J. Microbiol. Biotechnol. (2011), 21(12), 1306–1311http://dx.doi.org/10.4014/jmb.1105.05017First published online 6 September 2011

Monitoring of Environmental Arsenic by Cultures of the PhotosyntheticBacterial Sensor Illuminated with a Near-Infrared Light Emitting DiodeArray

Maeda, Isamu1,2*, Hirokazu Sakurai

1, Kazuyuki Yoshida

1, Mohammad Shohel Rana Siddiki

2, Tokuo

Shimizu3, Motohiro Fukami

1,2, and Shunsaku Ueda

1,2

1Faculty of Agriculture, Utsunomiya University, 350 Minemachi, Utsunomiya 321-8505, Japan2United Graduate School of Agricultural Science, Tokyo University of Agriculture and Technology, 3-5-8 Saiwaicho, Fuchu 183-8509, Japan3Graduate School of Engineering, Utsunomiya University, 7-1-2 Yoto, Utsunomiya 321-8585, Japan

Received: May 12, 2011 / Revised: July 28, 2011 / Accepted: July 29, 2011

Recombinant Rhodopseudomonas palustris, harboring the

carotenoid-metabolizing gene crtI (CrtIBS), and whose

color changes from greenish yellow to red in response to

inorganic As(III), was cultured in transparent microplate

wells illuminated with a light emitting diode (LED) array.

The cells were seen to grow better under near-infrared

light, when compared with cells illuminated with blue or

green LEDs. The absorbance ratio of 525 to 425 nm after

cultivation for 24 h, which reflects red carotenoid

accumulation, increased with an increase in As(III)

concentrations. The detection limit of cultures illuminated

with near-infrared LED was 5 µg/l, which was equivalent

to that of cultures in test tubes illuminated with an

incandescent lamp. A near-infrared LED array, in

combination with a microplate, enabled the simultaneous

handling of multiple cultures, including CrtIBS and a

control strain, for normalization by the illumination of

those with equal photon flux densities. Thus, the

introduction of a near-infrared LED array to the assay is

advantageous for the monitoring of arsenic in natural

water samples that may contain a number of unknown

factors and, therefore, need normalization of the reporter

event.

Keywords: Light emitting diode, Rhodopseudomonas, arsenic,

crtI, biosensor, arsR

Exposure to arsenic through groundwater has been a major

public health problem in the USA, Taiwan, Mexico,

Mongolia, Argentina, India, Chile, and Bangladesh. The

World Health Organization (WHO) has described the

arsenic crisis in Bangladesh as “the largest mass poisoning

of a population in history” [1]. An estimated 35-77

million people in Bangladesh have been chronically

exposed to high concentrations of arsenic through drinking

water. Arsenic concentrations were found to range from

< 7 µg/l to 590 µg/l, with 33% of tube wells exceeding

10 µg/l [8]. Exposure to arsenic in drinking water can

cause fatal poisoning and has also been associated with

several cancers courtesy of its toxic effects on the liver,

skin, kidney, cardiovascular system, and lungs [1, 5, 7, 10,

17, 20, 23].

Hence, arsenic monitoring of well water is important to

prevent chronic diseases in such areas. Two methods, AAS

(atomic absorption spectrometry) and ICP (inductively

coupled plasma), are typically used for the measurement of

arsenic. However, these are analytical instruments, the use of

which is relegated to the laboratory. In an effort to compensate

for the limitations posed by instrumental analyses, bacterial

whole-cell biosensors have attracted much attention. It has

been demonstrated that genetically engineered whole-cell

biosensors are powerful tools for monitoring environmental

pollutants [2, 9, 11, 22]. In such biosensors, the quantity of

the signal can be specifically determined by the quantity of

the target molecule(s) through the expression of a reporter

gene encoding protein, such as green fluorescent protein

[19], luciferase [14], and β-galactosidase [6]. The crtI

gene, which encodes phytoene dehydrogenase, has been

used as one such reporter gene in the recombinant

photosynthetic bacterium (CrtIBS) [24]. As the reporter

gene is placed downstream of the transcriptional switch

responsible for inorganic As(III) [21], the presence of

*Corresponding authorPhone: +81-28-649-5477; Fax: +81-28-649-5477;E-mail: i-maeda@cc.utsunomiya-u.ac.jp

1307 Maeda et al.

As(III) facilitates gene expression and the production of

the CrtI enzyme, and finally results in the metabolization

of colorless phytoene to red lycopene. Therefore, by culturing

the photosynthetic bacterium under light illumination,

As(III) can be measured with the bacterial red color.

However, it has been highlighted that the CrtIBS background

color is affected by the composition of minerals in

environmental samples [24]. The color change is also

dependent on the physiological conditions of living

bacterial cells grown and stored before use. To eliminate

any bacterial background color change caused by minerals

in the water and/or the physiological conditions of living

bacterium, the reporter event needs to be normalized by

cultures of a control strain that does not specifically

respond to arsenic.

Incandescent lamps have been used as a light source for

the cultivation of photosynthetic bacteria. However, the

lamps consume a large amount of energy during cultivation

[3] and have difficulty illuminating multiple vessels with

equal photon flux densities. The replacement of incandescent

lamps with light emitting diode (LED) arrays would

enable the handling of multiple photosynthetic bacterial

cultures, while maintaining illumination with an even

photon flux density at each culture surface, and would

allow for less energy consumption. To take advantage of

the benefits of a whole-cell biosensor, development of a

sensing module that makes it possible to assay multiple

samples with equal photon flux density must be

considered. In this study, the application of an LED array

to the assay, which enables the operation of multiple

bacterial cultures and the normalization of the reporter

event, has been considered in order to establish a biosensing

system to screen for arsenic contamination in environmental

samples.

MATERIALS AND METHODS

Bacterial Strains and Arsenic Assay Procedure

The CrtIBS strain [24] and a nonsensitive control strain were used.

The bacteria were grown in a modified Okamoto medium (4CYMOM)

[16], where the NaCl concentration was adjusted to 0.2 g/l. One

hundred micrograms per liter of chloramphenicol was added when it

was required. Bacterial strains were cultured overnight in glass

vessels at 30oC under incandescent lamp irradiation while stirring.

When the culture reached A600 of 0.5 with a SmartSpec Plus OD600mode (Bio-Rad Laboratories, Tokyo, Japan), the bacterial cells were

harvested by centrifugation and resuspended, with the same cell

density as that of the culture, into the medium, where 0.1% (w/v)

NaHCO3 was added. NaAsO2 (Sigma-Aldrich, St. Louis, USA) and

ultrapure water (Simplicity UV; Merck Millipore, Tokyo, Japan) were

used to prepare arsenic standards. Three hundred µl of each cell

suspension, including the arsenic standard, was added to transparent

microplate wells. The microplates were sealed with a transparent

self-adhesive plastic sheet for 96-well real-time PCR plates, and

then placed above an LED array (Fig. 1A). Blue, green, and near-

infrared LEDs, with maximum wavelengths of 470, 525, or 850 nm,

were utilized. Radiation from an incandescent lamp was adjusted to

7 W/m2. The cultures were then illuminated with a constant photon

flux density for 24 h. The temperature was maintained at 30, 33, or

35oC. Carotenoid accumulation and cell growth were evaluated with

A525/A425 and A660, respectively, using a microplate reader (SH-1000

Lab; Hitachi High Technologies Corporation, Tokyo, Japan). A660was less affected by pigmentation, when compared with A600. Data

are shown as an average ± SD (n = 6).

To normalize the reporter event, a coefficient was first calculated

by dividing the ratio A525/A425 obtained in CrtIBS cultured in

ultrapure water with the ratio A525/A425 obtained in a nonsensitive

control strain cultured in ultrapure water. Then, normalization of the

reporter event was performed by subtracting the ratio A525/A425 in

the nonsensitive control strain multiplied by the coefficient from the

ratio A525/A425 in CrtIBS cultured in the corresponding standard

solution or well water.

Determination of Photon Flux Density

To determine the photon flux density, the radiation intensity was

measured with an optical power meter equipped with an optical

sensor (3664 and 9742 Optical Power Meter; Hioki E. E. Corporation,

Nagano, Japan). Coefficients to convert W/m2 to µmol s-1 m-2 were

determined by measuring both the photon flux density and the

radiation intensity of the light from blue, green, orange, and red

LEDs. Coefficients at 470 and 525 nm were 4.0 and 4.4 µmol s-1 W-1,

respectively. As a quantum sensor cannot measure the photon flux

density of near-infrared light, a coefficient at 850 nm was calculated

by a regression analysis of coefficients versus wavelengths in the

visible light region, and 7.0 µmol s-1 W

-1 was estimated.

Fig. 1. Cultivation of CrtIBS in microplate wells illuminated withan LED array. (A) Schematic representation of culturing devices. Effects of light source

from an LED array on carotenoid accumulation (B) and cell growth (C) of

CrtIBS. Open bar, no addition of As; gray bar, 50 µg As/l; near-IR, near-

infrared.

ARSENIC MONITORING BY PHOTOTROPHIC BACTERIA WITH LED 1308

DNA Manipulation

crtI was expressed based on the Rps. palustris-E. coli shuttle vector

pMG103 [12]. A plasmid, including a constitutive crtI gene, was

constructed by inverse PCR using LA-Taq with a GC buffer (Takara

Bio, Shiga, Japan) in combination with primers cis-element-up (5'-

AATCTAGAGTCGACCTGCAGAAAAAAAGCG, in which the XbaI

site is italicized) and crtI-up (5'-CATCTAGATTAAGGAGGTACC

CATGCTCG-3', in which the XbaI site is italicized) and a template

DNA pMG103ΩParsarsRcrtIcat [24]. The amplified DNA fragment

was digested with XbaI and self-ligated to complete pMG103crtIcat, in

which the region composed of ars promoter (Pars) and arsR was removed

from pMG103ΩParsarsRcrtIcat. Then 2.5 µg of pMG103ΩcrtIcat

was added to a 70 µl cell suspension of Rps. palustris No. 711 [25]

in an ice-chilled electroporation cuvette with an electrode gap of

1 mm. Electroporation was carried out with 25 µF, 1.25 kV, and

300 Ω using a gene pulser (Bio-Rad Laboratories, Tokyo, Japan).

Preparation of the cell suspension and selection of transformants

were carried out as has been described previously [24]. One of the

transformants, which was confirmed to harbor pMG103ΩcrtIcat by

PCR, was used as the nonsensitive control strain.

Preparation of Cultures Including Well Water

The CrtIBS No. 711 and nonsensitive control strains were cultured

overnight in glass vessels at 30oC under incandescent lamp irradiation

while stirring. When the cultures reached to A600 of 0.5 (SmartSpec

Plus, Bio-Rad Laboratories, Tokyo, Japan), 25 ml of each of the

cultures was harvested by centrifugation and resuspended to 2.5 ml

of 1× 4CYMOM. Subsequently, one volume of the cell suspension

was mixed with eight volumes of well water or arsenic standard,

one volume of 10× 4CYMOM, and 0.1% (w/v) NaHCO3. Then

300 µl each of the mixtures was loaded into the microplate wells

and the arsenic assay procedure was followed.

Measurement of Arsenic by Atomic Absorption Spectrophotometry

Water samples were collected from different tube wells in Bangladesh.

The arsenic from the well water was measured through polarized

Zeeman atomic absorption spectroscopy (AAS) with a graphite

atomizer (Z-2000; Hitachi High Technologies Corporation, Tokyo,

Japan). The arsenic was atomized at 2,500oC and absorption at

193.7 nm was monitored. Data were obtained as an average of three

consecutive measurements.

Statistical Analyses

Unpaired Student’s t-tests were used between groups of data

obtained with and without external arsenic. Any difference with a

significant level below 0.05 has been highlighted with an asterisk.

One-way analysis of variance (one-way ANOVA) among groups

was conducted using Fisher’s least significant difference (LSD) test

with a significance level of 0.05. No significant difference was

found amongst the groups shown by bars annotated with the same

character.

RESULTS AND DISCUSSION

Effects of Light Source on the Reporter Event

It has been reported that more than half the residents in

Bangladesh regularly consume well water with an arsenic

concentration > or = 50 µg/l, the acceptable government

standard [18]. In this study, therefore, 50 µg/l was used to

optimize arsenic assay parameters. As purple non-sulfur

bacteria have an absorbance maxima within the blue to

green and near-infrared light wavelengths, carotenoid

accumulation and cell growth in response to 50 µg/l

arsenic were evaluated after exposure of CrtIBS cultures to

light with a photon flux density of 100 µmol s-1 m-2 from

blue, green, or near-infrared LED. An increase in carotenoid

accumulation in the presence of arsenic was more marked

in green or near-infrared light than in blue light (Fig. 1B).

Cells reached the highest density when near-infrared light

was illuminated (Fig. 1C). Therefore, a near-infrared LED

was chosen as the light source for CrtIBS. Using CrtIBS

cultures in microplate wells, a dose-response curve was

obtained with near-infrared light (Fig. 2A). Carotenoid

accumulation increased markedly at arsenic concentrations

of between 1 and 20 µg/l and formed a plateau at

concentrations above 20 µg/l. It has been reported that

blue light induces expression of the genes encoding

carotenoid-metabolizing enzymes, phytoene synthase and

phytoene dehydrogenase, in a unicellular green alga

Chlamydomonas reinhardtii [4]. It has also been observed

that blue light enhances carotenoid production in another

unicellular green alga, Haematococcus pluvialis [15].

Therefore, a microplate used for arsenic assay was illuminated

with a near-infrared LED array in combination with a blue

LED array from its lower and upper sides. However, blue

light did not stimulate carotenoid accumulation in CrtIBS

Fig. 2. Standard curves of carotenoid accumulation of CrtIBS inresponse to inorganic As(III) concentrations. Near-infrared (A) or near-infrared in combination with blue (B) light was

irradiated.

1309 Maeda et al.

and, therefore, no significant magnification of the reporter

event was found (Fig. 2B).

Optimization of Assay Conditions

Carotenoid accumulation and cell growth of CrtIBS were

examined at 30, 33, or 35oC in cultures illuminated with a

near-infrared LED array or an incandescent lamp. An

increase of carotenoids in the presence of 50 µg/l arsenic

with near-infrared LED was most marked at 33oC, whereas

at all temperatures tested, a significant difference in the

increase of carotenoids was observed with an incandescent

lamp (data not shown). Cell growth was most marked at

33oC regardless of the light sources (data not shown).

Thus, the assay temperature with near-infrared light was

fixed to 33oC.

Poor growth of CrtIBS with a near-infrared LED array

at the optimized temperature was observed when compared

with growth of CrtIBS with an incandescent lamp (data not

shown). Therefore, the photon flux density of near-infrared

light was optimized. Two microplates were placed parallel

to an LED array at different distances from their surfaces.

The A660 values with near-infrared light at a photon flux

density of 46 µmol s-1 m-2 were comparable to those with

an incandescent lamp (Fig. 3B). An increase of carotenoids

with the addition of arsenic was more pronounced at a

photon flux density of 46 µmol s-1 m-2 than those at photon

flux densities of 23 or 114 µmol s-1 m-2, and comparable to

the increases with the addition of arsenic under illumination

from an incandescent lamp (Fig. 3A). Thus, the photon

flux density with the LED array for arsenic assay was fixed

to 46 µmol s-1 m-2.

Screening of Arsenic-Contaminated Well Water

Carotenoid accumulation and cell growth were measured

using CrtIBS and nonsensitive control strain cells suspended

in arsenic-contaminated well water samples. Their arsenic

concentrations, determined with AAS, were No. 1, 219 µg/l;

No. 2, 123 µg/l; No. 3, 110 µg/l; No. 4, 163 µg/l; No. 5,

0.4 µg/l; No. 6, 5.4 µg/l; No. 7, 3.4 µg/l; and No. 8,

14.5 µg/l. Carotenoid accumulation of CrtIBS cultured in

well water was higher in No. 1-4 samples than in No. 5-8

samples (Fig. 4A). Carotenoid accumulation in the

nonsensitive control strain did not respond to the arsenic

standards, whereas it varied in each sample regardless of

the arsenic concentrations determined with AAS (Fig. 4B).

Significant differences in growth among the cultures of

CrtIBS, or the nonsensitive control strain, were observed

when cells were suspended in well water (Fig. 4C and 4D).

The well water collected from the multiple sampling sites

and their mineral composition, determined with AAS,

differed (data not shown). Therefore, it was found that

carotenoid accumulation and cell growth are affected by

the mineral composition in well water. These results

indicate the necessity of a nonsensitive control strain for

the normalization of the reporter event in response to

arsenic in natural water samples. The nonsensitive control

strain constitutively expressed crtI and produced red

carotenoids. Colored carotenoids are essential for the

assembly of the LH2 complex and phototrophic growth, as

no absorption peaks correspond to LH2 in the crtI-deleted

mutant [25]. Therefore, the effects of mineral composition

in well water, on carotenoid accumulation and cell growth,

can be excluded, as they are not relevant as to whether the

crtI gene is expressed or not.

After data normalization, carotenoid accumulation in

cells cultured in well water of No. 5-8 became lower than

that cultured in the standard solution at an arsenic

concentration of 5 µg/l (Fig. 5). As the concentration of

No. 8 obtained with AAS (14.5 µg/l) was higher than

5 µg/l, the response to the well water, which was lower

than that of a standard 5 µg/l, was false negative. This

result clarified that the difficulty in quantifying arsenic

concentrations higher than 100 µg/l in well water is

primarily because carotenoid accumulation of CrtIBS

cultured at such high concentrations reaches a plateau. A

higher dynamic range would be required to quantify

arsenic concentrations above 100 µg/l in environmental

water. In addition to this restricted dynamic range, it has

been reported that ArsR is less sensitive to organic forms

of arsenic and inorganic As(V) [13]. A safety margin must

also be considered because false negatives may occur in

the screening of natural water samples, which include

various forms of arsenic and factors that disturb the

Fig. 3. Effects of light sources and intensity on carotenoidaccumulation (A) and cell growth (B) of CrtIBS. A near-infrared LED (LED) or an incandescent lamp (I) was used. Open

bar, no addition of As; gray bar, 50 µg As/l.

ARSENIC MONITORING BY PHOTOTROPHIC BACTERIA WITH LED 1310

reporter event, as observed in No. 8 well water. However,

using a threshold obtained with the standard solution at a

concentration of 5 µg/l, well water of No. 5-8, whose

arsenic concentrations with AAS ranged from 0.4 to

14.5 µg/l, was distinguishable from the well water of No.

1-4, whose arsenic concentrations with AAS ranged from

110 to 219 µg/l.

In conclusion, the pairing of a near-infrared LED array

with a microplate is advantageous for the screening of

arsenic contamination by a photosynthetic bacterial sensor,

because plural cultures of CrtIBS, or the nonsensitive

control strain suspended in water samples or arsenic

standard solutions, can be operated at the same time under

the same photon flux density in order to determine the

threshold and to normalize the reporter event.

Acknowledgments

Dr. Isamu Maeda’s work in relation to this study was

supported by grant-in-aid 05A22703a of the Industrial

Technology Research Program in 2005 from the New

Energy and Industrial Technology Development Organization

(NEDO) of Japan. In addition, Dr. Isamu Maeda was also

supported by a grant-in-aid from the Utsunomiya University

Center for Optical Research and Education (CORE). The

authors would like to express their sincere gratitude to Dr.

Harun-ur-Rashid for the provision of well water samples.

REFERENCES

1. Argos, M., T. Kalra, P. J. Rathouz, Y. Chen, B. Pierce, F.

Parvez, et al. 2010. Arsenic exposure from drinking water, and

all-cause and chronic-disease mortalities in Bangladesh (HEALS):

A prospective cohort study. Lancet 376: 252-258.

Fig. 4. Carotenoid accumulation (A and B) and cell growth (C and D) of CrtIBS (A and C) or a nonsensitive control strain (B and D)cultured in As-contaminated well water. Serial numbers of well water are shown.

Fig. 5. Relative carotenoid accumulation of CrtIBS cultured inAs-contaminated well water after normalization. Serial numbers of well water are shown.

1311 Maeda et al.

2. Belkin, S. 2003. Microbial whole-cell sensing systems of

environmental pollutants. Curr. Opin. Microbiol. 6: 206-212.

3. Bertling, K., T. J. Hurse, U. Kappler, and A. D. Rakic. 2006.

Lasers - an effective artificial source of radiation for the

cultivation of anoxygenic photosynthetic bacteria. Biotechnol.

Bioeng. 94: 337-345.

4. Bohne, F. and H. Linden. 2002. Regulation of carotenoid

biosynthesis genes in response to light in Chlamydomonas

reinhardtii. Biochim. Biophys. Acta 1579: 26-34.

5. Chen, C. J., Y. C. Chuang, S. L. You, T. M. Lin, and H. Y. Wu.

1986. A retrospective study on malignant neoplasms of bladder,

lung and liver in blackfoot disease endemic area in Taiwan. Br.

J. Cancer 53: 399-405.

6. Feliciano, J., S. Xu, X. Guan, H. J. Lehmler, L. G. Bachas, and

S. Daunert. 2006. ClcR-based biosensing system in the detection

of cis-dihydroxylated (chloro-)biphenyls. Anal. Bioanal. Chem.

385: 807-813.

7. Ferreccio, C., C. Gonzalez, V. Milosavjlevic, G. Marshall, A. M.

Sancha, and A. H. Smith. 2000. Lung cancer and arsenic

concentrations in drinking water in Chile. Epidemiology 11:

673-679.

8. Frisbie, S. H., E. J. Mitchell, L. J. Mastera, D. M. Maynard, A.

Z. Yusuf, M. Y. Siddiq, et al. 2009. Public health strategies for

western Bangladesh that address arsenic, manganese, uranium,

and other toxic elements in drinking water. Environ. Health

Perspect. 117: 410-416.

9. Harms, H., M. C. Wells, and J. R. van der Meer. 2006. Whole-

cell living biosensors - are they ready for environmental

application? Appl. Microbiol. Biotechnol. 70: 273-280.

10. Hopenhayn-Rich, C., M. L. Biggs, and A. H. Smith. 1998.

Lung and kidney cancer mortality associated with arsenic in

drinking water in Cordoba, Argentina. Int. J. Epidemiol. 27:

561-569.

11. Hynninen, A. and M. Virta. 2010. Whole-cell bioreporters for

the detection of bioavailable metals. Adv. Biochem. Eng.

Biotechnol. 118: 31-63.

12. Inui, M., J. H. Roh, K. Zahn, and H. Yukawa. 2000. Sequence

analysis of the cryptic plasmid pMG101 from Rhodopseudomonas

palustris and construction of stable cloning vectors. Appl.

Environ. Microbiol. 66: 54-63.

13. Kawakami, Y., M. S. Siddiki, K. Inoue, H. Otabayashi, K.

Yoshida, S. Ueda, et al. 2011. Application of fluorescent

protein-tagged trans factors and immobilized cis elements to

monitoring of toxic metals based on in vitro protein-DNA

interactions. Biosens. Bioelectron. 26: 1466-1473.

14. Kim, M. N., H. H. Park, W. K. Lim, and H. J. Shin. 2005.

Construction and comparison of Escherichia coli whole-cell

biosensors capable of detecting aromatic compounds. J.

Microbiol. Methods 60: 235-245.

15. Lababpour, A., K. Hada, K. Shimahara, T. Katsuda, and S.

Katoh. 2004. Effects of nutrient supply methods and illumination

with blue light emitting diodes (LEDs) on astaxanthin production

by Haematococcus pluvialis. J. Biosci. Bioeng. 98: 452-456.

16. Maeda, I., H. Miyasaka, F. Umeda, M. Kawase, and K. Yagi.

2003. Maximization of hydrogen production ability in high-

density suspension of Rhodovulum sulfidophilum cells using

intracellular poly(3-hydroxybutyrate) as sole substrate. Biotechnol.

Bioeng. 81: 474-481.

17. Morales, K. H., L. Ryan, T. L. Kuo, M. M. Wu, and C. J. Chen.

2000. Risk of internal cancers from arsenic in drinking water.

Environ. Health Perspect. 108: 655-661.

18. Parvez, F., Y. Chen, M. Argos, A. Z. Hussain, H. Momotaj, R.

Dhar, et al. 2006. Prevalence of arsenic exposure from drinking

water and awareness of its health risks in a Bangladeshi

population: Results from a large population-based study. Environ

Health Perspect. 114: 355-359.

19. Tani, C., K. Inoue, Y. Tani, M. Harun-ur-Rashid, N. Azuma, S.

Ueda, et al. 2009. Sensitive fluorescent microplate bioassay

using recombinant Escherichia coli with multiple promoter-

reporter units in tandem for detection of arsenic. J. Biosci.

Bioeng. 108: 414-420.

20. Tsuda, T., A. Babazono, E. Yamamoto, N. Kurumatani, Y.

Mino, T. Ogawa, et al. 1995. Ingested arsenic and internal

cancer: A historical cohort study followed for 33 years. Am. J.

Epidemiol. 141: 198-209.

21. Xu, C., W. Shi, and B. P. Rosen. 1996. The chromosomal arsR

gene of Escherichia coli encodes a trans-acting metalloregulatory

protein. J. Biol. Chem. 271: 2427-2432.

22. Yagi, K. 2007. Applications of whole-cell bacterial sensors in

biotechnology and environmental science. Appl. Microbiol.

Biotechnol. 73: 1251-1258.

23. Yang, C. Y., C. C. Chang, S. C. Ho, and H. F. Chiu. 2008. Is

colon cancer mortality related to arsenic exposure? J. Toxicol.

Environ. Health A 71: 533-538.

24. Yoshida, K., K. Inoue, Y. Takahashi, S. Ueda, K. Isoda, K.

Yagi, and I. Maeda. 2008. Novel carotenoid-based biosensor for

simple visual detection of arsenite: Characterization and

preliminary evaluation for environmental application. Appl.

Environ. Microbiol. 74: 6730-6738.

25. Yoshida, K., D. Yoshioka, K. Inoue, S. Takaichi, and I. Maeda.

2007. Evaluation of colors in green mutants isolated from

purple bacteria as a host for colorimetric whole-cell biosensors.

Appl. Microbiol. Biotechnol. 76: 1043-1050.

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 600 /GrayImageDepth -1 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 600 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile () /PDFXOutputCondition () /PDFXRegistryName (http://www.color.org) /PDFXTrapped /Unknown

/Description >>> setdistillerparams> setpagedevice