JPET #211722 1 Distinct properties of telmisartan on agonistic

JPET #211722

1

Distinct properties of telmisartan on agonistic activities for PPARγ among

clinically-used ARBs: drug-target interaction analyses

Hirotoshi Kakuta, Eiji Kurosaki, Tatsuya Niimi, Katsuhiko Gato, Yuko

Kawasaki, Akira Suwa, Kazuya Honbou, Tomohiko Yamaguchi, Hiroyuki

Okumura, Masanao Sanagi, Yuichi Tomura, Masaya Orita, Takako Yonemoto,

and Hiroaki Masuzaki

Drug Discovery Research, Astellas Pharma Inc., Ibaraki, Japan (H.K., E.K.,

T.N., K.G., Y.K., A.S., K.H., T.Y., M.S., Y.T., M.O.);Medical Affairs, Astellas

Pharma Inc., Tokyo, Japan (H.O.); Shizuoka Prefectural General Hospital,

Shizuoka, Japan (T.Y.);Division of Endocrinology, Diabetes and Metabolism,

Hematology, Rheumatology (Second Department of Internal Medicine),

Graduate School of Medicine, University of the Ryukyus, Okinawa, Japan

(H.M.)

JPET Fast Forward. Published on January 14, 2014 as DOI:10.1124/jpet.113.211722

Copyright 2014 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on January 14, 2014 as DOI: 10.1124/jpet.113.211722

at ASPE

T Journals on N

ovember 18, 2018

jpet.aspetjournals.orgD

ownloaded from

http://jpet.aspetjournals.org/

JPET #211722

2

Running title:

distinct interaction of telmisartan-PPARγ

Correspondence to Hirotoshi Kakuta, M.S.

Drug Discovery Research

Astellas Pharma Inc.

21 Miyukigaoka

Tsukuba 305-8585, Ibaraki, Japan

Tel: +81-29-863-6632

Fax: +81-29-852-2955

E-mail: [email protected]

Number of text pages: 61

Number of tables: 2

Number of figures: 6

Number of references: 65

Number of words in Abstract: 250

Number of words in Introduction: 583

Number of words in Discussion: 2004


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

3

Abbreviations: ARB, angiotensin II receptor blocker; DG, deoxy glucose; ITC,

isothermal titration calorimetry; PAMPA, parallel artificial membrane

permeability; PPARγ, peroxisome proliferator-activated receptor gamma;

RT-PCR, real-time polymerase chain reaction; SPR, surface plasmon resonance

Recommended section assignment:

Cellular and Molecular


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

4

Abstract

A proportion of angiotensin II receptor blockers (ARBs) improve glucose

dyshomeostasis and insulin resistance in a clinical setting. Of these ARBs,

telmisartan has the unique property of being a partial agonist for peroxisome

proliferator-activated receptor γ (PPARγ). However, the detailed mechanism of

how telmisartan acts on PPARγ and exerts its insulin-sensitizing effect is poorly

understood. In this context, we investigated the agonistic activity of a variety of

clinically available ARBs on PPARγ using isothermal titration calorimetry

(ITC) and surface plasmon resonance (SPR) system. Based on physicochemical

data, we then re-evaluated the metabolically beneficial effects of telmisartan in

cultured murine adipocytes. ITC and SPR assays demonstrated that telmisartan

exhibited the highest affinity of the ARBs tested. Distribution coefficient and

parallel artificial membrane permeability assays were employed to assess

lipophilicity and cell permeability, for which telmisartan exhibited the highest

levels of both. We next examined the effect of each ARB on insulin-mediated

glucose metabolism in 3T3-L1 preadipocytes. To investigate the impact on

adipogenesis, 3T3-L1 preadipocytes were differentiated with each ARB in

addition to standard inducers of differentiation for adipogenesis. Telmisartan

dose-dependently facilitated adipogenesis and markedly augmented the mRNA


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

5

expression of aP2, accompanied by an increase in the uptake of 2-deoxyglucose

and protein expression of GLUT4. In contrast, other ARBs showed only

marginal effects in these experiments. In accordance with its highest affinity of

binding for PPARγ as well as the highest cell permeability, telmisartan superbly

activates PPARγ among ARBs tested, thereby providing a fresh avenue for

treating hypertensive patients with metabolic derangement.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

6

1. Introduction

Insulin resistance is frequently observed in hypertensive patients

(Lamounier-Zepter et al., 2006; Zavaroni et al., 1992; Lind et al., 1995).

Angiotensin II type 1 (AT1) receptor blockers (ARBs) are widely used for the

treatment of hypertensive patients with fuel dyshomeostasis (Jandeleit-Dahm et

al., 2005; Abuissa et al., 2005), as angiotensin II inhibits physiological

differentiation of adipocytes and interferes with the insulin receptor signaling

pathway via the AT1 receptor (Janke et al., 2002; Velloso et al., 1996). However,

the degree of metabolically beneficial effects on insulin resistance or glucose

dyshomeostasis differs among ARBs (Vitale et al., 2005; Rizos et al., 2010; de

Luis et al., 2010).

Peroxisome proliferator-activated receptors (PPARs) are members of the

nuclear receptor superfamily of ligand-activated transcription factors. A variety

of coactivators and corepressors are involved in the ligand-dependent

transcription of genes, allowing tissue- and ligand-specific activation of target

genes by PPARs. As a main subtype of PPARs, PPARγ controls a wide variety

of genes involved in fuel storage in adipose tissue, and thus plays a crucial role

in the regulation of adipogenesis and insulin sensitivity (Picard and Auwerx,

2002). It has been shown that relative ratio of mRNA level between PPARγ1


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

7

and PPARγ2 in 3T3-L1 preadipocytes is approximately 10-fold, but it turns to

be equal in differentiated 3T3-L1 adipocytes (Takenaka et al., 2013). It is also

reported that PPARγ1 protein does express in 3T3-L1 adipocytes. PPARγ1 is

expressed in preadipocytes, which increases approximately 8-hold during

adipocyte differentiation. In contrast, PPARγ2 is slightly expressed in

preadipocytes, which increases approximately 180-hold during the adipocyte

differentiation (Jitrapakdee et al., 2005). A wide variety of tissues or cells

express PPARγ1, whereas PPARγ2 is highly restricted to adipocytes (Escher et

al., 2001). PPARγ2 plays a crucial role in regulating the program of adipocyte

differentiation (Tontonoz et al., 1994). Therefore, we evaluated the effect of

telmisartan on PPARγ2 mRNA expression. A subgroup of ARBs has been

reported to augment PPARγ activity (Benson et al., 2004; Schupp et al., 2004),

suggesting that such ARBs could improve insulin resistance, at least in part, via

this activity. However, despite attention being focused on the insulin-sensitizing

effects of ARBs, the direct evidence of ARBs on their interaction with PPARγ

still remains obscure.

Telmisartan, an ARB, has unique chemical properties that enable it to

partially activate PPARγ (Amano et al., 2012) as well as strongly block AT1

receptors (Ohno et al., 2011; Kakuta et al., 2005). We recently demonstrated for


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

8

the first time that telmisartan formed a ternary complex structure with PPARγ

and a coactivator, steroid receptor coactivator-1 (SRC-1), thereby revealing that

telmisartan directly binds to the ligand-binding domain of PPARγ via a distinct

mode from that of full agonists for PPARγ such as rosiglitazone and farglitazar

(Amano et al., 2012). In addition, telmisartan is known to induce a distinct

subset of genes in adipocytes compared with PPARγ full agonists, indicating

that it acts as a selective PPARγ modulator (SPPARM) (Schupp et al., 2005).

To clarify the mechanism by which telmisartan expresses agonistic activity

for PPARγ, we focused on the direct interaction between ARBs and PPARγ.

Two analytical methods—isothermal titration calorimetry (ITC) and surface

plasmon resonance (SPR)—were employed to precisely determine the binding

affinities of ARBs for PPARγ. Further, to examine whether or not ARBs enable

activation of PPARγ in cellular systems, we investigated physicochemical

properties, such as lipophilicity and cell permeability. Finally, using cultured

murine adipocytes, 3T3-L1 cells, we assessed the impact of the interaction

between ARBs and PPARγ on their PPARγ agonistic activities and resultant

insulin-sensitizing effects.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

9

2. Materials and Methods

2.1. Materials

Clinically available angiotensin II AT1 receptor blockers were prepared as

follows: telmisartan (2-(4-{[4-methyl-6-(1-methyl-1H-1,3-benzodiazol-2-yl)-

2-propyl-1H-1,3-benzodiazol-1-yl]methyl}phenyl)benzoic acid) was purchased from

Nippon Boehringer Ingelheim Pharmaceuticals Inc. (Tokyo, Japan) and

irbesartan (2-butyl-3-({4-[2-(2H-1,2,3,4-tetrazol-5-yl)phenyl]phenyl}methyl)-

1,3-diazaspiro[4.4]non-1-en-4-one) from Shionogi Pharmaceutical Pharma Inc.

(Tokyo, Japan). These compounds were then extracted by Astellas

Pharmaceutical Inc. (Ibaraki, Japan). Azilsartan (2-ethoxy-1-([2'-(5-oxo-4,5-

dihydro-1,2,4-oxadiazol-3-yl)biphenyl-4-yl]methyl)-1H-benzimidazole-7-

carboxylic acid) was synthesized by Astellas Pharmaceutical Inc. as previously

reported (Kohara et al., 1996). Candesartan (2-ethoxy-1-({4-[2-(2H-1,2,3,4-

tetrazol-5-yl) phenyl]phenyl}methyl)-1H-1,3-benzodiazole-7-carboxylic acid) was

purchased from Sequoia Research Products Ltd. (Pangbourne, UK). A

thiazolidinedione derivative, Pioglitazone ((RS)-5-(4-[2-(5-ethylpyridin-2-yl)

ethoxy]benzyl)thiazolidine-2,4-dione), was purchased from Takeda

Pharmaceutical Co, Ltd. (Osaka, Japan) and then extracted by Astellas

Pharmaceutical Inc.. Farglitazar was synthesized by Astellas Pharmaceutical


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

10

Inc. as previously reported (Henke et al., 1998). Human recombinant insulin

was purchased from Funakoshi Co., Ltd. (Tokyo, Japan).

3-Isobutyl-1-methylxanthine (IBMX), dexamethasone (DEX), and fetal bovine

serum (FBS) were purchased from Sigma-Aldrich Japan Inc. (Tokyo, Japan).

Dulbecco’s Modified Eagle’s Medium (DMEM) was purchased from Life

Technologies Japan Ltd. (Tokyo, Japan). The lipid assay kit was purchased

from Primary Cell Co., Ltd. (Hokkaido, Japan).

2.2. Cell culture and Oil Red O staining

3T3-L1 cells were purchased from ATCC (Manassas, VA, USA) and

maintained in DMEM supplemented with 10% FBS until they reached a state

of density arrest at 2 days post-confluence on 24-well plates, and then cultured

and differentiated into adipocytes as described (Frost and Lane, 1985;

Ishii-Yonemoto et al., 2010). Briefly, cells were grown for 2 days

post-confluence (referred as Day 0) in 10% FBS/DMEM. Differentiation was

induced with 10% FBS/DMEM containing 0.5 mmol/L IBMX, 0.25 μmol/L

DEX and 1 μg/mL insulin for 2 days. The cells were then incubated in 10%

FBS/DMEM with 1 μg/mL insulin for 2 days and maintained with 10%

FBS/DMEM until Day 6. Telmisartan, irbesartan, azilsartan, candesartan, and


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

11

pioglitazone were dissolved in DMSO and added to media from Days 0 to 6

with 0.1% of volume. Medium was changed every other day. On Day 6, the

cells were washed with PBS (-) twice, fixed in 3.7% formaldehyde for 1 h at

room temperature and then stained with 0.6% (w/v) Oil Red O solution (60%

isopropanol, 40% water) for 1 h at room temperature. Cells were then washed

with water to remove unbound dye. Oil Red O was eluted with isopropanol and

quantified by measuring the optical absorbance at 510 nm (OD510)

(Ramírez-Zacarías et al., 1992).

2.3. PPARγ protein expression and purification

In comparison with PPARγ1, PPARγ2 contains 30 additional amino acids at

its N-terminus as a consequence of alternative splicing at the 5�-end of the

gene (Tontonoz et al., 1994). It has been shown that PPARγ agonists bind to the

both isoforms with a similar extent of IC50s, and subsequently activate both

isoforms in the same way (Elbrecht et al., 1996). Importantly, ligand binding

domain of PPARγ is subjected to a series of isothermal titration calorimetry

(ITC) experiments (Porcelli et al., 2012). DNA encoding human PPARγ

ligand-binding domain (LBD) (amino acids 225-505) was amplified by PCR.

For ITC studies, DNA was subcloned into the expression vector pET28a


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

12

(Merck Millipore, Darmstadt, Germany). HisTag-PPARγ LBD was expressed

in Escherichia coli BL21(DE3) (Merck Millipore) and purified as previously

described (Amano et al., 2012). The target protein was dialyzed against buffer

containing 20 mmol/L Tris-HCl, 100 mmol/L NaCl, 2 mmol/L EDTA, 1

mmol/L Tris(2-carboxyethyl)phosphine hydrochloride, pH 8.0 and concentrated

to 15 mg/mL. For SPR studies, DNA was subcloned into the modified

expression vector pAN-4 (Cosmo Bio Co., Ltd. Tokyo, Japan), with an

N-terminal HisTag followed by thrombin cleavage site and AviTag.

HisTag-AviTag-PPARγ LBD was expressed in E. coli BL21(DE3) (Merck

Millipore) transformed with pACYC184 harboring birA gene. In vivo

biotinylation of PPARγ LBD was carried out through expression. The target

protein was purified with Ni-NTA column, dialyzed against (20 mmol/L

Tris-HCl, 100 mmol/L NaCl, 2 mmol/L EDTA, 1 mmol/L

Tris(2-carboxyethyl)phosphine hydrochloride, pH 8.0), and concentrated to 4

mg/mL.

2.4. Isothermal titration calorimetry (ITC)

ITC experiments were carried out using a high-precision MicroCal

Auto-iTC200 system (GE Healthcare UK Ltd, Little Chalfont, Buckinghamshire,


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

13

UK) (Velazquez-Campoy et al., 2004). All solutions contained within the

calorimetric cell and injector syringe were prepared in the same buffer, which

consisted of PBS, pH 7.4, with 5% DMSO. Binding affinities (Kd = 1/Ka) were

determined by injecting compounds (250 μmol/L-3 mmol/L) into the

calorimetric cell containing 2-25 μmol/L PPARγ at 25 °C. The absence of large

particles (i.e. aggregates) in the compound solutions was confirmed using

dynamic light scattering equipment (DLS, Zetasizer Nano ZS, Malvern, UK)

prior to experiments (Yao et al., 2005). By using DLS, possible compound

aggregates were detected in the pioglitazone solution, indicating the solubility

of this compound in this experimental buffer was too low to determine the

binding affinity with ITC. We therefore used farglitazar as a positive control.

Each experiment was performed as one injection of 0.8 μL followed by 27

injections of 1.4 μL with a 200-s interval between each injection. The heat

evolved after each injection was obtained from the integration of the

calorimetric signal. Data were analyzed using a single binding site model

implemented in the ORIGIN software package (OriginLab, Northampton, MA,

USA) provided with the instrument.

2.5. Surface plasmon resonance (SPR)


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

14

SPR measurements were performed using a Biacore 4000 (GE Healthcare

UK Ltd.) at 25 °C. HBS-P+ buffer (10 mmol/L HEPES, 150 mmol/L NaCl,

0.05% Surfactant P20, pH 7.4) was used as running buffer. Biotinylated PPARγ

LBD was immobilized on the surface of a SA chip (GE Healthcare) in running

buffer. ARBs at a range of concentrations were then injected into the flow cells

at a flow rate of 30 μL/min for 60 s, followed by dissociation for 60 s Data

were analyzed using Biacore 4000 Evaluation Software version 1.0 for Steady

State Affinity Analysis to determine dissociation constants.

2.6. Assays for lipophilicity and cell permeability

An octanol/pH 7.4 buffer distribution coefficient was used as a quantitative

descriptor of lipophilicity of a series of ARBs. The procedure of distribution

and separation was conducted by the JIS standard protocol (JIS Z7260-107;

OECD Test Guideline 107). The concentrations of the upper phase (1-octanol

phase) and the lower phase (aqueous phase) were measured using an HPLC/MS

system (Agilent LC1100; Agilent Technologies, Palo Alto, CA, USA).

A parallel artificial membrane permeability assay (PAMPA) was employed to

assess cell permeability in a series of ARBs (Avdeef, 2012). The PAMPA

Evolution (pION Inc., Woburn, MA, USA) using a double-sink PAMPATM


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

15

method was used in this study. In PAMPA, a “sandwich” is formed from a

96-well microtiter plate (PN 110243; pION Inc.) and a 96-well filter plate

(IPVH; Millipore, Bedford, MA, USA), such that each composite well is

divided into 2 chambers: a donor at the bottom and an acceptor at the top. The

donor solutions were adjusted in pH 6.5 (NaOH-treated universal buffer, PN

110151; pION Inc.), while the acceptor solutions were maintained at pH 7.4

(PN 110139; pION Inc.). Following the formation of the sandwich, the plates

were incubated at 25 °C for 2 h in a humidity-saturated atmosphere.

2.7. Real time polymerase chain reaction

Total RNA was purified from cultured adipocytes on Day 6 using an RNeasy

Mini Kit (Qiagen, Tokyo, Japan) in accordance with the manufacturer’s

instructions, and cDNA was synthesized as previously described (Suwa et al.,

2010). The level of mRNA expression of aP2 (aP2, also known as fatty acid

binding protein, transports fatty acids into cells. The aP2 gene is a

representative target of PPARγ) and PPARγ2 was quantified via real-time

quantitative polymerase chain reaction (RT-PCR) using the SYBR green

method with a PRISM 7900 Sequence Detector (PerkinElmer Applied

Biosystems, CA, USA). The primers for aP2 were tgagcctctgaagtccagata


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

16

(forward) and acagggtctggtcatgaagga (reverse), while those for PPARγ2 were

caccagtgtgaattacagcaaa (forward) and gctcataggcagtgcatcag (reverse). Results

were normalized to endogenous β-actin mRNA concentrations. The level of

expression was calculated as the percentage of activation (% of activation)

compared to the DMSO control.

2.8. Western blot analysis

On Day 6, adipocytes were washed with ice-cold PBS and dissolved with

CelLytic M solution (Sigma-Aldrich Japan Inc., Tokyo, Japan), kept on ice for

10 min. After centrifugation, supernatant were normalized for protein

concentration using a BCA protein assay kit (Bio-Rad Laboratories Inc., Tokyo,

Japan) and subjected to immunoblotting. Equal amounts of protein lysates were

separated on SDS-polyacrylamide gel and transferred to a polyvinylidene

difluoride membrane, then exposed to anti-GLUT4 antibody (AbD Serotec,

Oxford, UK). The membranes were subsequently probed with horseradish

peroxidase-conjugated secondary antibody (GE Healthcare Bio-Sciences KK,

Tokyo, Japan) and enhanced using an ECL Western Blotting System (GE

Healthcare Bio-Sciences KK, Tokyo, Japan). Chemiluminescence intensity was

quantified using a quantitative digital imaging system (VersaDoc, Bio-Rad, CA,


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

17

USA). The amount was calculated as the percentage of activation (% of

activation) compared to the DMSO control.

2.9. Assay for 2-Deoxy glucose uptake

On Day 6, glucose transport in 3T3-L1 adipocytes was assessed based on the

uptake of 2-deoxy-[14C]glucose (PerkinElmer Japan, Kanagawa, Japan) as

previously described (Shimaya et al., 1998). Briefly, cells were starved of

serum for 5 h before experiments. Cultured adipocytes were washed with PBS,

and then Krebs-Ringer-Hepes buffer (KRH buffer) or KRH buffer containing

insulin (final concentration of 100 nmol/L) was added and incubation was

continued for 20 min. Glucose transport assays were initiated by the addition of

2-deoxy-[14C]glucose (final concentration: 200 μmol/L, 0.2 μCi) for 10 min at

37 °C. The reaction was terminated by washing with ice-cold PBS. Cells were

disrupted with 0.5% SDS, and radioactivity was determined using a

scintillation counter.

2.10. Statistical Analysis

Data are expressed as mean ± standard error of the mean (S.E.M.). Results

for lipid accumulation in cells, real-time PCR, glucose uptake, and GLUT4


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

18

protein expression were analyzed by ANOVA followed by Dunnett’s multiple

comparison test to compare the data between the vehicle (DMSO) and treated

groups. Statistical significance was defined as P < 0.05. All analyses were

conducted using GraphPad Prism software (version 5.0, GraphPad, San Diego

CA, USA).


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

19

3. Results

3.1. Telmisartan exhibited the highest affinity for PPARγ among various

types of ARBs tested

The affinity (Kd = 1/Ka) of the interaction between PPARγ and ARBs was

measured by ITC. In this experiment, the binding of farglitazar, a potent PPARγ

full-agonist, was simultaneously assessed as a positive control. The binding

affinities of a series of compounds are summarized in Table 1. Only telmisartan

exhibited robust binding affinity for PPARγ, scoring a Kd value in a nanomolar

range (Kd = 340 ± 40 nmol/L). In contrast, irbesartan showed marginal binding

affinity for PPARγ (Kd = 10.3 ± 1.5 μmol/L). The value of azilsartan and

candesartan were both >100 μmol/L.

The binding affinities for PPARγ as determined by SPR were as follows:

telmisartan (8.6 ± 0.28 µmol/L), irbesartan (60 ± 6.0 µmol/L), azilsartan (>100

μmol/L) and candesartan (>100 μmol/L). Results obtained by SPR showed a

markedly similar trend to those in ITC (Papalia et al., 2006). Both results are in

agreement with previous reports of the rank order of PPARγ transactivation

ability of ARBs (Benson et al., 2004; Schupp et al., 2004; Kajiya et al., 2011).

3.2. Lipophilicities and cell permeability of ARBs


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

20

Given that PPARγ is expressed in the nucleus, higher lipophilicity is required

for ARBs to penetrate the lipophilic lipid bilayer (nuclear membrane, cell

membrane) and interact with the PPARγ. We therefore assessed the

lipophilicity and cell permeability of ARBs. Telmisartan exhibited the highest

lipophilicity and the highest cell permeability of the compounds tested (Table

2). In contrast, irbesartan showed moderate lipophilicity and cell permeability.

Azilsartan and candesartan showed subtle lipophilicity and cell permeability.

Correlations between lipophilicity and cell permeability observed in this study

are in good accordance with the previous report (Yamashita et al, 1997).

3.3. Lipid accumulation in 3T3-L1 adipocytes

To investigate the potential impact of each ARB on adipogenesis, 3T3-L1

preadipocytes were differentiated with each ARB, with replenishment of

standard inducers of differentiation (i.e. IBMX, DEX, and insulin) (Frost and

Lane, 1985; Ishii-Yonemoto et al., 2010). As shown in Fig. 1, telmisartan

robustly and dose-dependently facilitated adipose differentiation at a

concentration of 0.3 μmol/L in 3T3-L1 cells. In contrast, only a higher dose (10

μmol/L) of irbesartan slightly induced adipose differentiation. Similarly, a

higher dose (10 μmol/L) of azilsartan or candesartan minutely provoked


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

21

adipose differentiation. However, the impact was marginal compared with

telmisartan. These results are consistent with those of previous reports (Benson

et al., 2004; Schupp et al., 2004; Kajiya et al., 2011; Fujimoto et al., 2004).

3.4. Effect of ARBs on aP2 and PPARγ2 mRNA in cultured adipocytes

To investigate the potential regulation of PPARγ target genes by ARBs in

adipocytes, compounds were replenished with differentiation media from Day 0

to 6. By addition of 10 μmol/L telmisartan, the mRNA expression level of aP2

was markedly increased by approximately 3.4-fold compared to vehicle

(DMSO) (Fig. 2A). In contrast, other ARBs did not increase the mRNA

expression level of aP2. Further, telmisartan dose-dependently increased the

mRNA expression level of PPARγ2 (Fig. 2B, 3.0-fold increase at 10 μmol/L).

Interestingly, higher dose of irbesartan significantly increased the expression of

PPARγ2 (3.3-fold increase at 10 μmol/L). Azilsartan also significantly

increased the expression of PPARγ2 (2.0-fold increase at 10 μmol/L). However,

of note, these effects were not dose-dependent . In contrast, candesartan did not

increase expression of PPARγ2 at all.

3.5. Effect of ARBs on 2-deoxy glucose transport in 3T3 adipocytes


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

22

To evaluate potential impact of ARBs on glucose transport in 3T3-L1

adipocytes, a 2-deoxy glucose (2-DG) uptake assay was conducted. As shown

in Fig. 3, even in the absence of insulin, 1 and 10 μmol/L telmisartan

significantly augmented 2-DG uptake in adipocytes by 1.6- and 2.4-fold,

respectively. In the presence of insulin, 1 and 10 μmol/L telmisartan augmented

2-DG uptake in adipocytes by 1.8- and 2.7-fold, respectively. Similarly, in the

absence or presence of insulin, 10 μmol/L irbesartan augmented 2-DG uptake

by 2.3 and 2.1-fold, respectively. In contrast, azilsartan as doses up to 10

μmol/L did not affect 2-DG uptake. Although a higher dose (10 μmol/L) of

candesartan increased 2-DG uptake, the effect was marginal compared with

telmisartan or irbesartan.

3.6. Effect of ARBs on GLUT4 protein level in 3T3-L1 adipocytes

We assessed the effect of each ARB on GLUT4 protein expression in

adipocytes. As shown in Fig. 4, telmisartan at 10 μmol/L significantly increased

GLUT4 protein 3.0-fold. Similarly, irbesartan at 10 μmol/L significantly

increased GLUT4 protein expression 2.8-fold. In contrast, azilsartan and

candesartan did not increase GLUT4 protein expression.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

23

4. Discussion

Affinity analyses of ARBs to PPARγ

ITC and SPR are the latest techniques for characterizing the direct

interaction of drugs and their target proteins (Holdgate et al., 2013; Núñez et al.,

2012; Renaud and Delsuc, 2009). Both techniques can be used to determine the

affinity (Kd) between a drug and its target protein in solution. ITC monitors

thermal changes (i.e. thermodynamics) upon complex formation, while SPR

monitors the process of association and dissociation between drugs and their

target proteins. One advantage of ITC assays is that samples can be used

without chemical modification, physical immobilization or a combination of

the two. Therefore, the interaction between a drug and its target protein can be

elucidated in an environment that closely reflects physiological conditions. To

our knowledge, the present study is the first direct demonstration of the binding

of each ARB for PPARγ.

Using ITC and SPR assays, we demonstrated that, among a series of ARBs,

telmisartan exhibited the highest affinity for PPARγ. The binding affinities of

ARBs show good correlation with transcriptional activities obtained from

biochemical assays, indicating that the initial binding to PPARγ is a pivotal step


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

24

in transcriptional activation.

The superior binding affinity of telmisartan for PPARγ may be attributable to

its unique chemical structure. The molecular structure of telmisartan is divided

into two parts that consist of biphenyl carboxylic acid (the A-Part) and two

benzimidazole rings (the B-Part) (Fig. 5 inset). The A-Part is conserved in most

ARBs, but in telmisartan the carboxylic acid is substituted for bioisostere

tetrazole. Further, the B-Part of telmisartan is distinct from those of other ARBs

(Fig. 5 outset).

We recently revealed the complex structure of PPARγ with telmisartan via

X-ray crystallographic analysis (Amano et al., 2012). As shown in Fig. 5 inset,

part of the two benzimidazole rings occupies a lipophilic narrow pocket

surrounded by Ile281, Cys285, Leu356, Phe363 and His449 residues. In

general, binding of a compound to its target protein is mainly controlled by

complementarity in shape and physicochemical properties (lipophilic and

electrostatic characters). From this perspective, the benzimidazole rings of

telmisartan might be advantageous, for two reasons. First, the two

benzimidazole rings, which can form a co-planner conformation, might fit into

the narrow, flat pocket of PPARγs. Second, the lipophilic property of

benzimidazole rings as well as the pocket surface of PPARγ, are favorable for


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

25

hydrophobic interaction, which is further reinforced by the stacking interaction

between the benzene ring of the central benzimidazole ring and His449. Of

note, the N3’ nitrogen of the central benzimidazole ring forms a hydrogen bond

with Tyr473, which appears to be essential for PPARγ agonism (Amano et al.,

2012). In contrast, other ARBs would be unable to bind PPARγ and form a

hydrogen bond with Tyr473, in a similar fashion to telmisartan (Fig. 5, outset).

For example, olmesartan and valsartan have bulky, non-planar substituents,

which are unfavorable for accessing the narrow and flat pocket of PPARγ.

Further, azilsartan, candesartan, eprosartan, olmesartan, and valsartan contain

carboxylic acid, the high acidity of which might hamper these compounds’

binding to the lipophilic surface of PPARγ. Eprosartan, irbesartan, losartan,

olmesartan, and valsartan also lack benzene rings adjacent to the imidazole

rings, which might reduce stacking interaction with His449. Taken together,

markedly high affinity of telmisartan for PPARγ observed in the ITC and SPR

can be attributed to the optimal complementarity in shape and lipophilicity.

Physicochemical properties of ARBs

Here, we demonstrated for the first time that telmisartan exhibits the highest

cell permeability of tested ARBs. Since PPARγ is localized in the nucleus,


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

26

robust lipophilicity is critical for compounds to interact with the target through

the highly lipophilic lipid bilayer (nuclear membrane and cell membrane).

Consistent with a previous report (Yamashita et al., 1997), this study

demonstrated good correlation between lipophilicity and cell permeability in

each ARB. Indeed, when telmisartan was incubated with primary cultures of

murine mesangial cells, considerably high intracellular levels of the compound

were detected by high-performance liquid chromatography analysis (Shao et al.,

2007). In contrast, intracellular concentrations of losartan were undetectable in

the same assay (Shao et al., 2007). This result also supports our finding that the

concentration of telmisartan required to induce adipocyte differentiation is the

lowest of the ARBs tested. In addition to the direct PPARγ agonistic properties,

these data further suggest that the degree of lipophilicity of ARBs may also

affect activating potency of PPARγ.

In addition to lipophilicity, the mode of action of telmisartan is pivotal in the

activation of PPARγ. As reported by Schupp et al., telmisartan acts as a partial

agonist for PPARγ (Schupp et al., 2004). Crystallographic analysis revealed

that telmisartan exhibits a distinct binding mode from full agonists for PPARγ

(Amano et al., 2012). Binding of telmisartan to PPARγ results in unstable

interaction with its helix 12, which may recruit unique subset of co-activators.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

27

This binding pattern may also explain the mechanism by which telmisartan

expresses a unique subset of genes. PPARγ-coactivator-1 α (PGC-1α) binds to

PPARγ to induce the expression of key enzymes involved in the mitochondrial

respiration chain, thereby stimulating energy expenditure. Steroid receptor

coactivator-1 (SRC-1) stabilizes the binding of PGC-1α to PPARγ. Notably,

transcriptional intermediary factor-2 (TIF-2) competes with SRC-1 for the

formation of PGC-1α/PPARγ complexes, leading to an increase in

PPARγ-mediated triglyceride storage within adipocytes (Picard et al., 2002).

Therefore, an increase in the ratio of TIF-2 to SRC-1 in adipocytes might

contribute to the progression of obesity and insulin resistance (Picard et al.,

2002). A previous study revealed that telmisartan enhanced transcriptional

activation of PPARγ without recruitment of TIF-2 (Schupp et al., 2005). In this

context, we may reasonably speculate that TIF-2-independent activation of

PPARγ by telmisartan may prevent the gain of body fat and favor insulin

sensitization (Fig. 6B) (Schupp et al., 2005; Araki et al., 2006; Sugimoto et al.,

2006; Shimabukuro et al., 2007). As we described in Discussion section, we

speculate that telmisartan could augment PGC-1α action in an indirect manner

by decreasing the ratio of TIF-2 (lipid accumulating co-activator) to SRC-1

(anti-lipid accumulating co-activator) in 3T3-L1 adipocytes, partly because


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

28

telmisartan enhances the transcriptional activity of PPARγ without recruitment

of TIF-2. Telmisartan does activate adipogenesis through partial agonistic

activity for PPARγ. However, it should be noted that telmisartan-controlled

balance between TIF-2 vs. SRC-1 in adipocytes may be beneficial for

prevention of body fat accumulation (Schupp et al., 2005; Araki et al., 2006;

Sugimoto et al., 2006; Shimabukuro et al., 2007). In contrast, PPARγ full

agonists such as pioglitazone are associated with unwelcome weight gain via

the robust recruitment of TIF-2. Weight reduction lowers arterial blood pressure

in obese hypertensive patients, suggesting a close association between energy

homeostasis and blood pressure (Busetto et al., 2001). A line of evidence has

suggested that hypertrophic adipocyte-derived hypertensive substances such as

leptin and angiotensinogen are involved in pathogenesis of obesity-related

hypertension (Wajchenberg, 2000). Taken together, in telmisartan, less potency

of body fat accumulation through partial agonistic activity for PPARγ as well as

AT1-R blockade coordinately improve hypertension in animals with elevated

blood pressure.

Of note, the concentration of telmisartan required for the augmentation of

lipid accumulation or glucose uptake in cultured adipocytes is achieved in the

plasma of hypertensive patients treated with telmisartan, but not with irbesartan


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

29

(Israili, 2000; Marino et al., 1999). One exception was azilsartan, albeit only at

high concentrations, which slightly but significantly augmented the lipid

accumulation and mRNA level of PPARγ2 in a dose-independent manner.

Based on these results, ARBs other than telmisartan might not exert

PPARγ-dependent metabolically beneficial effects in hypertensive patients

treated with conventional clinical dosage.

Pharmacological properties of telmisartan in adipocytes and its clinical

implications

With its prominent agonistic activity for PPARγ, telmisartan has been

reported to improve insulin resistance and glucose dyshomeostasis both in

humans and rodents (Benson et al., 2004; Rizos et al., 2009; Takagi et al., 2013;

Mori et al., 2011; Fujisaka et al., 2011). Telmisartan has been reported to

significantly decrease the plasma levels of fasting insulin and triglycerides, also

significantly decrease the value of HOMA-R (homeostasis model assessment

for insulin resistance: index of insulin resistance), while telmisartan has been

reported to significantly increase the plasma levels of adiponectin and

HDL-cholesterol in diabetic patients with hypertension (Miura et al., 2005,

Watanabe et al., 2010). Furthermore, systematic reviews of randomized clinical


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

30

trials clearly demonstrate that telmisartan is superior to other ARBs in the

amelioration of fasting plasma levels of glucose, insulin, triglyceride, and

insulin resistance, which is accompanied by a significant increase in plasma

adiponectin levels (Takagi and Umemoto, 2012a; 2012b; 2012c; Suksomboon

et al., 2012).

Previous report demonstrated that telmisartan significantly increased serum

adiponectin level in hypertensive patients with metabolic risk factors (Yano et

al., 2007). Because adiponectin gene expression in adipocytes is strongly

controlled by PPARγ (Maeda et al., 2001), it is reasonable to speculate that

partial agonistic activity for PPARγ in telmisartan of clinical doses significantly

elevate the circulating level of adiponectin in humans. Adiponectin is shown to

stimulate glucose utilization and fatty-acid oxidation by the activation of

AMP-kinase, and subsequently improve insulin resistance (Yamauchi et al,

2001, 2002). In this context, telmisartan would be beneficial for hypertensive

patients with multiple metabolic risk factors.

In the present study, telmisartan augmented 2-DG uptake in adipocytes at a

concentration of 0.3 μmol/L, comparable to that in the plasma of patients

treated with conventional clinical dosage. Further, Furukawa et al. recently

reported that telmisartan but not candesartan increased the phosphorylation of


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

31

insulin receptors, insulin receptor substrate-1, and Akt by insulin in a

“differentiated� 3T3-L1 adipocyte system, suggesting that telmisartan

increases insulin sensitivity. In addition, the authors also reported that

up-regulation of glucose uptake by telmisartan was inhibited by a PPARγ

antagonist, T0070907, indicating that telmisartan acts via PPARγ activation in

adipose tissue (Furukawa et al., 2011). We previously reported that telmisartan

augments mRNA level of aP2 (a representative molecular indicator of PPARγ

activation) in 3T3-L1 cells (Fujimoto et al., 2004). In our report, the effect of

telmisartan was examined in both “differentiating” adipocytes and

“differentiated” adipocytes using 3T3-L1 cellular systems. Notably, telmisartan

did increase aP2 mRNA level at lower doses in differentiating adipocytes than

in differentiated adipocytes. Based on our previous findings, in the present

study, we examined the effect of telmisartan in differentiating adipocytes.

Therefore, it is likely to speculate that telmisartan would increase

phosphorylation of IR, IRS-1, and Akt at lower doses (1 μmol/L or lower) in

the differentiating 3T3-L1 adipocytes than in Furukawa’s differentiated 3T3-L1

adipocytes.

On the other hand, Lakshmanan reported that telmisartan attenuates

oxidative stress and rescue the down-regulation of Ang-(1-7) mas receptor


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

32

protein (Lakshmanan et al., 2011) in murine kidney. In the same report, they

reported that telmisartan rescued the down-regulation of PGC-1α protein in

murine kidney, and thus they suggest that telmisartan might increase the

PPARγ and its downstream, PGC-1α expressions through the up-regulation of

Ang-(1-7) mas receptor. Therefore, there is a possibility that rescue of

down-regulation of Ang-(1-7) mas receptor by telmisartan might also

contribute to its metabolically-beneficial effects.

Collectively, our data support the notion that telmisartan exerts a variety of

metabolically beneficial effects within clinically available oral doses.

Conclusion

In this study of ARBs tested in a series of advanced analytical assays,

telmisartan exhibited the highest cell permeability and the highest binding

affinity and the highest agonistic activities for PPARγ. The concentration of

ARBs required for the augmentation of glucose uptake in cultured adipocytes is

achieved only in the plasma of hypertensive patients treated with telmisartan.

Such effects were not observed in irbesartan, azilsartan or candesartan. In this

context, among clinically used ARBs, telmisartan might solely exert

PPARγ-dependent metabolically beneficial effects in clinical settings. As we


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

33

describe in introduction, angiotensin II inhibits physiological differentiation of

adipocytes and interferes with the insulin receptor signaling via the AT1

receptor. Thus, in general, ARBs are considered to improve insulin resistance

by the blockade of AT1-receptor. Furthermore, telmisartan may also improve

insulin resistance via PPARγ agonistic activity. Therefore, it is reasonable to

speculate that telmisartan could outweigh the action of other ARBs (Fig.6). Our

findings provide novel insight into the therapeutic options for hypertensive

patients with insulin resistance and convergence of metabolic risk factors.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

34

Acknowledgements

We thank Mitsubishi Chemical Medience Corporation for help with the cell

experiments. We also thank Mr. F. Hirayama and Mr. T. Yamanaka for

extracting telmisartan and irbesartan from tablets and synthesizing azilsartan.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

35

Authorship Contributions

Participated in research design:

Kakuta, Kurosaki, Niimi, Kawasaki, Suwa, Yamaguchi, Okumura, Sanagi,

Tomura, Orita, Yonemoto, and Masuzaki

Conducted experiments:

Kakuta, Kurosaki, Gato, Kawasaki, Suwa, Honbou, Yamaguchi, and

Masuzaki

Contributed new reagents or analytic tools:

Kakuta, Gato, Kawasaki, Suwa, and Honbou

Performed data analysis:

Kakuta, Kurosaki, Niimi, Gato, Kawasaki, Suwa, Honbou, Yamaguchi,

Okumura, and Masuzaki

Wrote or contributed to the writing of the manuscript:

Kakuta, Kurosaki, Niimi, Gato, Kawasaki, Suwa, Honbou, Yamaguchi,

Okumura, Sanagi, Tomura, Orita, Yonemoto, and Masuzaki


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

36

References

Abuissa H, Jones PG, Marso SP, and O’Keefe JH (2005).

Angiotensin-converting enzyme inhibitors or angiotensin receptor blockers

for prevention of type 2 diabetes. A meta-analysis of randomized clinical

trials. J Am Coll Cardiol 46:821-826

Amano Y, Yamaguchi T, Ohno K, Niimi T, Orita M, Sakashita H, and Takeuchi

M (2012). Structural basis for telmisartan-mediated partial activation of

PPAR gamma. Hypertens Res 35:715-719

Araki K, Masaki T, Katsuragi I, Tanaka K, Kakuma T, and Yoshimatsu H

(2006). Telmisartan prevents obesity and increases the expression of

uncoupling protein 1 in diet-induced obese mice. Hypertension 48:51-57

Avdeef A (2012). Permeability-PAMPA, In Absorption and drug development:

solubility, permeability, and charge state Second edition ed., pp319-498,

Wiley. com.

Benson SC, Pershadsingh HA, Ho CI, Chittiboyina A, Desai P, Pravenec M, Qi

N, Wang J, Avery MA, and Kurtz TW (2004). Identification of telmisartan as

a unique angiotensin II receptor antagonist with selective PPARγ-modulating

activity. Hypertension 43:993-1002


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

37

Busetto L. (2001) Visceral obesity and the metabolic syndrome. Effect of

weight loss. Nutr Metab Cardiovasc Dis;11:195-204

de Luis DA, Conde R, González-Sagrado M, Aller R, Izaola O, Dueñas A,

Castrillón JL, and Romero E (2010). Effects of telmisartan vs olmesartan on

metabolic parameters, insulin resistance and adipocytokines in hypertensive

obese patients. Nutr Hosp 25:275-279

Elbrecht A, Chen Y, Cullinan CA, Hayes N, Leibowitz MD, Moller DE, and

Berger J. (1996) Molecular cloning, expression and characterization of

human peroxisome proliferator activated receptors γ1 and γ2. Biochem

Biophys Res Commun 224:431-437

Escher P, Braissant O, Basu-Modak S, Michalik L, Wahli W, and Desvergne B.

(2001) Rat PPARs: Quantitative analysis in adult rat tissues and regulation in

fasting and refeeding. Endocrinology 142:4195-4202

Frost SC, and Lane MD (1985). Evidence for the involvement of vicinal

sulfhydryl groups in insulin-activated hexose transport by 3T3-L1 adipocytes.

J Biol Chem 260:2646-2652

Fujimoto M, Masuzaki H, Tanaka T, Yasue S, Tomita T, Okazawa K, Fujikura J,

Chusho H, Ebihara K, Hayashi T, Hosoda K, and Nakao K (2004). An

angiotensin II AT1 receptor antagonist, telmisartan augments glucose uptake


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

38

and GLUT4 protein expression in 3T3-L1 adipocytes. FEBS Letters.

576:492-497

Fujisaka S, Usui I, Kanatani Y, Ikutani M, Takasaki I, Tsuneyama K, Tabuchi Y,

Bukhari A, Yamazaki Y, Suzuki H, Senda S, Aminuddin A, Nagai Y, Takatsu

K, Kobayashi M, and Tobe K (2011). Telmisartan improves insulin resistance

and modulates adipose tissue macrophage polarization in high-fat-fed mice.

Endocrinology 152:1789-1799

Furukawa H, Mawatari K, Koyama K, Yasui S, Morizumi R, Shimohata T,

Harada N, Takahashi A, and Nakaya Y (2011). Telmisartan increases

localization of glucose transporter 4 to the plasma membrane and increases

glucose uptake via peroxisome proliferator-activated receptor γ in 3T3-L1

adipocytes. Eur J Pharmacol 660:485-491

Henke BR, Blanchard SG, Brackeen MF, Brown KK, Cobb JE, Collins JL,

Harrington WW, Hashim MA, Hull-Ryde EA, Kaldor I, Kliewer SA, Lake

DH, Leesnitzer LM, Lehmann JM, Lenhard JM, Orband-Miller LA, Miller

JF, Mook RA Jr, Noble SA, Oliver W Jr, Parks DJ, Plunket KD, Szewczyk

JR, and Willson TM (1998). N-(2-Benzoylphenyl)-L-tyrosine PPARγ

aginists. 1. Discovery of a novel series of potent antihyperglycemic and

antihyperlipidemic agents. J Med Chem 41:5020-5036


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

39

Holdgate G, Geschwindner S, Breeze A, Davies G, Colclough N, Temesi D, and

Ward L (2013). Biophysical methods in drug discovery from small molecule

to pharmaceutical. In Protein-Ligand Interactions, Williams MA. ; Daviter T.

Eds. ; Humana Press: 1008:pp327-355

Ishii-Yonemoto T, Masuzaki H, Yasue S, Okada S, Kozuka C, Tanaka T,

Noguchi M, Tomita T, Fujikura J, Yamamoto Y, Ebihara K, Hosoda K, and

Nakao K (2010). Glucocorticoid reamplification within cells intensifies

NF-κB and MAPK signaling and reinforces inflammation in activated

preadipocytes. Am J Physiol Endocrinol Metab 298:E930-E940

Israili ZH (2000). Clinical pharmacokinetics of angiotensin II (AT1) receptor

blockers in hypertension. J Hum Hypertens 14 (Suppl. 1):S73-S86

Jandeleit-Dahm KA, Tikellis C, Reid CM, Johnston CI, and Cooper ME (2005).

Why blockade of the renin-angiotensin system reduces the incidence of

new-onset diabetes. J Hypertens 23:463-473

Janke J, Engeli S, Gorzelniak K, Luft FC, and Sharma AM (2002). Mature

adipocytes inhibit in vitro differentiation of human preadipocytes via

angiotensin type 1 receptors. Diabetes 51:1699-1707

Jitrapakdee S, Slawik M, Medina-Gomez G, Campbell M, Wallace JC, Sethi JK,

O’Rahilly S and Vidal-Puig AJ (2005) The peroxisome proliferator-activated


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

40

receptor-γ regulates murine pyruvate carboxylase gene expression in vivo

and in vitro. J Biol Chem 280:27466-27476

Kajiya T, Ho C, Wang J, Vilardi R, and Kurtz TW (2011). Molecular and

cellular effects of azilsartan: a new generation angiotensin II receptor blocker.

J Hypertens 29:2476-2483

Kakuta H, Sudoh K, Sasamata M, and Yamagishi S (2005). Telmisartan has the

strongest binding affinity to angiotensin II type 1 receptor: Comparison with

other angiotensin II type 1 receptor blockers. Int J Clin Pharmacol Res

25:41-46

Kohara Y, Kubo K, Imamiya E, Wada T, Inada Y, and Naka T (1996). Synthesis

and angiotensin II receptor antagonistic activities of benzimidazole

derivatives bearing acidic heterocycles as novel tetrazole bioisosteres. J Med

Chem 39:5228-5235

Lakshmanan AR, Watanabe K, Thandavarayan RA, Sari FR, Harima M,

Giridharan VV, Soetikno V, Kodama M, and Aizawa Y (2011) Telmisartan

attenuates oxidative stress and renal fibrosis in streptozotocin induced

diabetic mice with the alteration of angiotensin-(1-7) mas receptor

expression associated with its PPAR-γ agonist action. Free Radic Res

45:575-584


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

41

Lamounier-Zepter V, Ehrhart-Bornstein M, and Bornstein SR (2006). Insulin

resistance in hypertension and cardiovascular disease. Best Pract Res Clin

Endocrinol Metab 20:355-367

Lind L, Berne C, and Lithell H (1995). Prevalence of insulin resistance in

essential hypertension. J Hypertens 13:1457-1462

Maeda N, Takahashi M, Funahashi T, Kihara S, Nishizawa H, Kishida K,

Nagaretani H, Matsuda M, Komuro R, Ouchi N, Kuriyama H, Hotta K,

Nakamura T, Shimomura I, and Matsuzawa Y (2001) PPARγ ligands

increase expression and plasma concentrations of adiponectin, an

adipose-derived protein. Diabetes;50:2094-2099

Marino MR, Langenbacher KM, Ford NF, Raymond RH, Manning J,

Vesterqvist O, Shamblen EC, and Lasseter KC (1999). Pharmacodynamics

and pharmacokinetics of irbesartan in patients with mild to moderate

hypertension. J Cardiovasc Pharmacol Ther 4:67-75

Miura Y, Yamamoto N, Tsunekawa S, Taguchi S, Eguchi Y, Ozaki N, and

Oiso Y. (2005) Replacement of valsartan and candesartan by telmisartan in

hypertensive patients with type 2 diabetes: metabolic and antiatherogenic

consequences. Diabet Care 28:757-758

Mori Y, Tanaka T, Matsuura K, Yokoyama J, and Utsunomiya K (2011).


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

42

Influence of telmisartan on insulin response after glucose loading in obese

patients with hypertension: ARB trial of hypertension in obese patients with

hyperinsulinemia assessed by oral glucose tolerance test (ATHLETE). Adv

Ther 28:698-706

Núñez S, Venhorst J, and Kruse CG (2012). Target-drug interactions: first

principles and their application to drug discovery. Drug Discov Today

17:10-22

Ohno K, Amano Y, Kakuta H, Niimi T, Takakura S, Orita M, Miyata K,

Sakashita H, Takeuchi M, Komuro I, Higaki J, Horiuchi M, Kim-Mitsuyama

S, Mori Y, Morishita R, and Yamagishi S (2011). Unique “delta lock”

structure of telmisartan is involved in its strongest binding affinity to

angiotensin II type 1 receptor. Biochem Biophys Res Commun 404:434-437

Papalia GA, Leavitt S, Bynum MA, Katsamba PS, Wilton R, Qiu H, Steukers

M, Wang S, Bindu L, Phogat S, Giannetti AM, Ryan TE, Pudlak VA,

Matusiewicz K, Michelson KM, Nowakowski A, Pham-Baginski A, Brooks J,

Tieman BC, Bruce BD, Vaughn M, Baksh M, Cho YH, Wit MD, Smets A,

Vandersmissen J, Michiels L, and Myszka DG (2006). Comparative analysis

of 10 small molecules binding to carbonic anhydrase II by different

investigators using Biacore technology. Anal Biochem 359:94-105


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

43

Picard F, and Auwerx J (2002). PPARγ and glucose homeostasis. Annu Rev

Nutr 22:167-197

Picard F, Géhin M, Annicotte J, Rocchi S, Champy MF, O’Malley BW,

Chambon P, and Auwerx J (2002). SRC-1 and TIF2 control energy balance

between white and brown adipose tissues. Cell 111:931-941

Porcelli L, Gilardi F, Laghezza A, Piemontese L, Mitro N, Azzariti A, Altieri F,

Cervoni L, Fracchiolla G, Giudici M, Guerrini U, Lavecchia A, Montanari R,

Giovanni CD, Paradiso A, Pochetti G, Simone GM, Tortorella P, Crestani M,

and Loiodice F (2012) Synthesis, characterization and biological evaluation

of ureidofibrate-like derivatives endowed with peroxisome

proliferator-activated receptor activity. J Med Chem 55:37-54

Ramírez-Zacarías JL, Castro-Muñozledo F, and Kuri-Harcuch W (1992).

Quantitation of adipose conversion and triglycerides by staining

intracytoplasmic lipids with Oil red O. Histochemistry 97:493-497

Renaud JP, and Delsuc MA (2009). Biophysical techniques for ligand screening

and drug design. Curr Opin Pharmacol 9:622-628

Rizos CV, Elisaf MS, and Liberopoulos EN (2009). Are the pleiotropic effects

of telmisartan clinically relevant? Curr Pharm Des 15:2815-2832

Rizos CV, Milionis HJ, Kostapanos MS, Florentin M, Kostara CE, Elisaf MS,


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

44

and Liberopoulos EN (2010). Effects of rosuvastatin combined with

olmesartan, irbesartan, or telmisartan on indices of glucose metabolism in

Greek adults with impaired fasting glucose, hypertension, and mixed

hyperlipidemia: A 24-week, randomized, open-label, prospective study. Clin

Ther 32:492-505

Schupp M, Clemenz M, Gineste R, Witt H, Janke J, Helleboid S, Hennuyer N,

Ruiz P, Unger T, Staels B, and Kintscher U (2005). Molecular

characterization of new selective peroxisome proliferator-activated receptor

γ modulators with angiotensin receptor blocking activity. Diabetes

54:3442-3452

Schupp M, Janke J, Clasen R, Unger T, and Kintscher U (2004). Angiotensin

type 1 receptor blockers induce peroxisome proliferator-activated receptor-γ

activity. Circulation 109:2054-2057

Shao J, Nangaku M, Inagi R, Kato H, Miyata T, Matsusaka T, Noiri E, and

Fujita T (2007). Receptor-independent intracellular radical scavenging

activity of an angiotensin II receptor blocker. J Hypertens 25:1643-1649

Shimabukuro M, Tanaka H, and Shimabukuro T (2007). Effects of telmisartan

on fat distribution in individuals with the metabolic syndrome. J Hypertens

25:841-848


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

45

Shimaya A, Kurosaki E, Shioduka K, Nakano R, Shibasaki M, and Shikama H

(1998). YM268 increases the glucose uptake, cell differentiation, and mRNA

expression of glucose transporter in 3T3-L1 adipocytes. Horm Metab Res

30:543-548

Sugimoto K, Qi NR, Kazdová L, Pravenec M, Ogihara T, and Kurtz TW (2006).

Telmisartan but not valsartan increases caloric expenditure and protects

against weight gain and hepatic steatosis. Hypertension 47:1003-1009

Suksomboon N, Poolsup N, and Prasit T (2012). Systematic review of the

effect of telmisartan on insulin sensitivity in hypertensive patients with

insulin resistance or diabetes. J Clin Pharm Ther 37:319-327

Suwa A, Kurama T, Yamamoto T, Sawada A, Shimokawa T, and Aramori I

(2010). Glucose metabolism activation by SHIP2 inhibitors via up-regulation

of GLUT1 gene in L6 myotubes. Eur J Pharmacol 642:177-182

Takagi H, Niwa M, Mizuno Y, Goto S, and Umemoto T (2013). Telmisartan as

a metabolic sartan: The first meta-analysis of randomized controlled trials in

metabolic syndrome. J Am Soc Hypertens 7:229-235

Takagi H, and Umemoto T (2012a). Telmisartan increases adiponectin levels: A

meta-analysis and meta-regression of randomized head-to-head trials. Int J

Cardiol 155:448-451


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

46

Takagi H, and Umemoto T (2012b). Telmisartan improves insulin sensitivity: A

meta-analysis of randomized head-to-head trials. Int J Cardiol 156:92-96

Takagi H, and Umemoto T (2012c). Telmisartan reduces triglyceride levels

over other angiotensin II receptor blockers: A meta-analysis of randomized

head-to-head trials. Int J Cardiol 157:403-407

Takenaka Y, Inoue I, Nakano T, Shinoda Y, Ikeda M, Awata T, and Katayama S.

(2013) A novel splicing variant peroxisome proliferator-activated receptor-γ

(Pparγ1sv) cooperatively regulates adipocyte differentiation with Pparγ2.

PLoS One 8:e65583

Tontonoz P, Hu E, and Spiegelman BM. (1994) Stimulation of adipogenesis in

fibroblasts by PPARγ2, a lipid-activated transcription factor. Cell

79:1147-1156

Velazquez-Campoy A, Ohtaka H, Nezami A, Muzammil S, and Freire E (2004).

Isothermal titration calorimetry. in Curr Protoc Cell Biol Chapter 17:Unit

178

Velloso LA, Folli F, Sun XJ, White MF, Saad MJ, and Kahn CR (1996).

Cross-talk between the insulin and angiotensin signaling systems. Proc Natl

Acad Sci. USA 93:12490-12495

Vitale C., Mercuro G, Castiglioni C, Cornoldi A, Tulli A, Fini M, Volterrani M,


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

47

and Rosano GM (2005). Metabolic effect of telmisartan and losartan in

hypertensive patients with metabolic syndrome. Cardiovasc Diabetol 4:6

Wajchenberg BL. (2000) Subcutaneous and visceral adipose tissue: their

relation to the metabolic syndrome. Endocr Rev 21:697-738

Watanabe M, Inukai K, Sumita T, Ikebukuro K, Ito D, Kurihara S, Ono H,

Awata T, and Katayama S. (2010) Effects of telmisartan on insulin

resistance in Japanese type 2 diabetic patients. Intern Med 49:1843-1847

Yamashita S, Tanaka Y, Endoh Y, Taki Y, Sakane T, Nadai T, and Sezaki H

(1997). Analysis of drug permeation across Caco-2 monolayer: Implication

for predicting in vivo drug absorption. Pharm Res 14:486-491

Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S,

Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P,

Carling D, Kimura S, Nagai R, Kahn BB, and Kadowaki T (2002)

Adiponectin stimulates glucose utilization and fatty-acid oxidation by

activating AMP-activated protein kinase. Nat Med 8:1288-1295

Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori Y, Ide T,

Murakami K, Tsuboyama-Kasaoka N, Ezaki O, Akanuma Y, Gavrilova O,

Vinson C, Reitman ML, Kagechika H, Shudo K, Yoda M, Nakano Y, Tobe K,

Nagai R, Kimura S, Tomita M, Froguel P, and Kadowaki T. (2001) The


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

48

fat-derived hormone adiponectin reverses insulin resistance associated with

both lipoatrophy and obesity. Nat Med 7:941-946

Yano Y, Hoshide S, Ishikawa J, Noguchi C, Tukui D, Hidaka T, Tada M,

Kanemaru Y, Yano A, Ishikawa S, Shimada K, and Kario K (2007) The

differential effects of angiotensin II type 1 receptor blockers on

microalbminuria in relation to low-grade inflammation in metabolic

hypertensive patients. Am J Hypertens 20:565-572

Yao B, Collins B, and Chen M (2005). Light scattering to detect compound

aggregation in screening assays. DrugPlus International

Zavaroni I, Mazza S, Dall’Aglio E, Gasparini P, Passeri M, and Reaven GM

(1992). Prevalence of hyperinsulinaemia in patients with high blood pressure.

J Intern Med 231:235-240


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

49

Footnotes

While this research was supported by Astellas Pharma Inc., Drs. Yonemoto

and Masuzaki declare no conflicts of interest concerning the present

manuscript.

Dr. Masuzaki is supported in part by Grants-in-Aid from the Ministry of

Education, Culture, Sports, Science and Technology of Japan (MEXT)

KAKENHI [Grant 24591338, (2012~2014)] and by Special Account Budget for

Education and Research (2011~2015) granted by the Japan Ministry of

Education, Culture, Sports, Science and Technology of Japan.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

50

Figure legends

Figure 1. Effect of each ARB or pioglitazone on adipose differentiation in

3T3-L1 adipocytes. Telmisartan, irbesartan, azilsartan, candesartan, and

pioglitazone were dissolved in DMSO (vehicle) and added to media during the

course of adipocyte differentiation (Day 0-6). (A) Differentiated adipocytes

were fixed and stained with Oil Red O at day 6. Microscopic images

(magnitude 10×) of cells are shown. (B) Lipid accumulation was assessed via

quantification of OD510 in destained Oil Red O with isopropanol. Data are

expressed as mean ± S.E.M. from quadruplicate experiments. *P < 0.05, ***P <

0.001 (Dunnett’s multiple comparison test) compared with vehicle

(DMSO)-treated group. TEL: telmisartan, IRB: irbesartan, AZL: azilsartan,

CAN: candesartan, PIO: pioglitazone

Figure 2. Effect of ARBs and pioglitazone on the mRNA expression of aP2

and PPARγ2 in differentiating 3T3-L1 adipocytes. Cells were treated with

each compound during the course of adipocyte differentiation (Day 0-6). Total

RNA was extracted, and mRNA for aP2 (A) or PPARγ2 (B) was determined via

quantitative RT-PCR. Quantification of relative mRNA expression is shown.

Results were normalized to the signal generated from β-actin mRNA. Data are


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

51

expressed as mean ± S.E.M. from triplicate or quadruplicate experiments. **P

< 0.01, ***P < 0.001 (Dunnett’s multiple comparison test) compared with

vehicle (DMSO)-treated group. TEL: telmisartan, IRB: irbesartan, AZL:

azilsartan, CAN: candesartan, PIO: pioglitazone

Figure 3. Effect of each ARB or pioglitazone on basal and

insulin-stimulated 2-deoxy glucose (DG) uptake in 3T3-L1 adipocytes.

Cells were treated with each compound during the course of adipocyte

differentiation (Day 0-6). 2-DG uptake was measured in the absence (A) or

presence (B) of 100 nmol/L insulin. Data are expressed as mean ± S.E.M. from

quadruplicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001 (Dunnett’s

multiple comparison test) compared with vehicle (DMSO)-treated group. TEL:

telmisartan, IRB: irbesartan, AZL: azilsartan, CAN: candesartan, PIO:

pioglitazone

Figure 4. Effect of each ARB or pioglitazone on GLUT4 protein expression

in 3T3-L1 adipocytes. Cells were treated with each compound during the

course of adipocyte differentiation (Day 0-6). On Day 6, total cell lysates were

prepared, and equal amounts of protein were subjected to Western blotting.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

52

Quantification of relative protein expression was plotted. Data are expressed as

mean ± S.E.M. from triplicate experiments. **P <0.01 (Dunnett’s multiple

comparison test) compared with vehicle (DMSO)-treated group. TEL:

telmisartan, IRB: irbesartan, AZL: azilsartan, CAN: candesartan, PIO:

pioglitazone

Figure 5. Unique structure of telmisartan. (A) Chemical structure of

telmisartan divided into the A-Part, which contains biphenyl carboxylic acid,

and the B-Part, which contains two benzimidazole rings. The central

benzimidazole ring of the B-Part is shown in green. (B) Top view of telmisartan

bound to PPARγ. The structure is available in Protein Data Bank (PDB

ID:3VN2). Telmisartan is shown in a space-filling model. Amino acid residue

of PPARγ is shown in a wire frame model. Gray atoms indicate carbon atoms

of the A-Part. Yellow and green atoms indicate carbon atoms of the central

benzimidazole ring and other region of the B-Part, respectively. Cyan atoms

indicate carbon atoms of PPARγ. Red and blue atoms indicate oxygen and

nitrogen atoms, respectively. Tyr473 makes a hydrogen bond with telmisartan.

(C) Side view of the B-Part in the hydrophobic and narrow pocket of PPARγ. A

cross-sectional view is shown from the direction indicated by the arrow in (B).


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

53

In this view, the A-Part is removed to make it easier to recognize the B-Part.

(Outside of inset) Chemical structures of typical ARBs are shown around the

inset. Sections corresponding to the central benzimidazole ring of telmisartan

are shown in green.

Figure 6. (A) Insulin signal transduction pathway and mechanism of

insulin resistance induced by Ang II. (B) Role of TIF-2, SRC-1 in energy

metabolism of adipocytes. (A) Insulin signal transduction pathway and

mechanism of insulin resistance induced by Ang II. Ang II stimulation

mediated by AT1-R induces serine phosphorylation of IRS-1, impairing insulin

induced signal transduction towards Akt and the downstream molecules. Ang

II: angiotensin II, AT1-R: angiotensin II type 1 receptor, IR: insulin receptor,

IRS-1: insulin receptor substrate-1, Tyr-p, phosphorylated Tyrosine, PI3-K:

phosphatidylinositol-3 kinase, Akt: protein kinase B (B) Scheme illustrating the

hypothetical role of TIF-2 and SRC-1 in obesity and insulin resistance. The

lack of TIF-2 in adipocyte suppresses its competition with SRC-1 for PGC-1α,

and promotes the formation of SRC-1/PGC-1α complex, subsequently

stimulates energy expenditure. This protects against fat accumulation and

favors insulin sensitization.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

54

Table 1. Binding affinities of ARBs against PPARγ assessed by isothermal

titration calorimetry

Compound Kd

Telmisartan

μM

0.34 ± 0.04

Irbesartan 10.3 ± 1.5

Azilsartan >100

Candesartan >100

Farglitazar 0.01 ± 0.02

The binding affinities (Kd = 1/Ka) were determined at 25 °C by isothermal

titration calorimetry. The PPARγ solution (approximately 25 μmol/L) in the

calorimetric cell was titrated with ARB solutions (1.4 μL per injection of 250

μmol/L-3 mmol/L) dissolved in the same buffer (PBS, pH 7.4 with 5% DMSO).

Data are expressed as mean ± S.E.M. from independent triplicate experiments.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

55

Table 2. Lipophilicities and cell permeability of ARBs assessed by

high-performance liquid chromatography/mass spectrometry system and

parallel artificial membrane permeability assay (PAMPA)

Compound Lipophilicity Cell

permeability

Telmisartan

2.6 ± 0.0

10-6cm/sec

27.1 ± 1.4

Irbesartan 1.3 ± 0.0 6.6 ± 0.5

Azilsartan -0.9 ± 0.0 0.7 ± 0.2

Candesartan -1.5 ± 0.0 0.4 ± 0.2

Lipophilicities of a series of ARBs were determined as 1-octanol/water

distribution coefficient at pH 7.4 (LogD) by using high-performance liquid

chromatography/mass spectroscopy system. The procedure of distribution and

separation was conducted by the JIS standard (JIS Z7260-107; OECD Test

Guideline 107). Cell permeability was assessed by a parallel artificial

membrane permeability assay (PAMPA) (Avdeef, 2012). 125-μm-thick

microfilter disc (0.45-μm diameter pores) coated with a 20% (w/v) dodecane

solution of a lecithin mixture was used as artificial cell membrane. Data are

expressed as mean ± S.E.M. from independent triplicate experiments.


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

56

Fig. 1


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

57

Fig. 2


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

58

Fig. 3


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

59

Fig. 4


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

60

Fig. 5


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


JPET #211722

61

Fig. 6


at ASPE

T Journals on N

ovember 18, 2018


ownloaded from


Documents

JPET #211722 1 Distinct properties of telmisartan on agonistic