Upload
stanislaw
View
215
Download
0
Embed Size (px)
Citation preview
Milk from cows of different b-casein genotypes as a sourceof b-casomorphin-7
ANNA CIESLINSKA1, ELZBIETA KOSTYRA2, HENRYK KOSTYRA3, KAMIL OLENSKI1,
EWA FIEDOROWICZ3, & STANISŁAW KAMINSKI1
1Department of Animal Genetics, 2Department of Biochemistry, University of Warmia and Mazury, Olsztyn, Poland, and3Department of Food Immunology and Microbiology, Institute of Animal Reproduction and Food Research, Polish Academy of
Sciences, Tuwima 10, Olsztyn 1-747, Poland,
AbstractThe aim of this study was to quantify b-casomorphin-7 in raw, hydrolyzed and processed milk in different stages of the cowlactation. The obtained results lead to the following conclusion: the highest amount of b-casomorphin-7 released from thehydrolyzed and processed milk is related to the b-casein A1 allele, irrespective of a lactation period. Some traces ofb-casomorphin-7 in milk from cows with the b-casein A2 variant are probably a result of the acid hydrolysis of b-casein during itsdigestion with pepsin. It has been shown that processing of raw milk at high temperatures affects, in a slight degree, thedifferences between b-casomorphins-7 originating from different b-casein genotypes. The obtained results suggest a possibilityto provide a new nutritional factor for milk quality based on the content of b-casomorphin-7 liberated in vivo from milk digestedby a mixture of the gastrointestinal enzymes.
Keywords: b-casein, b-casomorphin-7, polymorphism, biochemical individuality
Introduction
The nutritive value of bovine caseins is not only
determined by their amino acid content but also by
bioactive peptides released during their digestion in the
gastrointestinal track (Park 2009). In the human
organism, those bioactive peptides may act as regulatory
components with hormone-like activities, which may
modulate specific physiological functions (Meisel 2001;
Kostyra et al. 2004; Silva and Malcata 2005). Bovine
b-caseins are a source of bioactive peptides that manifest
antimicrobiological, antihypertensive, antithrombotic,
immunomodulatory and mineral-binding activities
(Clare and Swaisgood 2000; Phelan et al. 2009).
Within these bioactive peptides, the opioid
b-casomorphin-7 drew a lot of attention. It has been
shown that b-casomorphin-7 originates only from
b-casein A1 or B (Hartwig et al. 1997; Jinsmaa and
Yoshikawa 1999) and may be a serious risk factor in
human ischaemic heart disease, arteriosclerosis, type 1
diabetes and sudden infant death syndrome (Elliott
et al. 1999; Sun et al. 1999, 2003; Thorsdottir et al.
2000; McLachlan 2001; Birgisdottir et al. 2002, 2006;
Laugesen and Elliott 2003; Tailford et al. 2003).
b-Casomorphin-7 is made up of amino acids, which
run from position 60 to 66 in the b-casein protein
chain (Tyr–Pro–Phe–Pro–Gly–Pro–Ile). Releasing
b-casomorphin-7 from A1 b-casein prevents many
other peptides that have important effects from being
released in that region. In this context, it is worth to
note that there are 12 genetic variants of CSN2, but
only six of them occur in the Holstein cattle: A1, A2,
A3, B, C and I, the first two being the most common
(Kaminski et al. 2006, 2007; Caroli et al. 2009;
Heck et al. 2009; Nilsen et al. 2009; Arendonk and
Bovenhuis 2010; Olenski et al. 2010; Visker et al.
2010). The natural mutation that gave rise to this
difference is a result of a single nucleotide polymorph-
ism at codon 67 of theb-casein gene: CCT (A2 and A3,
proline) ! CAT (A1, B, C, histidine). This difference
ISSN 0963-7486 print/ISSN 1465-3478 online q 2011 Informa UK, Ltd.
DOI: 10.3109/09637486.2011.634785
Correspondence: H. Kostyra, Department of Food Immunology and Microbiology, Institute of Animal reproduction and Food Research,Polish Academy of Sciences, Tuwima 10, Olsztyn 1-747, Poland. Tel: (4889) 5234675. Fax: (4889) 5240124. E-mail: [email protected]
International Journal of Food Sciences and Nutrition,
June 2012; 63(4): 426–430
Int J
Foo
d Sc
i Nut
r D
ownl
oade
d fr
om in
form
ahea
lthca
re.c
om b
y U
nive
rsity
of
Win
dsor
on
07/1
6/14
For
pers
onal
use
onl
y.
in the amino acid sequence suggests a conformational
difference in the secondary structure of the expressed
protein (Elliott et al. 1999; McLachlan 2001).
Although the European Food Safety Authority has
not supported the hypothesis on the cause–effect
relationship between an oral intake of b-casomorphin-7
and the aetiology of human diseases, high contents of
that peptide in enzymatically hydrolyzed milk remain
intriguing (Cieslinska et al. 2007; De Noni 2008). The
aim of the current study was to examine the influence
of b-casein genotypes, stages of cow’s lactation and
high-temperature processing of cow’s milk on the
release of b-casomorphin-7 with gastrointestinal
proteases in vitro.
Materials and methods
Genetic investigations
One hundred seventy seven Holstein–Friesian cows
were included in the analysis. They were kept in the
same herd and fed with a balanced diet. The cows with
the same genotype of b-casein had no common
ancestor (neither the same sire nor grandsire). Out of
177 cows, 18 were selected for the experiment. These
cows were in their first lactation and were milked in the
same season. All the selected cows did not show any
sub-clinical symptoms of mastitis diagnosed by
somatic cell count, measured routinely once a month.
The level of urea in milk did not indicate any metabolic
disturbances. The genotype of b-casein locus was
determined using the method described by Lien et al.
(1992) with minor modifications. Blood (350ml) was
drawn from the cows to isolate DNA using the
MasterPure Purification Kit (Epicentre, illumina,
USA). The primers had the following sequences:
CASB122L-50GAGTCGACTGCAGATTTTCAAC-
ATCAGTGAGAGTCAGGCCCTG30, CASB67R-
50CCTGCAGAATTCTAGTCTATCCCTTCCCT-
GGGCCCATCG 30.
To produce a 322 bp fragment of the CSN2 gene,
the following PCR mix was composed: 0.4ml of the
primers 122 L and 67 R, each in concentrations
of 50 pmol/ml, 0.7 U of Tfl polymerase (Epicentre),
1.25ml of MasterAmp 20 £ PCR buffer (Epicentre),
1.5ml of magnesium chloride (15 mM), 2.0ml of
Enhancer (Epicentre), ca. 150 ng of genomic DNA
and 25ml of H20. The samples were amplified in the
MJ Research thermocycler under the following
conditions: 3 min/948C and 35 cycles of 948C/25 s,
628C/25 s and 728C/25 s. The PCR product was then
digested by the Nsi I enzyme to generate restriction
fragments and then electrophoresed in 2.5% agarose gel
(AmpliSize, Bio-Rad Inc., Madison, USA).
Immunometric assay of b-casomorphin-7
Milk from 18 cows (six A1A1, six A2A2 and six A1A2,
all being in their first lactations and with similar
productivities) was collected in three terms: on
the 30th, 100th and 200th day of their lactation.
The peptides were extracted from milk according
to our previous work (Cieslinska et al. 2007).
b-Casomorphin-7 contents were analysed with the
ELISA. Immuno-module plates were coated with
antibody, incubated at 378C for 2 h and the unbound
antigen was washed off using 200ml of 1 £ phosphate
buffered saline system (PBS)/Tween. The antigen was
blocked using 200ml of 1% gelatine for 1 h at 378C and
the plate was washed of 3 £ with 200ml PBS/Tween.
Polyclonal antibodies were prepared according to the
method described in our publication (Sienkiewicz-
Szłapka et al. 2009). Hundred microlitres of antibody
were added, incubated for 1 h at 378C and washed 3 £
with 200ml of PBS/Tween. Then, 100ml of secondary
antibody was added, incubated for 1 h at 378C and
washed with 200ml of 3 £ PBS/Tween. Hundred
microlitres of peroxidase substrate o-pheylenediamine
(OPD) were added, incubated for 30 min at 378C and
the reaction was stopped with 50ml of 5 M HCl. The
plates were read on an ELISA plate reader at 492 nm
(ASYS UVM 340).
The milk samples were also hydrolyzed by a cocktail
of digestive enzymes (pepsin/trypsin/elastase). The pH
of the milk samples (10 ml) was adjusted to 1.8 with
1 M HCl and then pepsin was added (E:S 1:25 v/v,
pepsin dissolved in SGF, pH 1.8). Every milk sample
Figure 1. A typical electropherogram that shows genotyping of theb-casein locus. Theoretical (A) and observed (B) pattern of the DNA restriction
fragments. Path 1 – DNA size markerFX174/Hae III; paths 2, 4, 10 – homozygote A2A2; paths 3, 5 – homozygote A1A1; paths 6–9 – heterozygote
A1A2; path 11 – PCR product undigested by Nsi I. The DNA band of 37 bp size diffused out of the gel and is not visible.
A source of b-casomorphin-7 427
Int J
Foo
d Sc
i Nut
r D
ownl
oade
d fr
om in
form
ahea
lthca
re.c
om b
y U
nive
rsity
of
Win
dsor
on
07/1
6/14
For
pers
onal
use
onl
y.
was mixed and incubated at 378C for 1 h. After this
time, the pH of the mixture was raised to 8.0 with 1 M
NaOH (inactivation of pepsin). Then, a trypsin
solution (E:S 1:50 v/v, trypsin dissolved in SGF,
pH 8.0) was added to the mixture, mixed and
incubated at 378C for 15 min. Next, the pH of the
solution was raised to 9.0 with 1 M NaCl and an
elastase solution (E:S 1:100 v/v, elastase dissolved
in SGF, pH 9.0) was added and incubated at 378C
for 20 min. Samples of the digested peptides
were extracted from the mixture according to the
method of Harwalkar and Elliott (1971) and then
b-casomorphin-7 was identified using the ELISA
technique as described above.
The stimulated gastric fluid (SGF) solution was
prepared as follows: 0.15 M NaCl was acidified with
1 M HCl to pH 1.8 or alkalized with 1 M NaOH to pH
8.0 or 9.0. Six litres of milk were collected from each
cow. Milk of A1, A2, A1A2 b-casein phenotypes was
pooled and divided into three parts, each destined
to different processing: drying (milk powder), pas-
teurization (958C/20 min.) and sterilization
(1178C/5 min). Five litres of milk were used to make
milk powder and the remaining milk was pasteurized
(0.5 l) or sterilized (0.5 l) using the standardized
method used routinely in the dairy industry (Kessler
1981). Twenty millilitres of the pasteurized and the
sterilized milk were taken for further analysis. An
amount of 660 mg of the powdered milk was dissolved
in 20 ml of water. From each group of the samples
(powdered, pasteurized and sterilized milk), 10 ml was
taken to extract the peptides as described above. The
remaining milk (10 ml from each batch) was digested
by the cocktail of enzymes (pepsin/trypsin/elastase).
Statistical analysis
Quantitative compositions of bovine caseins from
cows of the same genotype can be different. They
depend on agents such as the breed, feeding,
environment, temperature, age and biochemical
individuality of the cow organism. Our investigations
took the biochemical individuality into serious
consideration, which required using all the obtained
data in a statistical analysis. For this reason, we divided
the data concerning the content of b-casomorphin-7
in milk and milk protein hydrolysates into two
statistical series. The classification of the data into
each series was done using the Dixon Q test for
identification and rejection of outliers. Each of the
statistical series was evaluated on the basis of a small
sample. The evaluation of the statistical significance
between both series was made using a test for the
difference between means (Dixon 1951; Meloun et al.
2001; Ott and Longnecker 2001).
Results and discussion
The results of the genotype occurrences in the
investigated Holstein–Friesian breed are presented
in Figure 1 and Table I. One hundred and seventy
seven cows were included in this analysis. They were
kept in the same herd and fed with a balanced diet.
The cows with the same genotype of b-casein had no
common ancestor (neither the same sire nor grand-
sire). All the selected cows did not show any
sub-clinical symptoms of mastitis diagnosed routinely
once a month. Out of them, 18 were carefully selected
to be in their first lactation and to be milked in the
same season. A typical electropherogram that shows
genotyping of the b-casein locus is presented in
Figure 1. Frequencies of the b-casein genotypes in the
investigated cows are presented in Table I. Twenty-two
cows were characterized by the genotype A1A1,
86 cows were characterized by the genotype A2A2
and 69 cows were characterized by the genotype
A1A2. It means that milk from these cows contains
b-casein from which b-casomorphin-7 can be
released. The amount of b-casomorphin-7 in the raw
and the hydrolyzed milk in the subsequent periods of
the lactation is a confirmation of these assumptions
(Tables II and III). In our work all cows were
genotyped by the method allowing to identify allele A1
or A2, since only substitution of His to Pro in position
67 leads to the occurrence of b-casomorphin-7. All
other amino acid substitutions (for allele A3, B, C and I)
do not produce b-casomorphin-7 amino acid chain
and, therefore, they were not identified by PCR test.
b-Casomorphin-7 was present in all milk samples,
i.e. the raw milk, the one digested with pepsin, and the
Table I. Frequencies of genotypes in the Polish Holstein–Friesian
breed.
Frequencies of genotypes
A1A1 A2A2 A1A2
Number of cows
22 (12.43%) 86 (48.59%) 69 (38.98%)
Table II. Means and SD of b-casomorphin-7 content in raw and
hydrolyzed milk in the subsequent periods of the cow lactation.
Milk
Genotype N Undigested Pepsin (ng/ml) PTE
30th day of lactation
A1A1 3 2.0 25.0 544 ^ 77
A1A2 3 1.8 21.0 357 ^ 68
A2A2 3 1.2 8.0 47 ^ 7
100th day of lactation
A1A1 3 2.1 22.0 596 ^ 120
A1A2 3 1.9 18.0 469 ^ 69
A2A2 3 1.1 7.0 45 ^ 10
200th day of lactation
A1A1 3 2.1 23.0 683 ^ 129
A1A2 3 2.0 19.0 479 ^ 71
A2A2 3 1.2 6.0 59 ^ 6
Notes: Data (PTE) presented as means (N ¼ 3) for significant
(P , 0.05). N, number of cows; PTE, milk digested with pepsin,
trypsin and elastase.
A. Cieslinska et al.428
Int J
Foo
d Sc
i Nut
r D
ownl
oade
d fr
om in
form
ahea
lthca
re.c
om b
y U
nive
rsity
of
Win
dsor
on
07/1
6/14
For
pers
onal
use
onl
y.
mixture of pepsin, trypsin and elastase. These data
require a more detailed explanation, particularly in the
context of information presented by Jinsmaa and
Yoshikawa (1999) and Considine et al. (1999). Those
authors have proved that b-casomorphin-7 was
released only from the genetic variant of b-casein
containing a His residue at the 67th position of the
peptide chain. It is known from the literature that
pepsin and trypsin do not liberate b-casomorphin-7
from b-casein (Schmelzer et al. 2007). Thus,
the following problem arose: why is there more
b-casomorphin-7 in pepsin hydrolysates of milk than
in milk itself? This phenomenon can be explained by
the observations made by Bitri (2004). He has proved
that bioactive peptides can be liberated from bovine
casein not only by the enzymatic hydrolysis but also by
the acidic one. So, the increase in the content of
b-casomorphin-7 in the pepsin hydrolysate of milk
when compared to the raw milk probably caused the
acidic hydrolysis of b-casein (pH 2.0, environment of
pepsin action). The amounts of b-casomorphin-7
detected in the raw milk and the milk hydrolyzed with
pepsin are too small to raise the interest of nutritionists
and physicians (EFSA Report 2009).
At the same time, the contents of b-casomorphin-7
in the milk hydrolyzed with the mixture of the
gastrointestinal enzymes (pepsin, trypsin and elastase)
were 20–30 times higher than in the raw milk (Tables I
and II). When interpreting these results further, it is
necessary to account for the choice of those enzymes.
It is known that pepsin and trypsin do not liberate
b-casomorphin-7 from b-casein. According to Jinsmaa
and Yoshikawa (1999), elastase cleaves the peptide
bond between Ile66 and His67, releasing the carboxyl
terminus of b-casomorphin-7. Pepsin is required to
release the amino terminus of this peptide. In this
mixture, trypsin probably plays a role similar to pepsin
(Jakobsson et al. 1983). Thus, the in vitro hydrolysis of
b-casein with the mixture of the gastric intestinal
enzymes can reflect a potential of forming of
b-casomorphins in the digestive tract.
Moreover, our results confirm the fact that the milk
from cows with the A1A1 genotype of b-casein
represents the main source of b-casomorphin-7.
From the milk of cows with the A1A2 genotype of
b-casein, smaller amount of b-casomorphin-7 is libe
rated. It is absolutely correct because b-casomorphin-7
is not liberated from the milk derived from cows with
the A2A2 genotype of b-casein. As it has been
mentioned before, small amounts of b-casomorphin-7
in the milk from cows with the A2A2 genotype of
b-casein are probably a result of the acidic hydrolysis of
b-casein. The contents of b-casomorphin-7 in the
processed milk are presented in Table IV.
It has been observed that thermal processes caused a
decrease of b-casomorphin-7 in the obtained pro-
ducts. It is probably the non-enzymatic glycolysis of
milk proteins that are responsible for this phenom-
enon. During processing of milk, lactose interacts with
casein and may affect the conformation and the
kinetics of the enzymatic hydrolysis (Kostyra et al.
2010). Finally, it is necessary to confirm that the test
for the differences between the means of both series
proved that they are statistically significant.
Conclusions
The obtained results lead to the conclusion that the
highest amount of b-casomorphin-7 released from the
hydrolyzed and processed milk is related to b-casein
A1 allele, irrespective of the lactation period. The
traces of b-casomorphin-7 in milk from cows with
b-casein A2 variant is probably a result of the acid
hydrolysis of b-casein during its digestion with pepsin.
It has been shown that the processing of raw milk at a
high temperature slightly affects the differences of
b-casomorphin-7 referred to b-casein genotype.
Different amounts of b-casomorphin-7 in milk from
cows with different genetic variations of b-casein
suggest a possibility to provide a new nutritional
factor of milk quality based on the content of
Table III. Means and SD of b-casomorphin-7 content in raw and
hydrolyzed milk in the subsequent periods of the cow lactation.
Milk
Genotype N Undigested Pepsin (ng/ml) PTE
30th day of lactation
A1A1 3 3.0 14.0 373 ^ 43
A1A2 3 2.0 13.0 157 ^ 20
A2A2 3 1.5 8.0 28 ^ 6
100th day of lactation
A1A1 3 2.2 8.0 375 ^ 52
A1A2 3 2.0 6.0 276 ^ 51
A2A2 3 1.3 7.0 18 ^ 7
200th day of lactation
A1A1 3 2.3 8.0 515 ^ 60
A1A2 3 2.0 11.0 306 ^ 43
A2A2 3 1.4 6.0 38 ^ 7
Notes: Data (PTE) presented as means (N ¼ 3) for significant
(P , 0.05). N, number of cows; PTE, milk digested with pepsin,
trypsin and elastase.
Table IV. The content of b-casomorphin-7 in the processed milk.
Genotype RM (ng/ml) PTE (ng/ml)
Milk powder
A1A1 2.7 324.8
A2A2 0.9 86.8
A1A2 0.8 152.5
Pasteurized milk
A1A1 3.3 346.9
A2A2 3.6 31.7
A1A2 6.1 207.1
Sterilized milk
A1A1 2.9 240.7
A2A2 5.4 31.1
A1A2 7.4 154.1
Notes: RM, raw milk; PTE, milk digested with pepsin, trypsin and
elastase.
A source of b-casomorphin-7 429
Int J
Foo
d Sc
i Nut
r D
ownl
oade
d fr
om in
form
ahea
lthca
re.c
om b
y U
nive
rsity
of
Win
dsor
on
07/1
6/14
For
pers
onal
use
onl
y.
b-casomorphin-7 liberated in vivo from milk digested
with a mixture of the gastrointestinal enzymes.
Declaration of interest: This work has been
financially supported by the University of Warmia
and Mazury (Project No. 0105-0804), MNiSzW
(Project No. N 312034). The first author has been
awarded with an EU scholarship within the frames of
the European Social Fund. The authors report no
conflicts of interest. The authors alone are responsible
for the content and writing of the paper.
References
Arendonk JAM, Bovenhuis H. 2010. Association of bovine beta-
casein protein variant with milk production and milk protein
composition. Anim Genet 42:212–218.
Birgisdottir BE, Hill JP, Harris DP, Thorsdottir I. 2002. Variation in
consumption of cow milk proteins and lower rate of Type 1
diabetes in Iceland versus the other 4 Nordic countries. Diabetes
Nutr Metab 15:240–245.
Birgisdottir BE, Hill JP, Thorsson AV, Thorsdottir I. 2006. Lower
consumption of cow milk protein A1 beta-casein at 2 years of age,
rather than consumption among 11- to 14-year-old adolescents,
may explain the lower rate of type 1 diabetes in Iceland than in
Scandinavia. Ann Nutr Metab 50:177–183.
Bitri L. 2004. Optimization study for the production of an opioid-
like preparation from bovine casein by mild acidic hydrolysis. Int
Dairy J 14:535–539.
Caroli AM, Chessa S, Erhardt GJ. 2009. Milk protein polymorph-
ism in cattle: effect on animal breeding and nutrition. J Dairy Sci
9:5335–5352.
Cieslinska A, Kaminski S, Kostyra E, Sienkiewicz-Szłapka E. 2007.
Beta-casomorphin 7 in raw and hydrolyzed milk derived from
cows of alternative beta-casein genotypes. Milchwissenschaft 62:
125–127.
Clare DA, Swaisgood HE. 2000. Bioactive milk peptides: a
perspective. J Dairy Sci 83:1187–1195.
Considine T, Healy A, Kelly AL, McSweeney PLH. 1999. Proteolytic
specificity of elastase on bovineb-casein. Food Chem 66:463–470.
De Noni I. 2008. Release of beta-casomorphins 5 and 7 during
simulated gastro-intestinal digestion of bovine beta-casein variants
and milk-based infant formulas. Food Chem 110:897–903.
Dixon WJ. 1951. Ratios involving extreme values. Ann Math Stat
21:488–506.
EFSA Report 2009. Review of the potential health impact of b-
casomorphins and related peptides. EFSA Scientific Report 231:
1–107.
Elliott RB, Harris DP, Hill JP, Bibby NJ, Wasmuth HE. 1999. Type 1
(insulin-dependent) diabetes mellitus and cow milk: casein
variant consumption. Diabetologia 42:292–296.
Hartwig A, Teschemacher H, Lehmann W, Gauly M, Erhardt G.
1997. Influence of genetic polymorphisms in bovine milk on the
occurrence of bioactive peptides. Int Dairy Federation 9702:
459–460.
Harwalkar VR, Elliott JA. 1971. Isolation of bitter and astringent
fractions from Cheddar cheese. J. Dairy Sci 54:8–11.
Heck JML, Schennink A, van Valenberg HJF, Bovenhuis H, Visker
MHPW, van Arendonk JAM, van Hooijdonk ACM. 2009.
Effects of milk protein variants on the protein composition of
bovine milk. J Dairy Sci 92:1192–1202.
Jakobsson I, Borulf S, Lindberg T, Benediktsson B. 1983. Partial
hydrolysis of cow’s milk proteins by human trypsin and elastases
in vitro. J Pediatr Gastroenterol Nutr 2:613–616.
Jinsmaa Y, Yoshikawa M. 1999. Enzymatic release of neocasomor-
phin and beta-casomorphin from bovine beta-casein. Peptides
20:957–962.
Kaminski S, Rusc A, Cieslinska A. 2006. A note of A1 and A2
variants of bovine beta-casein locus in Polish Holstein bulls. J
Anim Feed Sci 15:195–198.
Kaminski S, Cieslinska A, Kostyra E. 2007. Polymorphism of bovine
beta-casein and its potential effect on human health. J Appl
Genet 48:189–198.
Kessler HG. 1981. Food engineering and dairy technology. Freising:
Verlag A. Kessler.
Kostyra E, Sienkiewicz-Szłapka E, Jarmołowska B, Krawczuk S,
Kostyra H. 2004. Opioid peptides derived from milk proteins.
Pol J Food Nutr Sci 13(Suppl. 1):25–35.
Kostyra H, Wocior A, Rudnicka B, Rydzewski M, Kostyra E. 2010.
Influence of non-enzymatic glycosylation of sodium caseinate on
the kinetics of its enzymatic hydrolysis. Milchwiseschaft 65(3):
302–305.
Laugesen M, Elliott R. 2003. Ischaemic heart disease, Type 1
diabetes, and cow milk A1 beta-casein. NZ Med J 116:1–19.
Lien S, Alestrom P, Hlungland H, Rogne S. 1992. Detection of
multiple beta-casein (CASB) alleles by amplification created
restriction sites (ACRS). Anim Genet 23:333–338.
Meisel H. 2001. Bioactive peptides from milk proteins: a perspective
for consumers and producers. Aus J Dairy Tech 56:83–91.
McLachlan CNS. 2001. Beta-casein A1, ischaemic heart disease
mortality, and other illnesses. Med Hypotheses 56:262–272.
Meloun M, Hill M, Militky J, Kupka K. 2001. Analysis of large and
small samples of biochemical and clinical data. Clin Chem Lab
Med 39:53–61.
Nilsen H, Olsen HG, Hayes B, Sehested E, Svendson M, Nome T,
et al. 2009. Casein haplotypes and their associations with milk
production traits in Norwegian Red cattle. Genet Sel Evol 41:
1–12.
Olenski K, Kaminski S, Szyda J, Cieslinska A. 2010. Polymorphism
of the beta-casein gene and its associations with breeding value
for production traits of Holstein–Fresian bulls. Livest Sci 131:
137–140.
Ott RL, Longnecker M. 2001. An introduction to statistical methods
and data analysis. 1st ed., Pacific Grove, CA: Duxbury.
Park W. 2009. Bioactive components in milk and dairy products.
Ames, IA: Wiley-Blackwell.
Phelan M, Aherne A, FitzGerald RJ, O’Brien NM. 2009. Casein-
derived bioactive peptides: biological effects, industrial uses,
safety aspects and regulatory status. Int Dairy J 19:643–654.
Schmelzer CEH, Schops R, Reynell L, Ulbrich-Hofmann R,
Neubert RHH, Raith K. 2007. Peptic digestion of beta-casein.
The course and fate of possible bioactive peptides. J Chromatogr
A 1166:108–115.
Sienkiewicz-Szłapka E, Jarmołowska B, Krawczuk S, Kostyra E,
Kostyra H, Iwan M. 2009. Contents of agonistic and
antagonistic opioid peptides in different cheese varieties. Int
Dairy J 19:258–263.
Silva SV, Malcata FX. 2005. Caseins as source of bioactive peptides.
Int Dairy J 15:1–15.
Sun Z, Cade R, Fregly MJ, Privette RM. 1999. ß-Casomorphin
induces fos-like immunoreactivity in discrete brain regions
relevant to Schizophrenia and Autism. Autism 3:67–83.
Sun Z, Zhang Z, Wang X, Cade R, Elmir Z, Fregly M. 2003.
Relation of beta-casomorphin to Apnea in sudden infant death
syndrome. Peptides 24:937–943.
Tailford KA, Berry CL, Thomas AC, Campbell JH. 2003. A casein
variant in cow’s milk is atherogenic. Atherosclerosis 170:13–19.
Thorsdottir IBE, Birgisdottir IM, Johannsdottir DP, Harris J, Hill L,
Steingrimsdottir L, Thorsson A. 2000. Different beta-casein
fractions in Icelandic versus Scandinavian cow’s milk may
influence diabetogenicity of cow’s milk in infancy and explain low
rate of insulin-dependent diabetes mellitus in Iceland. Pediatrics
106:719–724.
Visker MHP, Dibbits BW, Kinders SM, van Valenberg HJF,
Arendonk JAM, Bovenhuis H. 2010. Association of bovine beta-
casein protein variant with milk production and milk protein
composition. Anim Genet 42:212–218.
A. Cieslinska et al.430
Int J
Foo
d Sc
i Nut
r D
ownl
oade
d fr
om in
form
ahea
lthca
re.c
om b
y U
nive
rsity
of
Win
dsor
on
07/1
6/14
For
pers
onal
use
onl
y.