney P, Muntoni F. (2001) Mutations in the Fukutin-Related

Protein Gene (FKRP) Cause a Form of Congenital Muscular Dystrophy

with Secondary Laminin a2 Deficiency and Abnormal Glycosylation of

a-Dystroglycan. American Journal of Human Genetics 69, 1198-1209.

Chen C, Matesic LE. (2007) The Nedd4-like family of E3 ubiquitin ligases

and cancer. Cancer metastasis reviews 3-4, 587-604.

Clarke BA, Drujan D, Willis MS, Murphy LO, Corpina RA, Burova E,

Rakhilin SV, Stitt TN, Patterson C, Latres E, Glass DJ. (2007) The E3

Ligase MuRF1 degrades myosin heavy chain protein III

dexamethasone-treated skeletal muscle. Cell Metabolism 6, 376-385.

- 84-

Cooper EM, Hudson AW, Amos J, Wagstaff J, Howley PM. (2004)

Biochemical Analysis of Angelman Syndrome-associated Mutations in

the E3 Ubiquitin Ligase E6-associated Protein. The Journal of biological

chemistry 279, 41208-41217.

Costello BR, Shafiq SA. (1979) Freeze-fracture study of muscle

plasmalemma in normal and dystrophic chickens. Muscle & Nerve 2,

191-201.

Crosbie RH, Yamada H, Venzke DP, Lisanti MP, Campbell KP. (1998)

Caveolin-3 is not an integral component of the dystrophin glycoprotein

complex. FEBS Letters 427, 279-282.

Dallas CJ, Marc NW, Mohamed 0, Jochen GH, Melvin JG, Laurie HG. (2006)

Regulation of Adult Bone Mass by the Zinc Finger Adapter Protein

Schnurri-3. Science 312, 1223-1227.

Dowling JJ, Gibbs EM, Feldman EL. (2008) Membrane traffic and muscle:

lessons from human disease. Traffic9, 1035-1043.

DuHadaway JB, Sakamuro D, Ewert DL, Prendergast GC. (2001) BinI

mediates apoptosis by c-Myc in transformed primary cells. Cancer

research 61,3151-3156.

Fanzani A, Stoppani E, Gualandi L, Giuliani R, Galbiati F, Rossi S, Fra A,

Preti A, Marchesini S. (2007) Phenotypic behavior of C2C12 myoblasts

upon expression of the dystrophy-related caveolin-3 PI04L and TFT

mutants. FEBS Letters 581, 5099-5104.

Flasza M, Gorman P, Roylance R, Canfield AE, Baron M. (2002) Alternative

Splicing Determines the Domain Structure of WWP1, a Nedd4 Family

Protein. Biochemical and Biophysical Research Communications 290,

431-437.

- 85-

Flasza M, Nguyen Huu NS, Mazaleyrat S, Clemence S, Villemant C, Clarke

R, Baron M (2006) Regulation of the nuclear localization of the human

Nedd4-related WWPI protein by Notch. Molecular membrane biology 23,

269-276.

Galderisi U, Di Bernardo G, Cipollaro M, Jori FP, Piegari E, Cascino A,

Peluso G, Melone MA. (1999) Induction of apoptosis and differentiation

in neuroblastoma and astrocytoma cells by the overexpression of BinI, a

novel Myc interacting protein. Journal of cellular biochemistry 74,

313-322.

Galbiati F, Volonte D, Minetti C, Bregman DB, Lisanti MP. (2000a)

Limb-girdle muscular dystrophy (LGMD-IC) mutants of caveolin-3

undergo ubiquitination and proteasomal degradation. The Journal of

biological chemistry 275, 37702-37711.

Galbiati F, Volonte D, Chu JB, Li M, Fine SW, Fu M, Bermudez J, Pedemonte

M, Weidenheim KM, Pestell RG, Minetti C, Lisanti MP. (2000b)

Transgenic overexpression of caveolin-3 in skeletal muscle fibers induces

a Duchenne-like muscular dystrophy phenotype. Proceedings of the

National Academy of Sciences of the United States of America 97,

9689-9694.

Galbiati F, Engelman JA, Volonte D, Zhang XL, Minetti C, Li M, Hou H Jr,

Kneitz B, Edelmann W, Lisanti MP. (2001) Caveolin-3 null mice show a

loss of caveolae, changes in the microdomain distribution of the

dystrophin -glycoprotein complex, and t-tubule abnormalities. The

Journal of biological chemistry 276, 21425-21433.

Gillessen-Kaesbach G, Demuth S, Thiele H, Theile U, Lich C, Horsthemke B.

(1999) A previously unrecognised phenotype characterised by obesity,

muscular hypotonia, and ability to speak in patients with Angelman

syndrome caused by an imprinting defect. European journal of human

genetics 7,638-644.

- 86-

Glimcher LH, Jones DC, Wein MN. (2007) Control of postnatal bone mass by

the zinc finger adapter protein Schnurri-3. Annals of the New York

Academy of Sciences 1116,174-181.

Hagiwara Y, Sasaoka T, Araishi K, Imamura M, Yorifuji H, Nonaka I, Ozawa

E, Kikuchi T. (2000) Caveolin-3 deficiency causes muscle degeneration in

mice. Human molecular genetics 9, 3047-3054.

Hershko A, Heller H, Elias S, Ciechanover A. (1983) Components of

ubiquitin-protein ligase system: Resolution, affinity purification, and

role in protein breakdown. The Journal of biological chemistry 258,

8206-8214.

Hill MM, Bastiani M, Luetterforst R, Kirkham M, Kirkham A, Nixon SJ,

Walser P, Abankwa D, Oorschot VM, Martin S, Hancock JF, Parton RG.

(2008) PTRF-Cavin, a conserved cytoplasmic protein required for caveola

formation and function. Cell 132, 113-124.

Huang K, Johnson KD, Petcherski AG, Vandergon T, Mosser EA, Copeland

NG, Jenkins NA, Kimble J, Bresnick EH. (2000) A HECT domain

ubiquitin ligase closely related to the mammalian protein WWP1 is

essential for Caenorhabditis elegans embryogenesis. Gene 252, 137-145.

Huizing M, Rakocevic G, Sparks SE, Mamali I, Shatunov A, Goldfarb L,

Krasnewich D, Gahl WA, Dalakas MC. (2004) Hypoglycosylation of

u-dystroglycan in patients with hereditary IBM due to GNE mutations.

Molecular Genetics and Metabolism 81, 196-202.

Imamura M, Araishi K, Noguchi S, Ebashi S. (2000) A

sarcoglycan-dystroglycan complex anchors Dp116 and utrophin in the

peripheral nervous system. Human Molecular Genetics 9, 3091-3100.

Jackson PK, Eldridge AG, Freed E, Furstenthal L, Hsu JY, Kaiser BK,

Reimann JDR. (2000) The lore of the RINGs: substrate recognition and

catalysis by ubiquitin ligases. Trends in cell biology 10, 429-439.

- 87-

Kaprielian Z, Bandman E, Fambrough DM. (1991) Expression of

Ca2+-ATPase isoforms in denervated, regenerating, and dystrophic

chicken skeletal muscle. Developmental biology 144, 199-211.

Kikuchi T, Ishiura S, Nonaka I, Ebashi S. (1981) Genetic heterozygous

carriers in hereditary muscular dystrophy of chickens. Tohoku Journal

of Agriculture Research 32, 14-26.

Kikuchi T, Akiba T, Ashmore CR. (1986) Conversion of muscle fiber types in

regenerating chicken muscles following cross-reinnervation. Acta

neuropathologica 71, 197-206.

Kikuchi T, Moriya H, Matuzani T, Katoh M, Takeda S. (1987) The

development of laboratory animal SCIence for the study of human

muscular and nervous diseases in Japan. Congenital anomalies 27,

447-462.

Kim S, Lee Y, Seo JE, Cho KH, Chung JH. (2008) Caveolin -1 increases basal

and TGF-beta1-induced expression of type I procollagen through PI-3

kinase/Akt/mTOR pathway in human dermal fibroblasts. Cellular

signalling20, 1313-1319.

Kishino T, Lalande M, Wagstaff J. (1997) UBE3A1E6-AP mutations cause

Angelman syndrome. Nature genetics 15, 70-73.

Kitamura T, Kitamura YI, Funahashi Y, Shawber CJ, Castrillon DH,

Kollipara R, DePinho RA, Kitajewski J, Accili D. (2007) A FoxolNotch

pathway controls myogenic differentiation and fiber type specification.

The Journal of clinical investigation 117, 2477-2485.

Komuro A, Imamura T, Saitoh M, Yoshida Y, Yamori T, Miyazono K,

Miyazawa K. (2004) Negative regulation of transforming growth

factor-beta (TGF-beta) signaling by WW domain-containing protein 1

(WWP1). Oncogene 23,6914-6923.

- 88-

Kondo K, Kikuchi T, Mizutani M. (1982) Breeding of the chicken as an

animal model for muscular dystrophy. In: Ebashi S (ed.), Muscular

Dystrophy 19-24. Tokyo University Press, Tokyo.

Kudryashova E, Kudryashov D, Kramerova I, Spencer MJ. (2005) Trim32 is

a Ubiquitin Ligase Mutated in Limb Girdle Muscular Dystrophy Type

2H that Binds to Skeletal Muscle Myosin and Ubiquitinates Actin.

Journal of Molecular Biology 354, 413-424.

Lai KM, Gonzalez M, Poueymirou WT, Kline WO, Na E, Zlotchenko E, Stitt

TN, Economides AN, Yancopoulos GD, Glass DJ. (2004) Conditional

activation of akt in adult skeletal muscle induces rapid hypertrophy.

Molecular and cellular biology 24, 9295-9304.

Langlands K, Yin X, Anand G, Prochownik EV. (1997) Differential

interactions of Id proteins with basic-helix-loop-helix transcription

factors. The Journal of biological chemistry 32, 19785-19793.

Larsson L, Salviati G. (1989) Effects of age on calcium transport activity of

sarcoplasmic reticulum in fast- and slow-twitch rat muscle fibres. The

Journal of physiology 419, 253-264.

Lattanzi G, Muntoni F, Sabatelli P, Squarzoni S, Maraldi NM, Cenni V,

Villanova M, Columbaro M, Merlini L, Marmiroli S. (2000) Unusual

Laminin a2 Processing in Myoblasts from a Patient with a Novel Variant

of Congenital Muscular Dystrophy. Biochemical and Biophysical

Research Communications 277, 639-642.

Lederkremer GZ, Glickman MH. (2005) A window of opportunity: timing

protein degradation by trimming of sugars and ubiquitins. Trends in

biochemical sciences 30,297-303.

Lee E, Marcucci M, Daniell L, Pypaert M, Weisz OA, Ochoa GC, Farsad K,

Wenk MR, De Camilli P. (2002) Amphiphysin 2 (BinI) and T-tubule

biogenesis in muscle. Science 297, 1193-1196.

- 89·

Lee EJ, Yoshizawa K, Mannen H, Kikuchi H, Kikuchi T, Mizutani M, Tsuji S.

(2002) Localization of the muscular dystrophy AMlocus using a chicken

linkage map constructed with the Kobe University resource family.

Animal Genetics 33, 42-48.

Libelius R, Jirmanova I, Lundquist I, Thesleff S, Barnard EA. (1979)

T-tubule endocytosis in dystrophic chicken muscle and its relation to

muscle fiber degeneration. Acta neuropathologica 48,31-38.

Lisi MT, Cohn RD. (2007) Congenital muscular dystrophies: new aspects of

an expanding group of disorders. Biochimica et biophysica acta 1772,

159-172.

Liu YC. (2004) Ubiquitin ligases and the immune response. Annual review of

immunology 22, 81-127.

Liu L, Pilch PF. (2008) A critical role of cavin (polymerase I and transcript

release factor) in caveolae formation and organization. The Journal of

biological chemistry 283, 4314-22.

Maier A. (1993) Transient expression of a ventricular myosin heavy chain

isoform in developing chicken intrafusal muscle fibers. Histochemistry

99, 333-338.

Mannen H, Tsoi SC, Pickford DB, Donald JA, Guillette LJ, Li SS. (1996)

Sequences of the lizard cDNAs encoding lactate dehydrogenase (LDJ1)

isozymes A (muscle) and B (heart). Gene 171, 303-304.

Mannen H, Tsoi SC, Krushkal JS, Li WH, Li SS. (1997) The cDNA cloning

and molecular evolution of reptile and pigeon lactate dehydrogenase

isozymes. Molecular biology and evolution 14,1081-1087.

Matsumoto H, Hayashi YK, Kim DS, Ogawa M, Murakami T, Noguchi S,

Nonaka I, Nakazawa T, Matsuo T, Futagami S, Campbell KP, Nishino I.

2005. Congenital muscular dystrophy with glycosylation defects of

u-dystroglycan in Japan. Neuromuscular Disorders 15,342-348

- 90-

Matsumoto H, Maruse H, Yoshizawa K, Sasazaki S, Fujiwara A, Kikuchi T,

Ichihara N, Mukai F, Mannen H. (2007) Pinpointing the candidate

region for muscular dystrophy in chickens with an abnormal muscle

gene. Animal science journal 78, 476-483.

Matsumoto H, Maruse H, Inaba Y, Yoshizawa K, Sasazaki S, Fujiwara A,

Nishibori M, Nakamura A, Takeda S, Ichihara N, Kikuchi T, Mukai F,

Mannen H. (2008) The ubiquitin ligase gene (WWP1) is responsible for

the chicken muscular dystrophy. FEBS Letters 582,2212-2218.

Matsumoto H, Maruse H, Sasazaki S, Fujiwara A, Takeda S, Ichihara N,

Kikuchi T, Mukai F, Mannen H. (2009) Expression pattern of WWPl in

muscular dystrophic and normal chickens. The journal of poultry science

46,95-99.

Matsuoka Y, Inoue A. (2008) Controlled differentiation of myoblast cells into

fast and slow muscle fibers. Cell and tissue research 332, 123-132.

Mosser EA, Kasanov JD, Forsberg EC, Kay BK, Ney PA, Bresnick EH. (1998)

Physical and functional interactions between the transactivation domain

of the hematopoietic transcription factor NF-E2 and WW domains.

Biochemistry 37, 13686-13695.

Muntoni F, Brockington M, Blake DJ, Torelli S, Brown SC. (2002) Defective

glycosylation in muscular dystrophy. Lancet 360, 1419-1421.

Nicot AS, Toussaint A, Tosch V, Kretz C, Wallgren-Pettersson C, Iwarsson E,

Kingston H, Garnier JM, Biancalana V, Oldfors A, Mandel JL, Laporte J.

(2007) Mutations in amphiphysin 2 (BINI) disrupt interaction with

dynamin 2 and cause autosomal recessive centronuclear myopathy.

Nature genetics, 39, 1134-1139.

Nonaka I. (1987a) Muscular dystrophy. In: Nonaka I. (ed.), Muscular

Dystrophy 42-75. Japan Medical Journal, Tokyo.

- 91-

Nonaka I. (1987b) Animal models for muscular dystrophy. In: Nonaka I. (ed.),

Muscular Dystrophy 178-185. Japan Medical Journal, Tokyo.

Pallares-Trujillo J, Agell N, Garcia-Martinez C, Lopez-Soriano FJ, Argiles

JM. (1997) The Ubiquitin System: A Role in Disease? Medicinal

Research Reviews 17,139-161.

Parton RG, Way M, Zorzi N, Stang E. (1997) Caveolin-3 associates with

developing T-tubules during muscle differentiation. The Journal of cell

biology 136, 137-154.

Parton RG, Hanzal-Bayer M, Hancock JF. (2006) Biogenesis of caveolae: a

structural model for caveolin-induced domain formation. Journal of cell

science 119, 787-796.

Partridge T. (1991) Animal models of muscular dystrophy: what can they

teach us? Neuropathology and Applied Neurobiology 17, 353-363.

Passmore LA, Barford D. (2004) Getting into position: the catalytic

mechanisms of protein ubiquitylation. The Biochemical journal 379,

513-525.

Patnaik SK, Stanley P. (2005) Mouse Large Can Modify Complex N- and

Mucin O-Glycans on u-Dystroglycan to Induce Laminin Binding. The

Journal of Biological Chemistry 280, 20851-20859.

Peter AK, Crosbie RH. (2006) Hypertrophic response of Duchenne and

limb-girdle muscular dystrophies is associated with activation of Akt

pathway. Experimental cell research 312,2580-2591.

Pickart CM, Fushman D. (2004) Polyubiquitin chains: polymeric protein

signals. Current opinion in chemical biology 8, 610-616.

Pickarta CM, Eddins MJ. (2004) Ubiquitin: structures, functions,

mechanisms. Biochimica et Biophysica Acta 1695, 55-72 .

. 92-

Pirozzi G, McConnell SJ, Uveges AJ, Carter JM, Sparksi AB, Kayi BK,

Fowlkes DM. (1997) Identification of Novel Human WW

Domain -containing Proteins by Cloning of Ligand Targets. The Journal

of biological chemistry 272, 14611-14616.

Plant PJ, Yeger H, Staub 0, Howard P, Rotin D. (1997) The C2 domain of the

ubiquitin protein ligase Nedd4 mediates Ca2+-dependent plasma

membrane localization. The Journal of Biological Chemistry 272,

32329-32336.

Plant PJ, Lafont F, Lecat S, Verkade P, Simons K, Rotin D. (2000) Apical

membrane targeting of Nedd4 is mediated by an association of its C2

domain with annexin XIIIb. The Journal of Cell Biology 149, 1473-1484.

Qin H, Pu HX, Li M, Ahmed S, Song J. (2008) Identification and structural

mechanism for a novel interaction between a ubiquitin ligase WWP1 and

Nogo-A, a key inhibitor for central nervous system regeneration.

Biochemistry 51, 13647-13658.

Rahkila P, Takala TE, Parton RG, Metsikk6 K. (2001) Protein targeting to

the plasma membrane of adult skeletal muscle fiber: an organized

mosaic of functional domains. Experimental cell research 267, 61-72.

Ralston E, Ploug T. (1999) Caveolin-3 is associated with the T-tubules of

mature skeletal muscle fibers. Experimental cell research 246,510-515.

Repetto S, Bado M, Broda P, Lucania G, Masetti E, Sotgia F, Carbone I,

Pavan A, Bonilla E, Cordone G, Lisanti MP, Minetti C. (1999) Increased

number of caveolae and caveolin-3 overexpreSSlOn m Duchenne

muscular dystrophy. Biochemical and Biophysical Research

Communications 261,547-550.

Saito F, Blank M, Schroder J, Manya H, Shimizu T, Campbell KP, Endo T,

Mizutani M, Kroger S, Matsumura K. (2005) Aberrant glycosylation of

u-dystroglycan causes defective binding of laminin in the muscle of

chicken muscular dystrophy. FEBS Letters 579,2359-2363.

- 93-

Scheffner M, Staub O. (2007) HECT E3s and human disease. BMC

Biochemistry 8 Suppl 1, S6.

Scherer PE, Lewis RY, Volonte D, Engelman JA, Galbiati F, Couet J, Kohtz

DS, van Donselaar E, Peters P, Lisanti MP. (1997) Cell-type and

tissue-specific expression of caveolin-2: Caveolins 1 and 2 co-localize and

form a stable hetero-oligomeric complex in vivo. The Journal of

Biological Chemistry 272, 29337-29346.

Schiaffino S, Reggiani C. (1994) Myosin isoforms in mammalian skeletal

muscle. Journal of applied physiology 77, 493-501.

Schmid M, Nanda I, Guttenbach M, Steinlein C, Hoehn M, Schartl M, HaafT,

Weigend S, Fries R, Buerstedde JM, Wimmers K, Burt DW, Smith J,

A'Hara S, Law A, Griffin DK, Bumstead N, Kaufman J, Thomson PA,

Burke T, Groenen MA, Crooijmans RP, Vignal A, Fillon V, Morisson M,

Pitel F, Tixier-Boichard M, Ladjali-Mohammedi K, Hillel J, Maki-Tanila

A, Cheng HH, Delany ME, Burnside J, Mizuno S. (2000) First report on

chicken genes and chromosomes. Cytogenetics and Cell Genetics 90,

169-218.

Schubert W, Sotgia F, Cohen AW, Capozza F, Bonuccelli G, Bruno C, Minetti

C, Bonilla E, Dimauro S, Lisanti MP. (2007) Caveolin-l(-/-)- and

caveolin-2(-/-)-deficient mice both display numerous skeletal muscle

abnormalities, with tubular aggregate formation. The American Journal

of Pathology 170, 316-333.

Semple CA, RIKEN GER Group, GSL Members. (2003) The comparative

proteomics of ubi quit in at ion in mouse. Genome Research 13, 1389-1394.

Silberstein L, Webster SG, Travis M, Blau HM. (1986) Developmental

progression of myosin gene expression in cultured muscle cells. Cell 46,

1075-1081.

- 94-

Smith AN, Borthwick KJ, Karet FE. (2002) Molecular cloning and

characterization of novel tissue-specific isoforms of the human vacuolar

HI-ATPase C, G and D subunits, and their evaluation in autosomal

recessive distal renal tubular acidosis. Gene 297, 169-177.

Smythe GM, Rando TA. (2006) Altered caveolin-3 expression disrupts PI(3)

kinase signaling leading to death of cultured muscle cells. Experimental

cell research 312, 2816-2825.

Song KS, Scherer PE, Tang Z, Okamoto T, Li S, Chafe I M, Chu C, Kohtz DS,

Lisanti MP. (1996) Expression of caveolin-3 in skeletal, cardiac, and

smooth muscle cells. Caveolin-3 is a component of the sarcolemma and

co-fractionates with dystrophin and dystrophin-associated glycoproteins.

The Journal of Biological Chemistry 271, 15160-15165.

Sotgia F, Lee JK, Das K, Bedford M, Petrucci TC, Macioce P, Sargiacomo M,

Bricarelli FD, Minetti C, Sudol M, Lisanti MP. (2000) Caveolin-3 directly

interacts with the C-terminal tail of B-dystroglycan: Identification of a

central WW-like domain within cave olin family members. The Journal of


Sudol M, Chen HI, Bougeret C, Einbond A, Bork P. (1995) Characterization

of a novel protein-binding module: the WW domain. FEBS Letters 369,

67-71.

Sultan KR, Henkel B, Terlou M, Haagsman HP. (2006) Quantification of

hormone-induced atrophy of large myotubes from C2C12 and L6 cells:

atrophy-inducible and atrophy-resistant C2C12 myotubes. American

journal of physiology. Cell physiology 290, c650-659.

Terri GT, Kunkel LM. (2000) Advances in muscular dystrophy: Exciting new

projects for millennium. NeuroScience News 3,4-12.

Thomas CM, Smart EJ. (2008) Caveolae structure and function. Journal of

cellular and molecular medicine 12, 796-809.

- 95 -

Tidyman WE, Moore LA, Bandman E. (1997) Expression of fast myoSIn

heavy chain transcripts in developing and dystrophic chicken skeletal

muscle. Developmental dynamics 208, 491-504.

Tomsig JL, Creutz CE. (2002) Copines: a ubiquitous family of

Ca2+-dependent phospholipid-binding proteins. Cellular and Molecular

Life Sciences 59, 1467-1477.

Trujillo JP, Agell N, Martinez CG, Soriano FJL, Argiles JMPt. (1997) The

Ubiquitin System: A Role in Disease? Medicinal research reviews 17,

139-161.

Vaghy PL, Fang J, Wu W, Vaghy LP. (1998) Increased caveolin-3 levels in

mdxmouse muscles. FEBS Letters 431, 125-127.

Verdecia MA, Joazeiro CA, Wells NJ, Ferrer JL, Bowman ME, Hunter T,

Noel JP. (2003) Conformational flexibility underlies ubiquitin ligation

mediated by the WWP1 HECT domain E3 ligase. Molecular celln,

249-259.

Vinten J, Johnsen AH, Roepstorff P, Harp0th J, Tranum-Jensen J. (2005)

Identification of a major protein on the cytosolic face of caveolae.

Biochimica et biophysica acta 1717,34-40.

von Poser C, Zhang JZ, Mineo C, Ding W, Ying Y, Sudhof TC, Anderson RG.

(2000) Synaptotagmin regulation of coated pit assembly. The Journal of


Wagner WD, PetersDn RA. (1970) Muscular dystrophy syndrome in the

Cornish chicken. American journal of veterinary research 31,331-338.

Walter MC, Braun C, Vorgerd M, Poppe M, Thirion C, Schmidt C, Schreiber

H, Knirsch UI, Brummer D, Muller-Felber W, Pongratz D,

Muller-Hocker J, Huebner A, Lochmuller H. (2003) Variable reduction of

caveolin-3 in patients with LGMD2BIMM. Journal of neurology 250,

1431-1438.

- 96-

Wilson BW, Randall WR, Patterson GT, Entrikin RK. (1979) Major

physiologic and histochemical characteristics of inherited dystrophy of

the chicken. Annals of the New York Academy of Sciences 317, 224-246.

Wood JD, Yuan J, Margolis RL, Colomer V, Duan K, Kushi J, Kaminsky Z,

Kleiderlein JJ, Sharp AH, Ross CA. (1998) Atrophin-1, the DRPLA gene

product, interacts with two families of WW domain-containing proteins.

Molecular and cellular neurosciences 11,149-160.

Woodman SE, Sotgia F, Galbiati F, Minetti C, Lisanti MP. (2004)

Caveolinopathies: mutations in caveolin-3 cause four distinct autosomal

dominant muscle diseases. Neurology62, 538-543.

Yamada H, Saito F, Ohi HF, Zhong D, Hase A, Arai K, Okuyama A, Maekawa

R, Shimizu T, Matsumura K. (2001) Processing of B-dystroglycan by

matrix metalloproteinase disrupts the link between the extracellular

matrix and cell membrane via the dystroglycan complex. Human

Molecular Genetics 10, 1563-1569.

Yoshida A, Kobayashi K, Manya H, Taniguchi K, Kano H, Mizuno M, Inazu

T, Mitsuhashi H, Takahashi S, Takeuchi M, Herrmann R, Straub V,

Talim B, Voit T, Topaloglu H, Toda T, Endo T. (2001) Muscular

Dystrophy and Neuronal Migration Disorder Caused by Mutations in a

Glycosyltransferase, POMGnTl. Developmental CellI, 717-724.

Yoshida Y, Chiba T, Tokunaga F, Kawasaki H, Iwai' K, Suzuki T, Ito Y,

Matsuoka K, Yoshida M, Tanaka K, Tai T. (2002) E3 ubiquitin ligase that

recognizes sugar chains. Nature 418,438-442.

Yoshida Y, Tokunaga F, Chiba T, I wai K, Tanaka K, Tai T. (2003) Fbs2 is a

new member of the E3 ubiquitin ligase family that recognizes sugar

chains. The Journal of Biological Chemistry 278, 43877-43884.

Yoshizawa K, Inaba K, Mannen H, Kikuchi T, Mizutani M, Tsuji S. (2004)

Fine mapping of the muscular dystrophy (Alld) gene on chicken

chromosome 2q. Animal Genetics 35,397-400.

- 97-

Zhang Q, Pearce-kelling S, Acland GM, Aguirre GD, Ray K. (1997) Canine

Rod Photoreceptor cGMP-gated Channel Protein a-subunit: Studies on

the Expression of the Gene and Characterization of the eDNA.

Experimental eye research 65,301-309.

- 98-

Documents

Elucidation of the mechanism leading to the onset of ...muscular dystrophies include progressive muscle wasting, limited range of movement, walking difficulty, respiratory difficulty