Click here to load reader

Nucleic Research - ncbi.nlm.nih.gov

  • View
    0

  • Download
    0

Embed Size (px)

Text of Nucleic Research - ncbi.nlm.nih.gov

Volume 16 Number 20 1988 Nucleic Acids Research
Sigma region located between C,, and C6 genes of human immunoglobulin heavy chain: possible involvement of tRNA-like structure in RNA splicing
Yasushi Akahori, Hiroshi Handal, Kenji Imai, Masumi Abe, Kohzoh Kameyama, Makoto Hibiya, Hisashi Yasui, Kazuhiko Okamura, Morihiro Naito, Hiroshi Matsuoka2 and Yoshikazu Kurosawa
Institute for Comprehensive Medical Science, Fujita-Gakuen Health University, Toyoake, Aichi 470-11, 'Department of Bacteriology, Tokyo University School of Medicine, Hongo, Bunkyo-ku, Tokyo 103 and 2Department of Pediatrics, Nagoya University School of Medicine, Tsurumai, Showa-ku, Nagoya 466, Japan
Received August 2, 1988; Revised and Accepted September 19, 1988 Accession nos X12842, X12843
ABSTRACT Noncoding regions within the cluster of immunoglobulin heavy chain
constant genes in the human genome contained a number of repeats. In the P-6 intron, two repeating units were contained. One 442-base-long fragment located JH- intron ( defined as "sigma i(op)") occupied the position in the p-5 intron. The other 1166-base-long fragment located somewhere in front of S (class switch) region of Cy gene was also found in the p-6 intron. We defined the repeats in the p-6 intron as "SIGMA (E)". The polaxities of the longer repeats in the genome were opposite between the p-6 intron and the upstreams of Cy genes. These inverted copies (deiined as Gy3 and 0y4), located 6 kb upstream of their respective Cy's, were apparently transcribed in vitro, via RNA polymerase III and transcripts should have contained tRNA-like structures. Small DNA fragments capable of encoding tRNA-like structures were also found in corresponding regions of mouse Ig Cy cluster.
INTRODUCTION
Immunoglobulin (Ig) heavy (H) chain genes on human chromosome 14 are
organized into the following gene clusters: VH, DH1 JH and constant(CH) (For a review see ref.1). The order of the CH genes is p-6-y3-yl-*P-al- *y-y2-y4-c-a2 (2, 3, 4). Characteristic repetitive sequences referred to
as class switch(S) sequences (5) exist upstream of each CH gene; only
exception being C . During B cell ontogeny, these genes undergo two
kinds of DNA rearrangements: DH-JH and then VH-DH joinings (For a review
see ref.6 ), resulting in the formation of a complete H chain gene;
subsequently, p-class H chain gene undergoing class switch via
recombination between two S sequences; e.g., S of p and S of y1 (7).
Both rearrangements usually involve the loss of intervening sequences (7,
8). However, aside from the classical switch via S-S recombination, there
have been reports of B cells expressing two isotypes such as IgM and IgG
(9). In these instances, DNA rearrangements have not been detected in CH
gene loci. Accordingly, simultaneous expression of two different
© JR L Press Limited, Oxford, England. 9497
Nucleic Acids Research
isotypes is thought to be mediated by alternative RNA splicing from an
extreamly long primary transcript (10).
While trying to find new DH gene families utilizing a JH-containing fragment as a probe, we identified an unexpected DNA segment on human
germline genome. Apparently, a copy of the DNA segment located between
the enhancer (11) and the S sequence (12) upstream of C gene has become
inserted into the p-6 intron. Moreover, one more DNA fragment seemingly
derived from somewhere upstream of one of the C genes was embedded in
the p-6 intron. We determined the nucleotide sequences upstream of C 3
and Cy4 genes. By comparison of nucleotide sequences of JH- introns,
i-6 introns and upstream of y genes between human and mouse, we suggest a
possible mechanism of alternative splicing of primary transcripts for
expression of two isotypes. We also identified a promoter activity for
transcription by RNA polymerase III upstream of constant y genes, and
discuss the possibility of discontinuous transcription followed by trans-
RNA splicing.
Clones CH4-38 and CH4-51 containing human C gene (13), were
provided by P.Leder ( Harvard Medical School ). Clones 5A and 5D
containing human C 2 and C 4 (14), respectively, were provided by L.Hood
( Cal Tech ). Clone MEP12 containing mouse y2b-y2a intron (15) was
donated by S.Tonegawa ( MIT ). To prepare a human C 1 probe, the 6 kb
HindIII fragment containing C 1 gene (16) was isolated with mouse C 1
gene as a probe. The human genomic library (17) was donated by T.Maniatis
( Harvard University ). Clone ARAJH1 was isolated by the ordinary
cloning procedure as described by Sakano et al. (18). Clones 1, 2, 3
and 6 were isolated by screening the Maniatis' human genomic library with
ARAJH1 probe according to Benton-Davis' method (19). Nucleotide sequence
was determined by the chain termination technique of Sanger et al.
(20), using Bluescript M13 vectors ( STRATAGENE ). Southern
hybridization was carried out by the published procedure (21). A 66 mer:
5'-CACACATGGCAGTTTGAGCAGCAGAACTCTGTTCTTTCCCAGTTCTAGAGGCCAGAAGTGTGGGCC-3',
which corresponds to 3589-3654 in Figure 2 of the paper by Richards et
al.(22), was chemically synthesized by DNA synthesizer ( Applied
Biosystems Inc.). In vitro transcription mixture was prepared from Hela
cells according to the procedure described by Dignam et al. (23). As DNA
9498
templates, the EcoRI-HindIII fragments containing ay3 and a 4 were
recloned in pUC9, resulting in pSG3 and pSG4, respectively.
RESULTS AND DISCUSSION
Identification of Sigma(E) region
With JH gene-containing probe ( JH probe ) as shown in Figure la, we
identified a very faint band at 3.8 kb, in addition to the germline band
I__ E:___IE-
a
t
v ~v %V IV I - v~~~-- (J'H - probe) (probe 1) (probe 2) (probe 3)
v V Clone 3
Umimd~ ARAJH 1
CYS3
b s v v I*l v CSt |C3 1 v I a
V*vvvv 11111111111 Clone 2
°14
I SF21 I C,2 I 1*1 I SF4 I-C4 (probe 4)
ikb i 1 v Clone I
Figure 1. Physical maps of the human immunoglobulin heavy chain constant gene loci and the clones (thick line) isolated in this study : ARAJH1, clones 1, 2, 3, 6. Details of cloning process are described in the text. In brief, ARAJH1 was first isolated by homology to J probe. Clones 1, 2, 3 and 6 were isolated from Maniatis' human phage Yibrary ( 17 ) with thte 3.8 kb insert of ARAJH1 as the probe. Clone 3 was a JH gene- containing clone. Clone 6 covered from the downstream of J gene cluster to 5' end of C6 genes. Clone 2 covered the upstream region of Cy3 gene. Clone 1 covered from Cy2 to the upstream of C 4 gene. aY ' ay4 and their homologous region in E are indicated by box with thick black arrows, and oy and its homologous region in £ by black box with thick white arrows. Direction of arrows indicates sequence polarity. Probes used in this study are indicated. The EcoRI-HindIII fragments containing CYY3 and 0Y4 indicated by horizontal double arrows were sequenced in this study. Restriction enzymes : Y HindIII, V EcoRI, + BamHl. Restriction sites of regions are not covered by the above clones are referred from published papers ( 2, 13, 14 ).
9499
Nucleic Acids Research
at 10 kb in HindIII-digested placenta DNA, cloned the 3.8 kb band, and
named it ARAJH1. In Southern hybridization of HindIII-digested placenta
DNA with the 3.8 kb DNA of ARAJH1 as the probe, six bands: 10 ( double ),
8, 4.5 and 3.8 kb ( double ) were detected ( date not shown ). We
screened a human DNA phage library provided by T.Maniatis (17) using the
3.8 kb DNA as the probe. Restriction maps of the four kinds of clones
obtained are shown in Figure 1. The 3.8 kb-containing clone was named
clone 6, and a JH gene-containing clone was named clone 3. The other two
clones, 1 and 2, are different. Homologous regions to the 3.8 kb probe
in clones 1 and 2 were mapped by Southern hybridization as shown in Figure
lbc. Clones 1 and 2 contained, respectively, 10 and 4.5 kb HindIII
fragments detected by the probe. The size of the HindIII fragment
containing JH region was also 10 kb. We compared the restriction maps
of clones 1, 2 and 6 with the published maps of Ig CH gene loci (2, 13,
14) and noticed that the maps of clones 1, 2 and 6 almost the same as
those of the upstream regions of C 4 and C 3 genes and p-6 intron,
respectively. Comparison of restriction maps among clones 6, CH4-38 and
CH4-51 (13) indicated that they have overlapping regions ( data not
shown ). The complete nucleotide sequence of the region from p to 6 was
published by Milstein et al. (24). Strikingly, the 442-nucleotide-long
sequence in p-6 intron ( from 6387 to 6828 in Figure 2 of the 1984 paper
by Milstein et al.(24)) was 97% homologous to the downstream of JH gene
( from 661 to 1102 in Figure 3 of the 1983 paper by Mills e- al.(25)).
Independently, we determined the nucleotide sequence of the relevant
region in clone 6, with the same results. Comparison among clones 1, 5A
and 5D (14), and Southern hybridization of clones 1 and 2 DNAs with human
C 1 probe indicated that clones 1 and 2 were located upstream of C 4
and C 3 genes, respectively ( data not shown ). Figure 1 shows the
location of clones 1, 2, 3 and 6 in the CH chain gene loci and their
physical maps. Southern hybridization of genomic DNA with probes 1 and 3
showin in Figure la detected only those fragments themselves ( data not
shown ). Probe 4 shown in Figure lc was prepared from clone 1, anid
Southern hybridization of HindIII-digested DNA was carried out. All the
bands ( 10, 8, 4.5 and 3.8 kb ) detected by ARAJH1 probe were also
detected by probe 4. All these fragments clearly contained regions
highly homologous to each other. Very recently we isolated two more DNA
fragments corresponding to the 8 kb band and one of the 3.8 kb bands, and
found that they are located upstream of C 1 and Cy2' respectively (data
9500
Nucleic Acids Research
not shown ). Thus, in the p-6 intron two DNA fragments were inserted :
one derived from JH-p intron and the other from upstream of C gene.
We refer to the region in the p-6 intron containing the two DNA fragments
as "SIGMA" ( E ) region and the regions upstream of C , Cy3 and C 4 genes
homologous to SIGMA region as small sigma i, y3 and y4 (Coy, ay3 and cy ),
respectively.
GETTCTATTCTGCCATGAAAGATGAATCTTGTCATCTGAGGTACATGGATGAGCTTGGAGGACATGTTAGTGAATAAGCTAGACACAGACAGCCAATATCACATGTTCTC ACTCATATATGGAAGCCAAATAAGTTGATCTCATAGAAATAGGGAGTAGAATAGTGGTAACCAGAGGCTGGGAATGGGAGGGGATAGGATAGCTAGAAGTCGATTAATAATAAAAATT
Y3 CTGGACACTTCCTGTGCGACA CCTCCTCGGGCTTT-------CCCGAGCCCTCTGGCCTCATTCCGTTCCCTGCTACC
Nucleotide sequences upstream of C and C4 genes - ~~~~~-y3--y4
We determined the nucleotide sequences of the ay3- and a 4-containing regions in clones 2 and 1, respectively. Figure 2 shows the nucleotide
sequences of the EcoRI-HindIII fragments containing a 3 and a 4 indicated
in Figure lb and lc, respectively. The upstream regions of C 3 and Cy4 genes are highly homologous to each other until 7 kb from the 5' ends of
Cy-coding sequences. The 1166-nucleotide-long DNA from AAATCT to GGGACA
in clone 2 and the 960-nucleotide-long DNA from TTTCTC to GGGACA in clone
1 were homologous to the DNA in p-6 intron (24)( Fig. 2B ). The
polarities of the sequences embedded in the chromosome are opposite
between E and a . The sequences further upstream of a regions are
different between y3 and y4 (Fig. 2A). The 5'-flanking sequence of a3
is relatively rich in A and T residues and contained a sequence repeated
three times. In that of ay4, however, there is no such repeating
sequence. On the other hand, the sequences downstream of both a 3 and
ay4 regions are very similar and, moreover, the characteristic 21 bp-
repeating sequences can be seen ( Fig. 2C ).
Presence of tRNA-like secondary structure in upstream regions of both
human and mouse C genes and the complementary sequences in p-6 introns
The complete DNA sequence between p and 6 genes of murine Ig has been
determined (22). Using the published data, we tried to find a sequence
homologous to a region in mouse p-6 intron. Unlike the human genome,
however, we could not find one in the murine genome. Souther^n
hybridization of mouse genomic DNA with the mouse p-6 intron DNA as a
probe gave only one band ( data not shown ). Therefore, "SIGMA"
structure has evolved only in the human genome. How and why did the
insertions of two DNA segments : a and a into the p-6 intron occur ?
Figure 2. Nucleotide sequences of EcoRI-HindIII fragments containing aY3 and aY4 regions. A. Nucleotide sequences of upstream regions of aY3 and aY4Y Sequences repeated three times were found in upstream of a . B. Comparison of nucleotide sequences among , aa and 0Y4Y The sequence between P-6 intron was referred from the published data (24), and shown in the opposite direction. Nucleotides that are different are marked by asterisks and underlined. Bars indicate missing nucleotides. Boundaries between homologous and non-homologous sequences are shown by vertical lines. TATA-like sequence (35), octamer-like sequence required for expression of Ig genes (36), and sigma gamma core sequence are boxed ( see RESULTS AND DISCUSSION ). C. Nucleotide sequences downstream of aY and aY. The 21-bp repeats are aligned, and the consensus sequence is written.
9503
iC AcU2AC- C IG-C CGC
G-CAUAA-CCAX cUU
Figure 3. Cloverleaf structure formed by tRNA and human sigma gamma core sequence. (a) Secondary structure of chioroplast tyrosyl tRNA (26). (b)Possible secondary structure of a putative transcript of human sigma gamma core sequence. Nucleotides that are the same between (a) and (b) are boxed. GGGU-.#t-GCCC in (a) and CCCA-& -UGGG in (b) in the upper stem region are also boxed.
We compared the sequence organization of human and mouse l-6 introns
(22, 24) . In human, there are three kinds of repeating sequences: 2 X 49
bp repeats, 3 X 35 repeats and 2 X 63 repeats. Although 49 bp or 35 bp
are repeated in tandem, 63 bp repeats are found at different loci. One
of the 63 bp repeating sequences is found from 4677 to 4739 in the DNA
(4280-5435) homologous to oy and the other 63 bp sequence exists in the
other region ( 6900-6962 ). The degree of the difference between the two
repeating sequences is much higher than that between Z and o . This
indicates that one of the 63 bp repeating sequences ( 6900-6962 ) had
existed in the p- intron before the insertion of oJ sequence into the
i- 6 intron occurred . We succeeded in finding the DNA homologous to the
63 bp sequence in the mouse p-6 intron (22) . Richards et al. (22)
described the presence of an open reading frame ( 3461-3898 ) possiblEyi encoding 146 amino acids in the mouse p-6 intron. This open reading
frame has a palindromic structure (3519-3680 versus 3936-4097) . The 63
bp sequence is homologous to this mouse sequence (3593-3650). The degree
of homology ( 40/58=69% ) is too high to be explained simply as a
coincidence. Tentatively, we refer to the sequence complementary to
these 63 nucleotides as "sigma gamma core "sequence .
Since the size of the sigma gamma core sequence is similar to that of
tRNA, we tried to construct a possible secondary structure Of this core
9504
sequence. Strikingly, an approximately 80 nucleotide sequence including
the sigma gamma core forms a tRNA-like structure, as shown in Figure 3b.
We compared it with the published sequence of tRNA genes ( reviewed by
Sprinzl et al.(26)), and found that both the primary sequence and
secondary structure of tyrosyl-tRNA of chloroplasts are very similar to
those of the sigma gamma core ( Fig. 3ab ). This finding suggests that
the origin of sigma gamma core sequence might be a tRNA gene.
If the sigma gamma core sequence plays a role in expression and/or
construction of Ig CH chain genes, a similar structure is expected to
reside somewhere upstream of mouse C genes as well. In order to
examine this possibility, we carried out Southern hybridization of clone
MEP12 containing y2b-y2a intron (15) with a chemically synthesized 66-mer
as described in MATERIALS AND METHODS. A few different regions in mouse
y2b-y2a intron gave positive signals to this probe. Since the 860
nucleotide-long BamHI-HindIII fragment located 10 kb upstream of C 2 gene
gave the strongest signal, we determined the nucleotide sequence of this
fragment (Details will be published elsewhere). A 69 nucleotide-long
region, which has a partial complementarity to the 66 mer, can form a
tRNA-like secondary structure. This indicated that there are tRNA-like
structures in upstream regions of C genes and the complementary sequences
in p-6 intron in both the mouse and man. Further structural analyses
will be necessary to form the definitive conclusion.
Highly Palindromic Nature of a Sequence
When the nucleotide sequences of different species, such as the mouse and
man, are compared, homologous sequences may sometimes be seen outside the
coding regions. These kinds of homologous sequences are indicative of
functional significance. In the case of the Ig gene system, sequence
homology has been observed in the enhancer sequence for transcription (11)
and the S sequence for H chain class switch (5). The a region in the
mouse and man is also highly homologous (22, 27, 28), although the
biological meaning of this homology has not been determined yet.
However, we noticed that the DNA of a and the neighboring region are
highly palindromic. This may not be accidental, reflecting some unknown
function, because the nucleotide sequences and their palindromic nature
are conserved in both the murine and human systems. Since the a regions
are contained in primary transcripts started from promoters located
upstream of VHDHJH genes, they should form a highly folded structure.
9505
Nucleic Acids Research
Presence of tRNA-like secondary structure in both mouse and human P-6
introns and the complementary sequences in a regions
As mentioned above, there are several repeating sequences in the p-6
introns (22, 24). In mouse, 76 bp sequences were repeated twice at
different loci. One of them is embedded from 2845 to 2920 and the other
from 3663 to 3737, located at the middle of the 146 amino acid open
reading frame. Differences between these two sequences exist only at
two nucleotides. In human, the 81 bp sequence from 5483 to 5563 is
similar to these 76bp sequences. Although the homology is not as high,
the possible secondary structures of the putative primary transcripts of
these regions are similar to each other. Both can form stem-loop
structures of tRNA. We refer to these sequences as "sigma delta core".
We looked for sequences complementary to the sigma delta core sequences in
iH- p introns. In both human and mouse, such complementary sequence
exists in the a region: in human, 814-825 and 850-865 in Figure 3 of ref.
25 versus 5497-5512 and 5526-5537 in Figure 2 of ref. 24; in mouse, 383-
408 in Figure 5 of ref. 28 versus 2880-2895 or 3698-3712 in Figure 2 of
ref. 22. It should be pointed out that the complementary sequence is
located at anti-codon loop in the putative tRNA-like structure and that
the complementary partners in the a region is located in a possible stem-
loop structure.
Biological meanings of presence of tRNA-like secondary structure and the
complementary structure in primary transcripts
In summary, sigma gamma core sequence upstream of Cy gene can form tRNA-
like secondary structure, and that in ia-6 introns there exist regions
complementary to the above noted sigma gamma core sequences. Moreover,
the sigma delta core sequence in the putative primary transcripts of Wu-6
introns can form another tRNA-like secondary structure, and sequences
complementary to these tRNA-like sequences exist in a regions. What
does this mean?
As described in Introduction, in B cells expressing two isotypes such
as IgM and IgG simultaneously , DNA rearrangements have not been detected
in CH gene loci (9). Therefore, simultaneous expression of two
different isotypes is thought to be mediated by alternative RNA splicing
from a long primary transcript (10). In the case of IgM- and IgD- double
producing cells, alternative RNA splicing is thought to be responsible for
simultaneous expression of both p and 6 chains (29; 30, 31). A long
9506
Nucleic Acids Research
primary transcript including both p and 6, however, has not been
identified as yet.
Recently, Akins and Lambowitz (32) showed that a mutant of Neurospora
crassa in tyrosyl-tRNA synthetase inhibits RNA splicing directly, and that
mitochondrial tyrosyl-tRNA synthetase is related to the activity that
splices mitochondrial group I introns in solution. Moreover, there are
several pieces of evidence that the introduction of secondary hybrid
structure in primary transcripts can cause alternative RNA splicing (33,
34).
In p- and 6- double producing cells, the complementary sequences in
o and p-6 intron may mediate to skip 11-coding exons for direct joining of
VH-DH-JH exon with 6-coding exons. The presence of complementary
sequences in a and p-6 intron, as well as in p-6 intron and upstream of
constant y genes may also be related to RNA splicing for y expression.
In p- and y-double producing cells, a long putative primary transcript
from VHDHJ to a y gene might form a hybrid structure, and presence of
tRNA-like secondary structure in the partners of the hybrids implies that
an aminoacyl-tRNA synthetase-like protein may be involved in RNA splicing.
The putative highly folded structure predicted in the a regions might be
related to such RNA splicing mechanism.
G region has promoter activity for in vitro transcription by RNA
polymerase III
Since the distances between VHDHJH genes and C genes are very long, in
addition to the tRNA-like structure possibly formed by the sigma gamma and
delta core sequences, various other kinds of secondary structure might be
formed in primary transcripts including the total regions from VHDHJH to
C genes. If tRNA-like structures in the sigma gamma and delta cores Y
function in RNA splicing, how can they be discriminated from other
regions? In a regions, we found a TATA-like sequence: TATAAAT (35) at
300bp upstream of the above 63bp sequence, and also an octamer-like
sequence : TTTTGCAT, which is required for expression of Ig genes (36)
exists 63bp upstream of TATA-like sequence ( Fig. 2B ). To test whether
this region works as a promoter for transcription we prepared
transcription mixtures from Hela extracts according to the procedure
described by Dignam et al. (22). As shown in Figure 4, three major
transcripts were detected in the products from the EcoRI-HindIII fragments
containing a 3 and a 4 connected to pUC9 vector. Strikingly, the
9507
Nucleic Acids Research
b c di 1 2 3 4 1 2 3 4 1 2 3 4 3
250,
1400)~Zrei- - 1150_
970.rs--1110
N~~~~~~~~~~~~~~~~~~
N~~~~~~~~~
Figure 4. Size analysis of RNA products synthesized by in vitro transcription mixture. Nuclear extracts were prepared from Hela cells as protocol described by Dignam et al. (23), using essentially the same reaction cocktails. The concentration of DNA templates is 50 mg/ml. Templates are (a)BamHI-digested pSG4; (b)BamHI-digested pSG3; (c)RNA polymerase I promoter-containing DNA kindly supplied by Dr. M.Muramatsu (Tokyo University); (d)Adeno VA DNA containing promoter for RNA polymerase III; (e)HindIII-digested pSG3; (f)HindIII-digested pSG4. Concentrations of a~-amanitin varied. (a-d)l. no; 2. 1 Y/ml; 3. 50 Y/ml 4. 25D Y/ml. (e,f) no. After incubation, RNA was extracted with pheno-chloroiJorn, glyoxalated and analyzed by 1.8% agarose gel electrophoresis. DNAs used as size markers were also glyoxalated. N indicates nucleotide-long. We judged that B-I to B-V and H-I to H-V are run-off products from the promoter described in the text except for B-II.
transcription seems to be mediated by RNA polymerase III. The synthesis
of these RNAs was inhibited byc-amanitin at 50 y/ml, but not at 1 y/ml. Them ensitivities to) a-amanitin are the same as expected for RNA
polymerase III ( Fig. 4d ), not for RNA poymerase I ( Fig. 4c )or II
( sensitive at 1 y/ml, data not shown ). Althoughipt is known that RNA
polymerase III terminates at T cluster and the average size of the
products is relatively short ( reviewed by Sollner-Webb (37); ex. Fig.4d), the run-off products inao - andoate - containing fragments are much
longer. Judging from the sizes of run-off products in BamHI-(Fig.4ab),
HindIII-( Gig. 4ef ) and Pstl-( data not shown ) digested DNAs, we roughly estimated the location of promoter sites. One of the promoters is
located at 230 bp upstream of sigma gamma core, which is common to y(B- p, H-Ila and a (B-I, H-Ill), another is at 60 bp upstream of a o3( II, H-IV) and at 400 bp upstream of e(H-V), and the other is in pUC9
vector(u-IV, B-V, H-I). When pUC vector itself was used asa template,
9508
only one transcript was detected ( data not shown ). The 970
nucleotide-long RNA indicated as B-II ( Fig. 4a ) must be the product of
end-to-end synthesis of a BamHI fragment (38). Origins of 1400
nucleotide-long RNA ( Fig. 4b ) and a few other minor bands are not known.
Recently, Lutzker and Alt (39) identified a truncated C 2b transcript in
A-MuLV transformants. The initiation site for such a "sterile"
transcription has been mapped 2 kb 5' to the S 2b region. Although
further analyses are necessary to determine the exact promoter sites and
to examine the promoter activities in vivo, our results suggest that
simultaneous expression of two different isotypes could be mediated by
discontinuous transcription followed by trans-RNA splicing. The presence
of trans-splicing pathway has been indicated in the rps 12 gene of
chloroplast (40, 41). The tRNA genes are encoded at multiple sites in
the chloroplast genome (42, 43). Some of the tRNA genes might be
involved in trans-splicing. The reason for the similarity of human sigma
gamma core sequence to the tRNA sequence of chloroplast, which would seem
to be evolutionarily very different, could be explained by similarities of
potential functions.
ACKNOWLEDGEMENTS We are grateful to Dr.S.Ohno for critical reading of the manuscript.
We thank Drs.L.Hood, P.Leder, S.Tonegawa, T.Maniatis and M.Muramatsu for providing us clones 5A, 5D, CH4-38, CH4-51, MEP12, human DNA library and RNA pol-nmerase I promoter, respectively. We also are gratefui to Drs.T.Okazaki, Y.Takagi, I.Ishiguro and K.Fujita for their encouragement and to Ms. A.Nagata for preparation of the manuscript. This work was supported in part by grants from the Ministry of Education, Science and Culture of Japan, and Fujita-Gakuen Health University, Japan Private School Promotion Foundation and the Uehara Science Foundation.
Present address : Department of Immunology, Chiba University, School of Medicine, Chiba, Japan ( K.I. ). Department of Immunology, Atomic Disease Institute, Nagasaki University School of Medicine, Sakamoto-cho, Nagasaki, Japan ( M.A. ). Mitsubishi-Kasei Institute of Life Science, Machida, Tokyo, Japan ( K.K ).
REFERENCES 1. Honjo,T. (1983) Ann.Rev.Immunol. 1, 499-528. 2. Flanagan,J.G. and Rabbitts,T.H. (1982) Nature 300, 709-713. 3. Lefranc,M-P., Lefranc,G. and Rabbitts,T.H. (1982) Nature 300, 760-
762. 4. bech-Hansen,N.T., Linsley,P.S. and Co,D.W. (1983) Proc.Natl.Acad.Sci.
USA. 80, 6952-6956. 5. Kataoka,T., Miyata,T. and Honjo,T. (1981) Cell 23, 357-368. 6. Tonegawa,S. (1983) Nature 302, 575-581.
9509
8. Sakano,H., Huppi,K., Heinrich,G. and Tonegawa,S. (1979) Nature 280, 288-294.
9. Chen,Y-W., Word,C., Dev,V., Uhr,J.W., Vitett,E.S. and Tucker,P.W. (1986) J.Exp.Med. 164, 562-579.
10. Yaoita,Y., Kumagai,Y., Okumura,lI. and Honjo,T. (1982) Nature 297, 697-699.
11. Gillies,S.D., Morrison,S.L., Oi,V.T. and Tonegawa,S. (1983) Cell 33, 717-728.
12. Davis,M.M., Kim,S.K. and Hood,L.E. (1980) Science 283, 1360-1365. 13. Ravetch,J.V., Siebenlist,U., Korsmeyer,S., Waldmann,T. and Leder,P.
(1981) Cell 27, 583-591. 14. Ellison,J. and Hood,L. (1982) Proc.Natl.Acad.Sci. USA 79, 1984-1988. 15. Roeder,W., Maki,R., Traunecker,A. and Tonegawa,S. (1981)
Proc.Natl.Acad.Sci. USA.78, 474-478. 16. Takahashi,N., Ueda,S., Obata,M., Nikaido,T., lakai,S. and Honjo,T.
(1982) Nature 302, 575-581. 17. Lawn,R.M., Fritsh,E.F., Parker,R.C., Blake,G. and Maniatis,T. (1978)
Cell 15, 1157-1174. 18. Sakano,H., Rogers,J.H., Huppi,K., Brack,C., Traunecker,A., Maki,R.,
Wall,R. and Tonegawa,S. (1979) Nature 277, 627-633. 19. Benton,W.D. and Davis,R.W. (1977) Science 196, 180-182. 20. Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc.Natl.Acad.Sci.USA.
74, 5463-5467. 21. Wahl,G.M., Stern,h4. and Stark,G.R. (1979) Proc.Natl.Acad.Sci.USA.
76, 3683-3687. 22. Richards,J.E., Gilliam,A.C. Shen,A., Tucker,P.W. and Blattner,F.R.
(1983) Nature 306, 483-487. 23. Dignam,J.D., Lebovitz,R.M. and Roeder,R.G. (1983) Nuc.Acids Res. 11,
1475-1489. 24. Milstein,C.P., Deverson,E.V. and Rabbitts,T.H. (1984) Nuc.Acids Res.
12, 6523-6535. 25. Mills,F.C., Fisher,L.M., Kuroda,R., Ford,A.M. and Gould,H.J. (1983)
Nature 306, 809-812. 26. Sprinzl,M., Vorderwulbecke,T. and Hartmann,T. (1985) Nuc.Acids Res.
13, suppl. r51-rlO4. 27. Rabbitts,T.H., Forster,A., Baer,R. and Hamlyn,P.H. (1983) Nature
306, 806-809. 28. Sakano,H., Maki,R., Kurosawa,Y., Roeder,W and Tonegawa,S. (1980)
Nature 286, 676-683. 29. Maki,R., Roeder,W., Traunecker,A., Sidman,C., Wabl,M., Raschke,W.
and Tonegawa,S. (1981) Cell 24, 353-365. 30. Moore,K.W., Rogers,J., Hunkapiller,T., Early,P., Nottenberg,C.,
Weissman,I., Bazin,H. and Hood,L.E. (1981) Proc.Natl.Acad.Sci.USA. 78, 1800-1804.
31. Blattner,F.R. and Tucker,P.W. (1984) Nature 307, 417-422. 32. Akins,R.A. and Lambowitz,A.M. (1987) Cell 50, 331-345. 33. Solnick,D. (1985) Cell 42, 157-164. 34. Solnick,D. (1985) Cell 43, 667-676. 35. Corden,J., Wasylyk,B. Buchwalder,A., Sassone-Corsi,P., Kedinger,C.
and Chambon,P. (1980) Science 209, 1406-1414. 36. Parslow,T.G., Blair,D.L., Murphy,W.J. and Granner,D.K. (1984)
Proc.Natl.Acad.Sci.USA. 81, 2650-2654. 37. Sollner-Webb,B. (1988) Cell 52, 153-154. 38. Manley,J.L., Fire,A., Samuels,M. and Sharp,P.A. (1983) Methods in
Enzymol. 101, 568-582.
39. Lutzker,S. and Alt,F.W. (1988) Mol.Cell.Biol. 8, 1849-1852. 40. Koller,B., Fromm,H., Galun,E. and Edelman,M (1987) Cell 48, 111-119. 41. Hildebrand,M., Hallick,R.B., Passavant,C.W. and Bourque,D.P. (1988)
Proc.Natl.Acad.Sci.USA. 85, 372-376. 42. Ohyama,K., Fukuzawa,H., Kohchi,T., Shirai,H., Sano,T., Sano,S.,
Umesono,K., Shiki,Y., Takeuchi,M., Chang,Z., Aota,S., Inokuchi,H. and Ozeki,H. (1986) Nature 522, 572-574.
43. Shinozaki,K., Ohto,C., Torazawa,K., Meng,B.Y., Sugita,M., Deno,H., Kamogashira,T., Yamada,K., Kusuda,J., Takaiwa,F., Kato,A., Tohdoh,N., Shimada,H. and Sugiura,M. (1986) EMBO J. 5, 2043-2049.
9511