Milk from cows of different b-casein genotypes as a sourceof b-casomorphin-7

ANNA CIESLINSKA1, ELZBIETA KOSTYRA2, HENRYK KOSTYRA3, KAMIL OLENSKI1,

EWA FIEDOROWICZ3, & STANISŁAW KAMINSKI1

1Department of Animal Genetics, 2Department of Biochemistry, University of Warmia and Mazury, Olsztyn, Poland, and3Department of Food Immunology and Microbiology, Institute of Animal Reproduction and Food Research, Polish Academy of

Sciences, Tuwima 10, Olsztyn 1-747, Poland,

AbstractThe aim of this study was to quantify b-casomorphin-7 in raw, hydrolyzed and processed milk in different stages of the cowlactation. The obtained results lead to the following conclusion: the highest amount of b-casomorphin-7 released from thehydrolyzed and processed milk is related to the b-casein A1 allele, irrespective of a lactation period. Some traces ofb-casomorphin-7 in milk from cows with the b-casein A2 variant are probably a result of the acid hydrolysis of b-casein during itsdigestion with pepsin. It has been shown that processing of raw milk at high temperatures affects, in a slight degree, thedifferences between b-casomorphins-7 originating from different b-casein genotypes. The obtained results suggest a possibilityto provide a new nutritional factor for milk quality based on the content of b-casomorphin-7 liberated in vivo from milk digestedby a mixture of the gastrointestinal enzymes.

Keywords: b-casein, b-casomorphin-7, polymorphism, biochemical individuality

Introduction

The nutritive value of bovine caseins is not only

determined by their amino acid content but also by

bioactive peptides released during their digestion in the

gastrointestinal track (Park 2009). In the human

organism, those bioactive peptides may act as regulatory

components with hormone-like activities, which may

modulate specific physiological functions (Meisel 2001;

Kostyra et al. 2004; Silva and Malcata 2005). Bovine

b-caseins are a source of bioactive peptides that manifest

antimicrobiological, antihypertensive, antithrombotic,

immunomodulatory and mineral-binding activities

(Clare and Swaisgood 2000; Phelan et al. 2009).

Within these bioactive peptides, the opioid

b-casomorphin-7 drew a lot of attention. It has been

shown that b-casomorphin-7 originates only from

b-casein A1 or B (Hartwig et al. 1997; Jinsmaa and

Yoshikawa 1999) and may be a serious risk factor in

human ischaemic heart disease, arteriosclerosis, type 1

diabetes and sudden infant death syndrome (Elliott

et al. 1999; Sun et al. 1999, 2003; Thorsdottir et al.

2000; McLachlan 2001; Birgisdottir et al. 2002, 2006;

Laugesen and Elliott 2003; Tailford et al. 2003).

b-Casomorphin-7 is made up of amino acids, which

run from position 60 to 66 in the b-casein protein

chain (Tyr–Pro–Phe–Pro–Gly–Pro–Ile). Releasing

b-casomorphin-7 from A1 b-casein prevents many

other peptides that have important effects from being

released in that region. In this context, it is worth to

note that there are 12 genetic variants of CSN2, but

only six of them occur in the Holstein cattle: A1, A2,

A3, B, C and I, the first two being the most common

(Kaminski et al. 2006, 2007; Caroli et al. 2009;

Heck et al. 2009; Nilsen et al. 2009; Arendonk and

Bovenhuis 2010; Olenski et al. 2010; Visker et al.

2010). The natural mutation that gave rise to this

difference is a result of a single nucleotide polymorph-

ism at codon 67 of theb-casein gene: CCT (A2 and A3,

proline) ! CAT (A1, B, C, histidine). This difference

ISSN 0963-7486 print/ISSN 1465-3478 online q 2011 Informa UK, Ltd.

DOI: 10.3109/09637486.2011.634785

Correspondence: H. Kostyra, Department of Food Immunology and Microbiology, Institute of Animal reproduction and Food Research,Polish Academy of Sciences, Tuwima 10, Olsztyn 1-747, Poland. Tel: (4889) 5234675. Fax: (4889) 5240124. E-mail: h.kostyra@pan.olsztyn.pl

International Journal of Food Sciences and Nutrition,

June 2012; 63(4): 426–430

Int J

Foo

d Sc

i Nut

r D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Win

dsor

on

07/1

6/14

For

pers

onal

use

onl

y.

in the amino acid sequence suggests a conformational

difference in the secondary structure of the expressed

protein (Elliott et al. 1999; McLachlan 2001).

Although the European Food Safety Authority has

not supported the hypothesis on the cause–effect

relationship between an oral intake of b-casomorphin-7

and the aetiology of human diseases, high contents of

that peptide in enzymatically hydrolyzed milk remain

intriguing (Cieslinska et al. 2007; De Noni 2008). The

aim of the current study was to examine the influence

of b-casein genotypes, stages of cow’s lactation and

high-temperature processing of cow’s milk on the

release of b-casomorphin-7 with gastrointestinal

proteases in vitro.

Materials and methods

Genetic investigations

One hundred seventy seven Holstein–Friesian cows

were included in the analysis. They were kept in the

same herd and fed with a balanced diet. The cows with

the same genotype of b-casein had no common

ancestor (neither the same sire nor grandsire). Out of

177 cows, 18 were selected for the experiment. These

cows were in their first lactation and were milked in the

same season. All the selected cows did not show any

sub-clinical symptoms of mastitis diagnosed by

somatic cell count, measured routinely once a month.

The level of urea in milk did not indicate any metabolic

disturbances. The genotype of b-casein locus was

determined using the method described by Lien et al.

(1992) with minor modifications. Blood (350ml) was

drawn from the cows to isolate DNA using the

MasterPure Purification Kit (Epicentre, illumina,

USA). The primers had the following sequences:

CASB122L-50GAGTCGACTGCAGATTTTCAAC-

ATCAGTGAGAGTCAGGCCCTG30, CASB67R-

50CCTGCAGAATTCTAGTCTATCCCTTCCCT-

GGGCCCATCG 30.

To produce a 322 bp fragment of the CSN2 gene,

the following PCR mix was composed: 0.4ml of the

primers 122 L and 67 R, each in concentrations

of 50 pmol/ml, 0.7 U of Tfl polymerase (Epicentre),

1.25ml of MasterAmp 20 £ PCR buffer (Epicentre),

1.5ml of magnesium chloride (15 mM), 2.0ml of

Enhancer (Epicentre), ca. 150 ng of genomic DNA

and 25ml of H20. The samples were amplified in the

MJ Research thermocycler under the following

conditions: 3 min/948C and 35 cycles of 948C/25 s,

628C/25 s and 728C/25 s. The PCR product was then

digested by the Nsi I enzyme to generate restriction

fragments and then electrophoresed in 2.5% agarose gel

(AmpliSize, Bio-Rad Inc., Madison, USA).

Immunometric assay of b-casomorphin-7

Milk from 18 cows (six A1A1, six A2A2 and six A1A2,

all being in their first lactations and with similar

productivities) was collected in three terms: on

the 30th, 100th and 200th day of their lactation.

The peptides were extracted from milk according

to our previous work (Cieslinska et al. 2007).

b-Casomorphin-7 contents were analysed with the

ELISA. Immuno-module plates were coated with

antibody, incubated at 378C for 2 h and the unbound

antigen was washed off using 200ml of 1 £ phosphate

buffered saline system (PBS)/Tween. The antigen was

blocked using 200ml of 1% gelatine for 1 h at 378C and

the plate was washed of 3 £ with 200ml PBS/Tween.

Polyclonal antibodies were prepared according to the

method described in our publication (Sienkiewicz-

Szłapka et al. 2009). Hundred microlitres of antibody

were added, incubated for 1 h at 378C and washed 3 £

with 200ml of PBS/Tween. Then, 100ml of secondary

antibody was added, incubated for 1 h at 378C and

washed with 200ml of 3 £ PBS/Tween. Hundred

microlitres of peroxidase substrate o-pheylenediamine

(OPD) were added, incubated for 30 min at 378C and

the reaction was stopped with 50ml of 5 M HCl. The

plates were read on an ELISA plate reader at 492 nm

(ASYS UVM 340).

The milk samples were also hydrolyzed by a cocktail

of digestive enzymes (pepsin/trypsin/elastase). The pH

of the milk samples (10 ml) was adjusted to 1.8 with

1 M HCl and then pepsin was added (E:S 1:25 v/v,

pepsin dissolved in SGF, pH 1.8). Every milk sample

Figure 1. A typical electropherogram that shows genotyping of theb-casein locus. Theoretical (A) and observed (B) pattern of the DNA restriction

fragments. Path 1 – DNA size markerFX174/Hae III; paths 2, 4, 10 – homozygote A2A2; paths 3, 5 – homozygote A1A1; paths 6–9 – heterozygote

A1A2; path 11 – PCR product undigested by Nsi I. The DNA band of 37 bp size diffused out of the gel and is not visible.

A source of b-casomorphin-7 427

Int J

Foo

d Sc

i Nut

r D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Win

dsor

on

07/1

6/14

For

pers

onal

use

onl

y.

was mixed and incubated at 378C for 1 h. After this

time, the pH of the mixture was raised to 8.0 with 1 M

NaOH (inactivation of pepsin). Then, a trypsin

solution (E:S 1:50 v/v, trypsin dissolved in SGF,

pH 8.0) was added to the mixture, mixed and

incubated at 378C for 15 min. Next, the pH of the

solution was raised to 9.0 with 1 M NaCl and an

elastase solution (E:S 1:100 v/v, elastase dissolved

in SGF, pH 9.0) was added and incubated at 378C

for 20 min. Samples of the digested peptides

were extracted from the mixture according to the

method of Harwalkar and Elliott (1971) and then

b-casomorphin-7 was identified using the ELISA

technique as described above.

The stimulated gastric fluid (SGF) solution was

prepared as follows: 0.15 M NaCl was acidified with

1 M HCl to pH 1.8 or alkalized with 1 M NaOH to pH

8.0 or 9.0. Six litres of milk were collected from each

cow. Milk of A1, A2, A1A2 b-casein phenotypes was

pooled and divided into three parts, each destined

to different processing: drying (milk powder), pas-

teurization (958C/20 min.) and sterilization

(1178C/5 min). Five litres of milk were used to make

milk powder and the remaining milk was pasteurized

(0.5 l) or sterilized (0.5 l) using the standardized

method used routinely in the dairy industry (Kessler

1981). Twenty millilitres of the pasteurized and the

sterilized milk were taken for further analysis. An

amount of 660 mg of the powdered milk was dissolved

in 20 ml of water. From each group of the samples

(powdered, pasteurized and sterilized milk), 10 ml was

taken to extract the peptides as described above. The

remaining milk (10 ml from each batch) was digested

by the cocktail of enzymes (pepsin/trypsin/elastase).

Statistical analysis

Quantitative compositions of bovine caseins from

cows of the same genotype can be different. They

depend on agents such as the breed, feeding,

environment, temperature, age and biochemical

individuality of the cow organism. Our investigations

took the biochemical individuality into serious

consideration, which required using all the obtained

data in a statistical analysis. For this reason, we divided

the data concerning the content of b-casomorphin-7

in milk and milk protein hydrolysates into two

statistical series. The classification of the data into

each series was done using the Dixon Q test for

identification and rejection of outliers. Each of the

statistical series was evaluated on the basis of a small

sample. The evaluation of the statistical significance

between both series was made using a test for the

difference between means (Dixon 1951; Meloun et al.

2001; Ott and Longnecker 2001).

Results and discussion

The results of the genotype occurrences in the

investigated Holstein–Friesian breed are presented

in Figure 1 and Table I. One hundred and seventy

seven cows were included in this analysis. They were

kept in the same herd and fed with a balanced diet.

The cows with the same genotype of b-casein had no

common ancestor (neither the same sire nor grand-

sire). All the selected cows did not show any

sub-clinical symptoms of mastitis diagnosed routinely

once a month. Out of them, 18 were carefully selected

to be in their first lactation and to be milked in the

same season. A typical electropherogram that shows

genotyping of the b-casein locus is presented in

Figure 1. Frequencies of the b-casein genotypes in the

investigated cows are presented in Table I. Twenty-two

cows were characterized by the genotype A1A1,

86 cows were characterized by the genotype A2A2

and 69 cows were characterized by the genotype

A1A2. It means that milk from these cows contains

b-casein from which b-casomorphin-7 can be

released. The amount of b-casomorphin-7 in the raw

and the hydrolyzed milk in the subsequent periods of

the lactation is a confirmation of these assumptions

(Tables II and III). In our work all cows were

genotyped by the method allowing to identify allele A1

or A2, since only substitution of His to Pro in position

67 leads to the occurrence of b-casomorphin-7. All

other amino acid substitutions (for allele A3, B, C and I)

do not produce b-casomorphin-7 amino acid chain

and, therefore, they were not identified by PCR test.

b-Casomorphin-7 was present in all milk samples,

i.e. the raw milk, the one digested with pepsin, and the

Table I. Frequencies of genotypes in the Polish Holstein–Friesian

breed.

Frequencies of genotypes

A1A1 A2A2 A1A2

Number of cows

22 (12.43%) 86 (48.59%) 69 (38.98%)

Table II. Means and SD of b-casomorphin-7 content in raw and

hydrolyzed milk in the subsequent periods of the cow lactation.

Milk

Genotype N Undigested Pepsin (ng/ml) PTE

30th day of lactation

A1A1 3 2.0 25.0 544 ^ 77

A1A2 3 1.8 21.0 357 ^ 68

A2A2 3 1.2 8.0 47 ^ 7

100th day of lactation

A1A1 3 2.1 22.0 596 ^ 120

A1A2 3 1.9 18.0 469 ^ 69

A2A2 3 1.1 7.0 45 ^ 10

200th day of lactation

A1A1 3 2.1 23.0 683 ^ 129

A1A2 3 2.0 19.0 479 ^ 71

A2A2 3 1.2 6.0 59 ^ 6

Notes: Data (PTE) presented as means (N ¼ 3) for significant

(P , 0.05). N, number of cows; PTE, milk digested with pepsin,

trypsin and elastase.

A. Cieslinska et al.428

Int J

Foo

d Sc

i Nut

r D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Win

dsor

on

07/1

6/14

For

pers

onal

use

onl

y.

mixture of pepsin, trypsin and elastase. These data

require a more detailed explanation, particularly in the

context of information presented by Jinsmaa and

Yoshikawa (1999) and Considine et al. (1999). Those

authors have proved that b-casomorphin-7 was

released only from the genetic variant of b-casein

containing a His residue at the 67th position of the

peptide chain. It is known from the literature that

pepsin and trypsin do not liberate b-casomorphin-7

from b-casein (Schmelzer et al. 2007). Thus,

the following problem arose: why is there more

b-casomorphin-7 in pepsin hydrolysates of milk than

in milk itself? This phenomenon can be explained by

the observations made by Bitri (2004). He has proved

that bioactive peptides can be liberated from bovine

casein not only by the enzymatic hydrolysis but also by

the acidic one. So, the increase in the content of

b-casomorphin-7 in the pepsin hydrolysate of milk

when compared to the raw milk probably caused the

acidic hydrolysis of b-casein (pH 2.0, environment of

pepsin action). The amounts of b-casomorphin-7

detected in the raw milk and the milk hydrolyzed with

pepsin are too small to raise the interest of nutritionists

and physicians (EFSA Report 2009).

At the same time, the contents of b-casomorphin-7

in the milk hydrolyzed with the mixture of the

gastrointestinal enzymes (pepsin, trypsin and elastase)

were 20–30 times higher than in the raw milk (Tables I

and II). When interpreting these results further, it is

necessary to account for the choice of those enzymes.

It is known that pepsin and trypsin do not liberate

b-casomorphin-7 from b-casein. According to Jinsmaa

and Yoshikawa (1999), elastase cleaves the peptide

bond between Ile66 and His67, releasing the carboxyl

terminus of b-casomorphin-7. Pepsin is required to

release the amino terminus of this peptide. In this

mixture, trypsin probably plays a role similar to pepsin

(Jakobsson et al. 1983). Thus, the in vitro hydrolysis of

b-casein with the mixture of the gastric intestinal

enzymes can reflect a potential of forming of

b-casomorphins in the digestive tract.

Moreover, our results confirm the fact that the milk

from cows with the A1A1 genotype of b-casein

represents the main source of b-casomorphin-7.

From the milk of cows with the A1A2 genotype of

b-casein, smaller amount of b-casomorphin-7 is libe

rated. It is absolutely correct because b-casomorphin-7

is not liberated from the milk derived from cows with

the A2A2 genotype of b-casein. As it has been

mentioned before, small amounts of b-casomorphin-7

in the milk from cows with the A2A2 genotype of

b-casein are probably a result of the acidic hydrolysis of

b-casein. The contents of b-casomorphin-7 in the

processed milk are presented in Table IV.

It has been observed that thermal processes caused a

decrease of b-casomorphin-7 in the obtained pro-

ducts. It is probably the non-enzymatic glycolysis of

milk proteins that are responsible for this phenom-

enon. During processing of milk, lactose interacts with

casein and may affect the conformation and the

kinetics of the enzymatic hydrolysis (Kostyra et al.

2010). Finally, it is necessary to confirm that the test

for the differences between the means of both series

proved that they are statistically significant.

Conclusions

The obtained results lead to the conclusion that the

highest amount of b-casomorphin-7 released from the

hydrolyzed and processed milk is related to b-casein

A1 allele, irrespective of the lactation period. The

traces of b-casomorphin-7 in milk from cows with

b-casein A2 variant is probably a result of the acid

hydrolysis of b-casein during its digestion with pepsin.

It has been shown that the processing of raw milk at a

high temperature slightly affects the differences of

b-casomorphin-7 referred to b-casein genotype.

Different amounts of b-casomorphin-7 in milk from

cows with different genetic variations of b-casein

suggest a possibility to provide a new nutritional

factor of milk quality based on the content of

Table III. Means and SD of b-casomorphin-7 content in raw and

hydrolyzed milk in the subsequent periods of the cow lactation.

Milk

Genotype N Undigested Pepsin (ng/ml) PTE

30th day of lactation

A1A1 3 3.0 14.0 373 ^ 43

A1A2 3 2.0 13.0 157 ^ 20

A2A2 3 1.5 8.0 28 ^ 6

100th day of lactation

A1A1 3 2.2 8.0 375 ^ 52

A1A2 3 2.0 6.0 276 ^ 51

A2A2 3 1.3 7.0 18 ^ 7

200th day of lactation

A1A1 3 2.3 8.0 515 ^ 60

A1A2 3 2.0 11.0 306 ^ 43

A2A2 3 1.4 6.0 38 ^ 7

Notes: Data (PTE) presented as means (N ¼ 3) for significant

(P , 0.05). N, number of cows; PTE, milk digested with pepsin,

trypsin and elastase.

Table IV. The content of b-casomorphin-7 in the processed milk.

Genotype RM (ng/ml) PTE (ng/ml)

Milk powder

A1A1 2.7 324.8

A2A2 0.9 86.8

A1A2 0.8 152.5

Pasteurized milk

A1A1 3.3 346.9

A2A2 3.6 31.7

A1A2 6.1 207.1

Sterilized milk

A1A1 2.9 240.7

A2A2 5.4 31.1

A1A2 7.4 154.1

Notes: RM, raw milk; PTE, milk digested with pepsin, trypsin and

elastase.

A source of b-casomorphin-7 429

Int J

Foo

d Sc

i Nut

r D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Win

dsor

on

07/1

6/14

For

pers

onal

use

onl

y.

b-casomorphin-7 liberated in vivo from milk digested

with a mixture of the gastrointestinal enzymes.

Declaration of interest: This work has been

financially supported by the University of Warmia

and Mazury (Project No. 0105-0804), MNiSzW

(Project No. N 312034). The first author has been

awarded with an EU scholarship within the frames of

the European Social Fund. The authors report no

conflicts of interest. The authors alone are responsible

for the content and writing of the paper.

References

Arendonk JAM, Bovenhuis H. 2010. Association of bovine beta-

casein protein variant with milk production and milk protein

composition. Anim Genet 42:212–218.

Birgisdottir BE, Hill JP, Harris DP, Thorsdottir I. 2002. Variation in

consumption of cow milk proteins and lower rate of Type 1

diabetes in Iceland versus the other 4 Nordic countries. Diabetes

Nutr Metab 15:240–245.

Birgisdottir BE, Hill JP, Thorsson AV, Thorsdottir I. 2006. Lower

consumption of cow milk protein A1 beta-casein at 2 years of age,

rather than consumption among 11- to 14-year-old adolescents,

may explain the lower rate of type 1 diabetes in Iceland than in

Scandinavia. Ann Nutr Metab 50:177–183.

Bitri L. 2004. Optimization study for the production of an opioid-

like preparation from bovine casein by mild acidic hydrolysis. Int

Dairy J 14:535–539.

Caroli AM, Chessa S, Erhardt GJ. 2009. Milk protein polymorph-

ism in cattle: effect on animal breeding and nutrition. J Dairy Sci

9:5335–5352.

Cieslinska A, Kaminski S, Kostyra E, Sienkiewicz-Szłapka E. 2007.

Beta-casomorphin 7 in raw and hydrolyzed milk derived from

cows of alternative beta-casein genotypes. Milchwissenschaft 62:

125–127.

Clare DA, Swaisgood HE. 2000. Bioactive milk peptides: a

perspective. J Dairy Sci 83:1187–1195.

Considine T, Healy A, Kelly AL, McSweeney PLH. 1999. Proteolytic

specificity of elastase on bovineb-casein. Food Chem 66:463–470.

De Noni I. 2008. Release of beta-casomorphins 5 and 7 during

simulated gastro-intestinal digestion of bovine beta-casein variants

and milk-based infant formulas. Food Chem 110:897–903.

Dixon WJ. 1951. Ratios involving extreme values. Ann Math Stat

21:488–506.

EFSA Report 2009. Review of the potential health impact of b-

casomorphins and related peptides. EFSA Scientific Report 231:

1–107.

Elliott RB, Harris DP, Hill JP, Bibby NJ, Wasmuth HE. 1999. Type 1

(insulin-dependent) diabetes mellitus and cow milk: casein

variant consumption. Diabetologia 42:292–296.

Hartwig A, Teschemacher H, Lehmann W, Gauly M, Erhardt G.

1997. Influence of genetic polymorphisms in bovine milk on the

occurrence of bioactive peptides. Int Dairy Federation 9702:

459–460.

Harwalkar VR, Elliott JA. 1971. Isolation of bitter and astringent

fractions from Cheddar cheese. J. Dairy Sci 54:8–11.

Heck JML, Schennink A, van Valenberg HJF, Bovenhuis H, Visker

MHPW, van Arendonk JAM, van Hooijdonk ACM. 2009.

Effects of milk protein variants on the protein composition of

bovine milk. J Dairy Sci 92:1192–1202.

Jakobsson I, Borulf S, Lindberg T, Benediktsson B. 1983. Partial

hydrolysis of cow’s milk proteins by human trypsin and elastases

in vitro. J Pediatr Gastroenterol Nutr 2:613–616.

Jinsmaa Y, Yoshikawa M. 1999. Enzymatic release of neocasomor-

phin and beta-casomorphin from bovine beta-casein. Peptides

20:957–962.

Kaminski S, Rusc A, Cieslinska A. 2006. A note of A1 and A2

variants of bovine beta-casein locus in Polish Holstein bulls. J

Anim Feed Sci 15:195–198.

Kaminski S, Cieslinska A, Kostyra E. 2007. Polymorphism of bovine

beta-casein and its potential effect on human health. J Appl

Genet 48:189–198.

Kessler HG. 1981. Food engineering and dairy technology. Freising:

Verlag A. Kessler.

Kostyra E, Sienkiewicz-Szłapka E, Jarmołowska B, Krawczuk S,

Kostyra H. 2004. Opioid peptides derived from milk proteins.

Pol J Food Nutr Sci 13(Suppl. 1):25–35.

Kostyra H, Wocior A, Rudnicka B, Rydzewski M, Kostyra E. 2010.

Influence of non-enzymatic glycosylation of sodium caseinate on

the kinetics of its enzymatic hydrolysis. Milchwiseschaft 65(3):

302–305.

Laugesen M, Elliott R. 2003. Ischaemic heart disease, Type 1

diabetes, and cow milk A1 beta-casein. NZ Med J 116:1–19.

Lien S, Alestrom P, Hlungland H, Rogne S. 1992. Detection of

multiple beta-casein (CASB) alleles by amplification created

restriction sites (ACRS). Anim Genet 23:333–338.

Meisel H. 2001. Bioactive peptides from milk proteins: a perspective

for consumers and producers. Aus J Dairy Tech 56:83–91.

McLachlan CNS. 2001. Beta-casein A1, ischaemic heart disease

mortality, and other illnesses. Med Hypotheses 56:262–272.

Meloun M, Hill M, Militky J, Kupka K. 2001. Analysis of large and

small samples of biochemical and clinical data. Clin Chem Lab

Med 39:53–61.

Nilsen H, Olsen HG, Hayes B, Sehested E, Svendson M, Nome T,

et al. 2009. Casein haplotypes and their associations with milk

production traits in Norwegian Red cattle. Genet Sel Evol 41:

1–12.

Olenski K, Kaminski S, Szyda J, Cieslinska A. 2010. Polymorphism

of the beta-casein gene and its associations with breeding value

for production traits of Holstein–Fresian bulls. Livest Sci 131:

137–140.

Ott RL, Longnecker M. 2001. An introduction to statistical methods

and data analysis. 1st ed., Pacific Grove, CA: Duxbury.

Park W. 2009. Bioactive components in milk and dairy products.

Ames, IA: Wiley-Blackwell.

Phelan M, Aherne A, FitzGerald RJ, O’Brien NM. 2009. Casein-

derived bioactive peptides: biological effects, industrial uses,

safety aspects and regulatory status. Int Dairy J 19:643–654.

Schmelzer CEH, Schops R, Reynell L, Ulbrich-Hofmann R,

Neubert RHH, Raith K. 2007. Peptic digestion of beta-casein.

The course and fate of possible bioactive peptides. J Chromatogr

A 1166:108–115.

Sienkiewicz-Szłapka E, Jarmołowska B, Krawczuk S, Kostyra E,

Kostyra H, Iwan M. 2009. Contents of agonistic and

antagonistic opioid peptides in different cheese varieties. Int

Dairy J 19:258–263.

Silva SV, Malcata FX. 2005. Caseins as source of bioactive peptides.

Int Dairy J 15:1–15.

Sun Z, Cade R, Fregly MJ, Privette RM. 1999. ß-Casomorphin

induces fos-like immunoreactivity in discrete brain regions

relevant to Schizophrenia and Autism. Autism 3:67–83.

Sun Z, Zhang Z, Wang X, Cade R, Elmir Z, Fregly M. 2003.

Relation of beta-casomorphin to Apnea in sudden infant death

syndrome. Peptides 24:937–943.

Tailford KA, Berry CL, Thomas AC, Campbell JH. 2003. A casein

variant in cow’s milk is atherogenic. Atherosclerosis 170:13–19.

Thorsdottir IBE, Birgisdottir IM, Johannsdottir DP, Harris J, Hill L,

Steingrimsdottir L, Thorsson A. 2000. Different beta-casein

fractions in Icelandic versus Scandinavian cow’s milk may

influence diabetogenicity of cow’s milk in infancy and explain low

rate of insulin-dependent diabetes mellitus in Iceland. Pediatrics

106:719–724.

Visker MHP, Dibbits BW, Kinders SM, van Valenberg HJF,

Arendonk JAM, Bovenhuis H. 2010. Association of bovine beta-

casein protein variant with milk production and milk protein

composition. Anim Genet 42:212–218.

A. Cieslinska et al.430

Int J

Foo

d Sc

i Nut

r D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Win

dsor

on

07/1

6/14

For

pers

onal

use

onl

y.