Proc. Nati Acad. Sci. USAVol. 78, No. 3, pp. 1376-1380, March 1981Biochemistry

Nucleotide sequence of a ribosomal RNA gene intron from slimemold Physarum polycephalum

(intervening sequences/Physarum 26S rRNA/sequencing/rRNA splicing mechanism/gene evolution)

HISAYUKI NOMIYAMA, YOSHIYUKI SAKAKI, AND YASUYUKI TAKAGIDepartment of Biochemistry, Kyushu University School of Medicine, 60 Fukuoka 812, Japan

Communicated by Motoo Kimura, October 31, 1980

ABSTRACT The Physarum polycephalum 26S ribosomal RNAgene contains two intervening sequences (introns). The DNA se-quence of one of these introns was analyzed together with that ofits flanking regions (exons). In addition, the nucleotide sequenceof the corresponding region of the reverse transcript of 26S rRNAwas determined, and from comparisons of both sequences theprecise location and size of the intron were determined. Our find-ings, when compared with those for Tetrahymena and Chamydo-monas rRNA gene introns, led to the conclusion that certain char-acteristics exist near the ends of these introns. (i) An exon ends inT at the exon/intron junction and an intron ends in G at the intron/exon junction in all cases. (ii) For each intron, direct repeats sev-eral nucleotides long are present 5 to -3O nucleotides upstreamfrom both the exon/intron and intron/exon junctions.

Many eukaryotic and viral genes are interrupted by interveningsequences (introns) which are not represented in their matureRNAs (1). The primary transcripts from such discontinuousgenes contain counterparts of introns as well as structural se-quences (exons) but, on processing, the intron counterparts areremoved and those of exons are rejoined to form functionalmessenger (2-6), ribosomal (7-9), or transfer (10, 11) RNAs bysplicing.

Analysis of the protein-coding gene introns and their flankingexon regions from various species showed that sequence homol-ogies are present around the splicing sites (12), and some modelsfor the RNA splicing mechanism have been proposed (13-17).However, tRNA gene intron boundaries apparently do not fol-low this rule, and it was suggested that a different splicingmechanism may be necessary for this process (1). For rRNAgene introns, the nucleotide sequence around splicing sites wasdetermined in two species, Tetrahymena (18) and Chlamydo-monas (19), but the information obtained was not sufficient todeduce a general rule or a model for the rRNA splicingmechanism.

In attempts to elucidate the rRNA splicing mechanism, werecently cloned the DNA fragment that contains a portion ofthe 26S rRNA structural sequence and the two introns. We re-port herein the determination of the sequence of one of theseintrons and its flanking exon regions. Our findings, togetherwith those for Tetrahymena and Chlamydomonas rRNA genes,suggest that a specific mechanism is involved in rRNA splicing.

MATERIALS AND METHODSEnzymes and Chemicals. T4 polynucleotide kinase and T4

DNA ligase were purified from T4-infected Escherichia coli B(20). EcoRI was prepared as described (21). Pst I and Bpa I werepurified in the same way as Hae III (22) and Hap 11 (23), re-spectively. All other restriction enzymes were purchased from

Bethesda Research Laboratories (Rockville, MD), New En-gland BioLabs, or Takara Shuzo (Kyoto, Japan). Avian myelo-blastosis virus reverse transcriptase was obtained from the Di-vision of Cancer Cause and Prevention (National CancerInstitute). Nuclease Si was a product of Sankyo and was a giftfrom T. Ando (Institute of Physical and Chemical Research,Japan). One unit of nuclease S 1 defined by Sankyo correspondsroughly to 40 Vogt units. [ y-32P]ATP with high specific activity(3000-5000 Ci/mmol; 1 Ci = 3.7 X 1010 becquerels) was fromNew England Nuclear or Amersham.

Preparation of Physarum polycephalum rDNA and 26SrRNA. P. polycephalum strain PPO-1 used in these experimentswas provided by T. Kuroiwa (National Institute for Basic Bi-ology, Japan). Nucleolar ribosomal DNA was isolated accordingto Vogt and Braun (24) with slight modifications. rRNAs wereextracted from ribosomes with phenol, and 26S rRNA was pu-rified by 5-20% sucrose density-gradient centrifugation.

Cloning of DNA Fragment Containing Introns. 'The hybridplasmid, which contained a 2.3-kilobase (kb) EcoRI fragmentconsisting of a portion of the Physarum 26S rRNA sequence andtwo introns, was constructed as follows. Ribosomal DNA wasdigested with EcoRI into three fragments, and the productswere inserted into the EcoRI site of plasmid pKY2592, a de-rivative of pKY2289 developed in our laboratory (25). E. coli K-12 (strain GM 48 dam- dcm-) was then transformed with theseDNAs, and plasmids were isolated from the bacteria. Four outof five colonies investigated harbored hybrid plasmid contain-ing an inserted fragment that comigrated on gel electrophoresiswith the 2.3-kb EcoRI fragment. The identity was further con-firmed by colony hybridization and nuclease Si mapping ex-periments (see below). Details of the experiments will be re-ported elsewhere. One of the four hybrid plasmids wasdesignated as pKY1020 and used for further analysis.The physical containment used for the construction and am-

plification of the hybrid plasmids was P2, as specified by theguidelines of the Ministry of Education, Science and Culture,Japan, and is similar to P2 of the National Institutes of Healthguidelines.

Nuclease SI Mapping. Hybridization was carried out in asolution (20 ,ul) containing 80% (vol/vol) formamide, 0.4 MNaCl, 40 mM 1,4-piperazinediethanesulfonic acid (Pipes) (pH6.4), 1 mM EDTA, 1 ,g of nonradioactive or 5'-end-labeledDNA sample, and 100 ,ug of 26S rRNA. The reaction mixturewas heated at 650C for 10 min and then incubated at 500C over-night. The mixture was cooled and diluted 1:20 by cold S1buffer (50 mM sodium acetate, pH 4.5/0.15 M NaCl/0.5 mMZnSO4). Nuclease S1, the amount of which is shown in the leg-end of Fig. 2, was added, and the preparation was incubatedat 370C for 1 hr. DNA was extracted with phenol and precipi-tated with 3 vol of ethanol. For 5'-end-labeled DNA samples,

Abbreviations: kb, kilobase; bp, base pair(s).

1376

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertise-ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Oct

ober

4, 2

021

Proc. NatL Acad. Sci. USA 78 (1981) 1377

1. Transcdption5.8 3 kb

M 19S, 26S8Eco RI -_

II.Xho IPst IBpa IKpn ISal IHpa IHinc 11Ava 11

Hae IIIHinf IHap 11Taq IAva I

Ill.

Int.2

-- 200 bp, -n

Int. 1A , C1 BA iB I

A BR

A , BAaBAB.

i A i C, BA C:DA BA , E, D, B tC

F~~I.9

*~~~~~~~r X-l--

_(C ,6 -4 A 6 ,, (a),-i :b , , , , , ,

4, 4,of,16.

FIG. 1. Restriction maps of rRNA gene introns from Physarum.(I) EcoRI restriction map of rRNA. Only half of the palindrome isshown, from the middle (M) to the left. The orientation of transcriptionof the rRNA genes is taken from ref. 30 and is indicated by an arrow.(II) Restriction enzyme maps of the 2.3-kb EcoRI fragment isolatedfrom pKY1020. The rRNA structural sequences and the introns (Int.1 and Int. 2) are indicated by filled and open boxes, respectively. Theprimer used for reverse transcription of 26S rRNA is shown by a thickbar. (III) Sequencing strategy of Int. 1. The uniquely labeled fragmentswere obtained either by secondary restriction enzyme cleavage or bystrand separation. The arrows indicate the position, direction, andlength of sequences determined for each fragment. Autoradiogramsof the sequencing gels of the intron/exon (a) and exon/intron (c)boundaries are shown in Fig. 3 a and c, respectively.

the pellets were dissolved in 20 ,1 of 90% formamide/1 mMEDTA/0.05% xylene cyanoV0.05% bromphenol blue and in-cubated at 900C for 2 min. The samples were then electropho-resed on an 8% polyacrylamide gel containing 7 M urea. Fornonradioactive DNA samples, the pellets were dissolved in 2mM EDTA/30 mM NaOH, and samples were electrophoresedon a 2% alkaline agarose gel (26). At the end of the run, the gelwas neutralized with 0.5 M Tris-HCl, pH 7.0/3 M NaCl. DNAwas transferred onto nitrocellulose paper (Sartorius) and hy-bridized with 32P-labeled 26S rRNA probe as described (27).Nitrocellulose papers and a 7M urea gel were autoradiographedwith a combination of pre-exposed Kodak X-Omat R film andCronex Lightning Plus intensifying screen at -80°C.

Sequence Determination. Preparation of fragments for de-termination of DNA sequence and actual sequencing proce-dures were as described (28).RNA sequence was determined with reverse transcriptase

as follows. The 5'-end-labeled, 2.3-kb EcoRI fragment wascleaved with Hae III, and the digested product was fractionatedon a 5% polyacrylamide gel. A 72-base-pair (bp) Hae III/EcoRIfragment was eluted and hybridized with 26S rRNA as de-scribed above. The mixture was precipitated with 3 vol ofethanol, redissolved in 0.3 M sodium acetate, and precipitatedwith ethanol again. The precipitate was then rinsed with ethanoland dried under reduced pressure. The radioactive Hae III/EcoRI fragment was elongated by incubation in a solution (100Al) containing 50 mM TrisHCl (pH 8.3), 6 mM magnesiumacetate, 10 mM dithiothreitol, 1 mM of each nonradioactivedATP, dGTP, dCTP, and dTTP, and 200 units of reverse tran-

scriptase. Incubation was at 41'C for 3 hr, after which RNA wasdegraded by 0.2 M NaOH at 41'C for 1 hr. After neutralizationwith 1 M HCl, the elongated DNA fragments were extractedwith phenol and precipitated with ethanol. The precipitate wasdissolved in the same buffer as described above and electro-phoresed on an 8% polyacrylamide gel containing 7 M urea.DNA fragments longer than 400 nucleotides were eluted andanalyzed by the method of Maxam and Gilbert (29).

Unless otherwise noted, all sequences in this paper are in-dicated as those of the anti-coding strand or rRNA.

RESULTS2.3-kb EcoRI Fragment of rDNA. In order to clarify the

processing mechanism of rRNA of P. polycephalum at the nu-cleotide level, ribosomal DNA was digested by several restric-tion enzymes and cloned into E. coli. One of the clones obtainedwas found to contain the 2.3-kb EcoRI fragment, and prelimi-nary nuclease SI mapping indicated that this fragment consistsof a portion of the 26S rRNA structural sequence and its introns.The cleavage sites of restriction enzymes on the 2.3-kb EcoRIfragment were determined by conventional methods and areshown in Fig. 1.

Presence of Introns in the Fragment. Two groups of inves-tigators have demonstrated in electron microscopic studies that26S rRNA genes of P. polycephalum strains a x i and M3C VIIIare interrupted by two introns =1000 and =500 nucleotideslong (31, 32). In the present investigations, the presence of twointrons was confirmed in P. polycephalum strain PPO-1 by usingthe nuclease SI mapping method developed by Berk and Sharp(33) as follows. The 2.3-kb EcoRI fragment and the 1.5-kb XhoI A fragment (see Fig. 1) were hybridized with 26S rRNA. Thehybrids were digested with nuclease S1, during which the non-hybridized regions were removed. The remaining DNARNAhybrids, protected from nuclease S1 digestion, were treatedwith alkali and electrophoresed on an alkaline agarose gel. Be-cause the resulting single-stranded DNA fragments were RNAcoding strands, the positions on the gel were detected by theSouthern blotting method with 32P-labeled 26S rRNA as probe.

A(a)(b)(c)(d)

* 1

1

-1653/51 7+506/396/Z344- 298-220 bp

B

_298-220'154

-75 bp

FIG. 2. Electrophoretic analysis of nuclease Si-resistant hybridsformed between 26S rRNA and various DNA fragments. (A) The 2.3-kb EcoRI fragment (lane b), 1.5-kb Xho IA fragment (lane c), and 2.3-kb EcoRI fragment digested withAva I (lane d) were hybridized with26S rRNA, digested with nuclease S1 (0.3 unit), and electrophoresedon 2% alkaline agarose gels. As a control, the 2.3-kb EcoRI fragmentwas run in parallel without pretreatment (lane a). The gel blots werethen hybridized with 32P-labeled rRNA. (B) The 5'-end-labeled EcoRIfragment was hybridized with 26S rRNA, digested with nuclease S1(0.2 unit), and electrophoresed onan 8% polyacrylamide gel containing7M urea. Size markers are pBR322 DNA digested with Hinfl.

Biochemistry: Nomiyama et aL

Dow

nloa

ded

by g

uest

on

Oct

ober

4, 2

021

1378 Biochemistry: Nomiyama et al.

As shown in Fig. 2A, lanes b and c, two clear bands (=z440 nu-cleotides and =z280 nucleotides long) were observed on the au-toradiogram. In addition to these two bands, in lane b, a faintband could be seen at a position indicating a length of =-100nucleotides. These results indicate that the structural gene of26S rRNA is interrupted to form three parts by two introns, andone of them is located on the 1.5-kb Xho I A fragment.

In order to determine the accurate size of the smallest frag-ment observed as a faint band, 5'-end-labeled 2.3-kb EcoRIfragment was hybridized with 26S rRNA, treated with nucleaseSi, and analyzed on a denaturing polyacrylamide gel. Afterelectrophoresis, a single band at a position indicating a lengthof -85 nucleotides was observed on the autoradiogram (Fig.2B), indicating that the 3' end (on the anticoding strand) of oneintron (intron 1) lies -85 nucleotides upstream [based on theorientation of transcription of the rRNA genes (Fig. 1)] fromthe EcoRI site. To localize the 5' end of this intron, we analyzedthe 2.3-kb EcoRI fragment digested with Ava II in a similar wayby nuclease SI mapping and Southern blotting. If the 5' endof intron 1 lies within the Ava II A fragment, fragments of thesame size as those shown in lane b should be apparent. How-ever, we found that the =440-nucleotide fragment had disap-peared and had been replaced by a new fragment of -310 nu-cleotides (lane d). (The largest fragment in lane d was a self-reassociated one of the Ava II A fragment, which was resistant

Proc. NatL Acad. Sci. USA 78 (1981)

to nuclease S1 digestion.) This finding, together with the esti-mation of the size of intron 1 by electron microscopy, indicatedthat the 5' end of intron 1 lies f140 nucleotides downstreamfrom the Ava II A fragment and, consequently, suggested thelocation of another intron (intron 2). The arrangement of thetwo introns on the 2.3-kb EcoRI fragment is summarized inFig. 1.

Nucleotide Sequence of the Fragment. In the next experi-ments, the nucleotide sequence was determined about 1300 bpupstream from the EcoRI site, which may cover intron 1 andits flanking exon regions. The 5' and 3' ends of intron 1 weredetermined by sequencing the reverse transcript of 26S rRNA.From nuclease S1 mapping experiments, the approximate lo-cation of the 3' end of intron 1 was estimated to lie --85 nu-cleotides upstream from the EcoRI site. A comparison of thisestimation with the restriction enzyme maps presented in Fig.1 indicated that this end is located close to a 72-bp Hae III/EcoRI fragment. Therefore, the 2.3-kb EcoRI fragment was la-beled with 32P at its 5' end and cleaved with Hae III. After diges-tion, the 72-bp Hae III/EcoRI fragment labeled only at the 5'end of the coding strand was isolated, hybridized with 26SrRNA, and incubated with avian myeloblastosis virus reversetranscriptase in the presence of four deoxyribonucleoside tri-phosphates. After incubation, the reaction mixture was sub-jected to gel electrophoresis in 7 M urea and the elongated

A +C) C) H- CD~_-_

_C_

_W.

_- t T

JPWAO~ ~

.,-a,a

VW

AAC

_*_

(a)

A +

cD F- C)

_* NM G

L

AA

-, C

coO.- A

AA

I C .

(b)

-cc u

CD H C

_w_

Gram~~~

..

W~~~~~

*'"- G

ISO--

O.-*.. .,

CU_t.-.~ ~~

T .

- G

(c,)

FIG. 3. Autoradiograms of the sequencing gels of the intron/exon boundary (a), reverse transcript of 26SrRNA (b), and the exon/intron bound-ary (c). Nucleotide sequences in a and c are those of coding strands. Splicing site is indicated by an arrow.

Dow

nloa

ded

by g

uest

on

Oct

ober

4, 2

021

Proc. Natt Acad. Sci. USA 78 (1981) 1379

5'.. CTAAGGTCCACUA-9ftACAGAAA VTUAGATAAAGGCAAA 50

AGTGGGCTTAACTCGCATTCAGTAGTAATGTGAAGCAAGAAATTGCGG 100

CTTAACGATCCTTAGCGGCGGGTGCCAGCCCACGCTTGAGGTGAGAGAg 150Vv * _ _ HpaI

AGTCCACAGGGATTGATACACACACACCAACGGTAACTAAAACGT'TAKA 200

FGAGTAACTATGACGGAACGAATCGCGTAACAGCGACGTTCCTATCTTTA 250

AACGGGGTCCCATT-AAAAGTCATCGGCACTGCAACGCGGT.CAAACGGTTA 300

AGAGCG AGGTCACCTGACCGGCGGGGCGTGGGGAGGGCGGGAAAAAAA 350

ATCTCiTTT AAACGATCCATATGCCGATGGCGACGCACCTGGATGCT 400

GAGACGGTTCAAAGGGGGCG AC ATACCCAAAAAGCCTC 450Hp I Xho I *K n IUrYKKC'FGA'CGGAGGGAACCCCGCAAACGACGGTAggTrCAAGC 500

SalIGTTCCCTGGCAACACCGGGGCGTGGGAGCTGGTCCTCGT.KCtACTCGTT 550

TCTTTTAACCACGCCAACCTTTTTCTCCCCAGTACTTCACGACCTTAACG 600

GGGCGTCGTCGTCAGCGGGTTGAGGGGGGGAGGGGTGCGTTTTTTGAGGC 650Xhol

GGCGTTGGCTCGAGA.CGGCGGGTCATAATCCAACCGATCGGGGCTTATCA 700

GCAAGCGACGAGGCCATCCAGCCGACGCGACTCAAAAGGAATCTGACCAC 750

CTCGGTGCAGCTCCGTACAGCGACGGTAGGTGATAAACGGTGGTTAAGCG 800

CTTCAACGACTGGAAAGGTGTGGGTGCGAGCGAGGT CTCGGTTGC 850

TGTTTTTTGAGACGGTGTGACGCCCGCTCTCTCTCTCGGTTGGCGATTAT 900

CGGACCGTTTCGCGCGCGTTCAAGGTGCAGTCCCTCCTGGTCCCGA$AGd 950

ACCCGCCATTTCAACCfGGCGGGGCGAATGGGGCCATCGCGATCGCCTT 1000-s.,y, PPt!I

AGTTATTTCGGACAGGGCAAAACGTAACCCACCAFT'?A1GGGTAACGGTC 1050

GTGAGCGTTTttAGTG GGGGTGGCGGGGTTTTTTTAAAGGGGAAA 11i00

GCCAAAACCTCTTCCCGTCT! CCTCGGGC TGGGT ZMDAMAG 1150

AATCGG'AACTGGCTTGTGGCCGCCAAGGTTCATAGCGACGTGGCTTTTT 1200Ecl RI

GATCCTTCGATGTCGGCTCTTCCTATCATACTAAAGCGKAU(YC)-.-3' 1250

FIG. 4. Nucleotide sequence of intron 1 and its flanking exon re-gions of the 26S rRNA gene. The exon/intron and intron/exon junc-tions are indicated by arrowheads, and flanking exon sequences areunderlined. The 7-nucleotide direct repeats are enclosed in boxes.Hairpin-loop-like structures were surveyed by a computer programdeveloped by Staden (34) and are shown by horizontal arrows. (G*Ubase pairs, in addition to G-C and A-U base pairs, are included in thesestructures.)

products of the 72-bp fragment were separated according tolength.DNA fragments longer than 400 nucleotides were eluted and

their sequences were determined. The autoradiogram is shownin parallel with those ofthe DNA sequence analyses of the exon/intron and intron/exon boundaries in Fig. 3. A comparison ofthese three led to identification of the exact location of intron1 (84-1075 nucleotides from the EcoRI site) on the 2.3-kb EcoRIfragment. This result agrees with findings from the nuclease S1mapping experiments. The nucleotide sequence of intron 1, 991nucleotides long, and its flanking exon regions are summarizedin Fig. 4. The most remarkable feature of the intron was that7-nucleotide direct repeats (A-A-A-G-T-T-A) were found 9 or

Physarwn

Saccharomyces

10 nucleotides upstream'from both the exon/intron and intron/exon junctions.

DISCUSSIONNuclease SI mapping experiments revealed that the 2.3-kbEcoRI fragment of Physarum rDNA contains two introns, andtheir approximate positions on the fragment and their sizes wereestimated. The nucleotide sequence of the larger intron (intron1) was then analyzed and its precise position was determined.

'From the results described here and from findings for Te-trahymena and Chlamydmonas (18, 19), we see that certainsequence characteristics exist near the ends of rRNA gene in-trons. First, the sequences of the boundaries of these intronsdiffer from those of protein-coding genes (A-G I G-T-A-A-G-T* * * Py-Py-N-Py-A-G 1) (12) or tRNA genes. Second, the 3'ends of exons terminate in T at the exon/intron junction andthe 3' ends of introns terminate in G at the intron/exon junctionin all these cases. Third, for each intron, direct repeats of 4-7nucleotides are present 5-30 nucleotides upstream from bothjunctions (Fig. 5).

Because the Physarum 26S rRNA gene contains two introns,it will be important to analyze the boundaries of the other intron(intron 2) to determine whether the findings correlate withthese conclusions.

While we were preparing this manuscript, the nucleotidesequence of the 21S rRNA gene intron from yeast mitochondriawas reported (35, 36). Although the precise splicing site was notdetermined in those studies because of the repetition of A-Adinucleotides at the ends of the intron, 6-nucleotide direct re-peats were found upstream from the junctions. Furthermore,assuming that splicing occurs at the left end of the A-A dinu-cleotides, the exon and intron will end in T and G, respectively(Fig. 5). Thus, the results of others also support our conclusionsconcerning the characteristics of rRNA gene introns.

These three characteristics, together with the absence ofother striking features aroundor in the rRNA gene introns, sug-gest that certain common splicing mechanisms are at work forrRNA processing. It may be recalled that restriction enzymessuch as Hph I, Mbo II, and Hga I recognize specific but asym-metric 5-bp nucleotide sequences and cleave at sites located5-10 bp apart from the recognition sequences as follows (37):

Hph I 5' G-G-T-G-A-N-N-N-N-N-N-N-N s3' C-C-A-C-T-N-N-N-N-N-N-N t

Mbo II 5' G-A-A-G-A-N-N-N-N-N-N-N-N3' C-T-T-C-T-N-N-N-N-N-N-N t

Hga I 5' G-A-C-G-C-N-N-N-N-N I

3' C-T-G-C-G-N-N-N-N-N-N-N-N-N-Nt

Therefore, one suggestion is that an enzyme similar to theserestriction enzymes recognizes the nucleotide sequences nearthe ends of the intron and cleaves at U or G located at definite

EXON INTRON EXON

5 *.-GCTTGAGGTGACGAGAMTACACBGGATGATA.......CGCCTCGGGCGTGGGTA8&qAGAGAAATCGGTCT-C'TG... 3'

5' .. ATTTAAATGTAATTACGT.. AAAAAATTTJAFGGTAA... 3'v VTetrahymena 5' ... CGGGIMGGCGGGAGTAACTATf&CTCTAAATT.....TAAIMWTAATATTAGTTTTGGACAATCGTAAGGTAGCC ... 3-

Chiamydomonas V T5'***ATGTGGTACT~j~GCTGGTTCMMCT~TA . AC GC.TTTTATTCGGCTTTAAAATTCATGCGTGAGACAG.. 3

FIG. 5. Comparison of nucleotide sequences atthe borders of introns andexons ofrRNA genes from some organisms. Theexon/intron and intron/exon junctions are indicated by arrowheads. In the yeast (Saccharomyces) 21S rRNA gene intron, precise location ofjunctions was not determineddue to A-A dinucleotide repetition at the ends of the intron. Homologous flanking exon sequences between Physarum and yeast are overlined.

Biochemistry: Nomiyama et aL

Dow

nloa

ded

by g

uest

on

Oct

ober

4, 2

021

1380 Biochemistry: Nomiyama et aL

A

B

Tetrahymena *.RG GIGUAACGCGA UAACUA G FUClE. coli 1891 * 4WC XUGG

GIJA UAGqpIA0GJUUCUUGG JG W.JCCC U se.L966

Physarwn * U GG UGC GCCCA GCUUGAGGE. coli 2395 G *GUUR a uSaccharomyces . AA ACA u A

UAAUA ACA GGGGUGAAAAAA Au GGAUAACAGMGUACGCAGAGUUCg

t5 At5G AG GGAUAACAG UA AGA

U LGJJCtCIllJCGAUGUCGG5UcIJ %i J..AUAUCGACGqCGUUUG ACCUCGAUGUCGGCUCAUCCL** 2519

A GAJGUUUGICACCUCGAUGUCG.II%..

C

ChiZcoydomonas GAA- TUT-GUG GAA*fiOA1E. coli 2 535 * CGGJUGUG CAUULAAJAIGUGGUACGIUA'GCUGGGU C ACGUCGUGAGACAGUUUWUCGUGGUACGIC iAGCUGGGUJGACGUCGUGAGACAGUQ:1;GUCl *261 0

FIG. 6. Comparison of the flanking exon regions of rRNA geneintrons from some organisms and the 3'-terminal region of E. coli 23SrRNA. Nucleotide sequences are for mature RNA and are taken fromrefs. 38 (E. coli), 18 (Tetrahymena), 35 (Saccharomyces), and 19(Chlamydomonas). Splicing sites are indicated by arrows; homologoussequences are enclosed in boxes. Numbering of E. coli rRNA is fromref. 38.

locations from the recognition site. If so, this hypothetical en-

zyme must be unique for each rRNA gene intron, because the"recognition sequence" differs in each of the operative fourcases. The Physarum and Tetrahymena rRNA genes so far stud-ied were obtained from nucleoli, whereas those of Chlamydo-monas and yeast were from chloroplast and mitochondria, re-

spectively. Therefore, rRNA splicing from different originsappears to follow a common rule.

Finally, sequences of the flanking exon regions of these fourrRNA gene introns were compared with that of E. coli 23SrRNA in order to get some insight into the evolutionary aspectsof rRNA genes. As shown in Fig. 6, the exons have many highlyhomologous regions, and all introns are located only in suchregions. It is particularly noteworthy that in Physarum andyeast, introns are found at almost identical, if not the same,

positions. Thus, these findings lead us to the following conclu-sions. (i) The prokaryotic 23S and eukaryotic 26S rRNAs havea common ancestor and the sequences, at least in the regionscompared here, have been strongly conserved during evolu-tion, probably because of their functional importance. (ii) In-troduction of introns took place only at certain selective siteswithin conservative regions of rRNA genes.

Note Added in Proof. After we submitted this manuscript, we foundthat the intron 2 also follows "T&G" rule described above.

We thank Ms. M. Ohara (Kyushu University) for critical reading of'the manuscript and Dr. S. Kuhara for skillful technical assistance with

the computer analysis. This work was supported by grants from theMinistry of Education, Science and Culture, Japan.

1. Crick, F. H. C. (1979) Science 204, 264-271.2. Nordstrom, J. L., Roop, D. R., Tsai, M.-J. & O'Malley, B. W.

(1979) Nature (London) 278, 328-331.3. Blanchard, J.-M., Weber, J., Jelinek, W. & Darnell, J. E. (1978)

Proc. Natl Acad. Sci. USA 75, 5344-5348.4. Gruss, P., Lai, C.-J., Dhar, R. & Khoury, G. (1979) Proc. Natt

Acad. Sci. USA 76, 4317-4321.5. Tilghman, S. M., Curtis, P. J., Tiemeier, D. C., Leder, P. &

Weissmann, C. (1978) Proc. Natt Acad. Sci. USA 75, 1309-1313.6. Kinniburgh, A. J. & Ross, J. (1979) Cell 17, 915-921.7. Merten, S., Synenki, R. M., Locker, J., Christianson, T. & Ra-

binowitz, M. (1980) Proc. Natl Acad. Sci. USA 77, 1417-1421.8. Zaug, A. J. & Cech, T. R. (1980) Cell 19, 331-338.9. Gubler, U., Wyler, T., Seebeck, T. & Braun, R. (1980) Nucleic

Acids Res. 8, 2647-2663.10. Peebles, C. L., Ogden, R. C., Knapp, G. & Abelson, J. (1979) Cell

18, 27-35.11. Knapp, G., Ogden, R. C., Peebles, C. L. & Abelson, J. (1979) Cell

18, 37-45.12. Seif, I., Koury, G. & Dhar, R. (1979) Nucleic Acids Res. 6,

3387-3398.13. Murray, V. & Holliday, R. (1979) FEBS Lett. 106, 5-7.14. Lerner, M. R., Boyle, J. A., Mount, S. M., Wolin, S. L. & Steiz,

J. A. (1980) Nature (London) 283,220-224.15. Harada, F. & Kato, N. (1980) Nucleic Acids Res. 6, 1273-1285.16. Bina, M., Feldmann, R. J. & Deeley, R. G. (1980) Proc. NatLAcad.

Sci. USA 77, 1278-1282.17. Rodger, J. & Wall, R. (1980) Proc. Natl. Acad. Sci. USA 77,

1877-1879.18. Wild, M. A. & Sommer, R. (1980) Nature (London) 283,693-694.19. Allet, B. & Rochaix, J.-D. (1979) Cell 18, 55-60.20. Panet, A., van de Sande, J. H., Loewen, P. C., Khorana, H. G.,

Raae, A. J., Lillehaug, J. R. & Kleppe, K. (1973) Biochemistry 12,5045-5050.

21. Yoshimori, R. N. (1971) Dissertation (Univ. California, SanFrancisco).

22. Roberts, R. J., Breitmeyer, J. B., Tabachnik, N. F. & Meyers,P. A. (1975)J. Mol Biol. 91, 121-123.

23. Takanami, M. (1973) FEBS Lett. 34, 318-322.24. Vogt, V. M. & Braun, R. (1976)1. Mol Biol. 106, 567-587.25. Ozaki, L. S., Maeda, S., Shimada, K. & Takagi, Y. (1980) Gene

8, 301-314.26. McDonell, M. W., Simon, M. N. & Studier, F. W. (1976)J. Mol.

Biol 110, 119-146. 427. Southern, E. M. (1975) J. Mol BioL 98, 503-517.28. Takeya, T., Nomiyama, H., Miyoshi, J., Shimada, K. & Takagi,

Y. (1979) Nucleic Acids Res. 6, 1831-1841.29. Maxam, A. & Gilbert, W. (1977) Proc. NatL Acad. Sci. USA 74,

560-564.30. Grainger, R. M. & Ogle, R. C. (1978) Chromosoma 65, 115-126.31. Gubler, U., Wyler, T. & Braun, R. (1979) FEBS Lett. 100,

347-350.32. Campbell, G. R., Littau, V. C., Meleraj P. W., Allfrey, V. G. &

Johnson, E. M. (1979) Nucleic Acids Res. 6, 1433-1447.33. Berk, A. J. & Sharp, P. A. (1977) Cell 12, 721-732.34. Staden, R. (1977) Nucleic Acids Res. 4, 4037-4051.35. Bos, J. L., Osinga, K; A., Van der Horst, G., Hecht, N. B., Tabak,

H. F., Van Ommen, G.-J. B. & Borst, P. (1980) Cell 20, 207-214.36. Dujon, B. (1980) CelL20, 185-197.37. Roberts, R. J. (11980) Nucleic Acids Res. 8, r63-r80.38. Brosius, J., Dull, T. J! & Noller, H. F. (1980) Proc. NatL Acad. Sci.

USA 77, 201-204.

Proc. Nad Acad. Sci. USA 78 -(1981)

Dow

nloa

ded

by g

uest

on

Oct

ober

4, 2

021