76
פרופ. מיכל זיו- יוקלסון המחלקה למדעי המחשב, א" בג[email protected] http://www.cs.bgu.ac.il/~negevcb/index.php String Algorithms Computational Biology Structural RNAomics

String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

  • Upload
    others

  • View
    7

  • Download
    0

Embed Size (px)

Citation preview

Page 1: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

יוקלסון-מיכל זיו. פרופ

בג"א, המחלקה למדעי המחשב

[email protected]

http://www.cs.bgu.ac.il/~negevcb/index.php

String Algorithms

Computational Biology

Structural RNAomics

Page 2: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure
Page 3: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure
Page 4: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Outline

• RNA and its structure.

• The “RNA Revolution” and principles of regulation by non-coding RNAs

• RNA structure implies function: deciphering the evidence

Page 5: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Outline

• RNA and its structure.

• The “RNA Revolution” and principles of regulation by non-coding RNAs

• RNA structure implies function: deciphering the evidence

Page 6: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

What is RNA?

• A biological molecule, composed as a

sequence over 4 types of building blocks

called bases or nucleotides.

• The different base types are denoted by

the letters A, G, C, and U.

Page 7: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

•RNA bases A,C,G,U

•Canonical Base Pairs

–A-U

–G-C

–G-U

“wobble” pairing

–Bases can only pair with

one other base.

/

2 Hydrogen Bonds3 Hydrogen Bonds – more stable

What is RNA?

Page 8: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

RNA Structure, Dimensions 1- 3 : Folding

Page 9: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

RNA Quaternary structure:

microRNA:mRNA

Wang, et al.,

(PlosCB 2010)1

Bicoid mRNA

Dimerization.

Ferrandon et al.,

(EMBO 1997)

RNA Structure, Dimension 4 : Self -Dimerization and RNA-RNA

interactions

Page 10: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Zhang W , Chen S PNAS 2002;99:1931-1936

©2002 by National Academy of Sciences

RNA Structure, Dimensions 5: Folding dymamics

Page 11: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Outline

• RNA and its structure.

• The “RNA Revolution” and principles of regulation by non-coding RNAs

• RNA Structure prediction from sequences

Page 12: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

> DNA sequence

AATTCATGAAAATCGTATACTGGTCTGGTACCGG

CAACACTGAGAAAATGGCAGAGCTCATCGCTAAA

GGTATCATCGAATCTGGTAAAGACGTCAACACCA

TCAACGTGTCTGACGTTAACATCGATGAACTGCT

GAACGAAGATATCCTGATCCTGGGTTGCTCTGCC

ATGGGCGATGAAGTTCTCGAGGAAAGCGAATTTG

Gene Function

> Protein sequence

MKIVYWSGTGNTEKMAELIAKGIIES

GKDVNTINVSDVNIDELLNEDILILGC

SAMGDEVLEESEFEPFIEEISTKISG

KKVALFGSYGWGDGKWMRDFEER

MNGYGCVVVETPLIVQNEPDEAEQD

CIEFGKKIANI

The Central Dogma of Molecular Biology

RNADNA PROTEIN

Page 13: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Genome: The digital backbone

of molecular biology

Transcripts: Perform functions

encoded in the genome

The Central Dogma of Molecular Biology

Page 14: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

What are RNA and mRNA?

• Traditional role as messenger molecule (mRNA)

• RNA: a polymer of nucleotides A,U,C,G.

CS374 Stanford

RNA

AUUGCCGAUGACGGCAGUGAUGUAGUA

Page 15: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

• Traditional role as messenger molecule (mRNA)

• RNA: a polymer of nucleotides A,U,C,G.

CS374 Stanford

RNA

AUUGCCGAUGACGGCAGUGAUGUAGUA

Down Regulation by mRNA Silencing

Page 16: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Up Regulation by mRNA stabilization

CS374 Stanford

RNA

AUUGCCGAUGACGGCAGUGAUGUAGU

binding site

Page 17: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

The Central Dogma of

Molecular Biology

Protein

RNA

DNA

transcription

translation

CCTGAGCCAACTATTGATGAA

PEPTIDE

CCUGAGCCAACUAUUGAUGAA

שעתוק

תרגום

Page 18: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

18

The Central Dogma of

Molecular Biology

Protein

RNA

DNA

transcription

translation

Non Coding RNA

- RNA molecule that is not translated into a protein

- Have been found to have roles in a great variety of processes

Page 19: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

הדוגמה המרכזית של הביולוגיה

DNA

RNA

PROTEINS

DNA

RNA

PROTEINS

Ron Unger – Bar-Ilan University 2009

RNA: the molecule of the year 2002.Couzin J. (2002). Breakthrough of the Year:

Small RNAs Make Big Splash. Science 298, 2296.

Page 20: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

20

Andrew Z. Fire Craig C. Mello

The Nobel Prize in Physiology or Medicine 2006

"for their discovery of RNA interference - gene

silencing by double-stranded RNA"

A Recent Example

DNA RNA Protein

Page 21: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

21

AUUGCCGAUGACGGCAGUGAUGUAGUA

CCGUCAC

Shutting down a gene by via a hybridization between an mRNA

and a complementary small RNA that prevents it from being

translated into a protein.

Anti-Sense:RNA complementarity yields gene silencing

Interpretation: the light-blue rectangle symbolizes the Ribosome,

the gray cloverleaf represents the tRNA

and the green circle and amino acid

Page 22: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

22

AUUGCCGAUGACGGCAGUGAUGUAGUA

CCGUCAC

Shutting down a gene by via a hybridization between an mRNA

and a complementary small RNA that prevents it from being

translated into a protein.

Anti-Sense:RNA complementarity yields gene silencing

Page 23: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

23

AUUGCCGAUGACGGCAGUGAUGUAGUA

CCGUCAC

However, the single stranded anti-sense fragments

are unstable, digested by proteins, and seemingly not

very useful as a therapy.

Anti-Sense:RNA complementarity yields gene silencing

Page 24: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

RISC

AUUGCCGAUGACGGCAGUGAUGUAGUA

Down Regulation by mRNA degradation

Page 25: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

GCUACUG

RISC

AUUGCCGAUGACGGCAGUGAUGUAGUA

binding site

Down Regulation by mRNA degradation

Page 26: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

AUUGCCGAUGACGGCAGUGAUGUAGUAGCUACUG

RISC

binding site

Down Regulation by mRNA degradation

Page 27: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

AUUGCCGAUGACGCUACUG

RISC

binding site

Down Regulation by mRNA degradation

Page 28: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

GCUACUG

RISC

AUUGCCGAUGAC

binding site

Down Regulation by mRNA degradation

Page 29: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

GCUACUG

RISC

AUUGCCGAUGAC

binding site

Down Regulation by mRNA degradation

Page 30: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

GCUACUG

RISC

AUUGCCGAUGAC

binding site

Down Regulation by mRNA degradation

Page 31: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

GCUACUG

RISC

AUUGCCGAUGAC

binding site

Down Regulation by mRNA degradation

Page 32: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

RNAסוגי מולקולות ....רשימה חלקית

Ron Unger – Bar-Ilan University 2009

Page 33: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

RNAסוגי מולקולות ....רשימה חלקית

Ron Unger – Bar-Ilan University 2009

Long non-

coding RNAs

Page 34: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

http://rfam.sanger.ac.uk/

Ron Unger – Bar-Ilan University 2009

Page 35: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure
Page 36: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure
Page 37: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

?ncRNAבאילו תהליכים משתתפות מולקולות

• Translation (tRNA and rRNA)

• Ribosome maturation and RNA processing (snRNA and snoRNA)

• Splicing (U1, U2, U4, U5)

• Replication (telomerase RNA)

• Gene regulation (miRNA, siRNA)

• Editing (rna editing, e.g. serotenin receptor)

• Protein translocation (SRP RNA)

• Fighting pathogens (vRNA, CRISPR)

• Translation quality control (tmRNA).

Ron Unger – Bar-Ilan University 2009

Page 38: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

noncoding RNAבקרה על ידי

הסבר אפשרי לחידת המורכבות שכן מבחינת עולם החלבונים אין הבדל גדול בין תולעים

.ובני אדם

Introns, Intergenic Regions, Repetitive sequences: מהרצף שמבוטא אינו מתורגם לחלבונים95%

:באופן כללי אורך וכמות האינטרונים קשורה במורכבות האורגניזם

100bpמהטרנסקריפטים יש אינטרונים באורך של כ 10-20%באוקריוטים פשוטים ל

500bpמהטרנסקריפטים יש אינטרונים באורך ממוצע של 50%בצמחים ל

500bpגם בנמטודות וזבובים האורך הממוצע הוא

3400bpבבני אדם האורך הממוצע של אינטרונים הוא

ncRNA רבים שוכנים בתוך אינטרונים

RNAהתא מקדיש מנגנונים רבים לטיפול ב

יותר מחצי מהם 456bpקטעי רצף שמורים באורך ממוצע של 400,000בין אדם לכלב ישנם כ

.אינם קשורים לגנים המקודדים לחלבונים

קשורים למנגנוני בקרה שתורמים למורכבות של יצורים ncRNAיתכן ש

Ron Unger – Bar-Ilan University 2009

Page 39: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

ncRNAיתרונות הבקרה על ידי

מאפשרים בקרה גמישה ויעילה כמו שבמערכות תקשורת מודרניות ncRNAבקרה על ידי

.קווי הבקרה נפרדים מקווי הנתונים

בקרה כזאת מאפשרת למשל לבצע עידכונים

בזמן אמת ללא צורך ליצר מולקולות חדשות

,בקרה כזו מאפשרת למשל סינכרון של פעילות

למשל

ncRNAכאשר גן חלבוני משועתק מולקולות

הנמצאות באינטרונים שלו יכולות לדווח על יצור

החלבון

Mattick J. Non-coing RNAs: the architects of eukaryotic complexity.

Embo Reports, 21:986-991, 2001.

Ron Unger – Bar-Ilan University 2009

Page 40: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

?בגנום ncRNAמדוע קשה לאתר מולקולות

אין לנו כלים נסיוניים טובים לאתר מולקולות כאלו במיוחד כאלה שהן קצרות חיים ונמצאות

.בכמויות קטנות

:מבחינה ביואינפרמטית הבעיה היא שבניגוד לחלבונים בהם ניתן להעזר בסיגנלים כמו

Start and Stop codons ,אין אנו מכירים סיגנלים ', וכו, פרומוטורים, מחזוריות הקודונים

:ncRNAכלליים כאלו לגבי

ניבוי מבנה שניוני: אז מה יש לנו

בין אורגניזמים(של רצף ומבנה)שימור

.סיגנלים ספציפיים למשפחות מסוימת

Ron Unger – Bar-Ilan University 2009

Page 41: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Outline

• RNA and its structure.

• The “RNA Revolution” and principles of regulation by non-coding RNAs

• RNA structure implies function: deciphering the evidence

Page 42: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Why is RNA Structure Interesting?

Page 43: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Accessible RNA binding sites

Page 44: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Binding site accessibility

A motif has to be accessible to binding

Page 45: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Binding site accessibility

A motif has to be accessible to binding

Page 46: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Binding site accessibility

A target-site motif accessible to binding

Page 47: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

GCUACUG

RISC

AUUGCCGAUGAC

binding site

Down Regulation by mRNA degradation

RNA Structure Prediction

Challenges ?

Page 48: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Ron Unger – Bar-Ilan University 2009

Page 49: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

51A target Gene

Conserved sequence in stem of “hairpin” structure

Page 50: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

52A target Gene

Conserved sequence in stem of “hairpin” structure

Page 51: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

54

Dicer

Gene

Conserved sequence in stem of “hairpin” structure

A target GeneAn inverted repeat

Page 52: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

55

Gene

Conserved sequence in stem of “hairpin” structure

A target GeneAn inverted repeat

Page 53: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

56

Gene

Conserved sequence in stem of “hairpin” structure

A target GeneAn inverted repeat

Page 54: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

57

Gene

Conserved sequence in stem of “hairpin” structure

A target GeneAn inverted repeat

Page 55: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

58

Gene

Conserved sequence in stem of “hairpin” structure

A target GeneAn inverted repeat

Page 56: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

59

Gene

Conserved sequence in stem of “hairpin” structure

A target GeneAn inverted repeat

Page 57: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

60

Conserved sequence in stem of “hairpin” structure

A target GeneAn inverted repeat

Witness 3: Structural (Co-evolutionary) Conservation –

Hairpin structure adapted for recognition by Drosha/Dicer

Within the hairpin structure, conserved sequence preserves

Complementarity with target site.

Page 58: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Problem 1a

Find these

Page 59: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Problem 1b

How do these fold?

Page 60: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Problem 2a

How to predict these?

Page 61: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Problem 2b

What are the targets

these bind to?

Page 62: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

How to Solve Problem 1a

Find these

Page 63: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

“GGUAU” “CCGUA”

GGUAU

CCGUA

[Mandal et al., 2003] predicted a potential pseudoknot between the two arms of the purine riboswitch aptamer.

Structural Cis-Elements: Purine Riboswitch

Page 64: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

“GGUAU” “CCGUA”

GGUAU

CCGUA

[Mandal et al., 2003] predicted a potential pseudoknot between the two arms of the purine riboswitch aptamer.

Structural Cis-Elements: Purine Riboswitch

Page 65: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure
Page 66: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Three Structural Witnesses for RNA functionality

Witness 1: Structure Stability.

Witness 2: Conserved Structure.

Witness 3 : Conserved Sequence (within its structural context).

Page 67: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

AUCCCCGUAUCGAUC

AAAAUCCAUGGGUAC

CCUAGUGAAAGUGUA

UAUACGUGCUCUGAU

UCUUUACUGAGGAGU

CAGUGAACGAACUGA

Witness 1: Stability of Structure

Measurements of Stability:

Max Base Pairs

Minimum Free Energy

Partition Function

Statistical Scores based on SCFGs/Machine Learning

Page 68: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Lactobacillus acidophilus Lactobacillus delbrueckii

G-U U-A

Witness 2: Conserved Structure

Page 69: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Lactobacillus acidophilus Lactobacillus delbrueckii

G-C C-G

Witness 2: Conserved Structure

Page 70: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Lactobacillus acidophilus Lactobacillus delbrueckii

U-A C-G

Witness 2: Conserved Structure

Page 71: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Lactobacillus acidophilus Lactobacillus delbrueckii

CAUCUUUGA CAUCUCUGA

Witness 3: Conserved Sequence(within its structural context)

Page 72: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Sequence and Structure Conservation in the context of

imprinted structural conservation

Lactobacillus acidophilus Lactobacillus delbrueckii

GGUAU

CCGUA

GGUAU

CCGUA

Page 73: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Three Structural Witnesses for RNA functionality

Witness 1: Structure Stability.

Witness 2: Conserved Structure.

Witness 3 : Conserved Sequence (within its structural context).

Page 74: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Three Structural Witnesses for RNA functionality

Witness 1: Structure Stability.

Witness 2: Conserved Structure.

Witness 3 : Conserved Sequence (within its structural context).

Page 75: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

AUCCCCGUAUCGAUC

AAAAUCCAUGGGUAC

CCUAGUGAAAGUGUA

UAUACGUGCUCUGAU

UCUUUACUGAGGAGU

CAGUGAACGAACUGA

Witness 1: Stablity of Structure (2D, predicted)

RNA Secondary Structure Prediction: O(N3):

[Nusssinov-Jacobson 1980, Zuker-Stiegler-1981]

MFOLD: http://www.rpi.edu/~zukerm

Vienna RNA Package: http://www.tbi.univie.ac.at/~ivo/RNA

Page 76: String Algorithms Computational Biology Structural …tabio152/wiki.files/NCRNA_bio...String Algorithms Computational Biology Structural RNAomics Outline • RNA and its structure

Nussinov Algorithm