Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
UNIVERSIDAD POLITÉCNICA DE MADRID
ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA
AGRONÓMICA, ALIMENTARIA Y DE BIOSISTEMAS
GRADO EN BIOTECNOLOGÍA
DEPARTAMENTO DE PRODUCCIÓN AGRARIA
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
TRABAJO FIN DE GRADO
Autor: Ainhoa García Terrón
Co-Tutor Profesional: Etienne Mouisel Co-Tutor UPM: David Menoyo Luque
Julio de 2019
ii
UNIVERSIDAD POLITÉCNICA DE MADRID
ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA
AGRONÓMICA, ALIMENTARIA Y DE BIOSISTEMAS
GRADO EN BIOTECNOLOGÍA
C H A R A C T E R I S A T I O N O F A D I P O S E - S P E C I F I C P A R T I A L D E L E T I O N O F H O R M O N E - S E N S I T I V E L I P A S E D U R I N G
O B E S I T Y
T R A B A J O F I N D E G R A D O
A i n h o a G a r c í a T e r r ó n
M a d r i d , 2 0 1 9
Director: David Menoyo Luque
Profesor Titular de la Universidad
Dpto de Producción Agraria
iii
T Í T U L O D E L T R A B A J O : C H A R A C T E R I S A T I O N O F A D I P O S E -S P E C I F I C P A R T I A L D E L E T I O N O F H O R M O N E - S E N S I T I V E
L I P A S E D U R I N G O B E S I T Y
Memoria presentada por Ainhoa García para la obtención del título de Graduado en
Biotecnología por la Universidad Politécnica de Madrid
Fdo: Alumno
VºBº Tutor y Director del TFG
D. David Menoyo Luque
Profesor Titular de la Universidad
Dpto de Producción Agraria
ETSIAAB - Universidad Politécnica de Madrid
Madrid, 28, Junio, 2019
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
iv
INDEX
INDEX .............................................................................................................................................iv
FIGURES INDEX .............................................................................................................................. v
ACRONYMS LIST ............................................................................................................................vi
ABSTRACT ..................................................................................................................................... vii
CHAPTER 1. INTRODUCTION ..................................................................................................... 1
CHAPTER 2. MATERIALS & METHODS ....................................................................................... 4
2.1 Animals .......................................................................................................................... 4
2.2 Echo Magnetic Resonance Imaging (EchoMRI) ............................................................. 5
2.3 Insulin (ITT) and Glucose (GTT) Tolerance Tests ........................................................... 5
2.4 Evaluation of gene expression ...................................................................................... 6
2.4.1 RNA extraction ...................................................................................................... 6
2.4.2 Retrotranscription - qPCR...................................................................................... 6
2.5 Protein quantification ................................................................................................... 7
2.5.1 Protein Extraction .................................................................................................. 7
2.5.2 Protein quantification and Western-Blot .............................................................. 7
2.6 Statistics ........................................................................................................................ 7
CHAPTER 3. RESULTS ................................................................................................................. 8
3.1 Model validation: the induction of the HSL deletion is different among the fat depots,
but protein expression has not a direct correlation with gene expression levels. ................... 8
3.2 HSL partial deletion induced during adulthood does not have an effect on
hypercaloric diet-induced weight gain. ..................................................................................... 9
3.3 In chow diet-fed mice, partial deletion of HSL in adulthood entails differences in
tolerance to glucose 6 weeks after induction. .......................................................................... 9
3.4 In vivo tests from weeks 15 and 16 show no significant difference when comparing
HSL partial deletion in adulthood and control groups. ........................................................... 10
CHAPTER 4. DISCUSSION ......................................................................................................... 10
4.1 Model validation – genotype ...................................................................................... 12
4.2 Weigth gain ................................................................................................................. 12
4.3 Tolerance to glucose ................................................................................................... 13
CHAPTER 5. FUTURE PERSPECTIVES ........................................................................................ 15
REFERENCES ................................................................................................................................ 16
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
v
FIGURES INDEX
Figure 1.1.- FA can be released from the adipocyte by hydrolysis of TAGs thank to the ATGL,
HSL and MGL Intermediate products are Diglycerol (DG) and monoglyceride lipid (MGL). ......... 2
Figure 2.1.- Mice genotype obtaining ........................................................................................... 4
Figure 2.2.- Experiments timeline. 2mgof tamoxifen (AdipoHSL+/-, n=8) or oil (AdipoHSL+/+,
n=7) was injected during 5 days at the age of 14 weeks. Mice were fed under a HFD in week 10
post tamoxifen injection. They were euthanized in week 18. GTT= Glucose tolerance test. ITT=
Insulin tolerance test. .................................................................................................................... 5
Figure 3.1.- Quantification of HSL gene expression in AdipoHSL+/- mice induced with tamoxifen
(black, n = 8) or oil (white, n = 7) in a) iWAt or b)pgWAT. Shown as a percentage of HSL
expression versus the control *** p< 0.0001 ............................................................................... 8
Figure 3.2.- Quantification of iWAT HSL protein expression in mice AdipoHSL+/- with tamoxifen
(black, n = 8) versus control (white, n = 7), normalized according to GAPDH .............................. 9
Figure 3.3.- Measure of a) weight gain and b) % of fat mass gain, expressed as a variation
relative to the weight at time 0 (pre-induction). .......................................................................... 9
Figure 3.4.- Results of the GTT performed at the sixth week. Time 0 = glucose injection.
AdipoHSL mice with tamoxifen (black, n = 8) versus control (white, n = 7). ** p < 0.001 .......... 10
Figure 3.5.- a) Results of the GTT performed at the 15th week. b) Insulin-ELISA on blood from
the 15th week. c) Results of the ITT performed during the 16th week. AdipoHSL mice with
tamoxifen (black, n = 8) versus control (white, n = 7). *** p< 0.0001. ....................................... 11
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
vi
ACRONYMS LIST
T2D:Type 2 Diabetes
FA: Fatty Acids
IR: Insulin Resistance
HSL: Hormone Sensitive Lipase
WHO: World Health Organization
WAT: White Adipose Tissue
o pgWAT: perigonadal WAT
o iWAT: subcutaneous WAT
TAG: Triacylglycerol
BMI: Body Mass Index
ATGL: Adipocyte Triacylglycerol Lipase
MGL: Monoglyceride Lipase
BAT: brown fat
HFD: High Fat Diet
EchoMRI: Echo Magnetic Resonance Imaging
ITT: Insulin Tolerance Tests
GTT: Glucose Tolerance Tests
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
vii
ABSTRACT
Obesity is a global pandemic, and the rate of mortality due to associated pathologies,
such as type 2 diabetes (T2D), is increasing every year. One of the most substantiated
causes of obesity-induced T2D concerns the high amount of fatty acids (FA) delivered in
the blood by a hypertrophic adipocyte. FA do not oxidize and therefore are accumulated
in non-adipose organs, leading to insulin resistance (IR) (Large et al. 1998). Therefore,
the study of lipid metabolism- related enzymes becomes increasingly important. Among
them the lipolytic pathway and notably hormone-sensitive lipase (HSL), is the
cornerstone of functional fat cell maintenance (Girousse et al. 2013). We attempted to
advance in the development of a new mouse model characterized by a lipid specific HSL
happloinsufficiency it order to progress in the study of this lipase. We have validated the
model by obtaining mice with nearly half deletion of HSL specific to adipose tissues.
Nevertheless, the tolerance tests results do not show noticeable differences between
control and study group. Such genetic modification do not seem to have systemic
metabolic effects.
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
1
CHAPTER 1. INTRODUCTION
Obesity and overweight are defined by the WHO as "as an abnormal or excessive
accumulation of fat that can be detrimental to health". Obese people are considered
those who exceed a 30 body mass index or BMI (kg of weight / m2 of height). 13% of
the world population was obese in 2016 (World Health Organization 2018b). In
particular, the prevalence of obesity among adults in Spain is 21,6% (Aranceta-Bartrina
2016). This pathology is a risk factor for the development of other diseases, such as
cardiovascular diseases, insulin resistance, diabetes, diseases of the locomotor system
and some types of cancer(World Health Organization 2018). 85% of type 2 diabetics are
overweight (Fundación para la diabetes n.d.). It is becoming increasingly important and
13,8% of adult Spanish population already suffer from type 2 diabetes (Calle 2011).
White adipose tissue (WAT) is the most affected tissue in obesity. It is mainly formed by
adipocytes, where fatty acids (FA) accumulate in triacylglycerol (TAG) and constitute the
main energy reserve of the body. In addition to adipocytes, the stromal vascular fraction
is part of the tissue, in which there are preadipocytes, stem cells, fibroblasts, endothelial
and immune cells, such as macrophages and lymphocytes (Morigny et al, 2016).
Different WAT pads exist in the body, that differ by their localization (subcutaneous vs
visceral) and their association to metabolic disorder, being visceral fat pad expansion
linked to greater insulin resistance (Castro et al. 2014). The fact that insulin-sensitive
tissues (muscle, liver or fat) do not respond properly to insulin lead to an oversecretion
of insulin by the pancreas permitting a transitory maintain of glycemia that could
become not enough to avoid a chronic hyperglycemia. Chronic hyperglycemia (>1.26 gl-1
measured twice at fasted states) is the definition of the diabetes (Mouri and Badireddy
2019).
One explanation largely described of insulin resistance concerns the high amount of free
FA delivered by obese WAT at the basal state in the blood, (Boden 2011). This excess of
FA is not completely oxidized by tissues that need such substrate, leading to a non-fat
depot that inhibit insulin pathway in those organs.
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
2
The controlled balance of esterification and lipolysis and high adipocyte plasticity is what
protects the ectopic deposit of fatty acids, preventing the development of diseases
associated with obesity (Morigny et al. 2016).
In addition, a direct relationship has been established between BMI and how a decrease
in lipolysis improves insulin sensitivity (Girousse et al. 2013).
Adipose tissue controls the process of lipid storage in periods of energy excess,
especially in the postprandial period, by esterification of three FA and a glycerol
molecule, obtaining TAGs. It also controls lipolysis when energy is needed (fasting or
physical exercise), hydrolysing TAG. Hydrolysis takes place by the sequential
intervention of three enzymes: the adipocyte triacylglycerol lipase (ATGL), the hormone-
sensitive lipase (HSL) and the monoglyceride lipase (MGL).
HSL is a limiting step of lipolysis due to its strong hydrolase activity (Lafontan and Langin
2009) and is an important factor in the maintenance of adipose tissue in adulthood
(Girousse et al. 2013), which is why it has become interesting to study as a target to
combat type 2 diabetes.
It has been shown that HSL -/- mice develop a resistance to high fat diet-induced obesity
(Harada et al. 2003). Interestingly, in the work published by the laboratory (Girousse et
al. 2013), it was shown that HSL +/- mice did not become less obese than WT mice
following a same hypercaloric diet, nor was their adipose tissue more inflamed.
Nevertheless, overall FA flows were small. This was accompanied by an improvement in
Figure 1.1.- FA can be released from the adipocyte by hydrolysis of TAGs thank to the ATGL, HSL and MGL Intermediate products are Diglycerol (DG) and monoglyceride lipid (MGL).
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
3
glucose metabolism, both uptake and de novo lipogenesis in insulin-sensitive tissues.
ATGL levels in HSL +/- and WT mice were similar, indicating that there is not any
compensatory mechanism that could explain differences in lipolysis. However, since the
muscle has a high lipolytic activity and an important role in glucose homeostasis, a new
mouse model is being developed: inducing haploinsufficient HSL specifically in adipose
tissue during adulthood.
The aim of this work was to advance the development and characterization of this new
model of adipose tissue specific heterozygosity for the HSL, in a context of diet-induced
obesity.
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
4
CHAPTER 2. MATERIALS & METHODS
2.1 Animals
All procedures where carried on in agreement to the INSERM and Genotoul Anexplo
animal core facility guidelines for the care and use of laboratory animals, by respecting
the three R rules (Replacement, Reduction and Refinement).
Mice used during this job have been obtained by crossing HSL-Lox/Lox mice
(Haemmerle, 2002) and Adiponectin-CreERT2 mice (Sassmann et al., 2010). Those with a
final Adiponectin-Cre-HSL lox/+ genotype where employed during the study.
Fifteen females compose this cohort. Eight of them (henceforth AdipoHSL+/- mice) were
injected intraperitoneally with 2mg of tamoxifen during five days. Control group
(henceforth AdipoHSL+/+ mice, n=7) followed the same protocol but injecting oil. (Figure
2.1).
A tamoxifen injection allowed the activation of the Cre-Recombinase enzyme and thus
the excision of a copy of the HSL gene in the CreLoxPAdipoHSL model.
Since week 10, mice were fed under a High fat diet (HFD) 45% fat.
Figure 2.1.- Mice genotype obtaining
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
5
Timeline of in vivo experiments can be consulted in Figure 2.2.
The mice were fasted between one and two hours before euthanize, to conduct gene
and protein expression tests. The death was carried out by decapitation, collecting the
blood in tubes coated with EDTA anticoagulant. Different organs were extracted and
frozen in liquid nitrogen: perigonadal and subcutaneous WAT (gWAT and iWAT) tissue,
brown fat (BAT), liver and soleus skeletal muscle. Then, tissue are conserved at -80ºC.
The blood was centrifuged 15 minutes at 4 ° C at 5000g to extract the plasma
(supernatant), which was frozen at -20ºC.
2.2 Echo Magnetic Resonance Imaging (EchoMRI)
EchoMRI is used to analyze mice’s body composition based on magnetic resonance
imaging technology. Each mouse is inserted into a clear plastic tube and placed in the
EchoMRI 3-in-1 System (Echo MedicalSystems, Houston, TX). Percentage of fat mass and
lean mass is quantified for each mouse at different weeks.
2.3 Insulin (ITT) and Glucose (GTT) Tolerance Tests
To evaluate the glycaemia regulation in vivo glucose and insulin tolerance tests are
performed. Mice are in a 6 hours fast state before test, in order to measure basal
tolerances. In GTT all mice are injected with 3 g of glucose per kg of body weight, 0.75 U
/ kg of insulin for the ITT. Using an Accu-check glucometer, the blood glucose is
Figure 2.2.- Experiments timeline. 2mg of tamoxifen (AdipoHSL+/-, n=8) or oil (AdipoHSL+/+, n=7) was injected during 5 days at the age of 14 weeks. Mice were fed under a HFD in week 10 post tamoxifen injection. They were euthanized in week 18. GTT= Glucose tolerance test. ITT= Insulin tolerance test.
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
6
measured by taking a drop of blood from the caudal vein 15 minutes before injection
and at 0, 15, 30, 60, 90 and 120 minutes after injection. In addition to GTT, insulin
concentration has been determined following 80-INSMS-E01, E10 "Mouse insulin ELISA"
protocol (ALPCO, 2015). Caudal blood was taken at time 0 and 15 during GTT for this
test.
2.4 Evaluation of gene expression
2.4.1 RNA extraction
The extraction of RNA was carried out according to the protocol provided by the Kit
RNeasyQiagen, based on a Phenol (Quiazol)-chloroform extraction, 700μL and 210μL
respectively for 50-100 mg of tissue in Precellys tubes with microspheres of ceramics.
Subsequently, filtration in RNAeasy columns with RPE 700μL and RW1 500μL buffers and
30-45μL of RNAse free water for the final elution. Total extracted RNA concentration
and purity evaluation is done by spectrophotometry in NanoDrop at 260/280 and 260 /
230nm. Samples are stored at -80ºC.
2.4.2 Retrotranscription - qPCR
To eliminate all possible DNA from the eppendorf, samples are subjected to a DNAse
(1.5μL) process. Afterwards, it is performed a retro-transcription in an inhibitory
environment of RNAsas (RNaseInhibitor 1μL). Mix contains 5 μg of RNA samples, 2μL of
specific primers (HSL gene and the housekeeping HPRT gene), 1μLMultiscribe Reverse
Transcriptase and 0.8μL of DNTPs. Final cDNA concentration is diluted to 5ng/μL and
frozen at -20 ° C.
From diluted cDNA, take 5μL per sample and add 7μL of the PCR mix. The mix is
comprised of FastSybr® Green Master Mix, primers interest genes (Table 1) and H2O
RNAse free. The analysis is carried out by StepOne Software 2.3
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
7
Gene Primer forward Primer reverse
HPRT TGGCCATCTGCCTAGTAAAGC GGACGCAGCAACTGACATTTC
Lipe (HSL) ACTCAACAGCCTGGCAAAAT AGGTCACAGTGCTTGACAGC
2.5 Protein quantification
2.5.1 Protein Extraction
For each sample, 500μL of RIPA buffer (Sigma R0278) enriched in antiproteases and
antiphosphatases (Sigma P5726, P0044, P8340) in a 1/1000th ratio. Between 50 and 100
mg of the WAT samples collected during euthanize are added to Precellys tubes with
ceramic microspheres with the buffer. Then it is crushed two times in Precellys at
5000rpm during 30 seconds and centrifuged at 12700 rpm for 20-40 minutes in 4ºC.
Supernatant is frozen at -20 ° C.
2.5.2 Protein quantification and Western-Blot
They are then diluted in denaturing buffer (SB4X) and heat up to 95ºC, allowing us to
perform Western Blot (BioRad) from 40 μg of protein extracts. After migration and
transfer to the membrane, labelling is performed by using mouse primary anti-HSL and
anti-GAPDH antibodies at 1/ 1000th, and secondary anti-mouse rabbit at 1 /10,000th
coupled to the HRP peroxidase (Cell Signaling Technology). Adding the HRP substrate
and then measuring the bioluminescence (Chemidoc - BioRad) allowed us protein
quantification.
2.6 Statistics
Statistics test were performed with GraphPadPrism program. T-tests or Mann-Whitney
are used for the comparison of two groups according to the normality of the distribution
of values, and ANOVA to compare more than two groups or kinetics by comparing two
or more groups. Significance has been studied by the p-value given by the program. P-
values below 0.001 are considered very significant and p-values below 0.05 significant.
Table 1. Primers used while PCR
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
8
CHAPTER 3. RESULTS
3.1 Model validation: the induction of the HSL deletion is different among the fat
depots, but protein expression has not a direct correlation with gene expression
levels.
Tamoxifen-induced HSL deletion in adipose tissue was verified in two different fat pads.
It shows a significant 40% mRNA decrease in AdipoHSL+/- subcutaneous tissue relative
to the control group (Figure 3.1a).
However, in perigonadal tissue there is no significant difference compared with the
control group. (Figure 3.1b).
Surprisingly, we found that HSL protein levels in the WAT do not vary between control
and induced groups (Figure 3.2) even though mRNA levels present in WAT were
significantly different.
Figure 3.1.- Quantification of HSL gene expression in AdipoHSL+/- mice induced with tamoxifen (black, n = 8) or oil (white, n = 7) in a) iWAt or b)pgWAT. Shown as a percentage of HSL expression versus the control *** p< 0.0001
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
9
3.2 HSL partial deletion induced during adulthood does not have an effect on
hypercaloric diet-induced weight gain.
Both groups of mice have the same weight gain (Figure 3.3a) and fat mass (Figure 3.3b)
gain before and after being fed in high fat diet.
3.3 In chow diet-fed mice, partial deletion of HSL in adulthood entails differences in
tolerance to glucose 6 weeks after induction.
Six weeks post-induction, a glucose tolerance test (GTT) performed on chow diet-fed
mice indicates that AdipoHSL+/- mice are more tolerant to glucose than the control
Figure 3.2.- Quantification of iWAT HSL protein expression in mice AdipoHSL+/- with tamoxifen (black, n = 8) versus control (white, n = 7), normalized according to GAPDH
Figure 3.3.- Measure of a) weight gain and b) % of fat mass gain, expressed as a variation relative to the weight at time 0 (pre-induction).
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
10
group.
-30 -15 0 15 30 45 60 75 90
100
200
300
AdipoHSL +/+
AdipoHSL +/-
**
% g
lycem
ia (
mg
/dl)
Time (min)
3.4 In vivo tests from weeks 15 and 16 show no significant difference when
comparing HSL partial deletion in adulthood and control groups.
However, the GTT performed fifteen weeks post-induction on mice under a HFD does
not show any differences between the two genotypes.
Insulin secretion was measured from blood samples extracted during this experiment at
the time of glucose injection and 15 minutes post-injection. No significant variation in
insulin concentration was found between the two groups. 16 weeks post-induction, an
ITT was conducted that also showed no difference.
CHAPTER 4. DISCUSSION
The aim of this work was to initiate the characterization of a new model of adipose tissue
specific heterozygosity for the HSL, which could facilitate this enzyme’s study and its role
in metabolism.
Figure 3.4.- Results of the GTT performed at the sixth week. Time 0 = glucose injection. AdipoHSL mice with tamoxifen (black, n = 8) versus control (white, n = 7). ** p < 0.001
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
11
-30 -15 0 15 30 45 60 75 90
100
200
300
400
AdipoHSL +/+
AdipoHSL +/-
gly
cem
ia (
mg
/dl)
Time (min)
0 15
0
1
2
3
4AdipoHSL +/-
AdipoHSL +/+
***
Time (min)
Insu
lin
e (
ng
/mL
)
0 50 100 1500
50
100
150
AdipoHSL +/+
AdipoHSL +/-
Time (min)
gly
cem
ia (
mg
/dl)
Figure 3.5.- a) Results of the GTT performed at the 15th week. b) Insulin-ELISA on blood from the 15th week. c) Results of the ITT performed during the 16th week. AdipoHSL mice with tamoxifen (black, n = 8) versus control (white, n = 7). *** p< 0.0001.
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
12
4.1 Model validation – genotype
qPCR in Tissues post sacrifice indicates the effectiveness of the induction. Comparing
the mRNA of the control group (AdipoHSL+/+) with the mRNA from the mice treated
with tamoxifen (AdipoHSL+/-) we found that in that
there are almost 50% less of AdipoHSL-mRNA in iWAT, which validates what was
expected
there is no decrease in pgWAT amount.
The result in pgWAT may be explained by two different hypotheses.
First one is based on the work of Kim et al (2014) which indicates that pgWAT has a
higher rate of turnover, increased by a HFD (Sakaguchi et al. 2017)(Kim et al. 2014). This
may cause that at the time of sacrifice no tamoxifen-induced adipocytes are left,
therefore an AdipoHSL+/+ genotype is shown by both groups. Another hypothesis is that
pgWAT cells do not respond properly to induction. Data obtained in the laboratory for
AdipoHSL-/- cells seem to support this idea, since neither show a full answer to
induction. However, the lack of prior literature or specific experiments does not give any
conclusive answer.
Regarding the data displayed in this work, it would be good to sacrifice the mice earlier.
This is to verify that there are less HSL transcription, solving the problem of renewal. The
results of Sakaguchi et al., 2017 support this idea. Also it would have to perform more
tests during a nearest stage, before renewal of tissue substitute induced cells.
4.2 Weigth gain
Previous studies about the HSL were based on the general depletion of HSL. They had
reported a HFD-induced obesity resistance in HSL -/- (Harada et al. 2003) whereas HSL
+/- mice did not show any variation in fat mass or body weight even if they showed an
amelioration in glucose and insulin tolerance (Girousse et al. 2013). Our experiment was
run to confirm if the result was linked to adipocyte-HSL or the general depletion.
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
13
As expected, inducible model do not show variation in fat mass or body weight, since a
partial reduction in the HSL gene expression does not affect the adipogenesis. This
correlates with HSL mice +/- (Girousse A, 2013). However, to corroborate Girousse et al
(2013) hypothesis, we should have executed experiments to control leptin levels or
energy expenditure.
4.3 Tolerance to glucose
Glucose tolerance tests were performed at the 6th week in a chow diet context and at
the 14th week, in a HFD context.
As it is showed in Figure 3.4, AdipoHSL+/- mice answer faster to glucose injection than
the AdipoHSL+/+ mice in week 6th GTT. It was already proved in humans that there is an
inverse correlation between lypolitic rate and glucose tolerance (Girousse A, 2013).
Therefore, if we extrapolate, it is normal that lower HSL expression carries to improved
glucose tolerance.
Nevertheless, Girousse et al test was ran out during a HFD context, thus our results of
6th week GTT should not be treated in the same way.
We should focus on the 2nd GTT, ran out the 15th week, and therefore when the
obesogenic context is achieved. At this time, any difference between groups is obtained.
This is explained if we refer to the amount of HSL protein present in the WAT removed
post-mortem. Since the lack of HSL is the responsible of differences in glucose and insulin
tolerances, an equal expression of protein between groups explains having the same
result in tolerance tests.
However the reason behind the different amounts in proteins is unknown, despite
presenting half of the gene expression.
Previous literature showed that obesity in humans lead to a decrease of HSL protein
expression (Langin et al. 2005). We may hypothesize that the forced decrease of HSL
due to the lack of gene, avoid the down regulation because of the obesity. Hence both
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
14
genotypes may be equilibrated in protein expression. To prove or refuse this hypothesis,
we could have as part of the cohort, some mice nourish in chow diet.
Another hypothesis could point to the effect of tamoxifen on mice. Tamoxifen binds to
estrogen receptor, and may generate physiological changes in the animal as lipoatrophy,
browning, decrease in appetite or adipogenesis ((Hesselbarth et al. 2015);(Liu et al.
2015)). However, it is considered that normal values are reached from the fourth week
post injection of tamoxifen(Liu et al. 2015) . So, it does not seem to be the best approach.
To prevent possible doubts, next performed experiment should be ran in both female
and male, to compare results since female are more affected by tamoxifen.
The third hypothesis is linked to the possibly different genotype at different time. It is
so due to the renewal of the adipose tissue (Kim et al. 2014). According to this
hypothesis, AdipoHSL +/- mice would show this differential phenotype in the sixth week
due to their lower HSL production. On the other hand, in the 15th week, there would be
different response to glucose because perigonadal adipose tissue would have already
renewed more quantity of fat cells and thus the expression of HSL would be
increasing. However, these results cannot be taken accurately, since during a GTT we
measure total body glucose tolerance, so we cannot exactly know each tissue
contribution (differences between pgWAT and iWAT, and especially muscle) to the test.
To clarify this question, a radioactive glucose-fluxes study could be carry out. By injecting
radioactive glucose in fast-mice and sacrificing them, it is possible to see the destiny.
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
15
CHAPTER 5. FUTURE PERSPECTIVES
To clarify further questions, we have propose to carry out the next experiments:
To circumvent the problem of adipocyte renewal we could either apply a second
injection of tamoxifen, or shorter the experiment timing.
Also we may suggest if HSL lipolytic activity and protein level are decreased, so we
should study fatty acids and glycerol plasma levels. We did not perform the consequent
experiment since mice were sacrificed in a relative fed state, meaning in a lipolysis basal
state, which was shown to not be decreased in vivo in HSL +/- (Girousse et al. 2013).
Measurement of glycerol and NEFAs have to be done after a fasting or subsequent to an
adrenergic agonist injection. As well, we should quantify HSL level at fat depots by
western blot and ectopic fat depots by lipidomics.
To study more about tolerance to insulin, we have to study insulin signalling and
evaluate the metabolic pathways known to be beneficial for insulin sensitivity. Insulin
signalling is evaluated by western blot. The inflammation pathway and the de novo
lipogenesis pathway are both analyse by gene expression, measuring ChREBP, FAS, ATGL
or F4/80)
When we perform GTTs, we are studying the general glucose uptake, which is not just
done by the adipose tissue but also by the muscle and the liver. To further
comprehension about the specific adipose HSL effect, we should study the glucose
uptake measurement after a radiolabelled GTT.
To sum up. We have obtained a correct new mouse model without half of HSL adipose
specific expression. It presents same weight gain and greater glucose uptake in chow
diet compared to control group. Henceforth it does not show no differences under a
HFD context in insulin and glucose tolerance as was expected. This may be linked to a
HFD compensatory effect in lipolysis, tamoxifen influence or cell renewal that reverses
the AdipoHSL removal. It will be necessary to run out more experiments to delve into
the knowledge of the pathways affected by HSL and its effect in a obesogenic context.
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
16
REFERENCES
Aranceta-Bartrina, Javier. 2016. “Prevalencia de Obesidad General y Obesidad Abdominal En La
Población Adulta Española (25–64 Años) 2014–2015: Estudio ENPE.” Revista Española de
Cardiología 69(6): 579–87.
https://linkinghub.elsevier.com/retrieve/pii/S0300893216001068 (February 18, 2019).
Boden, Guenther. 2011. “Obesity, Insulin Resistance and Free Fatty Acids.” Current Opinion in
Endocrinology, Diabetes and Obesity 18(2): 139–43.
http://content.wkhealth.com/linkback/openurl?sid=WKPTLP:landingpage&an=01266029-
201104000-00008.
Calle, Jose Ramón. 2011. “Situación Actual de La Diabetes En España. Estudio [email protected].”
https://www.fundaciondiabetes.org/general/articulo/58/situacion-actual-de-la-diabetes-
en-espana-estudio-dibetes (June 22, 2018).
Castro, Ana Valeria B, Cathryn M Kolka, Stella P Kim, and Richard N Bergman. 2014. “Obesity,
Insulin Resistance and Comorbidities? Mechanisms of Association.” Arquivos brasileiros
de endocrinologia e metabologia 58(6): 600–609.
https://www.ncbi.nlm.nih.gov/pubmed/25211442.
Fundación para la diabetes. “Riesgo de Diabetes Tipo 2.”
http://www.fundaciondiabetes.org/prevencion/310/riesgo-de-diabetes-tipo-2.
Girousse, Amandine et al. 2013. “Partial Inhibition of Adipose Tissue Lipolysis Improves
Glucose Metabolism and Insulin Sensitivity without Alteration of Fat Mass.” PLoS biology
11(2): e1001485–e1001485. https://www.ncbi.nlm.nih.gov/pubmed/23431266.
Harada, Kenji et al. 2003. “Resistance to High-Fat Diet-Induced Obesity and Altered Expression
of Adipose-Specific Genes in HSL-Deficient Mice.” American journal of physiology.
Endocrinology and metabolism 285(6): E1182-95.
Hesselbarth, Nico et al. 2015. “Tamoxifen Affects Glucose and Lipid Metabolism Parameters,
Causes Browning of Subcutaneous Adipose Tissue and Transient Body Composition
Changes in C57BL/6NTac Mice.” Biochemical and Biophysical Research Communications
464(3): 724–29. http://www.sciencedirect.com/science/article/pii/S0006291X15302461.
Kim, Soo M et al. 2014. “Loss of White Adipose Hyperplastic Potential Is Associated with
Characterisation of adipose-specific partial deletion of hormone-sensitive lipase during obesity
Ainhoa García Terrón
17
Enhanced Susceptibility to Insulin Resistance.” Cell metabolism 20(6): 1049–58.
https://www.ncbi.nlm.nih.gov/pubmed/25456741.
Lafontan, Max, and Dominique Langin. 2009. “Lipolysis and Lipid Mobilization in Human
Adipose Tissue.” Progress in Lipid Research 48(5): 275–97.
https://linkinghub.elsevier.com/retrieve/pii/S0163782709000204.
Langin, Dominique et al. 2005. “Adipocyte Lipases and Defect of Lipolysis in Human Obesity.”
Diabetes 54(11): 3190 LP-3197.
http://diabetes.diabetesjournals.org/content/54/11/3190.abstract.
Large, V et al. 1998. “Hormone-Sensitive Lipase Expression and Activity in Relation to Lipolysis
in Human Fat Cells.” Journal of lipid research 39(8): 1688–95.
Liu, L et al. 2015. “Tamoxifen Reduces Fat Mass by Boosting Reactive Oxygen Species.” Cell
Death &Amp; Disease 6: e1586. https://doi.org/10.1038/cddis.2014.553.
Morigny, Pauline, Marianne Houssier, Etienne Mouisel, and Dominique Langin. 2016.
“Adipocyte Lipolysis and Insulin Resistance.” Biochimie 125: 259–66.
https://linkinghub.elsevier.com/retrieve/pii/S0300908415003442.
Mouri, MIchelle, and Madhu Badireddy. 2019. “Hyperglycemia.” In Treasure Island (FL).
Sakaguchi, Masaji et al. 2017. “Adipocyte Dynamics and Reversible Metabolic Syndrome in
Mice with an Inducible Adipocyte-Specific Deletion of the Insulin Receptor.” Cell
Metabolism 25(2): 448–62.
http://www.sciencedirect.com/science/article/pii/S1550413116306416.
World Health Organization. 2018a. “Diabetes.” https://www.who.int/news-room/fact-
sheets/detail/diabetes.
World Health Organization. 2018b. “Obesity and Overweight.” https://www.who.int/news-
room/fact-sheets/detail/obesity-and-overweight.