Nucleic Research - ncbi.nlm.nih.gov

Volume 16 Number 20 1988 Nucleic Acids Research

Sigma region located between C,, and C6 genes of human immunoglobulin heavy chain: possibleinvolvement of tRNA-like structure in RNA splicing

Yasushi Akahori, Hiroshi Handal, Kenji Imai, Masumi Abe, Kohzoh Kameyama, Makoto Hibiya,Hisashi Yasui, Kazuhiko Okamura, Morihiro Naito, Hiroshi Matsuoka2 and Yoshikazu Kurosawa

Institute for Comprehensive Medical Science, Fujita-Gakuen Health University, Toyoake, Aichi470-11, 'Department of Bacteriology, Tokyo University School of Medicine, Hongo, Bunkyo-ku,Tokyo 103 and 2Department of Pediatrics, Nagoya University School of Medicine, Tsurumai,Showa-ku, Nagoya 466, Japan

Received August 2, 1988; Revised and Accepted September 19, 1988 Accession nos X12842, X12843

ABSTRACTNoncoding regions within the cluster of immunoglobulin heavy chain

constant genes in the human genome contained a number of repeats. In theP-6 intron, two repeating units were contained. One 442-base-longfragment located JH- intron ( defined as "sigma i(op)") occupied theposition in the p-5 intron. The other 1166-base-long fragment locatedsomewhere in front of S (class switch) region of Cy gene was also found inthe p-6 intron. We defined the repeats in the p-6 intron as "SIGMA (E)".The polaxities of the longer repeats in the genome were opposite betweenthe p-6 intron and the upstreams of Cy genes. These inverted copies(deiined as Gy3 and 0y4), located 6 kb upstream of their respective Cy's,were apparently transcribed in vitro, via RNA polymerase III andtranscripts should have contained tRNA-like structures. Small DNAfragments capable of encoding tRNA-like structures were also found incorresponding regions of mouse Ig Cy cluster.

INTRODUCTION

Immunoglobulin (Ig) heavy (H) chain genes on human chromosome 14 are

organized into the following gene clusters: VH, DH1 JH and constant(CH)(For a review see ref.1). The order of the CH genes is p-6-y3-yl-*P-al-*y-y2-y4-c-a2 (2, 3, 4). Characteristic repetitive sequences referred to

as class switch(S) sequences (5) exist upstream of each CH gene; only

exception being C . During B cell ontogeny, these genes undergo two

kinds of DNA rearrangements: DH-JH and then VH-DH joinings (For a review

see ref.6 ), resulting in the formation of a complete H chain gene;

subsequently, p-class H chain gene undergoing class switch via

recombination between two S sequences; e.g., S of p and S of y1 (7).

Both rearrangements usually involve the loss of intervening sequences (7,

8). However, aside from the classical switch via S-S recombination, there

have been reports of B cells expressing two isotypes such as IgM and IgG

(9). In these instances, DNA rearrangements have not been detected in CH

gene loci. Accordingly, simultaneous expression of two different

© JR L Press Limited, Oxford, England. 9497

Nucleic Acids Research

isotypes is thought to be mediated by alternative RNA splicing from an

extreamly long primary transcript (10).

While trying to find new DH gene families utilizing a JH-containingfragment as a probe, we identified an unexpected DNA segment on human

germline genome. Apparently, a copy of the DNA segment located between

the enhancer (11) and the S sequence (12) upstream of C gene has become

inserted into the p-6 intron. Moreover, one more DNA fragment seemingly

derived from somewhere upstream of one of the C genes was embedded in

the p-6 intron. We determined the nucleotide sequences upstream of C 3

and Cy4 genes. By comparison of nucleotide sequences of JH- introns,

i-6 introns and upstream of y genes between human and mouse, we suggest a

possible mechanism of alternative splicing of primary transcripts for

expression of two isotypes. We also identified a promoter activity for

transcription by RNA polymerase III upstream of constant y genes, and

discuss the possibility of discontinuous transcription followed by trans-

RNA splicing.

MATERIALS AND METHODS

Clones CH4-38 and CH4-51 containing human C gene (13), were

provided by P.Leder ( Harvard Medical School ). Clones 5A and 5D

containing human C 2 and C 4 (14), respectively, were provided by L.Hood

( Cal Tech ). Clone MEP12 containing mouse y2b-y2a intron (15) was

donated by S.Tonegawa ( MIT ). To prepare a human C 1 probe, the 6 kb

HindIII fragment containing C 1 gene (16) was isolated with mouse C 1

gene as a probe. The human genomic library (17) was donated by T.Maniatis

( Harvard University ). Clone ARAJH1 was isolated by the ordinary

cloning procedure as described by Sakano et al. (18). Clones 1, 2, 3

and 6 were isolated by screening the Maniatis' human genomic library with

ARAJH1 probe according to Benton-Davis' method (19). Nucleotide sequence

was determined by the chain termination technique of Sanger et al.

(20), using Bluescript M13 vectors ( STRATAGENE ). Southern

hybridization was carried out by the published procedure (21). A 66 mer:

5'-CACACATGGCAGTTTGAGCAGCAGAACTCTGTTCTTTCCCAGTTCTAGAGGCCAGAAGTGTGGGCC-3',

which corresponds to 3589-3654 in Figure 2 of the paper by Richards et

al.(22), was chemically synthesized by DNA synthesizer ( Applied

Biosystems Inc.). In vitro transcription mixture was prepared from Hela

cells according to the procedure described by Dignam et al. (23). As DNA

9498


templates, the EcoRI-HindIII fragments containing ay3 and a 4 were

recloned in pUC9, resulting in pSG3 and pSG4, respectively.

RESULTS AND DISCUSSION

Identification of Sigma(E) region

With JH gene-containing probe ( JH probe ) as shown in Figure la, we

identified a very faint band at 3.8 kb, in addition to the germline band

I__ E:___IE-

a

t

v ~v %V IV I - v~~~--(J'H - probe) (probe 1) (probe 2) (probe 3)

v V Clone 3

VW v la IV I I1 vg _ Clone 6

Umimd~ ARAJH 1

CYS3

b s v v I*l v CSt |C3 1 v I a

V*vvvv 11111111111 Clone 2

°14

I SF21 I C,2 I 1*1 I SF4 I-C4(probe 4)

ikb i 1 v Clone I

Figure 1. Physical maps of the human immunoglobulin heavy chain constantgene loci and the clones (thick line) isolated in this study : ARAJH1,clones 1, 2, 3, 6. Details of cloning process are described in the text.In brief, ARAJH1 was first isolated by homology to J probe. Clones 1,2, 3 and 6 were isolated from Maniatis' human phage Yibrary ( 17 ) withthte 3.8 kb insert of ARAJH1 as the probe. Clone 3 was a JH gene-containing clone. Clone 6 covered from the downstream of J gene clusterto 5' end of C6 genes. Clone 2 covered the upstream region of Cy3 gene.Clone 1 covered from Cy2 to the upstream of C 4 gene. aY ' ay4 andtheir homologous region in E are indicated by box with thick black arrows,and oy and its homologous region in £ by black box with thick whitearrows. Direction of arrows indicates sequence polarity. Probes usedin this study are indicated. The EcoRI-HindIII fragments containing CYY3and 0Y4 indicated by horizontal double arrows were sequenced in thisstudy. Restriction enzymes : Y HindIII, V EcoRI, + BamHl. Restrictionsites of regions are not covered by the above clones are referred frompublished papers ( 2, 13, 14 ).

9499


at 10 kb in HindIII-digested placenta DNA, cloned the 3.8 kb band, and

named it ARAJH1. In Southern hybridization of HindIII-digested placenta

DNA with the 3.8 kb DNA of ARAJH1 as the probe, six bands: 10 ( double ),

8, 4.5 and 3.8 kb ( double ) were detected ( date not shown ). We

screened a human DNA phage library provided by T.Maniatis (17) using the

3.8 kb DNA as the probe. Restriction maps of the four kinds of clones

obtained are shown in Figure 1. The 3.8 kb-containing clone was named

clone 6, and a JH gene-containing clone was named clone 3. The other two

clones, 1 and 2, are different. Homologous regions to the 3.8 kb probe

in clones 1 and 2 were mapped by Southern hybridization as shown in Figure

lbc. Clones 1 and 2 contained, respectively, 10 and 4.5 kb HindIII

fragments detected by the probe. The size of the HindIII fragment

containing JH region was also 10 kb. We compared the restriction maps

of clones 1, 2 and 6 with the published maps of Ig CH gene loci (2, 13,

14) and noticed that the maps of clones 1, 2 and 6 almost the same as

those of the upstream regions of C 4 and C 3 genes and p-6 intron,

respectively. Comparison of restriction maps among clones 6, CH4-38 and

CH4-51 (13) indicated that they have overlapping regions ( data not

shown ). The complete nucleotide sequence of the region from p to 6 was

published by Milstein et al. (24). Strikingly, the 442-nucleotide-long

sequence in p-6 intron ( from 6387 to 6828 in Figure 2 of the 1984 paper

by Milstein et al.(24)) was 97% homologous to the downstream of JH gene

( from 661 to 1102 in Figure 3 of the 1983 paper by Mills e- al.(25)).

Independently, we determined the nucleotide sequence of the relevant

region in clone 6, with the same results. Comparison among clones 1, 5A

and 5D (14), and Southern hybridization of clones 1 and 2 DNAs with human

C 1 probe indicated that clones 1 and 2 were located upstream of C 4

and C 3 genes, respectively ( data not shown ). Figure 1 shows the

location of clones 1, 2, 3 and 6 in the CH chain gene loci and their

physical maps. Southern hybridization of genomic DNA with probes 1 and 3

showin in Figure la detected only those fragments themselves ( data not

shown ). Probe 4 shown in Figure lc was prepared from clone 1, anid

Southern hybridization of HindIII-digested DNA was carried out. All the

bands ( 10, 8, 4.5 and 3.8 kb ) detected by ARAJH1 probe were also

detected by probe 4. All these fragments clearly contained regions

highly homologous to each other. Very recently we isolated two more DNA

fragments corresponding to the 8 kb band and one of the 3.8 kb bands, and

found that they are located upstream of C 1 and Cy2' respectively (data

9500


not shown ). Thus, in the p-6 intron two DNA fragments were inserted :

one derived from JH-p intron and the other from upstream of C gene.

We refer to the region in the p-6 intron containing the two DNA fragments

as "SIGMA" ( E ) region and the regions upstream of C , Cy3 and C 4 genes

homologous to SIGMA region as small sigma i, y3 and y4 (Coy, ay3 and cy ),

respectively.

A5'-flanking sequence of aY3

GETTCTATTCTGCCATGAAAGATGAATCTTGTCATCTGAGGTACATGGATGAGCTTGGAGGACATGTTAGTGAATAAGCTAGACACAGACAGCCAATATCACATGTTCTCACTCATATATGGAAGCCAAATAAGTTGATCTCATAGAAATAGGGAGTAGAATAGTGGTAACCAGAGGCTGGGAATGGGAGGGGATAGGATAGCTAGAAGTCGATTAATAATAAAAATT

TACTAATACCCTGGGAAAGGAATGCATCCCTGGGGGAGGTCTATAAACGGCCGCTCTGGGAATGTCTGTCTTATGTGGTTGAGATAAGGACTGAGATAAGGACTGAGATACGCCCTGGTC

TCCTGCAGTACCCTCAGCTTATTAGGGGGGTGMAAACTCCACCCTGGTAAATTTGTGGTCACACTGGTTCTCTGCTCTCAACTCTGTTTTCTGTTGTTTAAGATGTTTATCAAGATAAT

ATATGCACTGCTGAACA TAGACCCTTATCAGTAGTTCTGTTTTTGCCCTTTG-CCT---------------TGTGATCTTTGT

TGGACCCTTATCAGTGGTTCTGCTTTTGCCCTTTGTCCTGTTCCCTCAGMGCATGTGATCTTTGT

TAGACCCTTATTAGTAGTTCTGCTTTTTGCCTTTG--------------AAGCATGTGATCTTTGT ACCCACTCCCTGTGCTTACACCCCCTCCCfTT

TTATTCTCAGCTGGCCAACATTATGGAAAACAGAAAGAACCTACATTGAAATATTGGGGGCAGGTTCCCCCAATACTAATTATCCTGATTTGATCATCACCCATTGTATATATGTATC

CAAATATCACAATGTACCCCAAAATATATACAATTATTATGTGTCAATTAAAACAATCATAAACTTTTAAACAGCTAAAATAAAGTATATTGTTTTCTTCAAAAAATCTAATGCAay 3

5'-flanking sequence of aY4

GATTCTAGTACTACACTTACATATTGATTCAGGAATGCTAGGAGTTCATAGATGCAACTGGCCTTTTCCCTGGAGATGAGGAGCATTCATTGTCCTTCCAAGATGAGAEcoRICTTGAATTCTACCAACTCAAAGAGCTTTTGCATTGCTATCAATTATGTACAACTTAGAGCAGTGGTCCCCAACATTTTTGGCACCAGGAACCAGTTCCATGGAAGACAATTTTTCCAC

AGACCAGGATCGGGGGATGGCTTGGGGACAAGCTGTTCCACCTAGATCATTAGGCATTAGGGTGTCATAAGGAGGTGTGCACTTAGATCCCGGGAATGTGCGGCTCGCAATAGGGTTCGC

TCCTGTGAGAATCTAATGCTGCCACTGATCTGACAGGAGGTGGAGCTCGGGCAGGAATGCTCACACACCCCTCACCTCCTGCTCTGTGGCCCAGTTCCTAACAGGCCATGAACCGGTTCC

AGTGCATGACCCAGGGATTGGGGACCCCTGGCTTATAGAGGTGTAAAATAGTTCAAAGGAAATAAAGATGCAGAGCTCCACAGAATGAAATAACCTGGAAGAGTGTACAAGACGATGCC

AATATTTACAwAGAACCAAATGAAAATTC;TAGAACTGAAAGTATGATTCTGAAATGAAAACATCATTTTTCAGAGCAGGGTGAGAATGGACATGGGACTCAGAGCTGAGCAGGCCTGGTG

GGCCCCAGGAGGGAGACACAGAGGACTGGGGGATTTCAAGGCTGGCAGAGGCCAGAGATGGATCCCCAGCTGGGACTGGACCTGGGCTTATGGGAGCAACAGGTGACCCATCCTCCTTCCBamHI

TGGGGGCCCACCCTGCCCGGCCCCTCCAGCCCAGCACAGGCATTGGATAGAACCGGGAGAGAGCAGGCCAGGCACTGAGGCCTCTGCCCCAAATGCCCACAGCCTGGGGAAATGAGCAGATAGATGGGGGGGCAGTGGATCCCCCAGGCACACCCACACAGTGCACACAGCCCCACTTGGGCCAGAGGGGGCAGGAGGCTCGCCACCCCTGCTGTGGTTTCTCCCACACTTGATGCAGG

aY4

9501

GACATTTATCAGTTCCCAAATAATACTTTTATAATTTCTTATGCCTGTCTTTACTTTAATCTCATAATCCTGTTATCTTCATAAGCTGAGGATGTACGTCACCTCAGGACCACTGGGATA

ATTGTGTTAACTGTACAAATTGATTGTAAAACATATGTGTTTGAACAATATGAAATCAGTGCACCTTGAAAAAGACAGAATAACAGCGATTTTTAGGGAATAAGGGAAGACAACCATAAG

BamHl


B- 6 GAGGATGAGCCTTGAGCCTX K CTAATGCAGCTTTCCCTGCTGGGTTT-GGGCTTGCTTGGGACCCATGGCTCCTTCTCCTTTCcTATGTATCCCTTTTAGAATAGGAATGTCCATCY 3 TATATTGTTTTCTTCMM tTCTAATGCAGTTTCCCTACTAGGTTTTGGGCTTGCTTAGGACCCATGGCTCCTCTCTCCCTTCCAATGTATCCCTTTGGAATAGGAMTGTCCATC

'aY3 * **-6 CTATGCCTGCCCCATCATTGTACTTTGGAGCAGATMCTTCTTGTCAAGTTACMGGTCCACAGATGGAGAGGAATTTCACCC-AGATGATCTCACCCTGG CTCCCACACTTy3 CTATGCCTGCCCCATCATTGTACTTTGGAAGCAGATAACTTCTTGTCAAGTTACAAGGTCCACAGATGGAGAGGAATTTCACCCCAGAATGAATC--ACCCTGCC4CTCCCACACTTY4 ATGAGCAGATAGATGGGGGGGCAGTGGATCCCCCAGGCACACCCACACAGTGCACACAGCCCCACCTGGGCCAGAGGGGGCAGGAGGCTCGCCACCCCTGCTGTG TTCTCCCACACTT

* BamHI .**Y4- 6 GATGCAGGTGATATTTCGCTGAGATTGTGGACTAAGAGTTGGTGCTGGAAGGGGTCAGCCGTTCTGGAGATGTTGCTATGG,GATGCAGGGA rGASTGAGAAGGACATGATTATGG,y GATGCAGGTGATATGTCGCTGAGATTGTGGACTAAGAGTTGGTGCTGGAAGGGGTTAGCCATCGTGGAGATGTTGCTATGGGATGCAGGG rGCCT STGAGAAGGACATGATTATGGY3

y4 GATGCAGGTGATATTTCTCTGAGATTGTGGACTAAGAGTTGGTGCTGGAAGGGGTTAGCCATCTTGGAGATGTTGCTATGrGG_TGCAGGGA TTGCAM TGAGAAGGACATGATTATGG

w-6 GGGGAACGGAGGGCAAACTGTCATGGGTTAAATGI'GTCCCC GT AArTGTGTCGAAGTCCTAACCCCCAGGACCACAGAATGTGACCTTGTCTGGAAACAGTCTTGCAGCTGCAy 3 GGGGA7GCGGAGGGCAAMCTGTCATGGGTTAAATGTGTCCCC rAAACATGTGTTGAAGTCCTAACCCCCAGGACCACAGAATGTGACCTTGTTTGGAAACAGTCTTGCAGCTGCAY4 GGGAGTGGAGGGCAAACTGTCGTGGGTTAAAATGTGTCCCC ATMMT ICATGTGTTGAAGTCCTAACCCCCAGGACCACAGAATGTGACCTTGTTTGGAAACAGTCTTGCAACTGCA- 6 ATCAAGTTCAGATGAGGTCACCCTGGAGTAGGGCAAGCCTCTGATCCAATATGACTGCTGTCCTCATGAAAGGGGGAATCTGGGCACAGACAGCACGTGGGGAGAACGCCCTGTGAAGAy 3 ATCAAGTTCGGATGAGGTCACCCTGGAGTAGGGCAAGCCTCTGATCCAATATGACTGCTGTCCTCATGAAAAGGGGGMATCTGGGCACAGAC-GCACGTGTGGAGAACGCCCTGTGAAGAY 4 ATCAAGTTCAiGATGAGGTCACCCTGGAGTAGGGCAAGCCTCTGATCCAATATGACTGCTGTCCTCATGAAAGGGGGMATCTGGGTACAGACAGCACGTGGGGAGAACACCCTGTGAAGA- 6 TGGTGCTGCTTCCATAAGCCAAGAGCACCAGAGCCGGCCGGCAAAGCCCAGCAGCAGGGAGAGAGCCTGGAACAGAGTCTC CCGTGACACAGAGGAGCCAGCCCCGCCAAGGCCTCC KTCy 3 TGGTGCTGCTTCCACAAGCCAAGAGCAGCAGAGACGGCCGGCAAAGCCCAGCAGCAMGGAGAGAGCCTGGAACAGAG;TCTCC-ATGACACAGAGGAGCCAGCCCCACCGAGACCTCC STCy 4 TGGTGCTGCTTCCATAAGCCAAGAGCAGCAGAGACGG;CCGGCAAAGCCCAGCAGCAAGGAGAGAGCCTGGGACAGAGTCTCCCATGACACGGAGGTGCCAGCCCCGCCGAGGCCTCC KTC

* * ** *

6-6 CCAGATGCCCGGCCTCCAGAACCAGGACGGMTAMCGTCTGTTGTTTMGGCACGCAG CTGGGGTGCAGTGTTGCCAGGGCCACAGTTMCGGATACGAGTGTTGTCCTGAGCTGCCAy3 CCAGATGACCGGCCTCCAGMCCAGGACGGAATMACGTCTGTTGTTTMGCCACGCAGT TGGGGTGCAGTGTTGCCAGGGCCGCACTTMCGGATACGAGTGTTGTCCTGAGCTGCCAy4 CCAGATGCCCGGCCTCCAGMCCAGGACGGAATAAACGTCTGTTGTTTAAGCCACGCAG CTGGGGTGCTGTGTTGCCAGGGCCACAGTTMCGGATACGAGTGTTGTCCTGAGCTGCCA

* ,,* ** * * * * *

w-6 GCCCCACAGGCTGCACGAGGCCTCCCTGCCCCAGCCCAGTGCAGACTCCCCAGCCCCCTGGGTGTGCCCTGGGCAGTGTGGGGCTCCTCACTCCATCCTCCCCCAGGCTGGGAGGTTGAGy 3 GCCCCACAGACTGCACAAGGCCTCCCTGCCCCAGCCAAGTGCAGTCTCC CCAGCCCCCTGGGTGTGCCATGGGCAGTGTGGGGCCCATCACTCCGTCCTCCCCCAGGCTGGGAGGTTGAGy GCCCCACGGCGCACAGGCCTCCCTGCCCCAGCC CAGTGCAGACTCCCCAGCCCCCTGGGTGTGC CATGGGCAGTGCGGGGCCCCGACTCCACTGAGTA

34_- 6 CCTGTGATGAGCTACATGGGGTGAAGCTGGAGCGAGAGGCTGGGAGGCGACTCGGAGCCCACGGTTGGAGGATGGATTTCCCCAGGGACCCACACGTGCACCTCCACCTGTCTCCTGGACy 3 CCTGTGATGAGCTCCATGGGGTGAAGCTGGAGCGAGAGGCTGGGAGCCGACTGGGAGCCCGCGGCTGGAGGATGGATTTCCCCAGGGACCCACACGTACACCTCCACCTGTCTCCTGGACy CCCATTATGAGCTCCATGGGGTGMGCCGGAGCCAGMGCTGGGAGCCGACTGGG--CCTGCGGCTGGAGGATGGATTTCCCCAGGGACCCACACGTGCACCTCCACCTGTCTCCTGGAC

w-6 ATTGTCTCTGAGGGCAGGGCTGGTGCCAGCTCAGGGATCCAGCAGGGACAGMGGGCGGGCCGGGTCCATGTGGAGAGCACATTTAGTGGGAGGGAC CTTGTACCCAGCAGCCCCCy 3 GTCTCTCTGAGGGCAGGGCTGGTGCCAGCTCAGGGATCCAGCAGGGACAGMGGGCGGGCCGGGTCCTTGTGGAGAGCACATTTAGTGGGAGGGAC GATCCCCTCACMGTGTCCy ATTCTCTCTGAGGGCAGGGCTGGTGTCAGCTCAGGGATCCACCAGGGACACMGGGTGGGCCGGGTCCTTGTGGAGAGCACATTTAGTGGGA GATCCCTTCA-AAGTGTCC

BamHl ay

CCTGGATGCTTCCTGTTCCATC consensus sequence

33 TGGGAGGGACATGATTTCCCCTCACAAGTGTCCATT --- CTTCCTGTTCCTTG333 CTGGACGCTTCCTCTTCCATT

Y3 CTGGACACTTCCTGTGCGACA CCTCCTCGGGCTTT-------CCCGAGCCCTCTGGCCTCATTCCGTTCCCTGCTACC

34 TGGGAGGGACATGATTTCCCTTCA-MGTGTCCATT CTGGATGCTTCCTGTTCCACG04eCTGGACACTTCCTGTTCCACG

CTGGACGCTTCCTGTTCCACGCTTGACGCTTCCTGTTCCACGCTTGACGCTTCCTGTTCCATGCTGGATGCTTCCTGTTCCATGCTGGACATTTCCTGTTCCACTCTGGATGCTCCCTGTTCCATTCTGGATGCTTCCTGTTCCATGCTGGACATTTCCTGTTCCACTCTGCATGCTTCCTGTTCCACTCTGGATGCTTCCTGTGCGA_ CCTCCTCGGGCTTTTGGTCTGCCCAGTCCCTCTGGCTGCATCTCGTCCCCCGCTACC

Y 3 TCCCACTTCCACGTACGTCCTTGCC CAGCTCTTCCCTCTATC CAGAGCTTCTGCCTGGCAAGGTCCCTGCTGAGATCAGTCCAGGCTCCCCCAGCAvCAGGTAGGAGCCTTGCACATGCCC-Y4 TCCCACCTCCACATCCGTCCTTGCCCAGCTCCTCTCTCTCTCCAGAGTTTCCACCTGGCAAGGTCCCTGATGAGCTCAGTCCAGGCTCCCCCAGCACAGGTAGGAGCCTAG.CACCTGCCC

~~**** * ** *'Y3 TTGGACCTCCCCACCCTGCATGATGCCAGCATCCCCAGGCCCCAGGGAGGCCCCATTTCTCTCTCTGCTGGTAGTCCAGTGGCCCTGGAGTCCCACTGCAGGTGG;GGTGTGCCCCTGAACY4 TTGGACCTCCCCACCCTGCATGATGCCAGCATCCCCAGGCCCCAGGGAGGCCCCATTCTCTCTCTACTGCTGGCCCAGTGGCCCTGGAGTCCCACTGCAACTCGGCTGTGCCCCTGACC

y 3 TCTGAGGAAGCTAAGTACCCTGCCCTCAGACAGGCTATCCCCCCTGCTCAGCCCCAGGGCCCTGCCCCCTACCCCTTCCCCTCACCTGCACCACAGG;CTCTGGCCAACTCTTCCCAGGCCY 4 TCTGAGGAAGTTAAGTGTCCTGTCCCTAGC CAGGCTATCCCCTCTGCTCAGCCCCAGGGCCCTGCCCCTTACCCCTTCCCCTCACCTGCACGATAGGCTCTGGCCAACTCTGCCCAGGCC

Y 3 CTGAATGGGCCCCTCTGGCTCCCCTCTGCTGCTACACTGCCCTGCACCACCTCCACTCAGCTTCAGTGTGTTCATCCGCCTGTCCCACGTCCCCTCGGCCCCCAGGAGCACAGCTGGTGGy 4 CTGAATGGGCCCCTCTGGCTCCCCTCTGCTGCTACACTGCCCTGCACCACCTCCACTCAGCTTCAGTGTGTTCATCCACCTGTCCCACGTCCCCTCGGCCCCCAGGAGCACAGCTrGGTrGG

y 3 CCCTGGCTCCTCGCAGCCCATCTTGTTCCTTCTGGAGCACCAGCCTCAGAGGCCTTCCTGTGCAGGGTCCACTCGGCCAGCCCTGGGACCCTCCTGGTCTCAAGCACACACATTCTCCCT'Y4 CCCTGGTTCCTGGCAGCCCATCTTGTTCCTTCTGGAGCACCAGCCTCAGAGGCCTTCCTGTGCAGGGTCCACTCGGCCAGCCCTGGGACCCTCCTGGTCTCAAGCACACACGTTCTCCCT

Y 3 GCAGCCAGACCTGCCCCTGCCTGTGAGTTCAGACCTGAGCCTTGGAACGCCTTCCCTTCTCCATCCCAGCTCGCCTTGCCAGCTGCTCAGCAGGATGAACTCACACTCCCCTCCCTGCA'y4 GCAGCCAGACCTGCCCCTGCCTGTGAGTTCAGACCTGAGCCTTGGAACGTCTTCCCTTCTCCATCCCAGCTCGCCTTTGCCAGCTGCTCAGTGGGATGAACTCACACTCCCCTCCCTGCA

YI CCATGAGTGAGAGTCAGCTGGAGAGATGCCCAGGCAAAGCAGCCACCAGGGCCCAGTGGGGG-CCAGAAGCTT34

HindIII

9502


Nucleotide sequences upstream of C and C4 genes- ~~~~~-y3--y4

We determined the nucleotide sequences of the ay3- and a 4-containingregions in clones 2 and 1, respectively. Figure 2 shows the nucleotide

sequences of the EcoRI-HindIII fragments containing a 3 and a 4 indicated

in Figure lb and lc, respectively. The upstream regions of C 3 and Cy4genes are highly homologous to each other until 7 kb from the 5' ends of

Cy-coding sequences. The 1166-nucleotide-long DNA from AAATCT to GGGACA

in clone 2 and the 960-nucleotide-long DNA from TTTCTC to GGGACA in clone

1 were homologous to the DNA in p-6 intron (24)( Fig. 2B ). The

polarities of the sequences embedded in the chromosome are opposite

between E and a . The sequences further upstream of a regions are

different between y3 and y4 (Fig. 2A). The 5'-flanking sequence of a3

is relatively rich in A and T residues and contained a sequence repeated

three times. In that of ay4, however, there is no such repeating

sequence. On the other hand, the sequences downstream of both a 3 and

ay4 regions are very similar and, moreover, the characteristic 21 bp-

repeating sequences can be seen ( Fig. 2C ).

Presence of tRNA-like secondary structure in upstream regions of both

human and mouse C genes and the complementary sequences in p-6 introns

The complete DNA sequence between p and 6 genes of murine Ig has been

determined (22). Using the published data, we tried to find a sequence

homologous to a region in mouse p-6 intron. Unlike the human genome,

however, we could not find one in the murine genome. Souther^n

hybridization of mouse genomic DNA with the mouse p-6 intron DNA as a

probe gave only one band ( data not shown ). Therefore, "SIGMA"

structure has evolved only in the human genome. How and why did the

insertions of two DNA segments : a and a into the p-6 intron occur ?

Figure 2. Nucleotide sequences of EcoRI-HindIII fragments containing aY3and aY4 regions. A. Nucleotide sequences of upstream regions of aY3and aY4Y Sequences repeated three times were found in upstream of a .B. Comparison of nucleotide sequences among , aa and 0Y4Y Thesequence between P-6 intron was referred from the published data (24),and shown in the opposite direction. Nucleotides that are different aremarked by asterisks and underlined. Bars indicate missing nucleotides.Boundaries between homologous and non-homologous sequences are shown byvertical lines. TATA-like sequence (35), octamer-like sequencerequired for expression of Ig genes (36), and sigma gamma core sequenceare boxed ( see RESULTS AND DISCUSSION ). C. Nucleotide sequencesdownstream of aY and aY. The 21-bp repeats are aligned, and theconsensus sequence is written.

9503


a b 5' 3'A \ /c C-Gc U-A

iC AcU2AC- CIG-C CGC

G-CAUAA-CCAX cUU

Figure 3. Cloverleaf structure formed by tRNA and human sigma gamma coresequence. (a) Secondary structure of chioroplast tyrosyl tRNA (26).(b)Possible secondary structure of a putative transcript of human sigmagamma core sequence. Nucleotides that are the same between (a) and (b)are boxed. GGGU-.#t-GCCC in (a) and CCCA-& -UGGG in (b) in the upper stemregion are also boxed.

We compared the sequence organization of human and mouse l-6 introns

(22, 24) . In human, there are three kinds of repeating sequences: 2 X 49

bp repeats, 3 X 35 repeats and 2 X 63 repeats. Although 49 bp or 35 bp

are repeated in tandem, 63 bp repeats are found at different loci. One

of the 63 bp repeating sequences is found from 4677 to 4739 in the DNA

(4280-5435) homologous to oy and the other 63 bp sequence exists in the

other region ( 6900-6962 ). The degree of the difference between the two

repeating sequences is much higher than that between Z and o . This

indicates that one of the 63 bp repeating sequences ( 6900-6962 ) had

existed in the p- intron before the insertion of oJ sequence into the

i- 6 intron occurred . We succeeded in finding the DNA homologous to the

63 bp sequence in the mouse p-6 intron (22) . Richards et al. (22)

described the presence of an open reading frame ( 3461-3898 ) possiblEyiencoding 146 amino acids in the mouse p-6 intron. This open reading

frame has a palindromic structure (3519-3680 versus 3936-4097) . The 63

bp sequence is homologous to this mouse sequence (3593-3650). The degree

of homology ( 40/58=69% ) is too high to be explained simply as a

coincidence. Tentatively, we refer to the sequence complementary to

these 63 nucleotides as "sigma gamma core "sequence .

Since the size of the sigma gamma core sequence is similar to that of

tRNA, we tried to construct a possible secondary structure Of this core

9504


sequence. Strikingly, an approximately 80 nucleotide sequence including

the sigma gamma core forms a tRNA-like structure, as shown in Figure 3b.

We compared it with the published sequence of tRNA genes ( reviewed by

Sprinzl et al.(26)), and found that both the primary sequence and

secondary structure of tyrosyl-tRNA of chloroplasts are very similar to

those of the sigma gamma core ( Fig. 3ab ). This finding suggests that

the origin of sigma gamma core sequence might be a tRNA gene.

If the sigma gamma core sequence plays a role in expression and/or

construction of Ig CH chain genes, a similar structure is expected to

reside somewhere upstream of mouse C genes as well. In order to

examine this possibility, we carried out Southern hybridization of clone

MEP12 containing y2b-y2a intron (15) with a chemically synthesized 66-mer

as described in MATERIALS AND METHODS. A few different regions in mouse

y2b-y2a intron gave positive signals to this probe. Since the 860

nucleotide-long BamHI-HindIII fragment located 10 kb upstream of C 2 gene

gave the strongest signal, we determined the nucleotide sequence of this

fragment (Details will be published elsewhere). A 69 nucleotide-long

region, which has a partial complementarity to the 66 mer, can form a

tRNA-like secondary structure. This indicated that there are tRNA-like

structures in upstream regions of C genes and the complementary sequences

in p-6 intron in both the mouse and man. Further structural analyses

will be necessary to form the definitive conclusion.

Highly Palindromic Nature of a Sequence

When the nucleotide sequences of different species, such as the mouse and

man, are compared, homologous sequences may sometimes be seen outside the

coding regions. These kinds of homologous sequences are indicative of

functional significance. In the case of the Ig gene system, sequence

homology has been observed in the enhancer sequence for transcription (11)

and the S sequence for H chain class switch (5). The a region in the

mouse and man is also highly homologous (22, 27, 28), although the

biological meaning of this homology has not been determined yet.

However, we noticed that the DNA of a and the neighboring region are

highly palindromic. This may not be accidental, reflecting some unknown

function, because the nucleotide sequences and their palindromic nature

are conserved in both the murine and human systems. Since the a regions

are contained in primary transcripts started from promoters located

upstream of VHDHJH genes, they should form a highly folded structure.

9505


Presence of tRNA-like secondary structure in both mouse and human P-6

introns and the complementary sequences in a regions

As mentioned above, there are several repeating sequences in the p-6

introns (22, 24). In mouse, 76 bp sequences were repeated twice at

different loci. One of them is embedded from 2845 to 2920 and the other

from 3663 to 3737, located at the middle of the 146 amino acid open

reading frame. Differences between these two sequences exist only at

two nucleotides. In human, the 81 bp sequence from 5483 to 5563 is

similar to these 76bp sequences. Although the homology is not as high,

the possible secondary structures of the putative primary transcripts of

these regions are similar to each other. Both can form stem-loop

structures of tRNA. We refer to these sequences as "sigma delta core".

We looked for sequences complementary to the sigma delta core sequences in

iH- p introns. In both human and mouse, such complementary sequence

exists in the a region: in human, 814-825 and 850-865 in Figure 3 of ref.

25 versus 5497-5512 and 5526-5537 in Figure 2 of ref. 24; in mouse, 383-

408 in Figure 5 of ref. 28 versus 2880-2895 or 3698-3712 in Figure 2 of

ref. 22. It should be pointed out that the complementary sequence is

located at anti-codon loop in the putative tRNA-like structure and that

the complementary partners in the a region is located in a possible stem-

loop structure.

Biological meanings of presence of tRNA-like secondary structure and the

complementary structure in primary transcripts

In summary, sigma gamma core sequence upstream of Cy gene can form tRNA-

like secondary structure, and that in ia-6 introns there exist regions

complementary to the above noted sigma gamma core sequences. Moreover,

the sigma delta core sequence in the putative primary transcripts of Wu-6

introns can form another tRNA-like secondary structure, and sequences

complementary to these tRNA-like sequences exist in a regions. What

does this mean?

As described in Introduction, in B cells expressing two isotypes such

as IgM and IgG simultaneously , DNA rearrangements have not been detected

in CH gene loci (9). Therefore, simultaneous expression of two

different isotypes is thought to be mediated by alternative RNA splicing

from a long primary transcript (10). In the case of IgM- and IgD- double

producing cells, alternative RNA splicing is thought to be responsible for

simultaneous expression of both p and 6 chains (29; 30, 31). A long

9506


primary transcript including both p and 6, however, has not been

identified as yet.

Recently, Akins and Lambowitz (32) showed that a mutant of Neurospora

crassa in tyrosyl-tRNA synthetase inhibits RNA splicing directly, and that

mitochondrial tyrosyl-tRNA synthetase is related to the activity that

splices mitochondrial group I introns in solution. Moreover, there are

several pieces of evidence that the introduction of secondary hybrid

structure in primary transcripts can cause alternative RNA splicing (33,

34).

In p- and 6- double producing cells, the complementary sequences in

o and p-6 intron may mediate to skip 11-coding exons for direct joining of

VH-DH-JH exon with 6-coding exons. The presence of complementary

sequences in a and p-6 intron, as well as in p-6 intron and upstream of

constant y genes may also be related to RNA splicing for y expression.

In p- and y-double producing cells, a long putative primary transcript

from VHDHJ to a y gene might form a hybrid structure, and presence of

tRNA-like secondary structure in the partners of the hybrids implies that

an aminoacyl-tRNA synthetase-like protein may be involved in RNA splicing.

The putative highly folded structure predicted in the a regions might be

related to such RNA splicing mechanism.

G region has promoter activity for in vitro transcription by RNA

polymerase III

Since the distances between VHDHJH genes and C genes are very long, in

addition to the tRNA-like structure possibly formed by the sigma gamma and

delta core sequences, various other kinds of secondary structure might be

formed in primary transcripts including the total regions from VHDHJH to

C genes. If tRNA-like structures in the sigma gamma and delta coresY

function in RNA splicing, how can they be discriminated from other

regions? In a regions, we found a TATA-like sequence: TATAAAT (35) at

300bp upstream of the above 63bp sequence, and also an octamer-like

sequence : TTTTGCAT, which is required for expression of Ig genes (36)

exists 63bp upstream of TATA-like sequence ( Fig. 2B ). To test whether

this region works as a promoter for transcription we prepared

transcription mixtures from Hela extracts according to the procedure

described by Dignam et al. (22). As shown in Figure 4, three major

transcripts were detected in the products from the EcoRI-HindIII fragments

containing a 3 and a 4 connected to pUC9 vector. Strikingly, the

9507


b c di1 2 3 4 1 2 3 4 1 2 3 4 3

250,

8-fl2000_ i 0 _.- .T

1400)~Zrei- -1150_

970.rs--1110

N~~~~~~~~~~~~~~~~~~

N~~~~~~~~~

Figure 4. Size analysis of RNA products synthesized by in vitrotranscription mixture. Nuclear extracts were prepared from Hela cellsas protocol described by Dignam et al. (23), using essentially the samereaction cocktails. The concentration of DNA templates is 50 mg/ml.Templates are (a)BamHI-digested pSG4; (b)BamHI-digested pSG3; (c)RNApolymerase I promoter-containing DNA kindly supplied by Dr. M.Muramatsu(Tokyo University); (d)Adeno VA DNA containing promoter for RNA polymeraseIII; (e)HindIII-digested pSG3; (f)HindIII-digested pSG4. Concentrationsof a~-amanitin varied. (a-d)l. no; 2. 1 Y/ml; 3. 50 Y/ml 4. 25D Y/ml.(e,f) no. After incubation, RNA was extracted with pheno-chloroiJorn,glyoxalated and analyzed by 1.8% agarose gel electrophoresis. DNAs usedas size markers were also glyoxalated. N indicates nucleotide-long. Wejudged that B-I to B-V and H-I to H-V are run-off products from thepromoter described in the text except for B-II.

transcription seems to be mediated by RNA polymerase III. The synthesis

of these RNAs was inhibited byc-amanitin at 50 y/ml, but not at 1 y/ml.Them ensitivities to) a-amanitin are the same as expected for RNA

polymerase III ( Fig. 4d ), not for RNA poymerase I ( Fig. 4c )or II

( sensitive at 1 y/ml, data not shown ). Althoughipt is known that RNA

polymerase III terminates at T cluster and the average size of the

products is relatively short ( reviewed by Sollner-Webb (37); ex. Fig.4d),the run-off products inao - andoate - containing fragments are much

longer. Judging from the sizes of run-off products in BamHI-(Fig.4ab),

HindIII-( Gig. 4ef ) and Pstl-( data not shown ) digested DNAs, we roughlyestimated the location of promoter sites. One of the promoters is

located at 230 bp upstream of sigma gamma core, which is common to y(B-p, H-Ila and a (B-I, H-Ill), another is at 60 bp upstream of a o3( II,H-IV) and at 400 bp upstream of e(H-V), and the other is in pUC9

vector(u-IV, B-V, H-I). When pUC vector itself was used asa template,

9508


only one transcript was detected ( data not shown ). The 970

nucleotide-long RNA indicated as B-II ( Fig. 4a ) must be the product of

end-to-end synthesis of a BamHI fragment (38). Origins of 1400

nucleotide-long RNA ( Fig. 4b ) and a few other minor bands are not known.

Recently, Lutzker and Alt (39) identified a truncated C 2b transcript in

A-MuLV transformants. The initiation site for such a "sterile"

transcription has been mapped 2 kb 5' to the S 2b region. Although

further analyses are necessary to determine the exact promoter sites and

to examine the promoter activities in vivo, our results suggest that

simultaneous expression of two different isotypes could be mediated by

discontinuous transcription followed by trans-RNA splicing. The presence

of trans-splicing pathway has been indicated in the rps 12 gene of

chloroplast (40, 41). The tRNA genes are encoded at multiple sites in

the chloroplast genome (42, 43). Some of the tRNA genes might be

involved in trans-splicing. The reason for the similarity of human sigma

gamma core sequence to the tRNA sequence of chloroplast, which would seem

to be evolutionarily very different, could be explained by similarities of

potential functions.

ACKNOWLEDGEMENTSWe are grateful to Dr.S.Ohno for critical reading of the manuscript.

We thank Drs.L.Hood, P.Leder, S.Tonegawa, T.Maniatis and M.Muramatsu forproviding us clones 5A, 5D, CH4-38, CH4-51, MEP12, human DNA library andRNA pol-nmerase I promoter, respectively. We also are gratefui toDrs.T.Okazaki, Y.Takagi, I.Ishiguro and K.Fujita for their encouragementand to Ms. A.Nagata for preparation of the manuscript. This work wassupported in part by grants from the Ministry of Education, Science andCulture of Japan, and Fujita-Gakuen Health University, Japan PrivateSchool Promotion Foundation and the Uehara Science Foundation.

Present address : Department of Immunology, Chiba University, School ofMedicine, Chiba, Japan ( K.I. ). Department of Immunology, AtomicDisease Institute, Nagasaki University School of Medicine, Sakamoto-cho,Nagasaki, Japan ( M.A. ). Mitsubishi-Kasei Institute of Life Science,Machida, Tokyo, Japan ( K.K ).

REFERENCES1. Honjo,T. (1983) Ann.Rev.Immunol. 1, 499-528.2. Flanagan,J.G. and Rabbitts,T.H. (1982) Nature 300, 709-713.3. Lefranc,M-P., Lefranc,G. and Rabbitts,T.H. (1982) Nature 300, 760-

762.4. bech-Hansen,N.T., Linsley,P.S. and Co,D.W. (1983) Proc.Natl.Acad.Sci.

USA. 80, 6952-6956.5. Kataoka,T., Miyata,T. and Honjo,T. (1981) Cell 23, 357-368.6. Tonegawa,S. (1983) Nature 302, 575-581.

9509


7. Honjo,T. and Kataoka,T. (1978) Proc.Natl.Acad.Sci.USA. 75, 2140-2144.

8. Sakano,H., Huppi,K., Heinrich,G. and Tonegawa,S. (1979) Nature 280,288-294.

9. Chen,Y-W., Word,C., Dev,V., Uhr,J.W., Vitett,E.S. and Tucker,P.W.(1986) J.Exp.Med. 164, 562-579.

10. Yaoita,Y., Kumagai,Y., Okumura,lI. and Honjo,T. (1982) Nature 297,697-699.

11. Gillies,S.D., Morrison,S.L., Oi,V.T. and Tonegawa,S. (1983) Cell 33,717-728.

12. Davis,M.M., Kim,S.K. and Hood,L.E. (1980) Science 283, 1360-1365.13. Ravetch,J.V., Siebenlist,U., Korsmeyer,S., Waldmann,T. and Leder,P.

(1981) Cell 27, 583-591.14. Ellison,J. and Hood,L. (1982) Proc.Natl.Acad.Sci. USA 79, 1984-1988.15. Roeder,W., Maki,R., Traunecker,A. and Tonegawa,S. (1981)

Proc.Natl.Acad.Sci. USA.78, 474-478.16. Takahashi,N., Ueda,S., Obata,M., Nikaido,T., lakai,S. and Honjo,T.

(1982) Nature 302, 575-581.17. Lawn,R.M., Fritsh,E.F., Parker,R.C., Blake,G. and Maniatis,T. (1978)

Cell 15, 1157-1174.18. Sakano,H., Rogers,J.H., Huppi,K., Brack,C., Traunecker,A., Maki,R.,

Wall,R. and Tonegawa,S. (1979) Nature 277, 627-633.19. Benton,W.D. and Davis,R.W. (1977) Science 196, 180-182.20. Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc.Natl.Acad.Sci.USA.

74, 5463-5467.21. Wahl,G.M., Stern,h4. and Stark,G.R. (1979) Proc.Natl.Acad.Sci.USA.

76, 3683-3687.22. Richards,J.E., Gilliam,A.C. Shen,A., Tucker,P.W. and Blattner,F.R.

(1983) Nature 306, 483-487.23. Dignam,J.D., Lebovitz,R.M. and Roeder,R.G. (1983) Nuc.Acids Res. 11,

1475-1489.24. Milstein,C.P., Deverson,E.V. and Rabbitts,T.H. (1984) Nuc.Acids Res.

12, 6523-6535.25. Mills,F.C., Fisher,L.M., Kuroda,R., Ford,A.M. and Gould,H.J. (1983)

Nature 306, 809-812.26. Sprinzl,M., Vorderwulbecke,T. and Hartmann,T. (1985) Nuc.Acids Res.

13, suppl. r51-rlO4.27. Rabbitts,T.H., Forster,A., Baer,R. and Hamlyn,P.H. (1983) Nature

306, 806-809.28. Sakano,H., Maki,R., Kurosawa,Y., Roeder,W and Tonegawa,S. (1980)

Nature 286, 676-683.29. Maki,R., Roeder,W., Traunecker,A., Sidman,C., Wabl,M., Raschke,W.

and Tonegawa,S. (1981) Cell 24, 353-365.30. Moore,K.W., Rogers,J., Hunkapiller,T., Early,P., Nottenberg,C.,

Weissman,I., Bazin,H. and Hood,L.E. (1981) Proc.Natl.Acad.Sci.USA.78, 1800-1804.

31. Blattner,F.R. and Tucker,P.W. (1984) Nature 307, 417-422.32. Akins,R.A. and Lambowitz,A.M. (1987) Cell 50, 331-345.33. Solnick,D. (1985) Cell 42, 157-164.34. Solnick,D. (1985) Cell 43, 667-676.35. Corden,J., Wasylyk,B. Buchwalder,A., Sassone-Corsi,P., Kedinger,C.

and Chambon,P. (1980) Science 209, 1406-1414.36. Parslow,T.G., Blair,D.L., Murphy,W.J. and Granner,D.K. (1984)

Proc.Natl.Acad.Sci.USA. 81, 2650-2654.37. Sollner-Webb,B. (1988) Cell 52, 153-154.38. Manley,J.L., Fire,A., Samuels,M. and Sharp,P.A. (1983) Methods in

Enzymol. 101, 568-582.

9510


39. Lutzker,S. and Alt,F.W. (1988) Mol.Cell.Biol. 8, 1849-1852.40. Koller,B., Fromm,H., Galun,E. and Edelman,M (1987) Cell 48, 111-119.41. Hildebrand,M., Hallick,R.B., Passavant,C.W. and Bourque,D.P. (1988)

Proc.Natl.Acad.Sci.USA. 85, 372-376.42. Ohyama,K., Fukuzawa,H., Kohchi,T., Shirai,H., Sano,T., Sano,S.,

Umesono,K., Shiki,Y., Takeuchi,M., Chang,Z., Aota,S., Inokuchi,H.and Ozeki,H. (1986) Nature 522, 572-574.

43. Shinozaki,K., Ohto,C., Torazawa,K., Meng,B.Y., Sugita,M., Deno,H.,Kamogashira,T., Yamada,K., Kusuda,J., Takaiwa,F., Kato,A.,Tohdoh,N., Shimada,H. and Sugiura,M. (1986) EMBO J. 5, 2043-2049.

9511

Documents

Nucleic Research - ncbi.nlm.nih.gov