[6] Dierksen KP, Tagg JR. Haemolysin-deficient variants of

Streptococcus pyogenes and S. dysgalactiae subsp. equisimi-

lis may be overlooked as aetiological agents of pharyngitis.

J Med Microbiol 2000;/49:/811�6.

[7] Taylor MB, Barkham T. Fatal case of pneumonia caused by a

non-haemolytic strain of Streptococcus pyogenes. J Clin

Microbiol 2002;/40:/2311�2.

[8] James L, McFarland RB. An epidemic of pharyngitis due to a

non-haemolytic group A streptococcus at Lowry Air Force

base. N Engl J Med 1971;/284:/750�2.

[9] Weightman NC, Barnham MRD. Report of unusual clinical

appearance in bacteraemia with non-haemolytic M-type 58

Streptococcus pyogenes. Indian J Med Res 2004;/

119(Suppl):/17�21.

[10] Cimolai N, Trombley C, Bhanju NM. Non-haemolytic

Streptococcus pyogenes causing invasive infection. Clin

Pediatr (Phila) 2002;/41:/453.

[11] Colebrook L, Elliott SD, Maxted WR, Morley CW, Mortell

M. Infection by non-haemolytic group A streptococci.

Lancet 1942;/2:/30�1.

[12] Betschel SD, Borgia SM, Barg NL, Low DE, De Azavedo

JC. Reduced virulence of group A streptococcal Tn916

mutants that do not produce streptolysin S. Infect Immun

1998;/66:/1671�9.

[13] Efstratiou A. Group A streptococci in the 1990s. J Anti-

microb Chemother 2000;/45:/3�12.

[14] Carapetis JR, McDonald M, Wilson NJ. Acute rheumatic

fever. Lancet 2005;/366:/155�68.

First detection of a VIM-1 metallo-b-lactamasein a carbapenem-resistant Citrobacter freundii clinical isolatein an acute hospital in Germany

JAN WEILE1, HARALD RAHMIG2, SABINE GFROERER3, KLAUS SCHROEPPEL1,

CORNELIUS KNABBE1 & MILORAD SUSA1

From the 1Department of Clinical Chemistry and Laboratory Medicine, Robert Bosch Hospital, Stuttgart, 2Department for

Anaesthesiology and Intensive Care Medicine, Hospital Waiblingen, Waiblingen, and 3Institute for Laboratory Medicine,

Marien Hospital, Stuttgart, Germany

AbstractWe report the first detection of a carbapenem-resistant Citrobacter freundii clinical strain in Germany. It was isolated froman abscess of a patient with acute necrotic pancreatitis in an acute hospital. PCR and sequencing experiments revealed thatthe carbapenem resistance was mediated by a VIM-1 metallo-b-lactamase, located on a plasmid encoded class 1 integron.Carbapenem resistance in Enterobacteriaceae is so far a rare event and 1 of the major therapeutic concerns in the future.

Introduction

Carbapenems such as imipenem, meropenem and

ertapenem possess the broadest spectrum of all

b-lactam antibiotics, showing excellent phamacody-

namic behaviour and stability against the vast variety

of b-lactamases. Especially their stability against

so-called extended-spectrum b-lactamases (ESBLs),

which are 1 of the major therapeutic concerns during

recent y with increasing prevalence [1], lead to

the frequent use of carbapenems for the initial,

calculated antibiotic therapy of severe infections

such as sepsis or pneumonia caused by Gram-

negative bacteria. Since they are quite often the

last resort in the treatment of multidrug-resistant

pathogens, carbapenem resistance needs to be

carefully monitored for surveillance and control

of resistance development [2]. Carbapenem resis-

tance is mainly due both to membrane permeability

alterations and the production of metallo-b-

lactamases (MBL) that belong to Ambler class

B enzymes [3]. These class B enzymes require

zinc ions for enzyme activity and demonstrate a

primary structure quite different from those of

class A (TEM) and C enzymes (AmpC). They

possess 1 or 2 zinc ions in the catalytic centre

of the enzyme and show the broadest substrate

spectrum of all known b-lactamases due to the lack

of target sites [4]. Besides penicillins and cephalos-

Correspondence: J. Weile, Department of Clinical Chemistry and Laboratory Medicine, Robert Bosch Hospital, Auerbachstrasse 110, 70376 Stuttgart,

Germany. Tel: �/49 0 711 8101 3734. Fax: �/49 0 711 8101 3618. E-mail: jan.weile@ikp-stuttgart.de

264 Case reports

(Received 13 June 2006; accepted 15 June 2006)

ISSN 0036-5548 print/ISSN 1651-1980 online # 2007 Taylor & Francis

DOI: 10.1080/00365540600868388

Scan

d J

Infe

ct D

is D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Mel

bour

ne o

n 09

/14/

14Fo

r pe

rson

al u

se o

nly.

porins they also confer resistance against carbape-

nems. Only the monobactam aztreonam is not

hydrolized by metallo-b-lactamases. Four distinct

types of MBLs - IMP, VIM, SPM, and GIM

enzymes - are known to date [5,6]. The imp and

vim genes were predominantly found in non-fer-

menting species such as Pseudomonas aeruginosa or

Acinetobacter baumannii. Nevertheless, the overall

prevalence of carbapenemases has remained low in

Enterobacteriaceae [7]. However, an increase of

reports from recent y being associated with carba-

penem resistance from other important clinical

genera emphasizes the clinical importance of carba-

penemases. An increased occurrence especially of

imp genes in Klebsiella pneumoniae and Serratia

marcescens was noted [7�9]. They were mostly

found to be part of mobile gene cassettes inserted

in class 1 integrons. Therefore, a horizontal resis-

tance gene transfer to other Gram-negative genera is

quite likely.

Case report

An 80-y-old female with 3 d of diffuse abdominal

pain and vomiting was presented to the emergency

department. Physical examination revealed that

the patient had peritoneal signs, a slightly elevated

WBC count, increased inflammatory marker

and elevated pancreatic enzymes. A CT scan re-

vealed an exudative pancreatitis without necrosis.

The patient was admitted to the ICU and supportive

as well an antimicrobial therapy with imipenem/

cilastin (3 g/d) administered. Two weeks later

the patient status deteriorated with increased

septic signs. She underwent respiratory support

and CT revealed necrotizing pancreatitis. A routine

laboratory examination was performed with

expiration of necrotic tissue and abscess drainage.

Bacteroides sp. was yielded on an intraoperative

specimen and blood culture. Antibiotic therapy

with imipenem/cilastin was continued for the

next 10 d without improvement. Thereafter,

Pseudomonas aeruginosa and Citrobacter freundii,

both resistant to imipenem, were isolated from

drainage effluent. The patient was treated with

ciprofloxacin (800 mg/d, parenteral) for the next

14 d and the abscess was washed with colistin

(5*106 U/d). The patient showed significant im-

provement and was discharged to a normal ward

after 45 d in the ICU.

Microbiology

Species identification and antibiotic susceptibility

testing by microdilution and E-test were performed

by standard laboratory tests according to CLSI

guidelines. The isolates were cultured on blood

agar for subsequent analyses.

Sequence analyses. PCR amplification of the vim

gene was performed, using vim consensus primers

(vim_for TGATACAGCGTGGGGTGCGAAAAA;

vim_rev GTGCCCCGGAATGACGAACTGTG).

The PCR conditions consisted of 4 min initial

denaturation at 95C, 35 cycles of 30 s at 95C,

30 s at 55C, and 1 min at 72C, respectively, followed

by 5 min at 72C for terminal elongation. The

expected PCR product had a size of 430 bp

and was confirmed by lab-on-a-chip capillary

electrophoresis. Sequencing of the PCR product

was performed via capillary sequencing. Both

strands were sequenced using the same primers as

for vim PCR amplification. The genetic context was

further investigated by primer walking and sequen-

cing [10].

Results and discussion

The C. freundii clinical isolate was resistant

against all b-lactam antibiotics including the carba-

penems imipenem, meropenem and ertapenem

except for the monobactam aztreonam (piperacillin

�/64 mg/ml, cefotaxime �/32 mg/ml, ceftazidime

�/16 mg/ml, cefepime �/16 mg/ml, imipenem �/32

mg/ml, meropenem �/32 mg/ml, ertapenem �/32 mg/

ml, aztreonam B/8 mg/ml, ciprofloxacin B/1 mg/ml,

levofloxacin B/2 mg/ml). This result suggested the

presence of a MBL since it was in complete

accordance with the substrate spectrum of, e.g.

VIM MBL. Therefore, subsequent PCR analysis

was performed and sequencing experiments revealed

the presence of a vim-1 MBL gene in the C. freundii

isolate. The genetic context was further investigated

and showed that the detected vim-1 gene was part of

a plasmid encoded class 1 integron containing 3 gene

cassettes. Besides the vim-1 gene, genes for the

aminoglycoside modifying enzymes, aac(6 ?)-Ib and

aph(3 ?), were identified. The genetic analysis of the

imipenem resistance phenotype of the P. aeruginosa

strain isolated in parallel showed that this resistance

was mediated by a mutation in the mexT gene

[11,12], leading to the loss of the outer membrane

porin OprD. Additionally, no vim genes were

detected and the strain did not carry any plasmid.

This result excludes the possibility of a horizontal

MBL gene transfer from the P. aeruginosa isolate to

the C. freundii isolate.

To our knowledge, this is the first confirmed

description of a VIM-1 MBL in a member of the

Enterobacteriaceae family in Germany. The finding

demonstrates the worldwide observed ongoing

Case reports 265

Scan

d J

Infe

ct D

is D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Mel

bour

ne o

n 09

/14/

14Fo

r pe

rson

al u

se o

nly.

spread of MBLs in Enterobacteriaceae and empha-

sizes the need of an epidemiological surveillance at a

genetic level to monitor and control this major

therapeutic concern.

Acknowledgements

The authors would like to thank the PathoGenoMik

Project of the German Ministry for Education and

Research (BMBF) and the Robert Bosch Founda-

tion for financial support.

References

[1] Bradford PA. Extended-spectrum {beta}-lactamases in the

21st century: Characterization, epidemiology, and detection

of this important resistance threat. Clin Microbiol Rev 2001;/

14:/933�51.

[2] Livermore DM, Woodford N. Carbapenemases: a problem

in waiting? Curr Opin Microbiol 2000;/3:/489�95.

[3] Ambler RP, Coulson AF, Frere JM, Ghuysen JM, Joris B,

Forsman M, et al. A standard numbering scheme for class A

beta-lactamases. Biochem J 1991;/15:/269�70.

[4] Poirel L, Nordmann P. Acquired carbapenem-hydrolyzing

beta-lactamases and their genetic support. Curr Pharm

Biotechnol 2002;/3:/117�27.

[5] Livermore DM. Multiple mechanisms of antimicrobial

resistance in Pseudomonas aeruginosa: our worst nightmare?

Clinical Infectious Diseases 2002;/34:/634�40.

[6] Toleman MA, Simm AM, Murphy TA, Gales AC, Bieden-

bach DJ, Jones RN, et al. Molecular characterization of

SPM-1, a novel metallo-beta-lactamase isolated in Latin

America: report from the SENTRY antimicrobial surveil-

lance programme. J Antimicrob Chemother 2002;/50:/673�9.

[7] Lartigue M-F, Poirel L, Nordmann P. First detection of a

carbapenem-hydrolyzing metalloenzyme in an Enterobacter-

iaceae isolate in France. Antimicrob Agents Chemother

2004;/48:/4929�30.

[8] Henrichfreise B, Wiegand I, Sherwood KJ, Wiedemann B.

Detection of Vim-2 metallo-beta-lactamase in Pseudomonas

aeruginosa from Germany. Antimicrob Agents Chemother

2005;/49:/1668�9.

[9] Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM, et al.

bla(VIM-2) cassette-containing novel integrons in

metallo-beta-lactamase-producing Pseudomonas aeru-

ginosa and Pseudomonas putida isolates disseminated in a

Korean hospital. Antimicrob Agents Chemother 2002;/46:/

1053�8.

[10] Levesque RC, Piche L, Larose C, Roy PH. PCR mapping

of integrons reveals several novel combinations of

resistance genes. Antimicrob Agents Chemother 1995;/39:/

185�91.

[11] Maseda H, Saito K, Nakajima A, Nakae T. Variation of the

mexT gene, a regulator of the MexEF-oprN efflux pump

expression in wild-type strains of Pseudomonas aeruginosa.

FEMS Microbiol Lett 2000;/192:/107�12.

[12] Ochs MM, McCusker MP, Bains M, Hancock REW.

Negative regulation of the Pseudomonas aeruginosa outer

membrane porin OprD selective for imipenem and basic

amino acids. Antimicrob Agents Chemother 1999;/43:/1085�90.

Infective endocarditis of the tricuspid valve caused by Staphylococcusaureus after ear piercing

ALES KOVARIK, MAREK SETINA, MIREK SULDA, PETRA PAZDERKOVA &

ALES MOKRACEK

From the Kardiocentrum Nemocnice Ceske Budejovice, Czech Republic

AbstractRight-sided endocarditis usually involves the tricuspid valve, predominantly in intravenous drug abusers, in patients withanti-arrhythmic devices or central venous lines, and in patients with skin or genitourinary infection and with congenital heartdisease [1]. We describe a case of a 15-y-old patient, who had tricuspid valve endocarditis in a morphologically normal valveafter having his ear pierced, without history of parenteral drug addiction and vascular catheter use. Progression of vegetationsize and development of tricuspid valve regurgitation in spite of the intensive antibiotic treatment eventually requiredsurgical intervention.

Correspondence: A. Kovarik, Kardiocentrum Nemocnice Ceske Budejovice, Bozeny Nemcove 54, 370 87 Ceske Budejovice, Czech Republic. E-mail:

ales.kovarik@email.cz

266 Case reports

(Received 14 June 2006; accepted 16 June 2006)

ISSN 0036-5548 print/ISSN 1651-1980 online # 2007 Taylor & Francis

DOI: 10.1080/00365540600868396

Scan

d J

Infe

ct D

is D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Mel

bour

ne o

n 09

/14/

14Fo

r pe

rson

al u

se o

nly.