8/10/2019 Phalaris
1/4
Title: Evaluation of genetic diversity of some Phalaris sp.Using
minisatellites.
Authors: Gabor C* (1), Boldura Oana-Maria (2), Samfira I (1),
Popescu Sorina (1)[email protected]
1 - Universitatea de tiinte Agricole si Medicina Veterinara a
Banatului Regele Mihai I alRomaniei din Timisoara . Facultatea de
Horticultura si Silvicultura
2 - Universitatea de Medicin i Farmacie Victor Babe din Timioara
, Facultatea de Medicin
1 - University of Agricultural Sciences and Veterinary Medicine
of Banat "King Mihai I ofRomania" Timisoara. Faculty of
Horticulture and Forestry
2 - University of Medicine and Pharmacy, Victor Babes",
Timisoara, Faculty of Medicine
Summary: The experiment was conducted in order to see the
genotypic expression of 12varieties of Phalaris in order to
determine their degree of relatedness. The samples were takenfrom
USAMVBT didactical and experimental field. X DAMD molecular markers
randomlychoosen were tested. After the preliminary screening, four
primers was further used accordingto their qualities. The Data
collected from those probes made possible to construct aDendrogram
of genetic similarities among those 12
probes.XXXXXXXXXXXXXXXXXXXXXXXXXXX
Key words: Phalaris spp, DAMD molecular markers, Phalaris
Dendrogram.
Introduction: Phalaris is a perennial grass which grows mainly
in late autumn, winter and spring.Better suited to moderate to high
fertility soils. Sensitive to acid soils. Tolerates wet soils,
flooding,and moderately saline soils. Very persistent with
appropriate management.All varieties can cause phalaris poisoning.
Rotational grazing preferred, especially for semi erectand erect
types.There are between 15 up to 22 species some species are very
toxic containinggramine that cause serious brain damage and it may
cause death. The Phalaris manage to clean verywell soil by
absorbing polluted compounds from soil making from them a source of
nutrition orsouring those in biomass, this plant has a potential ,
a very big one because it is a medium to tall
plant with big biomass , it may be used as bioenergy , food for
animals not forgetting that some
compounds like those alkaloids may harm. Phalaris as a species
is relatively intolerant of soilacidity especially where soil
aluminium is high and phosphorus levels are low Some varieties
have
been developed for improved tolerance of acidic soil conditions.
In marginal situations use of thesevarieties may improve long term
productivity and persistence.
Genetic monitoring is the use of molecular markers to identify
individuals, species or populations,or to quantify changes in
population genetic metrics (such as effective population size,
geneticdiversity and population size) over time. Genetic monitoring
can thus be used to detect changes inspecies abundance and/or
diversity, and has become an important tool in
both conservation and livestock management. The types of
molecular markers used to monitor
populations are most commonly mitochondrial, minisatellitesor
microsatellites or ,single-nucleotide polymorphisms (SNPs), while
earlier studies also used allozyme data. Species gene diversity is
also
mailto:[email protected]:[email protected]://en.wikipedia.org/wiki/Genetic_markerhttp://en.wikipedia.org/wiki/Population_genetichttp://en.wikipedia.org/wiki/Effective_population_sizehttp://en.wikipedia.org/wiki/Genetic_diversityhttp://en.wikipedia.org/wiki/Genetic_diversityhttp://en.wikipedia.org/wiki/Conservation_management_systemhttp://en.wikipedia.org/wiki/Livestockhttp://en.wikipedia.org/wiki/Mitochondrialhttp://en.wikipedia.org/wiki/Microsatellite_(genetics)http://en.wikipedia.org/wiki/Single-nucleotide_polymorphismshttp://en.wikipedia.org/wiki/Single-nucleotide_polymorphismshttp://en.wikipedia.org/wiki/Allozymehttp://en.wikipedia.org/wiki/Allozymehttp://en.wikipedia.org/wiki/Single-nucleotide_polymorphismshttp://en.wikipedia.org/wiki/Single-nucleotide_polymorphismshttp://en.wikipedia.org/wiki/Microsatellite_(genetics)http://en.wikipedia.org/wiki/Mitochondrialhttp://en.wikipedia.org/wiki/Livestockhttp://en.wikipedia.org/wiki/Conservation_management_systemhttp://en.wikipedia.org/wiki/Genetic_diversityhttp://en.wikipedia.org/wiki/Genetic_diversityhttp://en.wikipedia.org/wiki/Effective_population_sizehttp://en.wikipedia.org/wiki/Population_genetichttp://en.wikipedia.org/wiki/Genetic_markermailto:[email protected]
8/10/2019 Phalaris
2/4
recognized as an important biodiversity metric for
implementation of the Convention on BiologicalDiversity.
Chapters:I Matherial and method used:
The biological material was represented by twelve varieties of
Phalaris specie, collected from theexperimental field of
B.U.A.S.V.M. and labeled according to Table 1
The young leaves from al twelve variety of Phalaris were
collected and bulked in order to obtain agenetically homogenous and
representative sample.Minisatelliets molecular markers were chosen
for the genetic diversity assessment. For the initial
No. Specie Variety1 Phalaris pycta2 Phalaris arundinacea Premier
(field cultivated collection)3 Phalaris arundinacea tardy4 Phalaris
arundinacea early
5 Phalaris arundinacea Premier (locally breaded)6 Phalaris
canariensis 7 Phalaris spp. Polycross bulk8 Phalaris arundinacea
Brandenbrug early9 Phalaris arundinacea Romanian clones (2011)10
Phalaris arundinacea Brandenbrug tardy11 Phalaris arundinacea
Polycross collection12 Phalaris arundinacea Premier (vegetative pot
cultivated collection)
DAMD primer code Sequence 5...3 A3 GACAGACAGACAGACAGACAA7
AGAGAGAGAGAGAGAGAGAGTA 10 CTCTCTCTCTCTCTCTCTCTTA 12
GAGAGAGAGAGACC
A 13 GTGTGTGTGTGTCCA 17 GTGGTGGTGGCA 21 CACACACACACAACUBC 818
CACACACACACACAGUBC808 AGAGAGAGAGAGAGAGCUBC810
GAGAGAGAGAGAGAGATUBC834 AGAGAGAGAGAGAGAGYTUBC873 GACAGACAGACAGAC
AUBC880 GGAGAGGAGAGGAGA
UBC884 HBHAGAGAGAGAGAGAGUBC886 VDVCTCTCTCTCTCTCT
http://en.wikipedia.org/wiki/Biodiversityhttp://en.wikipedia.org/wiki/Convention_on_Biological_Diversityhttp://en.wikipedia.org/wiki/Convention_on_Biological_Diversityhttp://en.wikipedia.org/wiki/Convention_on_Biological_Diversityhttp://en.wikipedia.org/wiki/Convention_on_Biological_Diversityhttp://en.wikipedia.org/wiki/Biodiversity
8/10/2019 Phalaris
3/4
screening experiment a set of fifteen primers (Table 2) were
used.
Single letter abbreviations for mixed-base positions: Y = (C,
T), R = (A, G), B = (non A), D = (non C), V = (non T), H= (non
G).
Methodes:
DNA was isolated an purified from aproximativelly 100 mg of leaf
fresh tissue using CTABmethod (ISO 21571, 2005).The quality and
quantity of DNA was assessed by specrophotometry method ( NanoDrop
8000,Thermo Scientific ).In all cases, amplication reactions were
carried out in volumes of 25 l containing 75 ng of DNAtemplate. The
composition of amplification mixture was carried out following the
producerinstructions for GoTaq Green Master Mix ( Promega , USA).
PCR was performed on a DNA Engine
Peltier Thermal Cycler (MJ Research, U.S.A.) and the PCR program
consisted of an initialdenaturing step for 5 min at 94C, followed
by 45 cycles of denaturation at 95C for 45 sec,annealing at 48C-
55C for 45 sec and extension at 72C for 2 min, with a final step at
72C for 5min., according to literature data. (Pharmawati et al.
2005.)The resulting PCR products were run on 1.8 % agarose gels in
TAE buffer at room temperature at aconstant voltage of 100 V for 90
minutes.The PCR products were visualized and photographed under UV
light (PhotoDocumentationSystem, UVP, England).The obtained data
were analysed with VisionWorksLC software.The dendrogram was
assesed from a set of variables by using DendroUPGMA (Garcia
Vallve, PerePuigbo, 2002) program. The program calculates a
similarity matrix and transforms similaritycoefficients into
distances and makes a clustering using the Unweighted Pair Group
Method withArithmetic mean (UPGMA) algorithm.
II Results
Primer squence Fragment size range Fraction
polymorphicfragments
