Upload
xu-jiang
View
216
Download
0
Embed Size (px)
Citation preview
NF-jB p65 transactivation domain is involvedin the NF-jB-inducing kinase pathwayq,qq
Xu Jiang,a,b Naoko Takahashi,a Kiichiro Ando,a,b Takanobu Otsuka,b
Toshifumi Tetsuka,a and Takashi Okamotoa,*
a Department of Molecular Genetics, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japanb Department of Orthopedic Surgery, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan
Received 13 December 2002
Abstract
NF-jB-inducing kinase (NIK) is involved in the signal transduction pathway leading to the NF-jB activation. In this report,
we demonstrate that the NIK-mediated NF-jB activation involves the transactivation (TA) domain of p65 subunit of NF-jBand the nuclear translocation of IKKa. By using luciferase assay, we found that both IKKa and IKKb could activate NF-jB in
synergy with NIK. Interestingly, although IKKb stimulated the NIK-mediated IjB degradation, IKKa stimulated the action of
NF-jB without enhancing the IjB degradation. By using heterologous transactivation system with Gal4 DNA-binding domain
in fusion with various portions of p65 TA domain, we found that the transactivation domain 1 (TA1) of p65 serves as the direct
target for the NIK–IKKa cascade and that the serine residue at 536 within p65 TA1 is indispensable for this action. Fur-
thermore, we found that this action of NIK depends on the energy-dependent action of Ras-related protein (Ran) since the
dominant negative mutant of Ran (RanQ69L) inhibited the transcriptional activity of p65 by preventing the nuclear import of
IKKa.� 2003 Elsevier Science (USA). All rights reserved.
Keywords: NF-jB; p65 subunit; Transactivation; NIK; IKK; Signal transduction; Kinase cascade; Nuclear translocation; Gene expression
NF-jB represents a family of eukaryotic transcrip-
tion factors participating in the regulation of immune
response, cell growth, and survival [1,2]. There are five
members of the NF-jB/Rel family in mammalian cells.
In most cells, NF-jB/Rel family members form hetero-and homodimers with distinct specificities in various
combinations, and the heterodimer of p65 (RelA) and
p50 is the predominant form of NF-jB. Since p65 is
responsible for the transcriptional activity of NF-jB, it
has been most extensively studied [3–6]. p65 contains
at least two independent transactivation domains (TA1
and TA2) within its C-terminal 120 amino acids and is
responsible for transcriptional activation of the target
genes. TA1 is confined to the C-terminal 30 aminoacids and is likely to adopt an amphipathic a-helicalstructure that clusters serine residues on the hydro-
philic surface [4]. Interestingly, the TNF-mediated
signaling was shown to involve phosphorylation of Ser
529 within TA1 by casein kinase II [7,8]. Similarly,
overexpression of IjB kinase b (IKKb) is reported to
induce phosphorylation of p65 at Ser536 [9]. In addi-
tion, Ras-induced NF-jB activation is mediated byPI3K/Akt kinase which phosphorylates serine residues
at 529 and 536 within TA1 [10]. These signal-induced
p65 phosphorylations appear to induce NF-jB-dependent gene expression by augmenting the tran-
scriptional activity of NF-jB (p65) rather than by
promoting its nuclear translocation through IjBaphosphorylation.
Biochemical and Biophysical Research Communications 301 (2003) 583–590
www.elsevier.com/locate/ybbrc
BBRC
qThis work was supported in part by grants-in-aid from the
Ministry of Health, Labour and Welfare, the Ministry of Education,
Culture, Sports, Science and Technology of Japan and the Japanese
Health Sciences Foundation.qqAbbreviations: NF-jB, nuclear factor kappa B; TA1, transac-
tivation domains 1; NIK, NF-jB-inducing kinase; RHD, Rel homol-
ogy domain; NLS, nuclear localization signal; Ran, Ras-related
protein; TNF, tumor necrosis factor; IL-1b, interleukin-1b; IKK,
IjB kinase; GFP, green fluorescent protein; luc, luciferase; NTF2,
nuclear transport factor 2.* Corresponding author. Fax: +81-52-859-1235.
E-mail address: [email protected] (T. Okamoto).
0006-291X/03/$ - see front matter � 2003 Elsevier Science (USA). All rights reserved.
doi:10.1016/S0006-291X(03)00011-1
In most cells, NF-jB complexes are located largely inthe cytoplasm. However, in response to proinflamma-
tory cytokines such as TNF and IL-1b, the inhibitory
proteins, IjB, become phosphorylated by IjB kinase
(IKK) complex on two serine residues located in the N-
terminal region [11], which results in rapid ubiquitina-
tion and proteolysis by the 26S proteasome, allowing
the liberated NF-jB to translocate to the nucleus [1,2].
The IKK complex consists of two catalytic subunits,IKKa and IKKb, and a regulatory subunit IKKc[12–15]. The kinase activity of both IKKa and IKKbis induced by a wide variety of NF-jB inducers such as
TNF or IL-1b, and mediated by the upstream kinases
including the NIK and the extracellular signal-regulated
kinase kinase kinase 1, 3 [16–19]. Recent studies have
demonstrated that in contrast to IKKb, although IKKadoes not participate in IjB phosphorylation, it is in-dispensable for generation of NF-jB transcriptional
activity [20]. NIK was originally identified as a protein
interacting with the TNF receptor associated factor 2
component of the TNF receptor complex [21]. NIK
physically interacts via its C-terminal region with IKKaand IKKb, and stimulates their catalytic activity
[17,22,23]. Moreover, recent studies in NIK-deficient
mice demonstrated that NIK plays an essential role inthe LTbR signaling pathway but not in TNF signaling
pathway [24,25].
In this report, we studied the effect of NIK on the
NF-jB activation. Our findings clearly indicate that the
NIK–IKKa pathway is involved in the induction of
transcriptional activation of p65 and that the nuclear
translocation of IKKa through the energy-dependent
action of Ras-related protein (Ran) is crucial.
Materials and methods
Plasmid constructs. Construction of mammalian expression vectors,
pM-p65, pM-p65 (286–551), pM-p65 (521–551), and pcDNA3.1-p65,
was previously described [26]. pM-p65 (1–286) was generated by
amplifying the corresponding p65 fragment by PCR using the oligo-
nucleotide primers 50-CGGGATCCCGATGGACGAACTGTTCC
CCCTCAT-30 and 50-GCTCTAGAGCGAATTCCATGGGCTCA
CTGAGCT-30 containing BamHI and XbaI sites. pM-p65 (521–
551:S529A) was generated by PCR using the oligo-nucleotides 50-
GGAATTCCCGGGGCTCCCCAATGGCCTCCTTGCAGGAGAT
GA-30 and 50-CGCGGATCCGCGCGTTAGGAGCTGATCTGACT
CAGCAGGGCT-30 containing EcoRI and BamHI sites. In order to
construct pM-p65 (521–551:S536A), the p65 (521–551:S536A) frag-
ment was generated by PCR using pM-p65 as a template with the
oligonucleotide primers 50-GCTCTAGAGCCCACCATGGACTACA
AAGACGATGACGACAAGATGGACGAACTGTTCCCCCTCAT
CTTCCCGGCAGAGCCAGCCC-30 and 50-CGCGGATCCGCGT
TAGGAGCTGATCTGACTCAGCAGGGCTGAGAAGTCCATG
TCCGCAATGGCGGAGAAGTCTTCATCTCCTGAAAGGAGGC
C-30 and this PCR product was cut with SmaI and BamHI. These PCR
fragments were inserted into pM vector at respective restriction sites.
pCR2FL-IKKa and pCR2FL-IKKb expression vectors encoding wild
type of IKKa and IKKb, respectively, were provided by Dr. Hiroyasu
Nakano (Juntendo University) [16]. pcDNA3-NIK and pcDNA3-
NIK(KM) encoding wild-type NIK and mutant NIK (KK429–430AA)
were gifts from Dr. David Wallach (The Weizmann Institute, Israel).
The plasmid expressing the Myc-tagged IjB, pcDNA-Myc-IjBa, wasprovided by Dr. S. Hatakeyama [27]. The plasmid expressing p65 TA1
in fusion with green fluorescent protein (GFP), pEGFP-TA1, was
generated from pM-p65 (521–551) by cutting with SmaI–BamHI and
ligated into pEGFP-C1 vector (Clontech). pEGFP-p65 was con-
structed by PCR using the oligo-nucleotides 50-CCCAAGCTTGGG
CCATGGACGAACTGTTCCCC-30 and 50-CGCGGATCCGCGTT
AGGAGCTGATCTGACTC-30 containing BamHI and HindIII sites,
and the PCR product was cloned into pEGFP-C1. All PCR amplifi-
cation reactions used Expand high fidelity system (Roche Molecular
Biochemicals). All the constructs were confirmed by dideoxynucleotide
sequencing using ABI PRISM Dye Terminator Cycle Sequencing
Ready Kit (Perkin–Elmer) on an Applied Biosystems 313 automated
DNA sequencer.
The construction of luciferase (luc) reporter plasmids of 4jBw-luc
containing four tandem copies of the HIV jB sequence and 4jBm-luc
harboring four mutated inactive jB sites has been described previously
[28]. Another luciferase reporter plasmid, pFR-luc, containing five
tandem copies of Gal4 binding site upstream of TATA box was pur-
chased from Stratagene.
The Ran expression plasmid pHARan1.1.1 and its mutant pHA-
RanQ69L1.1.1 were gifts from Dr. T. Kimura (Kansai Medical Uni-
versity, Osaka, Japan). pHARan1.1.1 expresses the wild-type Ran,
whereas pHARanQ69L expresses a mutant which dominantly inhibits
the Ran-mediated import of macromolecules [29].
Cell culture and transfection. Cells (293) were grown at 37 �C in
Dulbecco�s modified Eagle�s medium (Sigma) with 10% heat-inacti-
vated fetal bovine serum (IBL, Maebashi, Japan). Cells were
transfected using FuGene 6 transfection reagent (Roche Molecular
Biochemicals) according to the manufacturer�s recommendations. At
48 h post-transfection, the cells were harvested and the cell extracts
were prepared for the luciferase assay. Luciferase activity was
measured using the luciferase assay system (Promega) as described
previously [28]. Transfection efficiency was monitored by Renilla
luciferase activity using the pRL-TK plasmid (Promega) as an in-
ternal control and the luciferase activity was normalized by the
Renilla luciferase activity. For each transfection, 50 ng of the luc
reporter plasmid and 25 ng of internal control plasmid pRL-TK
were used. pUC19 was used to adjust the total amount of DNA
(500 ng) transfected. Cells without the stimulation of TNF were
lysed 48 h after transfection and the luciferase activity was mea-
sured. Other cells, as indicated, were stimulated with 10 ng/ml TNF
after 24 h of transfection and lysed after an additional incubation
for 24 h. The data are presented as the fold increase in luciferase
activities (means� SD) relative to the control of three independent
transfections.
Western blotting. The detection of Myc-IjB in the transfected
cells was performed as previously described [26,28]. Briefly, whole cell
extracts were lysed in 350ll of ice-cold lysis buffer (50mM Tris [pH
7.4], 150mM NaCl, 2mM EDTA, 1mM phenylmethylsulfonyl
fluoride, 1mM dithiothreitol, 0.2% Nonidet P-40, 10mM sodium
fluoride, 10 lg/ml aprotinin, 10 lg/ml leupeptin, and 1 lg/ml pepstatin
A). The proteins were resolved by 10% SDS–PAGE and transferred
onto PVDF membrane (Millipore). The membrane was incubated
with anti-Myc epitope antibody (Santa Cruz) and immunoreactive
proteins were visualized by enhanced chemilluminescence (ECL)
(Amersham).
Microscopic examination. The intracellular localizations of p65 and
its TA1 domain were examined by fluorescence microscopy by trans-
fecting pEGFP-C1-p65 and pEGFP-C1-TA1, respectively. Cells (293)
were cultured in 2-well chamber slides and transfected with plasmids
expressing these GFP fusion proteins using FuGene 6 transfection
reagent (Roche Molecular Biochemicals). After 24 h, cells were fixed in
4% paraformaldehyde at room temperature for 15min followed by
washing with PBS and subjected to microscopic examinations.
584 X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590
The intracellular localization of NIK and IKKa in 293 cells was
examined by immunostaining. Cells (293) were cultured in 2-well
chamber slides and after transfected with NIK or IKKa alone, or
contransfected with Ran and its mutants (RanQ69L), 24 h after
transfection cells were fixed in 4% (w/v) paraformaldehyde/PBS at
room temperature for 20min and then permeabilized by 0.5% Triton
X-100/PBS for 20min at room temperature. They were then incu-
bated with rabbit polyclonal antibody against NIK (Santa Cruz) or
IKKa (Santa Cruz) for 1 h at 37 �C, rinsed three times with 0.05%
Triton X-100/PBS, and incubated with secondary antibody, fluo-
rescein-conjugated goat anti-rabbit IgG (CAPPEL; ICN Pharma-
ceuticals), for 1 h at 37 �C. The slides were rinsed three times with
PBS and mounted with buffered glycerol for fluorescent microscopic
examination. Primary and secondary antibodies were diluted at
1:100 and 1:200 in PBS containing 3% of bovine serum albumin,
respectively.
Results
Synergism between NIK and IKKa or IKKb in the NF-jB
activation cascade
We first examined the effects of overexpression of
NIK, IKKa, and IKKb in the NF-jB activation path-
way, either alone or in combination, using the transient
luciferase assay with an NF-jB-dependent reporterplasmid (4jBw-luc). As shown in Fig. 1A, TNF alone
stimulated NF-jB-dependent gene expression by 21-fold
and overexpression of NIK activated the gene expres-
sion by 23-fold. Overexpression of IKKa alone did not
Fig. 1. Synergism between NIK and IKKa or IKKb. The effects of TNF-signaling, NIK, IKKa, and IKKb, either alone or in combination, on the
NF-jB-dependent luciferase (luc) gene expression and IjBa degradation were examined. (A) Effects of TNF, NIK, IKKa, or IKKb on the luc
reporter gene expression. Cells (293) were transfected with 50 ng of 4� jBw-luc (containing wild-type NF-jB binding sites) or 4� jBm-luc
(mutant NF-jB sites) reporter plasmid (pGL3-4jBwt-luc or pGL3-4jBm-luc) together with either 20 ng of pcDNA3-NIK, 50 ng of pCR2FL-
IKKa or pCR2FL-IKKb expression plasmids. TNF (10 ng/ml) was added as a physiological stimulator of the NF-jB signaling. (B) Synergistic
effect on TNF-mediated jB-dependent gene expression by the overexpression of NIK and IKKb but not IKKa. (C) Synergism between NIK and
IKKa or IKKb. (D) Roles of NIK, IKKa, and IKKb in IjBa degradation. Cells (293) were transfected with NIK, IKKa, or IKKb together with
Myc-tagged IjBa. After stimulated with low concentration of TNF (2 ng/ml) for 4min, the cells were lysed, the lysate was resolved by SDS–
PAGE, and the protein level of IjB was detected by Western blotting with anti-Myc epitope antibody. Antibody to b-tubulin was used as an
internal control.
X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590 585
significantly activate NF-jB-dependent gene expressionwhereas IKKb stimulated the gene expression by 3.5-
fold. These data suggested that upstream signal is re-
quired for the optimal activity of IKKs as previously
reported [12,14]. When a luciferase reporter construct
harboring mutant jB sites (4jBm-luc) was used, no
significant effect of these kinases was observed.
We then examined the effect of IKKa and IKKb on
the NF-jB-dependent gene expression when combinedwith TNF or NIK. As shown in Fig. 1B, when NIK,
IKKa, or IKKb was expressed in 293 cells and stimu-
lated with TNF, synergistic effect was observed with
NIK or IKKb, but not with IKKa. These results were
consistent with the fact that the TNF-induced NF-jBactivation is abolished in the IKKb- but not in the
IKKa-gene knockout mice [30–32]. However, when
NIK was overexpressed, either IKKa or IKKb syner-gized with NIK in stimulating the jB-dependent gene
expression (Fig. 1C). These findings suggest that
whereas the NIK–IKKb cascade is involved in the TNF
signaling, the NIK–IKKa cascade is not involved in the
TNF signaling.
We then examined the role of NIK, IKKa, and IKKbin IjB degradation. In Fig. 1D, Myc-IjBa is overex-
pressed in 293 cells and the synergism between TNFsignaling and NIK, IKKa, or IKKb was examined.
Similarly, the synergism between NIK and IKKa or
IKKb was assessed. TNF stimulation alone induced IjBdegradation, however, when NIK, IKKa, or IKKb was
overexpressed, the TNF-induced IjB degradation was
accelerated by NIK or IKKb, but not by IKKa (com-
pare lanes 3 and 5 with lane 4 in Fig. 1D). These data
were consistent with previous reports by others [20,30–32] that IKKb but not IKKa contributes to the IjBaphosphorylation and subsequent degradation in the
TNF/IL-1 signaling. Moreover, when NIK and IKKa or
IKKb were co-expressed, IKKb, but not IKKa, accel-erated the NIK-induced IjBa degradation (compare
lanes 10 and 11 in Fig. 1D). These findings collectively
indicate that the involvement of NIK in the NF-jBactivation is at least 2-fold: one through induction ofIjBa degradation by the NIK–IKKb cascade and the
other through the NIK–IKKa cascade without involv-
ing the IjBa degradation.
Effect of NIK on p65 nuclear localization and transacti-
vation
As it has been shown in Fig. 1 that one of the
mechanisms by which NIK activates NF-jB involvesIKKb and through the IjBa degradation, we examined
the nuclear translocation of p65 by transfecting pEGFP-
p65, expressing full-length p65 in fusion with green
fluorescent protein (GFP-p65). As shown in Fig. 2A,
when cells were transfected with pEGFP-p65 alone,
GFP-p65 was found both in the nucleus and the cyto-
plasm. When GFP-p65 was co-overexpressed with NIK,GFP-p65 located predominantly in the nucleus, whereas
co-overexpression of a kinase-defective mutant of NIK,
NIK(KM), did not alter its intracellular localization.
Since most of the nuclear factors are known to be
mediated by the action of Ran, a small GTPase protein
and the energy source of protein transportation through
the nuclear pore, GFP-p65 and NIK were co-expressed
in 293 cells and the effect of a dominant negative mutantof Ran lacking the GTPase activity (RanQ69L) was
examined. As demonstrated in Fig. 2A, NIK induced
nuclear transportation of GFP-p65, which was abol-
ished by RanQ69L. In Fig. 2B, we further examined the
effect of RanQ69L on the NIK-induced NF-jB-depen-dent gene expression. When p65 was co-overexpressed
with RanQ69L, the fold transactivation was dramati-
cally inhibited (from 16- to 3.6-fold) in a dose-dependentmanner for the amount of plasmid expressing RanQ69L
(lanes 1–5). When NIK was co-transfected with p65, the
gene expression from jB-Luc was further augmented
Fig. 2. Inhibition of NIK-induced p65 nuclear transport and its
transactivation by RanQ69L. (A) Suppression of p65 nuclear transport
by RanQ69L, a dominant negative mutant of Ran. Effects of Ran and
its mutant were examined on the intercellular locations of p65.
pEGFP-P65 was co-transfected with NIK, NIK(KM), Ran or
RanQ69L in various combinations, and its intracellular localization
was examined. (B) Suppression of the p65 transactivation by
RanQ69L. Expression plasmids for NIK, Ran, RanQ69L, and p65
were co-transfected with 4� jBw-luc and NF-jB-dependent gene ex-
pression was measured.
586 X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590
(23.5-fold) and the augmentation ion by NIK wascompletely abolished by expression of RanQ69L.
The effect of NIK on the NF-jB transcriptional activity is
mediated through the C-terminal transactivation domain
of p65
Since the NIK-mediated NF-jB activation through
IKKa did not involve IjB degradation (Fig. 1), we ex-
amined if NIK could affect the transcriptional activity ofNF-jB devoid of the IjB-mediated regulation. In order
to examine this possibility, we adopted a heterologous
luciferase reporter system in which gene expression from
the reporter plasmid pFR-luc containing Gal4-binding
sites is under the control of Gal4. We have created a
series of effector plasmids containing the Gal4 DNA-
binding domain fused with various portions of p65(Fig. 3A). These plasmids were co-transfected into 293
cells and the effect of NIK was examined. As demon-
strated in Fig. 3B, NIK stimulated the pM-p65- and
pM-p65 (286–551)-mediated transactivation by 4.8- and
3.0-fold, respectively. Neither transcriptional activity
nor activation by NIK was observed with pM-p65
(1–286) and pM, containing only the Gal4 DNA-bind-
ing domain. Remarkably, NIK stimulated the tran-scriptional activity of pM-p65 (521–551), containing
only the TA1 domain, by approximately 18-fold. When
Ser at 529 in p65 TA1 was substituted by Ala (pM-p65
(521–551:S529A)), NIK could still stimulate its tran-
scriptional activity by 17-fold. However, when Ser 536
in p65 TA1 was substituted by Ala (pM-p65 (521–
551:S536A)), the effect of NIK was greatly reduced.
Fig. 3. Role of C-terminal TA1 domain in the NF-jB activation by NIK. (A) Schematic representation of the p65 and its mutant constructs. The
indicated regions of p65 were cloned into a vector (pM) producing fusion proteins with the Gal4 DNA-binding domain. (B) The effect of NIK on the
Gal4-dependent gene expression driven by various p65 fusion proteins with the Gal4 DNA-binding domain. Cells (293) were transfected with 50 ng of
5�Gal4-TATA-luc reporter plasmid (pFR-luc) in the presence or absence of pcDNA3-NIK (20 ng) together with various pM-p65 constructs (50 ng).
X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590 587
These findings suggested that the effect of NIK wasprimarily mediated by TA1 and Ser536 appeared to be
the major target for the effect of NIK.
NIK-mediated NF-jB activation through TA1 domain of
p65 and the role of IKKa
In Fig. 4A, we examined the effect of NIK on the
intracellular localization o of p65 TA1 by creating a
plasmid expressing TA1 in fusion with GFP (pEGFP-TA1). GFP-TA1 was diffusely distributed both in the
cytoplasm and the nucleus, and the intracellular location
of GFP-TA1 was not affected by NIK or RanQ69L. In
addition, NIK did not affect the intracellular localiza-
tion of Gal4 DNA-binding domain (as observed with
GFP-Gal4 in Fig. 4A). Thus, the apparent effect of
NIK–IKKa cascade on the transcriptional activity of
NF-jB is not through the nuclear translocation of p65TA1. However, the expression of RanQ69L abolished
the NIK-induced activation of Gal4-TA1 in a dose-de-
pendent manner (Fig. 4B).
These data collectively indicate that the NIK-induced
activation of Gal4-TA1 depends on the nuclear trans-
port of other component in this cascade. Since a CRM1
inhibitor, leptomycin B, was shown to block nuclear
export of NIK and IKKa, but not IKKb, both NIK andIKKa are likely to shuttle between the cytoplasm and
the nucleus [33]. Others confirmed the nuclear presence
of IKKa in unstimulated cells [1]. Thus, we examined
the effect of RanQ69L on the intracellular localization
of NIK and IKKa. As shown in Fig. 4C, immuno-
staining demonstrated that NIK was primarily localized
in the cytoplasm and the overexpression of either Ran or
RanQ69L did not alter its intracellular localization. Onthe other hand, although IKKa is located in both cy-
toplasm and nucleus, when RanQ69L was expressed, the
nuclear transportation of IKKa was completely
blocked. Thus, the inhibitory effect of RanQ69L on the
transcriptional activity of p65 TA1 (Fig. 4B) might be
through blocking the nuclear translocation of IKKa and
it is suggested that the transcriptional activity of p65
TA1 depends on the nuclear IKKa.
Discussion
It is widely accepted that the nuclear translocation is
a hallmark of the transcriptional activation of NF-jBand its intracellular localization is governed by IjBs[1,2]. However, recent studies revealed that both NF-jBand IjB shuttle in and out of the nucleus [33,34]. In
addition, Birbach et al. [33] reported that the treatment
of cells with a nuclear export blocker leptomycin B re-
sulted in the nuclear accumulation of NIK and IKKabut not IKKb, indicating that NIK and IKKa also
shuttle between the cytoplasm and the nucleus. Our
findings clearly indicate that the NIK–IKKa cascadeinduces the transcriptional activity of NF-jB without
inducing the IjB degradation and that this effect is
mediated through the TA1 domain of p65. Our findings
also indicate that the nuclear transport of IKKa plays a
crucial role for this regulation.
The inhibitory role of RanQ69L, a dominant negative
form of nuclear transporter Ran, was apparent in at
least two steps, nuclear translocation of NF-jB andIKKa (Figs. 2 and 4). It is known that the bidirectional
exchange of macromolecules throughout the nuclear
membrane requires the energy that is provided by Ran
at the cost of GTP conversion to GDP [35]. As evi-
denced by previous studies with NLS of SV40 large T
[36], heterodimeric NLS receptor complex, known as
importin-ab or karypherin-ab, recognizes classical NLS
sequence through its direct interaction by importin-aand importin-b docks the entire ‘‘cargo-carrier’’ com-
plex at the cytoplasmic surface of the nuclear pore. The
complex is then recognized by nuclear transport factor 2
(NTF2) that recruits Ran GTPase and is eventually
translocated into the nucleus [35,37]. The dominant
negative mutant RanQ69L, exhibiting a large confor-
mational change in residues 68–74 responsible for the
interaction with NTF2, interferes with wild-type Ran ininteracting with NTF2 [29]. When the ‘‘cargo’’ protein
does not contain typical NLS, additional ‘‘adaptor’’
proteins such as transportin (also termed karypopherin-
b2) [38,39] may be required for specific recognition for
the nuclear import. NLS is found in NIK, IKKa, andp65. As IKKa was identified as NIK-interacting protein
[22], IKKa is likely to be associated with NIK, even in
the nucleus whereas the large IKK complex containingIKKb is found in the cytoplasm. However, since NIK
also contains the nuclear export signal (NES), the nu-
clear NIK is rapidly exported to the cytoplasm [33].
Thus, it is possible that nuclear NF-jB is activated by
such NIK–IKKa complex when NIK is transiently
translocated to the nucleus.
Although a major step that regulates NF-jB activity
is to remove IjB from the NF-jB/IjB complex, thecapacity of nuclear NF-jB to drive transcription is also
a regulated process. A number of studies support the
possibility that p65 phosphorylation regulates the tran-
scriptional competence of nuclear NF-jB [8–10,40–44].
Although the role of PKA in phosphorylating p65 is still
controversial [45–47], regulation of the transcriptional
competence of p65 by phosphorylation has been widely
accepted. One of the possible effects of p65 phosphory-lation at its TA domain by IKKa in controlling its
transcriptional competency is to recruit co-activator
proteins such as histone acetyl transferases [48,49] and
TLS [50] to NF-jB when it binds to the target promoter
sequence. Alternatively, p65 phosphorylation may pre-
clude the recruitment of co-repressor proteins such as
Groucho family proteins that are known to interact with
588 X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590
Fig. 4. NIK-mediated NF-jB activation through p65 TA1 and the effect of RanQ69L on the nuclear transportation of IKKa. (A) Effect of NIK and
RanQ69L on the intracellular localization of TA1 and Gal4 DNA-binding domain. GFP-TA1or GFP-Gal4 was co-overexpressed with NIK, Ran, or
dominant negative mutant of Ran (RanQ69L). Twenty-four hours after transfection, their intercellular locations were examined by fluorescence
microscopy. (B) Suppression of the NIK-mediated transcriptional activation of TA1 by RanQ69L. (C) RanQ69L inhibits the nuclear transportation
of IKKa but not NIK. IKKa or NIK was expressed in 293 cells together with Ran or RanQ69L. Twenty-four hours after transfection, their in-
tercellular locations were detected with anti-IKKa or anti-NIK antibody under fluorescence microscopy.
X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590 589
the p65 TA domain [26] and histone deacetylases(HDACs) [51].
In summary, our findings indicate that the p65
phosphorylation may act as another critical step for NF-
jB activation and the NIK–IKKa cascade plays a major
role. Based on the findings with gene knock-out mice, in
which genetic deficiency of IKKb exhibited far more
extensive effects such as embryonic fatality due to ex-
cessive apoptosis in the liver whereas that of NIK orIKKa showed limited effects, either NIK or IKKa could
serve as more feasible molecular targets for a number of
diseases in which NF-jB plays a crucial role.
Acknowledgments
We thank Dr. H. Nakano, Dr. D. Wallach, Dr. S. Hatakeyama,
and Dr. T. Kimura for their generosity in providing the expression
vectors encoding IKKa and IKKb, NIK, Myc-IjBa, Ran and Ran
(Q69L), respectively.
References
[1] S. Ghosh, M. Karin, Cell 109 (Suppl.) (2002) S81–S96.
[2] T. Okamoto, S. Sakurada, J.P. Yang, J.P. Merin, Curr. Top Cell.
Regul. 35 (1997) 149–161.
[3] P.A. Moore, S.M. Ruben, C.A. Rosen, Mol. Cell. Biol. 13 (1993)
1666–1674.
[4] M.L. Schmitz, P.A. Baeuerle, EMBO J. 10 (1991) 3805–3817.
[5] M.L. Schmitz, M.A. dos Santos Silva, P.A. Baeuerle, J. Biol.
Chem. 270 (1995) 15576–15584.
[6] M.L. Schmitz, G. Stelzer, H. Altmann, M. Meisterernst, P.A.
Baeuerle, J. Biol. Chem. 270 (1995) 7219–7226.
[7] D. Wang, A.S. Baldwin Jr., J. Biol. Chem. 273 (1998) 29411–
29416.
[8] D. Wang, S.D. Westerheide, J.L. Hanson, A.S. Baldwin Jr., J.
Biol. Chem. 275 (2000) 32592–32597.
[9] H. Sakurai, H. Chiba, H. Miyoshi, T. Sugita, W. Toriumi, J. Biol.
Chem. 274 (1999) 30353–30356.
[10] L.V. Madrid, M.W. Mayo, J.Y. Reuther, A.S. Baldwin Jr., J. Biol.
Chem. 276 (2001) 18934–18940.
[11] E.B. Traenckner, H.L. Pahl, T. Henkel, K.N. Schmidt, S. Wilk,
P.A. Baeuerle, EMBO J. 14 (1995) 2876–2883.
[12] J.A. DiDonato, M. Hayakawa, D.M. Rothwarf, E. Zandi, M.
Karin, Nature 388 (1997) 548–554.
[13] F. Mercurio, H. Zhu, B.W. Murray, A. Shevchenko, B.L. Bennett,
J. Li, D.B. Young, M. Barbosa, M. Mann, A. Manning, A. Rao,
Science 278 (1997) 860–866.
[14] E. Zandi, D.M. Rothwarf, M. Delhase, M. Hayakawa, M. Karin,
Cell 91 (1997) 243–252.
[15] D.M. Rothwarf, E. Zandi, G. Natoli, M. Karin, Nature 395
(1998) 297–300.
[16] H. Nakano, M. Shindo, S. Sakon, S. Nishinaka, M. Mihara, H.
Yagita, K. Okumura, Proc. Natl. Acad. Sci. USA 95 (1998) 3537–
3542.
[17] L. Ling, Z. Cao, D.V. Goeddel, Proc. Natl. Acad. Sci. USA 95
(1998) 3792–3797.
[18] F.S. Lee, R.T. Peters, L.C. Dang, T. Maniatis, Proc. Natl. Acad.
Sci. USA 95 (1998) 9319–9324.
[19] J. Yang, Y. Lin, Z. Guo, J. Cheng, J. Huang, L. Deng, W. Liao, Z.
Chen, Z. Liu, B. Su, Nat. Immunol. 2 (2001) 620–624.
[20] N. Sizemore, N. Lerner, N. Dombrowski, H. Sakurai, G.R. Stark,
J. Biol. Chem. 277 (2002) 3863–3869.
[21] N.L. Malinin, M.P. Boldin, A.V. Kovalenko, D. Wallach, Nature
385 (1997) 540–544.
[22] C.H. Regnier, H.Y. Song, X. Gao, D.V. Goeddel, Z. Cao, M.
Rothe, Cell 90 (1997) 373–383.
[23] J.D. Woronicz, X. Gao, Z. Cao, M. Rothe, D.V. Goeddel, Science
278 (1997) 866–869.
[24] L. Yin, L. Wu, H. Wesche, C.D. Arthur, J.M. White, D.V.
Goeddel, R.D. Schreiber, Science 291 (2001) 2162–2165.
[25] A. Matsushima, T. Kaisho, P.D. Rennert, H. Nakano, K.
Kurosawa, D. Uchida, K. Takeda, S. Akira, M. Matsumoto, J.
Exp. Med. 193 (2001) 631–636.
[26] T. Tetsuka, H. Uranishi, H. Imai, T. Ono, S. Sonta, N.
Takahashi, K. Asamitsu, T. Okamoto, J. Biol. Chem. 275 (2000)
4383–4390.
[27] M. Shirane, S. Hatakeyama, K. Hattori, K. Nakayama, J. Biol.
Chem. 274 (1999) 28169–28174.
[28] J.P. Yang, M. Hori, T. Sanda, T. Okamoto, J. Biol. Chem. 274
(1999) 15662–15670.
[29] M. Stewart, H.M. Kent, A.J. McCoy, J. Mol. Biol. 284 (1998)
1517–1527.
[30] M. Tanaka, M.E. Fuentes, K. Yamaguchi, M.H. Durnin, S.A.
Dalrymple, K.L. Hardy, D.V. Goeddel, Immunity 10 (1999) 421–
429.
[31] K. Takeda, O. Takeuchi, T. Tsujimura, S. Itami, O. Adachi, T.
Kawai, H. Sanjo, K. Yoshikawa, N. Terada, S. Akira, Science 284
(1999) 313–316.
[32] Y. Hu, V. Baud, M. Delhase, P. Zhang, T. Deerinck, M. Ellisman,
R. Johnson, M. Karin, Science 284 (1999) 316–320.
[33] A. Birbach, P. Gold, B.R. Binder, E. Hofer, R. de Martin, J.A.
Schmid, J. Biol. Chem. 277 (2002) 10842–10851.
[34] T.T. Huang, N. Kudo, M. Yoshida, S. Miyamoto, Proc. Natl.
Acad. Sci. USA 97 (2000) 1014–1019.
[35] E. Conti, E. Izaurralde, Curr. Opin. Cell. Biol. 13 (2001) 310–319.
[36] D. Gorlich, I.W. Mattaj, Science 271 (1996) 1513–1518.
[37] S.K. Vasu, D.J. Forbes, Curr. Opin. Cell. Biol. 13 (2001) 363–375.
[38] V.W. Pollard, W.M. Michael, S. Nakielny, M.C. Siomi, F. Wang,
G. Dreyfuss, Cell 86 (1996) 985–994.
[39] N. Bonifaci, J. Moroianu, A. Radu, G. Blobel, Proc. Natl. Acad.
Sci. USA 94 (1997) 5055–5060.
[40] T. Hayashi, T. Sekine, T. Okamoto, J. Biol. Chem. 268 (1993)
26790–26795.
[41] M. Naumann, C. Scheidereit, EMBO J. 13 (1994) 4597–4607.
[42] T.A. Bird, K. Schooley, S.K. Dower, H. Hagen, G.D. Virca, J.
Biol. Chem. 272 (1997) 32606–32612.
[43] N. Sizemore, S. Leung, G.R. Stark, Mol. Cell. Biol. 19 (1999)
4798–4805.
[44] M. Leitges, L. Sanz, P. Martin, A. Duran, U. Braun, J.F. Garcia,
F. Camacho, M.T. Diaz-Meco, P.D. Rennert, J. Moscat, Mol.
Cell 8 (2001) 771–780.
[45] M. Neumann, T. Grieshammer, S. Chuvpilo, B. Kneitz, M.
Lohoff, A. Schimpl, B.R. Franza Jr., E. Serfling, EMBO J. 14
(1995) 1991–2004.
[46] H. Zhong, H. SuYang, H. Erdjument-Bromage, P. Tempst, S.
Ghosh, Cell 89 (1997) 413–424.
[47] N. Takahashi, T. Tetsuka, H. Uranishi, T. Okamoto, Eur. J.
Biochem. 269 (2002) 4559–4565.
[48] M.E. Gerritsen, A.J. Williams, A.S. Neish, S. Moore, Y. Shi, T.
Collins, Proc. Natl. Acad. Sci. USA 94 (1997) 2927–2932.
[49] H. Zhong, R.E. Voll, S. Ghosh, Mol. Cell 1 (1998) 661–671.
[50] H. Uranishi, T. Tetsuka, M. Yamashita, K. Asamitsu, M.
Shimizu, M. Itoh, T. Okamoto, J. Biol. Chem. 276 (2001)
13395–13401.
[51] L. Chen, W. Fischle, E. Verdin, W.C. Greene, Science 293 (2001)
1653–1657.
590 X. Jiang et al. / Biochemical and Biophysical Research Communications 301 (2003) 583–590