Germplasm Release: Saikai 35, a Male and Female FertileBreeding Line Carrying Solanum Phureja-DerivedCytoplasm and Potato Cyst Nematode Resistance (H1)and Potato Virus Y Resistance (Rychc) Genes

Kazuyuki Mori & Nobuhiro Mukojima & Takashi Nakao & Seiji Tamiya & Yu Sakamoto &

Norio Sohbaru & Kazuya Hayashi & Hitomi Watanuki & Kazuhiro Nara &

Kaoru Yamazaki & Takashige Ishii & Kazuyoshi Hosaka

Published online: 17 November 2011# Potato Association of America 2011

Abstract Saikai 35 was bred from a cross between TD0101as the female, which was created by chromosome-doubling ofa good-tasting and bacterial wilt resistant diploid variety, Inca-no-mezame, and Sakurafubuki as the male, the latter of whichhas H1 and Rychc genes showing resistance to potato cystnematode (PCN) and Potato virus Y (PVY), respectively. Allfavorable traits were combined into Saikai 35, althoughmarketable yield in the spring cropping was 20.4–21.0%lower than those of major double-cropping varieties. Saikai35 is particularly useful for having Solanum phureja-derivedcytoplasm (S/ε), which resulted in high male and femalefertility. In addition, sets of very tightly linked DNA markerssandwiching H1 and Rychc are available. Therefore, Saikai 35is being released as a breeding line, which can conferefficiently PCN and PVY resistance genes.

Resumen Saikai 35 es el resultado de la cruza entre TD0101como hembra, que se creó por duplicidad de cromosomasde una variedad diploide de buen sabor y resistente a lamarchitez bacteriana, Inca-no-mezame, y Sakurafubukicomo macho, que tiene genes de H1 y Rychc quemuestran resistencia al nematodo de quiste de la papa(PCN) y al virus Y de la papa (PVY), respectivamente. Secombinaron todos los caracteres favorables en Saikai 35,aunque el rendimiento comercial en el cultivo deprimavera fue 20.4–21.0% más bajo que las principalesvariedades de doble cultivo. Saikai es particularmente útilpor tener citoplasma derivado de Solanum phureja (S/ε),que da como resultado alta fertilidad masculina y femenina.Además, están disponibles juegos de marcadores de DNAfuertemente ligados en sándwich con H1 y Rychc. De aquíque Saikai 35 se está liberando como una línea demejoramiento, que puede conferir eficientemente genes deresistencia a PCN y PVY.

Keywords Chromosome doubling . Cytoplasmic malesterility . Solanum phureja cytoplasm .Molecularmarker-assisted selection

Introduction

Various diseases and pests damage potato production.Genetic resistances are favorable compared with chemicalcontrols. Although resistance genes are not always availableto all diseases and pests, various resistance genes are knownand genetically mapped in the potato genome (Gebhardt andValkonen 2001). Some of them are highly effective in

K. Mori :N. Mukojima : T. Nakao :Y. SakamotoNagasaki Agricultural and Forestry Technical Development Center,Unzen, Nagasaki 854-0302, Japan

K. Mori : T. IshiiGraduate School of Agricultural Science, Kobe University,Nada, Kobe, Hyogo 657-8501, Japan

S. Tamiya :K. Hosaka (*)National Agricultural Research Center for Hokkaido Region,Memuro, Kasai, Hokkaido 082-0081, Japane-mail: spudman@affrc.go.jp

N. SohbaruNagasaki Tsushima Development Bureau,Tsushima, Nagasaki 817-8520, Japan

K. Hayashi :H. Watanuki :K. Nara :K. YamazakiTokyo Kasei Gakuin University,Machida, Tokyo 194-0292, Japan

Am. J. Pot Res (2012) 89:63–72DOI 10.1007/s12230-011-9221-4

protecting against causal organisms, and have been incorpo-rated with ease into cultivars.

In Japan, pathotype Ro1 of potato cyst nematodes[Globodera rostochiensis (Woll.) Behrens] has becomeincreasingly a serious problem, particularly in seed potatoproduction areas where once cyst nematodes are found,seed potatoes are not allowed to be transported outside theinfected areas (Mori et al. 2007). A single dominant geneH1, introduced from the accession CPC1673 of Solanumtuberosum L. ssp. andigena Hawkes, confers perfectresistance to the pathotype Ro1 (Huijsman 1955). Thepresence of H1 is now a prerequisite to the release of newcultivars. H1 was mapped to potato chromosome 5 (Pinedaet al. 1993; Gebhardt et al. 1993). Recently, a set of tightlylinked markers, N146 and N195, were developed whichsandwich H1 with the recombination frequencies of 0.109%and 0.207%, respectively (Takeuchi et al. 2009).

Twelve viruses are known to infect and damage potatoes inJapan (Maoka et al. 2010). Among them, Potato virus Y(PVY) is the most important, and thus, resistance to PVY ishighly desirable. Three main strains have been distinguished:common strain (PVYO), tobacco veinal necrosis strain(PVYN) and stipple streak strain (PVYC) (German 2001),among which PVYN is problematic because it often causes avirtually symptomless infection on potato but causes a severenecrosis on nearby tobacco foliage. Extreme resistance genesto PVY have been known from three different sources: Rystofrom S. stoloniferum Schlechtd. et Bché. (Cockerham 1943),Ryadg from S. tuberosum ssp. andigena (Munoz et al. 1975)and Rychc from S. chacoense Bitt. (Asama et al. 1982). Thesethree genes inherit monogenically with a dominant fashionand show strain nonspecific resistance (Ross 1958; Munoz etal. 1975; Hosaka et al. 2001). Rychc was identified in one ofthe leading Japanese cultivars, Konafubuki (Hosaka et al.2001), and mapped to the most distal end of chromosome 9(Sato et al. 2006). The Rychc-linked RAPD marker 38–530has been used for marker-assisted selection, although therecombination frequency was relatively high, 16.3% in thetetraploid population (Hosaka et al. 2001) and 0.9% in thediploid population (Sato et al. 2006). Recently, Takeuchi etal. (2009) developed a set of tightly linked markers, Ry186and Ry364, which sandwich Rychc with recombinationfrequencies of 0.203% and 0.085%, respectively.

For use as a parent in breeding, male and female fertilityis an important concern, because breeders often encoun-tered sterility problems in genotypes with desirable resis-tance traits. The common potato (S. tuberosum, 2n=4x=48)has at least seven different cytoplasmic sterility factors([ASFs], [Fms], [Ins], [SMs], [Sps], [TAs] and [VSAs]) thatcondition sterilities in the presence of dominant chromosomalgenes (ASF, Fm, In, SM, Sp, TA and VSA) (Grun et al. 1977).The cytoplasmic genome of potato is characterized byhaving T-type chloroplast DNA (Hosaka 1986) and β-type

mitochondrial DNA (Lössl et al. 1999). Although thecytoplasmic sterility factors likely reside on mitochondrialDNA (Hosaka et al. 1988; Lössl et al. 2000), β-typemitochondrial DNA so far shows complete association withT-type chloroplast DNA (hereinafter, T/β cytoplasm) (Lösslet al. 2000). T/β cytoplasm is predominant in the commonpotato (Hosaka and Hanneman 1988; Waugh et al. 1990;Powell et al. 1993; Bryan et al. 1999; Provan et al. 1999;Lössl et al. 2000), so that sterility problems are unavoidablewhen T/β cytoplasm is present. Besides such intrinsicsterility, some specific male sterility in association with thecytoplasmic genome has been known. Cultivars carryingRysto, released mainly in Germany (Ross 1986), show malesterility caused by association with the characteristic mito-chondrial genome derived from S. stoloniferum (Lössl et al.2000). S. demissum Lindl. is a hexaploid Mexican wildspecies and the most frequently used wild species in potatobreeding as a source of resistance to the most serious disease,late blight (Phytophthora infestans) (Rudorf 1950; Ross1986; Plaisted and Hoopes 1989). It can be crossed directlywith the common potato only when used as a female andforms pentaploid hybrids (Black 1943; Cooper and Howard1952; Irikura 1968). The resultant pentaploid F1 hybrids arenon-functional as males, and usually produce seeds only ifbackcrossed with the pollen of S. tuberosum. The malesterility of the backcrossed progeny persists even after ten ormore successive generations of backcrossing (Dionne 1961).The cytoplasmic genomes of S. stoloniferum and S.demissum introduced into cultivars were characterized to beW/γ and W/α, respectively (Lössl et al. 2000).

Inca-no-mezame is the first diploid variety released in Japan(Mori et al. 2009). It was selected for tuber formation underlong day from hybrid plants composed with the Andeanpotato-derived (75%) nuclear genome and S. phureja cyto-plasm (S/ε cytoplasm). It produces smaller tubers than normaltetraploid cultivars, resulting in lower yield. Nevertheless, dueto its excellent taste, it was officially released in 2001. Thepotato breeding program of Nagasaki Agricultural andForestry Technical Development Center aims to breed potatovarieties adopted for double-cropping in warm regions. As theperiod between cropping seasons (spring cropping from earlyFebruary to mid-May and fall cropping from early Septemberto late November) is fairly short, short tuber dormancy isrequired. We planned to combine desirable characters ofInca-no-mezame (good taste, bacterial wilt resistance,short tuber dormancy and S/ε cytoplasm) with H1 andRychc genes. The resultant Saikai 35 has all these traits andalso high male and female fertility, although tuber yieldwas slightly lower than major varieties grown in double-cropping regions. In this paper, we report that Saikai 35 isa highly useful breeding line for conferring potato cystnematode and PVY resistance genes. Saikai 35 will beavailable for distribution from the US Potato Genebank.

64 Am. J. Pot Res (2012) 89:63–72

Materials and Methods

Saikai 35 and the other cultivars and advanced breedinglines used in this study are listed in Table 1. The pedigree ofSaikai 35 is shown in Fig. 1. Inca-no-mezame waschromosome-doubled using a tuber-disc method (Komuraand Ohbayashi 2002), resulting in TD0101 that acquiredimproved male and female fertility (Mukojima et al. 2003).A pollen parent, Sakurafubuki, is a cultivar for starchproduction and possesses H1, originally derived from aGerman variety Tunika, and Rychc, derived from S.chacoense via Konafubuki (Murakami et al. 1995).

For breeding double-cropping varieties, two clonalgenerations were grown every year: a spring season cropusing clear plastic film-covered rows (mulching) and a fallseason crop. After seedling selection, superior genotypeswere grown and selected in fields as follows: a first clonalselection (one hill), a line selection (eight hills in one row),a preliminary yield trial (three rows with ten hills each), andthen, several seasons of yield trials (four rows with ten hillseach, three replications). Seed tubers were planted earlyFebruary for spring season cropping, and early Septemberfor fall season cropping, with a planting density of 65 cmbetween rows and 30 cm between plants for a first clonalselection, or 25 cm for all later generation plantings.Fertilizer at 126, 112, 112 and 28 kg ha−1 of N, P2O5,K2O and MgO, respectively, was applied.

Initial screening for the presence of H1 and Rychcgenes was carried out using molecular markers PCN(Tanaka and Komura 2000) and 38–530 (Hosaka et al.2001), respectively.

Growth and yield performances were examined from 2005to 2010 at one location (Unzen, Nagasaki) and compared withDejima and Nishiyutaka, the two most prevalent double-cropping cultivars. Marketable yields (kg/a) were compared;marketable sizes were >30 g in the spring season croppingand >40 g in the fall season cropping. Specific gravitywas calculated as weight in air (weight in air—weight inwater)−1, using 15 tubers of approximately 100 g size.

Table 1 Cultivars and breedinglines used in this study. Theircytoplasm types, parentageand resistance evaluation datafor Potato virus Y (PVY)are tabulated

1)US variety2)Chloroplast DNA type/mitochondrial DNA type, asdetermined by the methods ofSukhotu et al. (2004) and Lösslet al. (2000), respectively3)S = susceptible, R = resistant,ND = not determined4)Estimated by the pedigree

Clone Released year Cytoplasm2) Female Male PVY resistance (Rychc)

Phenotype3) Marker

Dejima 1971 T/β Hokkai 31 Unzen S –

Nishiyutaka 1978 T/β Dejima Chokei 65 S –

Pike1) 1995 T/β Allegany Atlantic S –

Aiyutaka 2003 T/β Dejima Chokei 108 S –

Haru-akari 2002 T/β T8973-20 Fugenmaru S –

Hokkai 56 – W/γ WB60139-3 Hokkai 44 ND –

Saikai 35 – S/ε TD0101 Sakurafubuki R +

Saikai 37 – S/ε Saikai 35 Saikai 33 R +

Saikai 38 – T/β Nishiyutaka Saikai 35 R +

Saikai 39 – W/α Aikei 125 Saikai 35 R +

Chokei 124 – T/β Aikei 90 Haru-akari ND –

Chokei 131 – S/ε Saikai 35 Saikai 33 R +

Aikei 172 – T/β Aikei 147 Saikai 35 ND +

T04204-13 – (W/α)4) Aikei 128 Saikai 35 ND +

T03097-19 – T/β Aiyutaka Hokkai 87 ND +

T05003-1 – A/ε V2 Haru-akari ND –

10H15 – S/ε Saikai 35 Pike ND +

10H16 – S/ε Saikai 35 Pike ND +

10H17 – S/ε Saikai 35 Pike ND +

Inca-no-mezame

Sakurafubuki

TD0101

Saikai 35

W82229-5US-W1

Solanum phureja(PI 225683)

P10173-5SD219-5*

SD375-5*

KonafubukiWB66201-10

Toyoshiro

Toyo-akariWB61037-4

Tunika

Chromosome doubling

2x

*2x S. tuberosum ssp. andigena

Fig. 1 Pedigree of Saikai 35

Am. J. Pot Res (2012) 89:63–72 65

Taste of steamed potatoes was evaluated 1 month afterharvest from the spring crop and 2 weeks after harvest fromthe fall crop by the same three members as sensorypanelists. Taste was scored from 1 (bad) to 5 (very good)with Dejima as a standard (score 4), and the three seasonmeans were compared. Carotenoid contents were measuredfrom three tubers with a size of approximately 100 g byanalytical high performance liquid chromatography asdescribed in Kobayashi et al. (2008). Data was obtainedfrom tubers of the spring crop of 2010.

Disease and pest resistances were evaluated by biologicalassays in the fields or by artificial inoculation. Five plants ina row were grown with two replications in a heavily infestedfield with potato cyst nematodes in mid-May. Each of threerandomly chosen plants in the row was evaluated by ratingfrom 0 (no cyst) to 4 (many cysts), and the mean wascalculated as Infection index from 0 (no cyst) to 100 (manycysts on all tested plants). For a PVY resistance assay, tenplants per genotype were grown in pots and inoculated withPVYO or PVYN to three leaves per plant in a greenhouse.One month later, upper leaves were examined by ELISA testand transmission percentages from inoculated leaves to upperleaves were obtained. For a bacterial wilt resistance assay,eight plants in a row were grown with two replications in fallseasons, and percentages of diseased plants were obtained.For a late blight resistance assay, five plants in a row weregrown with three replications in spring seasons under naturalinfection without fungicide application. Plants were separatelyscored from 0 (<2% leaflets infected) to 6 (100% leafletsinfected) and the mean was obtained as the Infection index.For a common scab resistance assay, five plants in a row weregrown with two replications in a heavily infested field inspring and fall seasons. Harvested tubers were visuallyinspected and Infection indices from 0 (no lesions) to 100(serious defects as Nishiyutaka) were obtained.

Diagnostic marker bands for H1 and Rychc were detectedusing a pair of N146 and N195, and a pair of Ry186 andRy364 markers, respectively (Table 2) (Takeuchi et al.2009). To both sets of markers, the granule-bound starchsynthase I gene (GBSS) marker was included as a positive

control to check whether the PCR was performed correctlyor not. PCR reaction was set in the volume of 10 μlconsisting of 2 μl of template DNA (approximately 5 ng/μl),5 μl of Ampdirect® Plus (Shimadzu Co., Japan), 0.25 units ofTaq DNA polymerase (BIOTAQ™ HS DNA Polymerase,Bioline Ltd., UK) and 0.3 μM primers (Table 2). Thermalcycling was performed using Veriti® 96-well thermal cycler(Applied Biosystems) (one cycle of 10 min at 95°C,followed by 35 cycles of 30 s at 94°C, 30 s at 55°C and1.5 min at 72°C, and then, terminated with one cycle of5 min at 72°C). A newly developed multiplex PCR methodfor simultaneous detection of diagnostic DNA markers ofH1, Rychc and resistance genes to Potato virus X (Rx1) andlate blight (R1 and R2) was also tested by the protocol ofMori et al. (2011). PCR products were separated byelectrophoresis on a 1.4% agarose gel in 1× TAE buffer,stained in 2.5 μl of Midori Green DNA Stain (NipponGenetics Europe GmbH, Germany) per 100 ml of 1× TAEbuffer for 30 min with gentle shaking, followed by de-staining in used 1× TAE buffer for 30 min with gentleshaking. Photographic images were captured over UV lamp.

Pollen stainability was examined for limited geno-types in 2010. A sample of 247–360 pollen grains wasstained with aceto-carmine and calculated by 100�ðthe number of stained pollen grains=the number of totalpollen grainsÞ:

Table 2 Diagnostic markers forresistance genes, H1 and Rychc,and the granule-bound starchsynthase I gene (GBSS) (allcited from Takeuchi et al. 2009)

Target gene Marker Primer (5′–3′ sequence) Size (bp)

H1 N146 N146-17 (AAGCTCTTGCCTAGTGCTC) 506N146-22 (AGGCGGAACATGCCATG)

H1 N195 N195-09 (TGGAAATGGCACCCACTA) 337N195-06 (CATCATGGTTTCACTTGTCAC)

Rychc Ry186 RY186-11 (TGGTAGGGATATTTTCCTTAGA) 587RY186-12 (GCAAATCCTAGGTTATCAACTCA)

Rychc Ry364 RY364-14 (CTATTATAAGTCTGGTACTAGGACG) 298RY364-19 (GGCTATATGTTCAATGAATTCATGCTAA)

GBSS GBSS GBSS-01 (ATGGCAAGCATCACAG) 981GBSS-02 (CAAAACTTTAGGTGCCTC)

RAPD marke

r 38-530

MFutureSaikai 35

Fig. 2 Evaluation of the plants of T02128 family using RAPD marker38–530 for the resistance gene Rychc. M contains lDNA HindIII/EcoRI double digests (Nippon gene)

66 Am. J. Pot Res (2012) 89:63–72

Results and Discussion

Breeding Process

In May of 2002, TD0101 was crossed as a female withpollen of Sakurafubuki. Twenty pollinations set 13 berriescontaining 1,007 seeds. Four hundred seeds (T02128

family) were sown in September of 2002, and 159 tuber-setting genotypes were selected. In February of 2003, onetuber per genotype was planted in a field, from which 14genotypes were selected on the basis of general appearanceof the tuber shape and size distribution. By a line selectionin the fall of 2003, agronomic traits were evaluated, and H1and Rychc genotypes were estimated using molecularmarkers PCN and 38–530 (Fig. 2), respectively. The markeranalysis indicated five genotypes had both PCN and 38–530 markers. By the spring cropping of 2004, one clonewith better taste and agronomic traits (clone T02128-14)was selected. Yield trials were continued for several yearsand agronomic performances and disease resistances wereexamined. Clonal identity was upgraded to Chokei 126 in2005, and to Saikai 35 in February of 2006.

Morphological Description and Growth Habit

Photographs of Saikai 35 are shown in Fig. 3. Saikai 35was slightly taller and had a shorter tuber dormancyperiod than Dejima and Nishiyutaka (Table 3). Vinematurity of Saikai 35 was medium to late, which wasslightly earlier than those of Dejima and Nishiyutaka.Saikai 35 had purple flowers, and its tubers werecharacterized by yellow flesh and skin with red-coloredshallow eyes.

Tuber Yield

Saikai 35 produced lower marketable yields from springcropping (6 year mean=331 kg/a) than Dejima and

Table 3 Morphologicalcharacteristics and growth habitsof Saikai 35 in comparisonwith Dejima and Nishiyutaka(2005–2009)

Values followed by the sameletter are not significantlydifferent among clonesat p=0.05 by Tukey’s test

Characteristic Season Saikai 35 Dejima Nishiyutaka

Emergence date Spring May 16th May 17th May 19th

Fall Sep. 28th Sep. 25th Oct. 1st

Vine shape Spring Semi-erect Semi-erect Erect

Fall Semi-erect Erect Erect

Stem length (cm) Spring 51±5.8 a 50±5.0 a 40±2.7 b

Fall 39±4.5 a 36±3.9 ab 28±7.0 b

No. of stems per hill Spring 1.8±0.3 a 1.6±0.2 ab 1.4±0.2 b

Fall 2.2±0.4 a 2.5±0.4 a 1.9±0.5 a

Tuber dormancy period (days) Spring 60±8.0 a 82±4.1 b 106±4.1 c

Fall 86±6.7 a 95±2.6 ab 100±2.8 b

Flower color Purple White White

Tuber shape Short ovate Short ovate Short ovate

Eye depth Shallow Semi-shallow Semi-shallow to medium

Skin texture Smooth Semi-smooth Medium

Skin color Yellow Pale beige Pale beige

Eye color Red Pale beige Pale beige

Flesh color Light yellow Pale yellow Pale yellow

A B

C D

Fig. 3 Morphology of Saikai 35: (A) whole plant, (B) inflorescence,(C) leaf, and (D) tubers

Am. J. Pot Res (2012) 89:63–72 67

Nishiyutaka (416 and 419 kg/a, respectively), and fallcropping as well (185 kg/a vs. 271 and 183 kg/a,respectively) (Table 4). The number of marketable tubersper hill of Saikai 35 was larger, but the mean tuber weightwas lower, which resulted in lower yields. However, thespecific gravity of Saikai 35 (1.085 in spring cropping and1.082 in fall cropping) was significantly higher than thoseof Dejima (1.068) and Nishiyutaka (1.066) in the springcropping, and Nishiyutaka (1.063) in the fall cropping(Table 4).

Tuber Quality

Saikai 35 tasted as good (a score of 4.8) as Inca-no-mezame(5.0), and better than Dejima (4.0) and Nishiyutaka (2.6).Saikai 35 contained carotenoids (58.8±4.46 μg lutein and17.4±4.99 μg of zeaxanthin per 100 g fresh weight), whichlikely contributed to the yellow flesh and good taste,because Dejima contained 48.1±2.26 μg lutein and nozeaxanthin per 100 g fresh weight (no data was availablefrom Nishiyutaka).

Disease and Pest Resistances

Saikai 35 was extremely resistant to potato cyst nematode(pathotype Ro1), PVY strains PVYO and PVYN, and alsoresistant to bacterial wilt (Table 5).

DNA Marker Analysis

Saikai 35 showed marker bands PCN and 38–530, and wasconfirmed by biological assays as a H1 and Rychc holder asdescribed above. Genetic segregations of these markerbands indicated that Saikai 35 was likely simplex for theseresistance genes (Table 6). More accurate diagnosticmarkers also supported that Saikai 35 has both H1 andRychc genes (Fig. 4).

Crossability with Saikai 35 and its Derived Progenies

Saikai 35 showed very high pollen stainability (80.7%). Itwas crossed as a male onto seven cultivars or breedinglines, which produced berries with 35.4–68.2% berry

Table 5 Biological assays for potato cyst nematode, Potato virus Y, bacterial wilt, late blight and common scab. Resistance classes (R resistant, Mmedium, MS moderately susceptible, S susceptible) and their supporting evaluation data in parentheses are shown

Disease or pest Saikai 35 Dejima Nishiyutaka

Potato cyst nematode1) R (0.0 a) S (27.1±2.10 b) S (29.2±4.15 b)

Potato virus Y (PVYO) 2) R (0.0 a) S (83.5±16.50 b) S (no data)

Potato virus Y (PVYN) 2) R (0.0 a) S (90.0±10.00 b) S (no data)

Bacterial wilt3) R (0.0 a) S (76.7±23.10 b) M (67.0±14.01 b)

Late blight4) MS (4.6±0.73 a) MS (4.8±0.58 a) S (5.5±0.33 a)

Common scab5) M (60.1±23.62 a) MS (85.1±31.37 b) S (100.0 b)

1) Infection indices from 0 (no cyst) to 100 (many cysts on all tested plants). Two year mean (2006–2007)2) Transmission percentages from inoculated leaves to upper leaves. Two year mean (2006–2007). Nishiyutaka was not tested for this study, butpreviously known as susceptible3) Percentages of diseased plants. Three year mean (2008–2010)4) Infection indices from 0 (<2% leaflets infected) to 6 (100% leaflets infected). Six year mean (2005–2010)5) Infection indices from 0 (no lesions) to 100 (serious defects as Nishiyutaka). Six year (two seasons each) mean (2005–2010)

Values followed by the same letter are not significantly different among clones at p=0.05 by Tukey’s test

Table 4 Yield-relatedcharacteristics of Saikai 35 incomparison with Dejima andNishiyutaka. The 6 year mean(2005–2010) for spring croppingwith mulching and the 5 yearmean (2005–2009) for fallcropping were compared

Values followed by the sameletter are not significantlydifferent among clonesat p=0.05 by Tukey’s test

Characteristics Cropping season Saikai 35 Dejima Nishiyutaka

No. of marketabletubers per hill

Spring 6.2±1.1 a 4.7±1.0 b 4.8±0.4 ab

Fall 3.6±0.5 a 3.6±0.8 a 2.5±0.4 a

Mean tuber weight (g) Spring 86±11 a 144±19 b 144±18 b

Fall 83±10 a 121±15 b 117±9 b

Marketable yield (kg/a) Spring 331±66 a 416±80 b 419±70 b

Fall 185±35 a 271±68 a 183±43 a

Specific gravity Spring 1.085±0.0046 a 1.068±0.0190 b 1.066±0.0025 b

Fall 1.082±0.0077 a 1.071±0.0050ab 1.063±0.0064 b

68 Am. J. Pot Res (2012) 89:63–72

setting rates and 84.5–255.9 seeds per berry (Table 7).When Saikai 35 was used as a female, berry setting rateswere 46.8–58.6% and 126.9–135.3 seeds per berry wereobtained. These results indicated Saikai 35 had high maleand female fertility.

Male fertility of the progenies from Saikai 35 wasexamined (Table 8). Aikei 172 was derived from Saikai 35

as a male and has typical S. tuberosum cytoplasm (T/β)(Table 1). It showed high pollen stainability (77.2%). Thecrosses of Aikei 172 as a male onto four genotypesproduced berries with 9.0–30.1% berry setting rates and24.6–37.2 seeds per berry.

Saikai 39 and T04204-13, derived from Saikai 35 as amale, have S. demissum-derived cytoplasm (W/α). Bothproduced abundant pollen grains, and the pollen stainabilityof Saikai 39 was 79.6%, implying high male fertility.Nevertheless, the pollen of Saikai 39 failed to set berriescompletely onto four cultivars and one breeding line, whileT04204-13 showed relatively low berry setting rates (4.3–13.7%). Such no or very low function of the pollen fromthese two genotypes might be attributed to the interaction ofa cytoplasmic factor or factors of S. demissum with nuclearfactors contributed by Saikai 35 (Dionne 1961).

Saikai 37 and Chokei 131 were derived from Saikai 35as a female, thus both having the same S/ε cytoplasm asSaikai 35. The pollen stainability of Saikai 37 was 87.9%.These two genotypes yielded high male fertility with 28.1–55.9% berry setting rates and 101.5–219.3 seeds per berry(Table 8).

These suggest that the S. phureja-derived S/ε cytoplasmdid not cause male sterility by interaction with nucleargenomic factor(s). Consequently, Saikai 35 showed goodmale and female fertility, and as long as Saikai 35 was used asa female, resulting progenies maintained good male fertility.

Usefulness of Saikai 35

We successfully combined H1 and Rychc genes with thefavorable traits of Inca-no-mezame, resulting in Saikai 35, agenotype with good taste, short tuber dormancy andresistances to potato cyst nematodes, PVY and bacterialwilt. However, the tuber yield in the spring cropping wassignificantly lower than those of major cultivars.

Rychc shows extreme resistance to any PVY strains sofar tested. From progenies of Saikai 35, advancedbreeding lines with PVY resistance have already beenselected (Saikai 37, Saikai 38, Saikai 39, and Chokei

(A)M 1 2 3 4 5 76 98 1011

(B)

(C)

1213

R1PVXGBSS

N146Ry186

N195

GBSS

N146N195

GBSS

Ry364Ry186

Fig. 4 Diagnostic marker bands for identification of Rychc (A) and H1(B) genes. Multiplex PCR method (Mori et al. 2011) can identifysimultaneously five resistance genes (in C, a late blight resistancegene R2 was not possessed by any genotypes). The granule-boundstarch synthase I gene (GBSS) marker is included as a positive controlto check whether the PCR was performed correctly or not. Theleft-most lane in each gel contained HindIII-digested lDNA. 1Nishiyutaka, 2 Dejima, 3 Haru-akari, 4 Pike, 5 10H15, 6 10H16, 710H17, 8 Saikai 37, 9 Saikai 38, 10 Saikai 39, 11 Chokei 131, 12Aikei 172, 13 Saikai 35

Table 6 Genetic segregationof marker bands in hybridprogenies from Saikai 35

1) Marker band being absent(female) × present (male)2) Expected segregation ratiosfrom a cross of nulliplex (aaaa) ×simplex(Aaaa) genotypes by therandom chromosome assortmentmodel (1A:1a) or randomchromatid assortment model(0.87A:1a)

Family Cross combination1) No. Marker segregation P-value by Chi-square test2)

Female Male Presence Absence 1:1 0.87:1

PCN marker (linked with H1)

T04090 Dejima Saikai 35 41 21 20 0.876 0.546

N146/N195 marker (linked with H1)

T06026 Hokkai 56 Saikai 35 167 80 87 0.588 0.721

RAPD marker 38–530 (linked with Rychc)

T04090 Dejima Saikai 35 41 22 19 0.639 0.360

T06026 Hokkai 56 Saikai 35 178 81 97 0.243 0.785

Am. J. Pot Res (2012) 89:63–72 69

131) (Table 1). A set of very tightly linked markerssandwiching Rychc (Takeuchi et al. 2009) can facilitatemarker-assisted selection (Fig. 4). Clones such as10H15,10H17 and Aikei 172 have been selected as possiblemultiple resistance genotypes based on diagnostic DNAmarkers (Fig. 4). Therefore, Saikai 35 is particularlyuseful as a PVY resistance gene donor. An additional

advantage of Saikai 35 is that has S/ε cytoplasm, whichcan avoid male sterility problems frequently caused by thecytoplasm of common potato (T/β), or strictly caused byS. demissum cytoplasm (W/α) and S. stoloniferumcytoplasm (W/γ). In this context, we recommend to useSaikai 35 as a female to assure good male fertility inthe progeny.

Table 8 Crossability ofSaikai 35-derived progeniesas male parents, which havedifferent cytoplasms

Female parent Male parent No. of flowerspollinated

No. of fruits Berry settingrate (%)

No. of seedsper fruit

1) T/β × T/β

Aiyutaka Aikei 172 84 25 29.8 30.6

Chokei 124 Aikei 172 58 11 19.0 28.0

Dejima Aikei 172 67 6 9.0 37.2

Haru-akari Aikei 172 83 25 30.1 24.6

2) T/β × W/α

Aiyutaka Saikai 39 92 0 0 0

Chokei 124 Saikai 39 116 0 0 0

Dejima Saikai 39 67 0 0 0

Haru-akari Saikai 39 33 0 0 0

Nishiyutaka Saikai 39 28 0 0 0

Chokei 124 T04204-13 88 12 13.6 37.1

Haru-akari T04204-13 46 2 4.3 28.0

Nishiyutaka T04204-13 51 7 13.7 69.6

3) T/β × S/ε

Aiyutaka Saikai 37 58 26 44.8 139.2

Chokei 124 Saikai 37 60 33 55.0 129.0

Dejima Saikai 37 92 35 38.0 207.4

Haru-akari Saikai 37 78 31 39.7 147.3

Nishiyutaka Saikai 37 32 9 28.1 123.0

Aiyutaka Chokei 131 31 15 48.4 101.5

Chokei 124 Chokei 131 68 38 55.9 165.4

Dejima Chokei 131 29 15 51.7 219.3

Haru-akari Chokei 131 47 22 46.8 172.1

Nishiyutaka Chokei 131 37 18 48.6 139.1

Table 7 Crossability of Saikai35 used as male and femaleparents

Female parent Male parent No. of flowerspollinated

No. of fruits Berry settingrate (%)

No. of seedsper fruit

Aiyutaka Saikai 35 115 66 57.4 152.2

Dejima Saikai 35 64 28 43.8 155.8

Nishiyutaka Saikai 35 123 51 41.5 99.7

Chokei 124 Saikai 35 45 23 51.1 255.9

Haru-akari Saikai 35 57 25 43.9 154.8

T03097-19 Saikai 35 48 17 35.4 84.5

T05003-1 Saikai 35 44 30 68.2 109.8

Saikai 35 Haru-akari 222 104 46.8 126.9

Saikai 35 T03097-19 58 34 58.6 129.0

Saikai 35 T05003-1 89 44 49.4 135.3

70 Am. J. Pot Res (2012) 89:63–72

Acknowledgments We thank coworkers in the Central AgriculturalExperiment Station and the Kitami Agricultural Experiment Station,Hokkaido Research Organization, for performance of or assistance inbiological assays of PVY and PCN resistances, respectively, and K.Mizoue, S. Sakai, Y. Kanasaki, N, Shikaya, S. Ohmachi, T.Matsushima and Y. Mukaida, Nagasaki Agricultural and ForestryTechnical Development Center, for technical assistance. This studywas supported in part by the Authorization Test Project, Agriculture,Forestry and Fisheries Res. Council, and by Calbee Inc.

References

Asama, K., H. Ito, N. Murakami, and T. Itoh. 1982. New potatovariety “Konafubuki” (in Japanese). The Bulletin of HokkaidoPrefectural Agricultural Experiment Stations 48: 75–84.

Black, W. 1943. Inheritance of resistance to two strains of blight(Phytophthora infestans de Bary) in potatoes. Transactions of theRoyal Society of Edinburgh 61: 137–147.

Bryan, G.J., J. McNicoll, G. Ramsay, R.C. Meyer, and W.S. De Jong.1999. Polymorphic simple sequence repeat markers in chloro-plast genomes of Solanaceous plants. Theoretical and AppliedGenetics 99: 859–867.

Cockerham, G. 1943. Potato breeding for virus resistance. Annals ofApplied Biology 30: 105–108.

Cooper, J.P., and H.W. Howard. 1952. The chromosome numbers ofseedlings from the cross Solanum demissum × tuberosumbackcrossed by S. tuberosum. Journal of Genetics 50: 511–521.

Dionne, L.A. 1961. Cytoplasmic sterility in derivatives of Solanumdemissum. American Potato Journal 38: 117–120.

Gebhardt, C., and J.P.T. Valkonen. 2001. Organization of genescontrolling disease resistance in the potato genome. AnnualReview of Phytopathology 39: 79–102.

Gebhardt, C., D. Mugniery, E. Ritter, F. Salamini, and E. Bonnel.1993. Identification of RFLP markers closely linked to the H1gene conferring resistance to Globodera rostochiensis in potato.Theoretical and Applied Genetics 85: 541–544.

German, T.L. 2001. Potato virus Y. In Compendium of potato disease,2nd ed, ed. W.R. Stevenson, R. Loria, G.D. Franc, and D.P.Weingartner, 69–71. St. Paul: APS Press.

Grun, P., C. Ochoa, and D. Capage. 1977. Evolution of cytoplasmfactors in tetraploid cultivated potatoes (Solanacease). AmericanJournal of Botany 64: 412–420.

Hosaka, K. 1986. Who is the mother of the potato? - restrictionendonuclease analysis of chloroplast DNA of cultivated potatoes.Theoretical and Applied Genetics 72: 606–618.

Hosaka, K., and R.E. Hanneman Jr. 1988. The origin of the cultivatedtetraploid potato based on chloroplast DNA. Theoretical andApplied Genetics 76: 172–176.

Hosaka, K., G.A. de Zoeten, and R.E. Hanneman Jr. 1988. Cultivatedpotato chloroplast DNA differs from the wild type by onedeletion – evidence and implications. Theoretical and AppliedGenetics 75: 741–745.

Hosaka, K., Y. Hosaka, M. Mori, T. Maida, and H. Matsunaga. 2001.Detection of a simplex RAPD marker linked to resistance topotato virus Y in a tetraploid potato. American Journal of PotatoResearch 78: 191–196.

Huijsman, C.A. 1955. Breeding for resistance to the potato rooteelworm. 2. Data on the inheritance of resistance in Andigenum-Tuberosum crosses obtained in 1954. Euphytica 4: 133–140.

Irikura, Y. 1968. Studies on interspecific crosses of tuber-bearingSolanums. I. Overcoming cross-incompatibility between Solanumtuberosum and other Solanum species by mean of inducedpolyploids and haploids (in Japanese). Hokkaido AgriculturalExperiment Station Shuho 92: 21–37.

Kobayashi, A., A. Ohara-Takada, S. Tsuda, C. Matsuura-Endo, N.Takada, Y. Umemura, T. Nakao, T. Yoshida, K. Hayashi, and M.Mori. 2008. Breeding of potato variety “Inca-no-hitomi” with avery high carotenoid content. Breeding Science 58: 77–82.

Komura, K., and K. Ohbayashi. 2002. Production of a hybrid progenybetween doubled Andes-aka (6x) and the potato variety (inJapanese). Kyushu-Nogyo-Kenkyu 64: 46.

Lössl, A., N. Adler, R. Horn, U. Frei, and G. Wenzel. 1999.Chondriome type characterization of potato: mt α, β, γ, δ, εand novel plastid-mitochondrial configurations. Theoretical andApplied Genetics 99: 1–10.

Lössl, A., M. Götz, A. Braun, and G. Wenzel. 2000. Molecularmarkers for cytoplasm in potato: Male sterility and contributionof different plastid-mitochondrial configurations to starch pro-duction. Euphytica 116: 221–230.

Maoka, T., S. Sugiyama, Y. Maruta, and T. Hataya. 2010. Applicationof cDNA microarray for simultaneous detection of 12 potatoviruses. Plant Disease 94: 1248–1254.

Mori, K., Y. Sakamoto, N. Mukojima, S. Tamiya, T. Nakao, T. Ishii,and K. Hosaka. 2011. Development of a multiplex PCR methodfor simultaneous detection of diagnostic DNA markers of fivedisease and pest resistance genes in potato. Euphytica 180: 347–355.

Mori, M., S. Tsuda, N. Mukojima, A. Kobayashi, C. Matsuura-Endo,A. Ohara-Takada, and I.S.M. Zaidul. 2007. Breeding of potatocyst nematode resistant varieties in Japan. In Potato productionand innovative technologies, ed. A.J. Haverkort and B.V.Anisimov, 328–339. The Netherlands: Wageningen AcademicPublishers.

Mori, M., A. Ohara-Takada, Y. Umemura, T. Maida, T. Kimura, N.Takada, A. Kobayashi, S. Tsuda, T. Nakao, T. Yoshida, C.Matsuura-Endo, and K. Hayashi. 2009. Breeding of diploidpotato variety “Inca no mezame” with orange in the tuber fleshcolor (in Japanese). Breeding Research 11: 53–58.

Mukojima, N., T. Nakao, K. Mori, and K. Komura. 2003. Change ofcharacteristics of 2x potato by chromosome doubling treatment(in Japanese). Kyushu-Nogyo-Kenkyu 65: 37.

Munoz, F.J., R.L. Plaisted, and H.D. Thurston. 1975. Resistance topotato virus Y in Solanum tuberosum ssp. andigena. AmericanPotato Journal 52: 107–115.

Murakami, N., H. Matsunaga, K. Senda, Y. Okuyama, M. Iritani, K.Asama, Y. Mitsui, and K. Shimizu. 1995. A new potato variety“Konamuso (=Sakurafubuki)” (in Japanese). The Bulletin ofHokkaido Prefectural Agricultural Experiment Stations 68: 1–16.

Pineda, O., M.W. Bonierbale, and R.L. Plaisted. 1993. Identificationof RFLP markers linked to the H1 gene conferring resistance tothe potato cyst nematode Globodera rostochiensis. Genome 36:152–156.

Plaisted, R.L., and R.W. Hoopes. 1989. The past record and futureprospects for the use of exotic potato germplasm. AmericanPotato Journal 66: 603–627.

Powell, W., E. Baird, N. Duncan, and R. Waugh. 1993. ChloroplastDNA variability in old and recently introduced potato cultivars.Annals of Applied Biology 123: 403–410.

Provan, J., W. Powell, H. Dewar, G. Bryan, G.C. Machray, and R.Waugh. 1999. An extreme cytoplasmic bottleneck in the modernEuropean cultivated potato (Solanum tuberosum) is not reflectedin decreased levels of nuclear diversity. Proceedings of the RoyalSociety, London, B 266: 633–639.

Ross, H. 1958. Inheritance of extreme resistance to virus Y inSolanum stoloniferum and its hybrids with Solanum tuberosum.In Proceedings of Third Conference on Potato Virus Diseases,204–211.

Ross, H. 1986. Potato breeding-problems and perspectives. Berlin:Verlag Paul Parey.

Am. J. Pot Res (2012) 89:63–72 71

Rudorf, W. 1950. Methods and results of breeding resistant strains ofpotatoes. American Potato Journal 27: 332–339.

Sato, M., K. Nishikawa, K. Komura, and K. Hosaka. 2006. Potatovirus Y resistance gene, Rychc, mapped to the distal end of potatochromosome 9. Euphytica 149: 367–372.

Sukhotu, T., O. Kamijima, and K. Hosaka. 2004. Nuclear andchloroplast DNA differentiation in Andean potatoes. Genome47: 46–56.

Takeuchi, T., J. Sasaki, T. Suzuki, H. Horita, S. Hiura, S. Iketani, R.Fujita, and K. Senda. 2009. DNA markers for efficient selection

of disease and pests resistance genes in potato (in Japanese).Hokkaido Nogyo-Shiken-Kaigi-Shiryo 2008: 1–26.

Tanaka, T., and K. Komura. 2000. Development of a genetic diagnosistechnique for detection of resistant feature to Globoderarostochiensis in potato (in Japanese). The Bulletin of NagasakiPrefectural Agricultural and Forestry Experiment Stations 26: 1–18.

Waugh, R., D.R. Glendinning, N. Duncan, and W. Powell. 1990.Chloroplast DNA variation in European potato cultivars. PotatoResearch 33: 505–513.

72 Am. J. Pot Res (2012) 89:63–72