Proc. Natl. Acad. Sci. USAVol. 87, pp. 6555-6559, September 1990Biochemistry

In vitro assembly of relaxosomes at the transfer origin ofplasmid RP4

(bacterial conjugation/initiation of transfer DNA replication/protein-DNA interaction/electron microscopy)

WERNER PANSEGRAU, DIETMAR BALZER, VOLKER KRUFT, RUDI LuRz, AND ERICH LANKA*Max-Planck-Institut fur Molekulare Genetik, Abteilung Schuster, Ihnestrasse 73, D-1000 Berlin 33, Federal Republic of Germany

Communicated by Charles C. Richardson, June 8, 1990

ABSTRACT During tiatin of conjugative transfer ofDNA containing the transfer origin (onTiT) of the promiscuousplasmid RP4, the proteins TraI, TraJ, and Trai interact andassemble a specialized nucleoprotein complex (the relaxosome)at onT. The structure can be visualized on electron micro-graphs. Site- and strand-specific nicking at the transfer originin vitro is dependent on the proteins TraIl and TraJ and onMg2+ ions. Substrate specificity is directed exclusively towardsthe cognate transfer origin: the RP4-specifled TraJ proteincannot recognize the closely related onT ofplasmid R751. Afternicking, TraI protein remains attached to the 5'-terminal2'-deoxycytidyl residue at the nic site [Pansegrau, W., Ziegelin,G. & Lanka, E. (1990) J. Biol. Chem. 265, 10637-10644].Nicking and relaxosome formation require supercoiled DNA.Thus, a complicated structure involving multiple plasmid-specified proteins and a defined region ofDNA must be formedat the transfer origin to prepare the plasmid for generating thesingle strand to be transferred.

Bacterial conjugation mediates horizontal gene transfer be-tween a wide variety of organisms (1, 2). The general modelfor initiation of conjugative DNA synthesis proposes thatcleavage at the nic site within the transfer origin (oriT) allowscreation ofa single strand by subsequent strand displacementthrough rolling-circle-type replication. A prerequisite for theinitial nicking reaction is the formation of a specializednucleoprotein structure at oriT, the relaxosome. For thepromiscuous IncPa plasmid RP4, it has been shown thatgenes specifying proteins which exert high-precision inter-actions with oriT sequences directly flank the transfer origin(3). The traJ gene encodes an oriT-recognizing protein es-sential for initiation of transfer DNA replication (3, 4).Genetic and biochemical data indicate that the product of thetraf gene is an additional component ofthe relaxosome (3, 5).However, definite proof that the gene products specified bythe relaxase operon (4) are sufficient for relaxosome forma-tion can be obtained only by in vitro assembly from purifiedcomponents. To address this issue, we attempted overpro-duction of Tral protein by means of molecular cloning inexpression vectors and its purification.We report here that purified TraJ and Tral proteins mimic

the specific nicking reaction on superhelical oriT DNA invitro. However, we demonstrate by gel electrophoresis thatstable complex formation with DNA needs a third proteincomponent, the product of the traH gene. Electron micros-copy of protein-DNA complexes directly locates the site ofrelaxosome assembly at the transfer origin. We presume thatrelaxosome formation follows a sequential order in that Tralprotein, which bears the specific nuclease activity, recog-nizes a preformed TraJ-oriT complex, and that this structure

subsequently is stabilized by specific protein-protein inter-actions of TraH with both TraJ and Tral.

MATERIALS AND METHODSBacterial Strains, Plasmids, and Media. Escherichia coli

strain SCS1 (6) was used as host for plasmids. Recombinantplasmids pJF166uA2 (3), pMS2260 (7), pGZ192OA114 (8),pJF145n (3), and pWP392n (7) have been described. Expres-sion systems used were the 17410/T7 gene 10 S/D vectorpT7-7 obtained from Stanley Tabor (Harvard MedicalSchool) and the Ptac/lacIQ vector pJF119HE (9). Cells weregrown under the conditions described (5). When appropriate,antibiotics were used at the following concentrations: chlor-amphenicol, 10 /Lg/ml; ampicillin (sodium salt), 100 .g/ml.DNA Techniques. Standard molecular cloning techniques

were performed as described (10).Proteins. TraJ protein was purified as described (4). A

purification procedure for TraH protein (3) will be publishedelsewhere. Antiserum to the TraI protein was raised inrabbits by using a TraL/Tral hybrid polypeptide as immu-nogen (5).Immunoblot Assay. Proteins were electrophoresed in SDS/

15% (wt/vol) polyacrylamide gels and transferred electro-phoretically to a nitrocellulose membrane (12 V/cm, 90 min;ref. 11), followed by reaction with anti-TraL/Tral serum(1:500, 2 hr) and dichlorotriazinylaminofluorescein-conju-gated goat anti-rabbit IgGs (Jackson ImmunoResearch; 1:50,45 min).

In Vitro Reconstitution of Relaxosomes. Under standardconditions, mixtures of Tra proteins and supercoiled plasmidDNA (0.7 ;kg) were incubated in a total volume of 30 p.l (20mM Tris-HCl, pH 7.6/50 mM NaCI/10 mM MgCl2/0.1 mMEDTA with bovine serum albumin at 10 ,ug/ml) for 45 min at370C. TraH protein was added after the samples were pre-incubated for 10 min at 370C. When desired, relaxed inter-mediates were captured by addition of SDS and proteinase Kto concentrations of 1% (wt/vol) and 100 tkg/ml, respec-tively. After incubation at 370C for 5 min, samples wereanalyzed electrophoretically. The amount of specifically re-laxed plasmid DNA was estimated by laser densitometry ofphotographs obtained from ethidium bromide-stained agar-ose gels. Since open circular (OC) and covalently closedcircular (CCC) forms of plasmid DNA give different specificfluorescence intensities, the yield of specifically relaxedplasmid DNA was calculated from the decrease of thefluorescence signal of the CCC form relative to that of theuntreated substrate DNA, ensuring that exposure signals onthe film were proportional to the amount of DNA.

RESULTSIdentification of the Tral N-Terminal Amino Acid Sequence

Defines the 5' End of the tral Gene. Immunological identifi-cation of the traf gene product as an 82-kDa polypeptide of

Abbreviations: OC, open circular; CCC, covalently closed circular.*To whom reprint requests should be addressed.

6555

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Oct

ober

19,

202

0

6556 Biochemistry: Pansegrau et al.

M-

E_ cmcx

M-_R _~a 2ca,Co

(I, . °.)~C :

II 11 I114-ll ~~~~~~~Al 14

1000IbpI i. . .. . L

G' 4 I K[E 4-- DIRECTION OF TRANSFER

4 - RELAXASE OPERON . 4-* LEADER OPERON-

FIG. 1. Gene organization of the regions flanking the transfer origin of plasmid RP4. A physical and genetic map of the 5.40-kilobase-pair(kbp) Tral fragment spanning the Dde I and Not I sites (RP4 coordinates 47.55-52.95; ref. 1) that was inserted between the BamHI and XmaIII sites of pBR329 to yield pMS2260 (7) is shown. The hatched portion represents the part of the traf gene used in the construction of pDB173(see also Fig. 2). The endpoint of the deletion present in pGZ1920A114 (8), which lacks the traJ gene, is marked with a bent arrow (A114).pJF166uA2 contains a Not I-Acc I fragment (A2) that was inserted into pJF118EH-(3). tra genes are named by capital letters and directions oftranscription are given by arrowheads. The transfer origin (oriT) is boxed.

the relaxase operon (Fig. 1 and ref. 5) demonstrated that thenatural occurrence of Tral is extremely low even if theoperon is part of a high-copy-number plasmid (5). Therefore,understanding of the gene organization at the traJ/tral junc-tion was an essential prerequisite to direct expression vectorcloning of traf Interpretation ofthe nucleotide sequence wasachieved with the help of the C-terminal sequence ofthe TraJprotein (4) and the N terminus ofTral, which define the 3' and5' ends of the corresponding genes. The previously describedPtac/IacIQ derivative pJF166uA2 (Fig. 1 and ref. 3) served toexpress and isolate a traf gene product of 56 kDa, truncatedat the C terminus but nevertheless suitable to determine theN-terminal sequence. Even under control of the tac pro-moter, tral gene products were not produced in amountsdetectable by Coomassie blue staining. However, with theuse of Tral-specific antiserum (5) to screen column fractionsby the immunoblot technique, a nearly homogeneous TraIA2fraction was obtained. The purification procedure involved

offxtraJM T F L A A K T A G 6 C A*

...G V V R P R A E P * A K H V PS/D S/D

column chromatography on heparin-Sepharose, hydroxylap-atite, and phosphocellulose. TraIA2 was analyzed by micro-sequencing (12) to obtain its N-terminal amino acid sequence(Fig. 2). The sequence data demonstrate that the traf geneuses a GTG as initiation codon, preceded by an atypicallyclose and G-rich potential Shine-Dalgarno sequence. ThetraJ and traf genes are connected by a short open readingframe (orfX) of 13 codons. Seven nucleotides upstream fromits potential initiation codon, ATG, another Shine-Dalgarnosequence is located. The ATG codon overlaps the termina-tion codon TGA of traJ (4). This complicated gene organi-zation might account for the extremely low natural amount ofTral protein.

Construction of a TraI-Overproducing Strain. The strategyfor designing the TraI-overproducing plasmid was guided bythe assumption that Tral expression is downregulated on thetranslational level rather than on the level of transcription(see above). Therefore, to achieve efficient overproduction

tR S I K K S D F A E L V K...

T6GGCGTGGTCCGCCCGAGGGCAGAGCCATGACTTTTTTAGCCG;CTAAACGGCC6GGGGGTGCGCGTGATTGCCACACGTCCCCATGCGCTCCATCMAAGAAGACGACTTCGCGGAGCTGGTGAAGTAACCCGCACCAGGCGGGCTCtCGTCTCGGTACTGAAAAAATCGGCGATTTTGCCGGCCCCCCACGCGCACTAACGGTTCGTGCAGGGGTACGCGAGGTAGTTCTTCTCGCTGAAGCGCCTCGACCACTTCAT

1 I A K H V P N R S I K K S 0 F A E L V K...S/D

AAGCTTGCATGCCTGCAGGTCGACTCTAGAAATAATTTGTTTTCTTTAAGAAGGAGATATA.Attatatgctscaagcacgtccctatgcgetcc TCAAAGACACTTCGCGGAGCTGGTGAAGTATTCGALTGACGTCLAUTCTTTATT AAAAATTGAAMTTCTTCCTCTATATGTATactaiacgttcgtgcagggatacgca"gtagtTCTTCTCGCTGAAGCGCCTCGACCACTTCATHindHI Sphl PS. San Thai Ndal KspM

FIG. 2. (Upper Left) RP4 nucleotide sequence flanking the traI initiation codon. Positions of overlapping arrangements of start and stopcodons between traj, orJX, and tra! are indicated by staggered lines, and those of possible Shine-Dalgarno sequences (S/D) by horizontal lines.An inverted nucleotide sequence repeat also present in RP4/RK2 KorB operator sequences is marked by arrows (4). Amino acid sequencesof TraJ (4), OrfX, and TraI were deduced from the nucleotide sequence. The amino acid sequence of the underlined N-terminal part of Tralwas confirmed by protein microsequencing (12). (Lower Left) Part of the pDB173 nucleotide sequence, beginning from the polylinker. Theribosomal-binding site ofphage T7 gene 10 is indicated by S/D. Nucleotide sequences of synthetic oligodeoxyribonucleotides that were employedto reconstitute codons 1-7 of traI are shown in lowercase letters. Sequences of adaptors reconstructing codons 8-12 are shown in boldfacelowercase letters. The tral initiation codon, which was changed'from GTG (RP4) to ATG (pDB173), is indicated by a short line above thesequence. (Right) Physical and genetic structure of plasmid pDB173. The native translational initiation signal of the RP4 tra! gene was replacedby that of phase T7 gene 10 by insertion of the pGZ1920A114 fragments Ksp6321-Not I (RP4 coordinates 50.61-49.19; ref. 1) and Not I-SspI (RP4 coordinates 49.19-48.33) between the Sma I and Nde I sites of the polylinker sequence of pT7-7. To restore 12 codons at the 5' terminusof traf upstream of the Ksp632I site and to change the traI initiation codon from ATG to GTG, the synthetic oligodeoxyribonucleotides shownin Lower Left served as adaptor molecules between the cohesive ends of Nde I (pT7-7) and Ksp6231 (RP4). Plasmids that carried the adaptorsin the desired orientation (pDB773) were digested with Xba I andBamHI and the 2360-bp fragment carrying the entire tral/traH coding sequencetogether with the phage 1T7 gene 10 translational initiation site was inserted between the Xba I and BamHI sites of the Ptac/lacIQ expressionvector pJF119HE, yielding pDB173. Curved arrows mark the extension of genes: lacIQ (lac repressor), bla (13-iactamase), and rrnB (part of theE. coli rrnB operon containing the gene for 5S rRNA and the transcriptional terminators Ti and T2). oriV is the pBR322 origin of vegetativereplication. The tac promoter is marked by P. DNA carrying the ribosomal binding site of phage 17 gene 10 and the out-of-phase overlappinggene arrangement of traf and traH is symbolized by the black segment.

Proc. Natl. Acad. Sci. USA 87 (1990)

_

aEI'

Dow

nloa

ded

by g

uest

on

Oct

ober

19,

202

0

Proc. Nati. Acad. Sci. USA 87 (1990) 6557

the GTG initiation codon was changed to ATG and the tralcoding region was 'connected to a strong translational initia-tion signal. Plasmid pT7-7 carries the phage T7 promoter 610and the gene 10 ribosomal binding site on a pMB1-typereplicon. The initiation codon of gene 10 is part of a uniqueNde I site that allows one to generate fusion to any codingregion. Appropriate traf gene fragments were combined withsynthetic adaptors to restore the 5' end of the traf gene andinserted downstream from the efficient gene expression sig-

nals ofpT77 (Fig. 2). Upon induction of transcription, strainscarrying either pDB773 or pDB173 overproduced a new bandon gels that amounted to about 10% of the soluble protein(Fig. 3, lane a). This protein was not detectable in theuninduced state (data not shown). Crossreaction with Tral-specific antiserum and comigration with native TraI in SDS/polyacrylamide gels identified the overproduced material as

the product of the traf gene (Fig. 3, lanes f and g).Purification and Physical Properties of TraI Protein. Tral

has been purified by a three-step procedure to near homo-geneity (Fig. 3 and Table 1). Faint bands seen directly belowthe major purification product are most probably degradedpolypeptides, since these bands crossreact with the TraI-specific antiserum (Fig. 3, lane g).The identity of the overproduced Tral protein has further

been verified by determination of its N-terminal amino acidsequence. The sequence obtained matches that of the Nterminus of TraIA2 (Fig. 2). Gel filtration and glycerolgradient centrifugation data suggest that the Tral proteinbehaves as a monomer in solution. The frictional ratiof/f0 =

1.54, indicates an anisometrical shape (13).In Vitro Cleavage at the nic Site of Supercoiled oMT DNA

Requires Tral and TraJ. The hypothesis that gene productsencoded by the RP4 relaxase operon fulfill the requirementfor relaxation of oriT DNA in the absence of host-specifiedproteins was investigated. Product analysis by agarose gel

a b c d e

....~ _

*Ad -'?m

-"m*_nnpI~-*

f h

- PHOS b

BSA

OVA

_CHYA

LYS

FIG. 3. Purification of Tral protein. Samples containing Tralwere electrophoresed in SDS/15% polyacrylamide gels. (Left) Gelstained with Coomassie blue. Lane a, SDS extract of SCS1(pDB173)induced with 1 mM isopropyl f3-D-thiogalactopyranoside; lanes b-d,fractions I-IlI (Table 1; 10, 7.5, and 5 Ag of protein, respectively);lane e, molecular mass standards (1 /ig each): phosphorylase b(PHOS b, 97.4 kDa), bovine serum albumin (BSA, 68 kDa), oval-bumin (OVA, 43.6 kDa), chymotrypsinogen A (CHY A, 25.7 kDa),and lysozyme (LYS, 14.3 kDa). (Right) Immunoblot assay of nativeand overproduced Tral. Lane f, SCS1(pMS2260) [the extract was

enriched for TraI by column chromatography on heparin-Sepharose(5); the applied amount corresponds to 7 OD600 units of cells]; laneg, fraction III (150 ng); lane h, molecular mass standards: fluoresceinisothiocyanate-labeled bovine serum albumin (BSA) and lysozyme(LYS). Immunoblot was photographed under 360-nm UV light.

Table 1. Purification of Tral protein

Protein, % %Fraction Step mg recovery purity*

I Crude extract 219 100 46II Heparin-Sepharose 80.5 49 61III Superose 12 14.2 14 99

Cultures (4 x 1.2 liters) ofSCS1(pDB173) were grown at 370C withshaking. At an OD°6 of 0.5, isopropyl /-D-thiogalactopyranosidewas added to a concentration of 1 mM. Shaking of cells wascontinued for 5 hr; at the end OD660 reached 1.5. The cultures werecentrifuged at 4000 x g for 10 min, cells (1 g of wet weight) wereresuspended in 5 ml of 1mM spermidine tris(hydiochloride)/200 mMNaCl/2 mM EDTA, pH 7.5, and frozen in liquid N2. After the cellswere harvested; all procedures were performed at 0-4VC. Frozencells (13.6 g in 60 ml) were thawed and 35 ml of20o (wt/vol) sucrose,30 ml of 100mM Tris HC1 (pH 7.6), 1 ml oflysozyme (50 mg/ml), 2.25ml of 10% (wt/vol) Brij-58, and 10 ml of 500 mM NaCl were added.After 1 hr at 0C the highly viscous lysate was centrifuged at 100,000x g for 90 min. The pellet, which contained TraI, was washed in 50ml of 10% sucrose/100 mM Tris-HCl, pH 7.6, and centrifuged at100,000 x g for 30 min. To dissolve Tral, the sediment wasthoroughly resuspended in 100 ml of10o sucrose/100 mM Tris HCl,pH 7.6/1 M NaCl and centrifuged again at 100,000 x g for 90 min.To the supernatant (89 ml), 32.84 g of (NH4)2SO4 was added (60%saturation) and the precipitated proteins were collected by centrif-ugation at 25,000 X. g for 20 min. The sediment was resuspended in20 ml of buffer A [20 mM Tris HCl, pH 7.6/1 mM EDTA/1 mMdithiothreitol/10o (wt/vol) glycerol] containing 500 mM NaCI anddialyzed against a 5-fold volume of buffer A/350 mM NaCl (fraction, 20 ml). Fraction 1 (20 ml) was diluted to 100 ml by addition of bufferA/350 mM NaCl and applied at -20 ml/hr to a 25-ml heparin-Sepharose CL-6B column (1.6 x 12.5 cm) equilibrated with bufferA/350 mM NaCl. The column was washed with 150 ml buffer A/350mM NaCl. Proteins were eluted with a 500-ml gradient from 350 to1200mM NaCl in buffer A at a flow rate of 20 ml/hr. Tral was elutedat about 650 mM NaCl (fraction II, 65 ml). Fraction II was concen-trated by dialysis against 20%o (wt/vol) polyethyleneglycol (Mr20,000) in buffer A/500 mM NaCl and applied in 200-Al portions,each containing 2.5 mg of protein, to a Superose 12 column (1 x 30cm) by using the Pharmacia FPLC equipment. Gel filtration wasperformed in buffer A/500 mM NaCI containing 0.01% Brij-58, at aflow rate of 18 ml/hr. The peak fractions were pooled, concentrated,dialyzed against buffer A/500 mM NaCI containing 50o glycerol,and stored at -20°C without loss of activity for at least 6 months(fraction III, 2.2 ml).*Calculated from laser densitometry of Coomassie blue-stained gels.

electrophoresis measured the conversion of superhelical toOC DNA after treatment of the reaction mixtures with SDSand proteinase K. TraI or TraJ alone had no measurableeffect on oriT DNA (Fig; 4I, lanes c and d). However,together the proteins in the presence of Mg2" ions increasedthe amount of OC DNA (Fig. 4I, lanes a and b). Quantifica-tion of the reaction indicated that about 30% of the inputDNA molecules were converted into the OC form (Table 2).The presence of TraH in the reaction mixture under theseconditions had a minor effect. Conversion to the OC formdepended on Mg2+ ions (Fig. 4I, lane e) and reached amaximum after about 30 nfin at 37°C (data not shown). Thereaction took place only with plasmids carrying the RP4 oriTbut-not on the closely related R751 oriT (3), indicating anexclusive substrate specificity (Fig. 4I, lanes f and g).

Cleavage Products of Relaxosomes Reconstituted in Vitroand Those Prepared from Cells Are Identical. The specificityof the cleavage reaction in vitro was further investigated by(i) separation of single-stranded DNA of linearized plasmidsin alkaline agarose gels (3), (ii) demonstration that Tral wasattached to the 5' nucleotide at the relaxation nick (5), and(iii) determination of the 5'-terminal nucleotide via "run-off'products (Fig. 5). Only the latter experiment is shown,confirming that the position of 5'-terminal nucleotides wereidentical independent of whether the relaxosomes were re-constituted in vitro or isolated from cells.

Bioche'mistry: Pansegrau et al.

Dow

nloa

ded

by g

uest

on

Oct

ober

19,

202

0

6558 Biochemistry: Pansegrau et al.

oc

ccC

~~~~~~~~~~~~~~~R

FIG. 4. (I) Specific relaxation of supercoiled oriT plasmid DNAby RP4-specified Tra proteins. Relaxed intermediates were preparedas described in Materials and Methods and electrophoresed in a 0.7%agarose gel (89 mM Tris borate, pH 8.0/2 mM EDTA) at 1.5 V/cm.Lanes a-e: pJF145n (RP4 oriT, 0.7 ,ug of DNA); a, proteins omitted;b, 100 ng of Tral and 50 ng of TraJ; c, 50 ng of TraJ; d, 100 ng ofTral;e, 100 ng of Tral and 50 ng of TraJ, MgCl2 omitted. Lanes f and g:pWP392n (R751 oriT, 0.7 ,ug of DNA); f, proteins omitted; g, 100 ngof Tral and 50 ng of TraJ. (II) Relaxosome formation of supercoiledoriT plasmid DNA with RP4 DNA relaxase. Protein-DNA com-plexes were assembled as described in Materials and Methods andelectrophoresed without SDS in a 0.7% agarose gel (40mM Tris OAc,pH 7.9/5 mM NaOAc/1 mM EDTA) at 5 V/cm. Lanes a-f: pJF145n(RP4 oriT, 0.7 ,g); a, proteins omitted; b, 250 ng of TraH, 100 ng ofTral, and 50 ng of TraJ; c, 250 ng of TraH and 50 ng of TraJ; d, 250ng ofTraH and 100 ng of Tral; e, 100 ng of Tral, 50 ng of TraJ; f, 250ng of TraH, 100 ng of Tral, and 50 ng of TraJ, MgCl2, omitted. Lanesg and h: pWP392n (R751 oriT, 0.7 jig); g, proteins omitted; h, 250 ngof TraH, 100 ng of Tral, and 50 ng of TraJ. Positions of OC and CCCplasmid DNA and of relaxosomes (REL) are indicated.

Supercoiled oriT Plasmid DNA Is Stably Complexed in thePresence of Three Plasmid-Specified Components. The com-bination of Tral and TraJ proteins essential for specificcleavage did not alter the mobility of supercoiled oriT plasmidDNA during agarose gel electrophoresis under conditionsthat preserve protein secondary structure (Fig. 4Il, lane e).Addition of the third gene product of the relaxase operon-the acidic protein TraH-decreased the electrophoretic mo-bility of the supercoiled DNA species, diagnostic of stablecomplex formation (Fig. 411, lanes a and b). The Tra proteinsappeared to recognize only superhelical DNA because OCDNA remained unaltered. In contrast to the requirements ofthe nicking reaction, complex formation itself was not de-pendent on the presence of Mg2" ions (Fig. 4II, lane f). Asexpected, the heterologous R751 transfer origin could not becomplexed by RP4 relaxosomal components (Fig. 4II, lanesg and h).

Table 2. Requirements for specific relaxation of supercoiledplasmid DNA

% specificallyComponent relaxed plasmidomitted DNA*

None 33TraH 30Tral <2TraJ <2Mg2+ <2RP4 oriTt <2

*Calculated from laser densitometry of ethidium bromide-stainedagarose gels.tpWP392n plasmid DNA (R751 oriT) was used instead of pJF145n(RP4 oriT).

A T G C

I,

a...

*

.

W

o -.'..0

A

.0

11A T G C

C GG CC GC GCCA TC G

C G

G C

A T

T A .G CAA'T A.

A 8T AA T'

A T

GGCG c

Ac G

0

FIG. 5. Nucleotide sequencing of the 5' terminus of specificallyrelaxed oriT plasmid DNA. (I) supercoiled pJF145n plasmid DNA(10 ,ug) was incubated with Tral and TraJ (2 and 1 jig, respectively)under standard conditions in a total volume of 150 ,ul. After 45 minat 37°C relaxed intermediates were captured and OC plasmid DNAwas isolated by preparative electrophoresis in a 0.7% agarose gel. (11)Specifically relaxed plasmid DNA was isolated from SCS1-(pMS226n) (5). DNAs were used as substrates in sequencing reac-tions as described (5). Reactions were initiated at a 17-mer primer(ACTTTCCTTGGTGTATC) hybridizing 18 bp downstream from therelaxation nick site. R marks the position of "run-of' products; thenucleotide position of the nic site is indicated by a wedge. The rightpart of a 19-bp inverted repeat and an imperfect palindromic se-quence are marked by arrows, with mismatches shown by dots.

The oriT Region Is Associated with a TraH/I/J-MediatedNucleoprotein Structure. The reasonably high stability of thecomplexes observed by agarose gel electrophoresis (Fig. 41I,lane b) facilitated their visualization by electron microscopy(Fig. 6I). To determine whether dots visible on superhelicalDNA always had a preferred location, nucleoprotein com-plexes were formed using supercoiled plasmid DNA, fixed byglutaraldehyde, and linearized with restriction endonucleasePvu I (data not shown) or Ava I (Fig. 6II). The analysisrevealed a sharp peak (50-bp width) indicating that themajority of protein accumulated at the transfer origin ap-proximately ±25 bp around the nic site. The apparent lengthof the DNA molecules remained unaltered. As demonstratedin agarose gels, DNA supercoils were required for complexformation. Analysis of a large number of complexed DNAmolecules, supercoiled as well as subsequently linearized,revealed a frequent coincidence of the protein position witha sharp bend of the DNA, suggesting that a highly orderednucleoprotein structure was formed.

DISCUSSIONOur results demonstrate that functional relaxosomes can bereconstituted by applying gene products exclusively speci-fied by the relaxase operon of plasmid RP4. Thus, host-encoded products are probably not required for the earlysteps of initiation of IncP transfer DNA replication. Onepossible pathway for the assembly of relaxosomes involves acascade-like mechanism: TraJ protein binds to the transferorigin by recognizing the right arm of a 19-bp inverted repeatsequence (4). The TraJ-oriT complex detectable by gel elec-

Proc. Natl. Acad. Sci. USA 87 (1990)

Dow

nloa

ded

by g

uest

on

Oct

ober

19,

202

0

Proc. Natl. Acad. Sci. USA 87 (1990) 6559

I

rs

:..-.:

*:, ,,

|| BamHItraJ

.(I3.

0D

a) O7o Mc

U,

,q0

z,) oQ

z

60

40

20

Aval

nic. <K

Pvul EcoRi BamHI BamHI

BamHI

Aval

FIG. 6. Electron microscopy of relaxosomes. (I) Protein-DNAcomplexes were assembled from supercoiled pJF145n DNA (4612bp) and TraH, -I, and -J under standard conditions, fixed withglutaraldehyde, and prepared for electron microscopy as described(14). Arrowheads mark the positions of bound Tra proteins. (Bar =1000 bp.) (II) Histogram depicts the frequency distribution of thelocation of bound Tra proteins on pJF145n plasmids that afterfixation were linearized at the Ava I recognition site; 119 moleculeswere measured and aligned. Positions of relevant restriction endo-nuclease recognition sites are indicated. The black box marks theRP4 oriT region. Details are shown above: the 5' end of the traJ geneis represented by the shaded segment; positions of inverted sequencerepeats are indicated by arrows. P marks the positions of thedivergent promoter sites PL1 and PR1 (1), and nic the location of thecleavage site (5). (Inset) Two representative linearized protein-DNAcomplexes. Arrows indicate bound proteins. (Bar = 1000 bp.)

trophoresis (3, 4) must be the target for Tral protein associ-ation because a specific Tral binding to oriT was not found.The stabilizing effect of TraH on the nucleoprotein structuresuggests that TraH is an additional component of the relax-osome. TraH is an acidic oligomeric protein of identicalsubunits without any detectable oriT binding properties. Tralor TraJ complex with TraH in the absence of oriT DNA as

detected by glycerol gradient centrifugation and columnchromatography (unpublished results). This in addition sup-ports the idea that TraH stabilizes the TraJ-TraIoriT struc-ture via protein-protein interactions. However, further rolesof TraH are likely. Superhelical DNA functions as thepreferred substrate for complex assembly and cleavage,probably because the predominant conformation of plasmidDNA in cells is the supercoil. Although complete complex-

ation of superhelical plasmids with Tra proteins could beachieved, upon capturing ofcleaved intermediates only about30% were converted to the OC form (Table 2). This couldmean that a considerable fraction of our relaxase preparationwas inactive with respect to nicking but still active in bindingto DNA. Alternatively, the method of "inducing" the nickingreaction (15) in fact could freeze a thermodynamic equilib-rium between noncovalently complexed CCC plasmid DNAand nicked plasmid DNA, the latter kept in the superhelicalstate by covalent and noncovalent interactions with tra geneproducts. Action of the relaxase at oriT therefore couldresemble that of a type I topoisomerase, conserving part ofthe energy of the cleaved phosphodiester bond via formationof the covalent Tral-oriT intermediate. Actually, under cer-tain conditions a variety of topoisomers released from relax-osomes can be observed (data not shown). Thus, the relax-osome might possess the intrinsic capacity to break andreseal its target DNA strand in a reversible reaction withoutadditional cofactors. Other plasmid maintenance functions,such as vegetative replication or transcription, therefore maynot be disturbed by presence of the relaxosome. However,the mechanism by which the relaxosome in vivo is used by theplasmid-encoded DNA-transfer machinery during the conju-gative process remains to be elucidated.

We are grateful to Heinz Schuster for generous support andstimulating discussions. We thank Stanley Tabor for providing theexpression vector pT7-7. The expert technical assistance of Mari-anne Schlicht and Beate Dobrinski is greatly appreciated. This workwas financially supported by Sonderforschungsbereich Grant 344/B2 of the Deutsche Forschungsgemeinschaft.

1. Guiney, D. G. & Lanka, E. (1989) in Promiscuous Plasmids ofGram-Negative Bacteria, ed. Thomas, C. M. (Academic, Lon-don), pp. 27-56.

2. Heinemann, J. A. & Sprague, G. F., Jr. (1989) Nature (Lon-don) 340, 205-209.

3. Furste, J. P., Pansegrau, W., Ziegelin, G., Kroger, M. &Lanka, E. (1989) Proc. Natl. Acad. Sci. USA 86, 1771-1775.

4. Ziegelin, G., Furste, J. P. & Lanka, E. (1989) J. Biol. Chem.264, 11989-11994.

5. Pansegrau, W., Ziegelin, G. & Lanka, E.(1990) J. Biol. Chem.265, 10637-10644.

6. Hanahan, D. (1983) J. Mol. Biol. 166, 557-580.7. Pansegrau, W., Ziegelin, G. & Lanka, E. (1988) Biochim.

Biophys. Acta 951, 365-374.8. Ziegelin, G. (1989) Dissertation (Freie Universitat, Berlin).9. Furste, J. P., Pansegrau, W., Franck, R., Blocker, H., Scholz,

P., Bagdasarian, M. & Lanka, E. (1986) Gene 48, 119-131.10. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular

Cloning:A Laboratory Manual (Cold Spring Harbor Lab., ColdSpring Harbor, NY).

11. Towbin, H., Staehelin, T. & Gordon, J. (1979) Proc. Natl.Acad. Sci. USA 76, 4350-4354.

12. Hewick, R. M., Hunkapiller, M. W., Hood, L. E. & Dreyer,W. J. (1981) J. Biol. Chem. 256, 7990-7997.

13. Siegel, L. M. & Monty, K. J. (1966) Biochim. Biophys. Acta112, 346-362.

14. Perez-Martin, J., del Solar, G. H., Lurz, R., de la Campa,A. G., Dobrinski, B. & Espinoza, M. (1989) J. Biol. Chem. 264,21334-21339.

15. Guiney, D. G. & Helinski, D. R. (1979) Mol. Gen. Genet. 176,183-189.

I _ TT

Biochemistry: Pansegrau et al.

Dow

nloa

ded

by g

uest

on

Oct

ober

19,

202

0