Studies on the Development of the High Efficacy Methods for … · shifting between invasive and replicative stages in both the mammalian host and mosquitoes. Parasite development

TitleStudies on the Development of the High Efficacy Methods forGenerating Transgenic Parasites in Rodent Malaria Model( 本文(Fulltext) )

Author(s) 曽賀, 晃

Report No.(DoctoralDegree) 博士(獣医学) 甲第508号

Issue Date 2018-09-21

Type 博士論文

Version ETD

URL http://hdl.handle.net/20.500.12099/77269

※この資料の著作権は、各資料の著者・学協会・出版社等に帰属します。

Studies on the Development of the High Efficacy Methods for

Generating Transgenic Parasites in Rodent Malaria Model

2018

The United Graduate School of Veterinary Science, Gifu University (Obihiro University of Agriculture and Veterinary Medicine)

SOGA, Akira

I

CONTENTS

CONTENTS I

ABBREVIATIONS IV

UNIT ABBREVIATIONS VI

GENERAL INTRODUCTION 1

1. Malaria 1

2. Lifecycle of the malaria parasites 3

3. Rodent malaria parasites 4

4. Plasmodium berghei 5

5. Traditional genetic manipulation method of P. berghei 6

6. Recent trends and problems of genetic manipulation in P. berghei 8

7. Objective of this study 11

CHAPTER 1

High efficacy in vitro selection procedure for generating transgenic parasites of P. berghei

using an antibiotic toxic to rodent hosts

1-1: Introduction 12

1-2: Materials and Methods 13

II

1-3: Results 20

1-4: Discussion 24

1-5: Summary 27

CHAPTER 2

Development of a bsd-blasticidin selection system in P. berghei



2-3: Results 50

2-4: Discussion 53

2-5: Summary 56

CHAPTER 3

Improvement of in vitro selection method in P. berghei



3-3: Results 74

III

3-4: Discussion 76

3-5: Summary 78

GENERAL DISCUSSION 87

GENERAL CONCLUSION 91

ACKNOWLEGEMENTS 93

REFERENCES 94

IV

ABBREVIATIONS

A ACT artemisinin combination therapy

AIDS acquired immune deficiency syndrome

B bsd: blasticidin S deaminase gene

C cl.: clone

D dhfr-ts dihydrofolate reductase-tymidylate synthase gene

E eGFP: enhanced green fluorescence protein

egfp: egfp gene

F FBS: fetal bovine serum

G GFP: green fluorescence protein

gfp: gfp gene

H hdhfr: human dihydrofolate reductase-thymidylate synthase gene

HIV human immunodeficiency virus

I IC inhibitory concentration

ITR: inverted terminal repeat

i. v.: intravenous injection

N n. s.: not significant

P pac: puromycin-N-acetyltransferase gene

V

pbdhfr-ts: P. berghei dihydrofolate reductase-thymidylate synthase gene

pbef-1 P. berghei elongation factor 1 alpha gene

pbhsp70: P. berghei heat shock protein 70 gene

PBS: phosphate-buffered saline

R RBC: red blood cell

RDT: rapid diagnostic test

RT: room temperature

S spect2: sporozoite microneme proteins essential for the cell traversal 2

gene

SDS Sodium dodecyl sulfate

W WHO World Health Organization

VI

UNIT ABBREVIATIONS

B bp: base pair

D ºC: degree Celsius

H h: hour

K kbp: kilobase pair

L l: liter

M μg: microgram

mg: milligram

min: minute

μl: microliter

μm: micrometer

μM: micromolar

N ng: manogram

1

GENERAL INTRODUCTION

1. Malaria

Malaria is a mosquito-borne disease caused by apicomplexan parasites of the genus

Plasmodium and remains one of the leading infectious diseases causing high morbidity and

mortality in humans globally. Nearly half of the world’s population is potentially exposed to

the infection, and an estimated 216 million clinical cases and 445,000 deaths were reported in

2016 (100). Most malaria cases and deaths in 2016 were recorded in the African region

(90% and 91%, respectively).

There are five Plasmodium species that cause malaria in humans, Plasmodium

falciparum (P. falciparum), P. vivax, P. ovale, P. malariae and P. knowlesi. Plasmodium

falciparum is considered devastating and is the most prevalent malaria parasite in

sub-Saharan Africa. Plasmodium vivax is the dominant malaria parasite in most of the

countries outside of sub-Saharan Africa, and it is estimated that deaths due to vivax malaria is

increasing (13, 77). Plasmodium ovale and P. malariae are less common but can cause

significant diseases (13). Recently, infection of simian parasite P. knowlesi in humans has

emerged as zoonosis in several countries in Southeast Asian countries, where it is

predominantly a zoonosis (1, 8, 13, 96). However, there is no definite evidence of primary

human to human transmission of this parasite (13).

Malaria is an acute febrile illness. In a non-immune individual, symptoms appear

approximately ten days after infection (100). The first symptoms are non-specific, including

fever, headache, chills and muscle pains; however, if not treated within 24 hours, P.

falciparum malaria can progress to severe illness, often leading to death (100). Children

with severe malaria frequently develop one or more of the following symptoms: severe

2

anemia, respiratory distress in relation to metabolic acidosis or cerebral malaria (100). In

adults, multiorgan disorder is also frequent (100). In particular, children under age five

years old, pregnant women, patients with human immunodeficiency virus (HIV)/acquired

immune deficiency syndrome (AIDS) and non-immune travelers have a considerably higher

risk of severe malaria (13). In endemic areas, it is estimated that more than 70% of malaria

deaths occur in this age group of children (100).

Early diagnosis and treatment of malaria are critical to effective disease management.

The World Health Organization (WHO) recommends that all suspected patients malaria

should be treated based on a confirmatory diagnosis by microscopic examination and rapid

diagnostic test (RDT) (98). RDTs are lateral flow immunochromatographic

antigen-detection tests which detect specific antigens produced by malaria parasites in the

blood of patients. Artemisinin combination therapy (ACT) is recommended as a first-line

treatment for P. falciparum malaria, whereas the treatment with chloroquine or ACT is

recommended for P. vivax, P. ovale, P. malariae and P. knowlesi malaria (98).

Many antimalarial drugs, insecticides and insecticide-treated mosquito nets have been

used to control malaria; however, the emergence and spread of drug-resistant parasites and

insecticide-resistant mosquitoes are public health concerns in endemic areas (97). ACTs

have been integral to the recent success of global malaria control (21); thus, protecting their

efficacy for the treatment of malaria is a global health priority. However, although

artemisinin resistance has not been reported in Africa, multidrug resistance to artemisinin and

partner drugs has been reported in five countries of the Greater Mekong subregion (3, 17, 21,

73, 99), which has raised serious concerns about the continued efficacy of ACTs therapies.

Currently, mosquito resistance to several insecticides has emerged in many countries (15, 39,

41, 67, 72, 105). The spread of resistance to pyrethroids, which are currently the most

3

widely used insecticides for mosquito control in endemic areas, has become an important

issue in vector control (107). Furthermore, there is currently no antimalarial vaccine

available for clinical use, although clinical field trials of the pre-erythrocytic vaccine

RTS,S/AS01, an anti-sporozoite vaccine, show partial efficacy (5, 10, 12, 17, 34).

Consequently, high priority is being placed on development of novel strategies to control

malaria.

2. Lifecycle of the malaria parasites

Malaria parasites are transmitted to the mammalian host through the bite of infected

female Anopheles mosquitoes (17). The parasite takes many forms during its life cycle,

shifting between invasive and replicative stages in both the mammalian host and mosquitoes.

Parasite development in the mammalian host starts when a female Anopheles mosquito

deposits sporozoite, which is the invasive form, into the dermis of the mammalian hosts (82).

After reaching a blood vessel, the injected sporozoites move to the liver through the blood

stream, exit the liver sinusoids and then invade hepatocytes (82). After traversing several

hepatocytes, the parasite develops into a matured schizont containing thousands of merozoites

(83). The merozoite is released into the blood stream after the rupture of the schizonts, then

invades red blood cell (RBC), and repeats asexual replication. This replication leads to the

onset of disease (82). During the asexual replication, some parasites occasionally

differentiate into male and female gametocytes, which are the invasive form to the mosquitoes.

When a mosquito ingests the sexual stages during a blood meal, fertilization of gametes

occurs in the midgut with the formation of a zygote (17, 82). The zygote differentiates into a

motile ookinete, which traverses the midgut wall of the mosquito. The ookinete develops

into an oocyst at the midgut basal lamina. During the oocyst stage, the parasite undergoes

4

sporogony to produce thousands of sporozoites (89). Once the oocyst has matured, it

ruptures and releases sprozoites into the hemolymph. The sporozoite invades the salivary

glands, matures, and is transmitted to a new host during the next blood meal (89).

3. Rodent malaria parasites

Rodent malaria parasites are used as a model to study malaria. These parasites do not

cause malaria in humans, and their full lifecycles can be reproduced in a laboratory. The

basic biology of rodent malaria parasites is similar to that of human malaria parasites, and

housekeeping genes and biochemical processes are conserved between them (48). The

genome organization and genetics are also conserved between the rodent and human parasites,

and methodologies for genetic manipulation are available (48). In addition, rodent hosts

have extensively characterized genetic backgrounds and several transgenic lines are available

(48, 104). Thus, rodent malaria parasites are a valuable model for investigating the

developmental biology of malaria parasites, parasite-host interactions and vaccine/drug

development. Four species, P. berghei, P. yoelii, P. chabaudi and P. vinckei, and their

various strains (e.g. P. yoelii XL, P. yoelii 17XNL) have been adapted to the laboratory use

(48, 104). They vary in their biology and this variety can cover different aspects of human

malaria. Plasmodium berghei (P. berghei ANKA, P. berghei NK65), P. yoelii (P. yoelii YM,

P. yoelii XL), P. chabaudi (P. chabaudi CB) and P. vinckei (P. vinckei vinckei) cause lethal

infections in mice, whereas P. yoelii (P. yoelii 17XNL), P. chabaudi (P. chabaudi AS, P.

chabaudi adami) and P. vinckei (P. vinckei petterei) are non-lethal, and they are cleared after

the initial acute parasitemia (104). They also have specific RBC tropism; for example, P.

berghei infects mature RBCs and reticulocytes, the various strains of P. chabaudi and P.

vinckei infect mature RBCs, and some lines of P. yoelii are restricted to reticulocytes whereas

5

the others can invade all RBCs (104). These tropisms facilitate studies on immunopathology,

experimental cerebral malaria, mechanisms of host immune evasion and RBC invasion

mechanism of the parasite. In addition, some strains have been used as models to study

specific aspects of malaria. For example, P. berghei ANKA strain has been used as a model

to investigate the pathogenesis of cerebral malaria (87). Plasmodium yoelii 17XL, which is

a non-lethal strain, has been used to study the pathology and protective immune response of

malaria (104). In contrast, lethal strains P. yoelii 17XL and P. yoelii YM have been used for

challenging vaccine recipients to evaluate the vaccine-induced protective immune response

(87, 104). Plasmodium chabaudi chabaudi AS strain, which causes hemolysis that is

secondary to hyperparasitemia, has been used to study experimental vaccines and

immunological processes which controls hyperparasitemia (87). Plasmodium yoelii is used

to investigate the biology of the liver stages in BALB/c mice (55, 58).

4. Plasmodium berghei

Plasmodium berghei was identified as a parasite of thicket rats (Grammomys

dolichurus) and Anopheles sureni mosquitoes in African highland forests (71), and was

isolated in Kantaga (pbNK for New York-Kantaga) and in Kasapa (pbANKA for

Antwetpen-Kasapa) (47, 94). During natural infection, it prefers immature RBCs (30), and

undergoes asynchronous development with a haploid cycle of 22 hours in the blood stage (47).

The evolutional distance between the P. berghei clade and either P. falciparum or P. vivax is of

the same order of magnitude as that between P. falciparum and P. vivax (71). Therefore, P.

berghei is a relevant model species to study common principles of Plasmodium biology (71).

This model allows the examination of parasite-host interaction in vivo, including clinically

relevant phenomena like parasite sequestration (26), experimental cerebral malaria (23, 38),

6

host immune responses (36) and parasite immune evasion (54). The advantage of using P.

berghei is that a reverse genetics approach has been most frequently applied among rodent

malaria parasites (18, 50). In addition, in vitro cultures of liver and mosquito stages are

available, allowing us to study the less accessible parts of the lifecycle of the human malaria

parasite (48). Indeed, our knowledge of the Plasmodium mosquito stages are largely based

on findings from experiments with P. berghei (71); however, there are disadvantages as well.

For example, laboratory animals are required for passaging the parasite. In addition, a

long-term in vitro culture of the blood stage is not easily established, since the schizont does

not spontaneously rupture and thus the development is discontinued (51, 71).

5. Traditional genetic manipulation method of P. berghei

An improved understanding of the biology of the malaria parasite at each stage of its

life cycle facilitates the identification and characterization of novel targets or strategies for

malaria intervention (17). The reverse genetics approach to assess gene function is central to

these advances (17).

In standard protocol, genetic manipulation of P. berghei is performed as follows (51).

Parasite transfection is performed by introduction of DNA into purified merozoites (51).

The transfected parasite is injected into a mouse, and is followed by in vivo drug selection

(51). The in vivo drug selection is based on the treatment of the mouse with the drug, which

selects for target mutant parasites expressing drug-resistant markers (51). Subsequently, the

desired mutant parasite is obtained by in vivo cloning. The cloning procedure is performed

by intravenously injection (i. v.) of single infected erythrocyte obtained by limiting dilutions

(59).

7

Successful transfection was first demonstrated in the avian malaria species P.

gallinaceum (33). Since then, diverse Plasmodium parasites have proven to be accessible to

genetic manipulation, including human (81, 103), primate (61, 91), and rodent malaria

parasites (71, 75, 85, 92). Plasmodium berghei can be transfected by electroporation of

plasmid DNA (4, 51). There are different strategies available to manipulate the parasite

genome: (i) episomal transfections, (ii) single crossover and (iii) double crossover

recombination (71). The choice of strategy is determined by the required genetic stability of

the recombinant parasites and whether the loss of genetic information is unwanted or

desirable (71). A circular transfection plasmid will not be integrated in the parasite genome,

but instead will be maintained episomally as long as drug pressure is applied (71). Such

transfections do not lead to the loss of any genetic information. However, the episome will

be lost rapidly in the absence of a selecting drug (71). Stable integration can be achieved

using linearized DNA constructs with left and right homology arms that target the construct to

a specific locus in the parasite genome (71). The integration efficacy is up to approximately

four orders of magnitude higher in P. berghei than in P. falciparum (17, 51). The

user-friendly character of P. berghei is one reason that this parasite species is widely used to

dissect gene function.

Successfully transfected parasites are usually selected by applying drug pressure (71).

Positive selection of transgenic P. berghei is based on antifolate pyrimethamine or its

derivative WR99210 (7, 11, 71). Both serve as inhibitory substrate analogues of the parasite

bi-functional dihydrofolate reductase-thymidylate synthase (DHFR-TS) (71, 106).

Pyrimethamine can be administered orally, whereas WR99210 needs to be injected repeatedly

intraperitoneally or subcutaneously (51). There are three antifolate-positive selection

markers available in P. berghei: pyrimethamine-resistant P. berghei DHFR-TS (pbdhfr-ts)

8

(92), Toxoplasma gondii DHFR-TS (tgdhfr-ts) and human DHFR (hdhfr) (95). All three

markers confer resistance to pyrimethamine, but only hdhfr can confer resistance to

WR99210; therefore, in terms of selection systems, hdhfr can be used as a secondary marker

in sequential genetic manipulations (16).

Drug selection is usually not completely effective, resulting in mixtures of transgenic,

spontaneously mutated and wild-type parasites (71). Therefore, isolation of the target

mutant parasites is required. Traditionally, desired mutants have been isolated by limiting

dilution, and following injection of a single parasitized erythrocyte into several naive mice

(59).

6. Recent trends and problems of genetic manipulation in P. berghei

Using several approaches described above, meaningful progress has been made in the

past 20 years in developing genetic tools to investigate Plasmodium spp.. This is reflected by

the increasing the number of malaria-related publications that report the use of these genetic

tools as a core technology (17). However, until recently, these advances have been mostly

incremental (17). Nevertheless, of the approximately 5,000 genes have been identified in the

genome of Plasmodium spp. (37), it is estimated that approximately 500 Plasmodium genes

have been successfully targeted so far for gene disruption (17, 50), and the function of nearly

half the genes in the genome remains unknown (25). There are several factors that have

limited progress in genetic manipulation: i) poor transfection efficacy, ii) paucity of available

selection marker and iii) time consuming protocol to obtain desired mutant parasite clones

(47).

Although the transfection efficacy of P. berghei is much higher than that of P.

falciparum, it is 10-3 to 10-2 even with the latest nucleofector technology, which has proven to

9

be an efficient DNA delivery to several cell types that are naturally difficult to be transfected

(35, 51, 64, 68). This low transfection efficacy makes the selection step of transfected

parasites essential to isolate the desired mutant parasite.

The paucity of positive selection markers has restricted sequential genetic

manipulations including several knockout (KO) and KO rescue experiments in P. berghei (18,

32, 66, 71). Although six selection markers are now available in P. falciparum (14, 24, 29,

69, 102), only three markers are available in P. berghei, as previously described (17). It is

challenging to run sequential genetic manipulation experiments in P. berghei because hdhfr

confers a slight WR99210 resistance to dhfr-ts-integrated parasites (16). To solve the

problem of the limited number of selection markers, several strategies have been developed.

The positive-negative selection method was developed for recycling the hdhfr marker using

yeast cytosine deaminase and uridyl phosphoribosyltransferase (yfcu) marker and

5-fluorocytosine (5-FC), which kills the parasite expressing yfcu (6, 80). In this strategy, a

wild type transfected with the targeting vector hdhfr-yfcu marker was first selected by

antifolate to obtain the marker-integrated parasite, and then selected by 5-FC to obtain the

desired marker-free parasite (6). Thus, this method permits marker recycling in P. berghei.

However, negative selection cannot eliminate the yfcu-integrated parasites completely (70).

In addition, this strategy is laborious and time-consuming (66). This problem was addressed

by combining it with a flow cytometry-associated sorting method termed “Gene Out Marker

Out” (GOMO) (70). In this strategy, desired mutants were enriched through sorting using

fluorescent markers after each selection. Manzoni et al., recently reported that this method

permits the rapid isolation of a pure population of desired mutant parasites without in vivo

cloning (70). However, this cannot be used for mutant parasites generated using the hdhfr

marker in past malaria research. The “Gene Insertion/Marker Out” (GIMO) method, an

10

improved positive-negative selection method using a reference line expressing the hdhfr-yfcu

marker has been also developed. This method permits KO rescue experiments far more

easily and efficiently; however, this method needs the reference line and cannot be used for

mutant parasites containing the hdhfr marker.

Many experimental animals, time and labor are required to isolate a single cloned

parasite (59). The success of the in vivo cloning procedure relies on the ratio of the

wild-type to mutant parasites after drug selection. In the conventional in vivo drug selection

method, the desired mutant parasite generated by homologous recombination can be enriched

to 10–20%. Therefore, two rounds of limited dilution procedures are often needed to isolate

a single clonal parasite. To overcome this problem, flow cytometry-based isolation methods

have been developed (27, 49, 59, 62). These methods are performed by introducing a

fluorescent protein expression cassette and subsequent isolation of the fluorescent mutant

parasite by flow cytometry. Development of this method significantly reduced labor and

animal being used (71). Currently, almost pure populations of desired mutant parasites can

be obtained with the improved protocol using the P. berghei heat shock protein 70 (pbhsp70)

promoter (42, 70). However, these methods are laborious and time-consuming, and often

cannot completely eliminate wild types; therefore, an additional cloning step is often needed

to isolate a pure population of the desired mutant parasite (66). Furthermore, this strategy

has the drawback that fluorescent marker cassettes increase the size of the targeting vector.

In Plasmodium, it is difficult to assemble large-sized targeting constructs because such

constructs often result in instability in E. coli for replication caused by the AT-rich nature of

Plasmodium genome (66).

11

7. Objective of this study

The objective of this study was to improve a reverse genetics approach to dissect the

molecular biology of malaria parasites by establishing a flexible platform for genetic

manipulation in P. berghei. I aimed to develop a novel drug selection system that can enrich

the desired mutant to nearly 100% and can be applied for with several established selection

methods, such as the positive-negative selection method and GOMO. The specific

objectives were as follows: 1) development of an in vitro selection systems in P. berghei with

antibiotics which are toxic to rodent host in P. berghei (Chapter 1); 2) development of an

additional drug selection system for in vitro selection system for sequential genetic

manipulation (Chapter 2); and 3) improvement of the in vitro selection system for routine

application (Chapter 3).

12

CHAPTER 1

High efficacy in vitro selection procedure for generating transgenic

parasites of P. berghei using an antibiotic toxic to rodent hosts

1-1: Introduction

The malaria parasite P. berghei is one of the main rodent malaria models. A

shortcoming of this model parasite is its low flexibility in genetic manipulation. In vivo drug

selection procedures using rodents are required for the isolation of genetically manipulated P.

berghei, as the parasite cannot be continuously propagated through in vitro cultures. Since

this rules out drugs that are harmful to mammalian hosts, the use of popular mammalian drug

selection marker genes is largely precluded (18). This leads to difficulties in running

sequential genetic manipulation experiments, such as phenotype rescue experiments using

gene knockout (KO) parasites or the generation of multiple KO parasites (6, 16, 32). These

circumstances have been impeding malaria research.

In Chapter 1, I developed a novel selection method to overcome the genetic

manipulation problems in P. berghei models. I focused on the

puromycin-N-acetyltransferase (pac)-puromycin system, which is commonly used in

mammalian cells (74, 93). Puromycin-N-acetyltransferase can be isolated from

Streptomyces alboniger and shows resistance to the aminonucleoside antibiotic, puromycin

(19). A previous study reported that pac might be used as a selection marker for blood stage

long-term in vitro cultures of P. falciparum, the most virulent human malaria parasite (19).

As puromycin is severely toxic to rodents and thus cannot be used for P. berghei in vivo, I

developed a pac-puromycin system based on a novel short-term in vitro culture method.

13

1-2: Materials and Methods

Ethics statement

This study was carried out in strict accordance with the recommendations in the Guide

for Laboratory Animals of the Obihiro University of Agriculture and Veterinary Medicine.

The protocol was approved by the Committee of Animal Experiments of the Obihiro

University of Agriculture and Veterinary Medicine (permit number 28-91).

Experimental animals and parasites

ICR and BALB/c (five-week old) mice were obtained from CLEA (Tokyo, Japan). I

used the P. berghei ANKA strain (obtained from Dr M. Torii, Ehime University) and a strain

constitutively expressing GFP (44) (obtained from Dr M. Yuda, Mie University).

Plasmid construct

Elements of pXL/hdhfr-pac-egfp and pXL/hdhfr-pac::egfp plasmids were sequentially

ligated into a pXL-BacII-DHFR (obtained from the BEI Resources Repository, MRA-916,

deposited by John Adams) plasmid backbone (4, 65). Firstly, the hdhfr expression cassette

was excised from pXL-BacII-DHFR, namely pXL-BacII-DHFR (-). Next, hdhfr, under the

control of P. berghei elongation factor 1 alpha (pbef-1α) promoter and pbdhfr-ts terminator,

was cloned into pXL-BacII-DHFR (-). Then, for pXL/hdhfr-pac-egfp, egfp was excised

from pCX-EGFP Vector (79) under the control of a pbhsp70 promoter and terminator and was

then cloned into the plasmid pXL-BacII-DHFR (-) containing the hdhfr expression cassette.

pac was then excised using a pMXs-Puro retroviral vector (Cell Biolabs, San Diego, CA,

USA) under the control of a pbhsp70 promoter and terminator, and cloned in the

pXL-BacII-DHFR (-) containing the hdhfr and egfp expression cassettes. For

14

pXL/hdhfr-pac::egfp, pac was cloned into a pEFP-N1 vector (Clontech, Palo Alto, CA, USA),

then the resulting pac::egfp fusion gene was cloned into the plasmid pXL-BacII-DHFR (-)

containing the hdhfr expression cassette, under the control of another pbhsp70 promoter and

terminator. The promoter and terminators were excised from a Y2 plasmid (obtained from

Dr M. Yuda, Mie University).

The transposase expression vector EGF-pgT contained a transposase gene excised from

pHTH (obtained from the BEI Resources Repository, MRA-912, deposited by John Adams),

under the control of an pbef-1α promoter and pbhsp70 terminator, cloned into a pBluescript

(pBS) vector (4).

Elements of pBS/spect2 KO were generated into a pBS backbone. The pac expression

cassette was flanked by 5′ and 3′ sequences of spect2 (pBS/spect2 KO) amplified by PCR

(Table 2).

Parasite transfection and drug selection in vitro

Parasite transfection experiments were run following standard protocols (51). Briefly,

about 1 ml of infected blood (1.0–3.0% parasitemia) collected from an ICR mouse by heart

puncture was cultured in 50 ml of RPMI 1640 medium (cat no. 23400-021, Thermo Fisher

Scientific, Waltham, MA, USA,) supplemented with NaHCO3 (0.85 g/l), neomycin sulfate (50

μg/l), and 20% fetal bovine serum (FBS) for schizonts collection. Schizonts were purified

by Nycodenz density gradient centrifugation (52). Obtained schizonts were sufficient for at

least 5 independent transfections. Transfection was performed with a Nucleofector 2b

device (Lonza, Basel, Switzerland) using a T Cell Nuclofector Kit (Lonza) under the U-33

program. All in vitro selection procedures were performed separately from the in vivo drug

selection using pyrimethamine or WR99210. All in vitro culture and drug selection

15

procedures were performed without shaking, and started at a time between 13:00h and

15:00h.

During the piggyBac experiment, 5 μg of target plasmid was co-transfected with 5 μg of

transposase plasmid EGF-pgT. In the double crossover homologous recombination

experiment, 10 μg of linearized plasmid was used in each transfection. After transfection,

the parasites were immediately injected intravenously into a naive ICR mouse. The first

drug selection was performed about 1–2 days post-injection when parasitemia reached

0.5-3.0%.

In piggyBac experiments, about 7 μl of infected tail blood were collected in 0.5 ml of

culture medium (described above) with 2 μl of heparin solution (143 units/ml), and

centrifuged at 500 × g for 5 min at room temperature (RT). The supernatant was discarded

and the parasites were resuspended in 0.5 ml of culture medium. The suspension (450 μl)

was put into a 24-well plate (Thermo Fisher Scientific), and either 50 μl of either puromycin

solution (10 μg/ml, diluted by culture medium; Wako, Osaka, Japan; stock: 50 mg/ml in

distilled water) to a final concentration of 1.0 μg/ml (1.8 μM), or WR99210 solution (62.5

ng/ml, diluted by culture medium; Jacobus Pharmaceuticals; stock: 5 mg/ml in DMSO) to a

final concentration of 6.25 ng/ml (1.6 x 10-2 μM) was added. Plasmodium berghei-infected

RBC (iRBC) was incubated for 20 h (36.5 °C, 5% CO2, 5% O2, 90% N2). After incubation,

iRBCs were separated by centrifuge at 500 × g for 5 min at RT, and resuspended in 100 μl of

phosphate-buffered saline (PBS). They were then injected intravenously into a naive ICR

mouse. When parasitemia reached 0.5-3.0% (about 5 days post-injection), the same

selection procedure was repeated for the 2nd and 3rd selection using about 7 μl of tail blood.

Cloning of parasites was done by in vivo limiting dilution method using male BALB/c mice.

In the first selection of double crossover homologous recombination experiments, 200

16

μl of infected blood was collected in 5 ml of culture medium by heart puncture under

anesthesia, using a syringe containing heparin solution. After centrifugation at 500 × g for 8

min at RT, the supernatant was discarded. The blood was resuspended in 10.8 ml of culture

medium. The suspension was put into a 25 cm2 flask (Thermo Fisher Scientific) with 1.2 ml

of puromycin (10 μg/ml, diluted by culture medium) solution to make a final concentration of

1.0 μg/ml and a total volume of 12 ml. This suspension was then incubated for 20 h. After

drug selection, the sample was centrifuged at 500 × g for 8 min at RT and resuspended in 100

μl of PBS. The suspension was injected intravenously into a naive ICR mouse. When

parasitemia reached 0.5-3.0% (about 5 days post-injection), the selection procedure was

repeated. In the 2nd and 3rd selection, about 7 μl of tail blood in 0.5 ml culture medium was

used as described above for the piggyBac experiment.

A schematic diagram of the in vitro pac-puromycin selection procedure is shown in

Figure 1.

Mutant ratio calculation by microscopy

About 10 μl of infected blood were collected in 200 μl of PBS, and 2 μl each of heparin

solution and Hoechst33342 (1 mM) were added. The sample was then incubated at 37 °C

for 5 min. After incubation, the sample was harvested at 500 × g for 5 min, and resuspended

in 25–30 μl of RPMI1640. The suspension was placed on a glass slide, and the number of

enhanced green fluorescence protein (eGFP)-positive parasites stained with Hoechst33342

was determined using fluorescent microscopy. The parasites were distinguished from white

blood cells by fluorescence intensity and morphology of nuclei stained with Hoechst. At

least 1,000 Hoechst-positive parasites were counted in several fields under 400×

magnification. The mutant ratio was calculated by dividing the number of eGFP-positive

17

parasites by the number of Hoechst-positive parasites. In experiments where transfection

was performed with green fluorescence protein (GFP)-positive parasites, the mutant ratio was

calculated by dividing the number of GFP-negative parasites by the number of

Hoechst-positive parasites.

Flow cytometry analysis

About 20 μl of infected tail blood (5 to 10% parasitemia) was collected in 1 ml of

serum-free RPMI 1640 medium containing 1 μM of cell-permeant DNA Dye SYTO59

(Thermo Fisher Scientific) for counter staining, and incubated for 45 min at 20° C (86). The

stained cells were analyzed with an EPICS ALTRA flow cytometer (Beckman Coulter, Brea,

CA, USA) equipped with 488 nm argon lasers for GFP or eGFP, and 633 nm HeNe lasers for

SYTO59. Parasites were gated using logarithmic forward/side scatter dot plots. The

mutant ratio was analyzed by counting the number of GFP or eGFP-positive parasites among

gated SYTO59-positive parasites. At least 19,000 SYTO59-positive parasites were analyzed.

Data analysis was performed using program Kaluza ver. 1.5 (Beckman Coulter).

Fluorescence analysis

Once parasite nuclei had been stained with Hoechst 33342, fluorescent images were

obtained using a BZ-9000 fluorescence microscope (Keyence, Osaka, Japan) and were

analyzed using a BZ-II Analyzer (Keyence).

Drug sensitivity test

Wild type P. berghei were transfected with pXL/hdhfr-pac-egfp and EGF-pgT, selected

using pyrimethamine in vivo (51), and named HSP70-PAC. Drug sensitivity tests were

18

performed as previously described (16, 53). Briefly, infected blood (parasitemia 1.0–3.0%)

was resuspended in a culture medium to a final cell concentration of 2%. A 500-μl cell

suspension was cultured with various concentrations of puromycin (0–15 μM) for 20 h in a

24-well plate. The parasites were harvested by centrifugation and analyzed using

Giemsa-stained thin blood smear films. The number of mature schizonts per 300 parasites

was counted and normalized to the control. Three experiments were performed in triplicate.

Fifty percent inhibitory concentration (IC50) values were calculated using the program

GraphPad Prism ver.5 (GraphPad, San Diego, CA, USA).

Southern blot analysis

Two micrograms of extracted DNA were digested using EcoRI or EcoRV, separated on

agarose gel, transferred onto a Hybond N+ membrane (GE Healthcare, Chalfont St. Giles, UK),

and then hybridized with probes labeled using an AlkPhos Direct Kit (GE Healthcare). The

signal was detected using a CDP-star detection reagent (GE Healthcare).

Identification of piggyBac insertion site

In summary, genomic DNA of mutant parasites was digested using NdeI and then

ligated with T4 DNA ligase. Inverse PCRs were performed using the primer F:

ATGTCCAGGAGGAGAAAGGC, R: GCCCCCAAATAAAAACTTCC. The sequences of

these products were obtained using an ABI3100 Analyzer (Applied Biosystems Foster city,

CA, USA), and the insertion sites were identified using the PlasmoDB database

(http://plasmodb.org/plasmo/).

19

Statistical analysis

Statistical analyses comparing each pac-integrated parasite clone against the wild type

parasite were performed using two-tailed unpaired t-tests. The mutant ratio of each selection

was compared using paired t-tests. IC50 values were calculated using the program GraphPad

Prism ver.5 (GraphPad).

20

1-3: Results

Expression of pac confers resistance to puromycin

To determine whether pac can confer puromycin resistance to the P. berghei, the

parasites transfected with pXL/hdhfr-pac-egfp carrying pac under the control of pbhsp70

promoters (HSP70-PAC) were obtained using in vivo pyrimethamine selection (Fig. 2). IC50

values of wild type and HSP70-PAC were 0.17 ± 0.06 μM and 5.69 ± 0.70 μM (mean ± SD),

respectively (Fig. 3). IC90 values of wild type and the mutant parasites were 0.55 ± 0.14 μM

and 9.39 ± 1.07 μM (mean ± SD), respectively (Fig. 3).

I identified a suitable puromycin concentration for drug selection by selecting

pXL/hdhfr-pac-egfp-transfected parasites at various puromycin concentrations. The

empirical optimal concentration was 1.0 μg/ml (1.8 μM) and the target mutant was not

obtained at concentrations above 1.5 μg/ml.

Generation of transgenic parasites using pac markers through piggyBac transposon

To determine whether pac can be used as a positive selection marker for genetically

manipulated parasites, I used it to select pXL/hdhfr-pac-egfp-transfected parasites (Fig. 2).

Three selections were performed after transfection: the first after two days, the second after

8-9 days, and the third after 13-14 days. After the second selection, over 95% of parasites

were expressing enhanced green fluorescent protein (eGFP) (Figs. 4A, 4B). The target

mutant ratio increased significantly from first to second selections. There was no significant

difference between second and third selections (Fig. 4B). A typical transfectant line was

also analyzed using flow cytometry. Over 95% of parasites were expressing eGFP after the

third selection (Fig. 4C). Three clones were obtained and analyzed using Southern blot

analysis (Fig. 5A) to confirm genomic integration. The fragments of integrated pac cassettes

21

(4.8, 5.7, 6.2 kbp) were detected with a pac probe. I did not detect a signal corresponding to

plasmid size. Plasmid rescues on parasite DNA extracted from these clones confirmed the

absence of episomally maintained plasmids. Sequence analyses of inverse PCR products

showed that these three clones had single copy insertions in unique loci (Table 1). To

determine the inhibitory effect of pac expression on parasite growth, the growth of the three

pac clones was analyzed. Clones 1 and 2 showed no significant difference from wild type

parasites, but clone 3 exhibited significantly higher parasitemia at seven and eight days post

infection (Fig. 5B). These results demonstrate that pac represents a valid selection marker in

P. berghei.

Generation of transgenic parasites using pac through double homologous recombination

I investigated whether pac can be used for gene targeting by assembling constructs that

contained pac under the control of a pbhsp70 promoter and terminator (Fig. 6). I used a

GFP-expressing parasite (44) under the control of a pbhsp70 promoter and terminator as a

parental strain for transfection. As shown in Fig. 6, the gfp expression cassette would be

replaced by the pac expression cassette after the homologous recombination event, and GFP

expression would be lost. Three selections were performed after transfection: the first after

2 days, the second after 8 days, and the third after 12 days. After the second selection, more

than 99% of parasites were GFP-negative (Figs. 7A, 7B). The mutant ratio increased

significantly from first to second selections, but there was no significant difference between

second and third selections (Fig. 7B). A typical transfectant line was also analyzed using

flow cytometry. More than 99% of parasites were GFP-negative after the second selection

(Fig. 7C). From these two experiments I obtained two independent clones, which were

analyzed using Southern blot analyses (Fig. 8). The 8.9-kbp fragment containing the gfp

22

cassette was only detected in the parental GFP-expressing parasite with the gfp probe. The

identical 8.9-kbp signals were detected in both clones, but not in the wild type, with the pac

probe and the 5′pbhsp70 probe. Based on these results, the in vitro pac-puromycin system is

suitable for gene targeting as well as random insertion by transposon.

Sequential genetic manipulation of pac to pbdhfr-ts parasites

I attempted to demonstrate sequential genetic manipulation using pac and pbdhfr-ts

markers for gene targeting. For this purpose, I assembled a targeting vector composed of a

pac cassette flanked by sporozoite microneme proteins essential for the cell traversal 2

(spect2, PBANKA_1006300) (43) gene sequence (Fig. 9). A GFP-expressing parasite (44)

containing pbdhfr-ts marker was used as the parental strain for transfection. The parasite

was transfected with the targeting construct, after which puromycin selection was applied.

The ratio of the target mutant was determined using genomic Southern blot analysis (Fig.

10A). KO locus signals (3.7 kbp) appeared after the first selection but became dominant

after the second selection. I confirmed that GFP was continuously expressed from before

transfection to after the third selection (Fig. 10B). The KO of spect2 was confirmed by PCR

(Fig. 10C). These results show that the in vitro pac-puromycin system can be used in

combination with traditional pbdhfr-ts markers to establish double mutant parasites.

Generation of mutants using the pac::egfp fusion marker

I investigated whether the pac::egfp fusion gene can be used as a marker by assembling

a piggyBac transposon vector that contained the fusion gene under the control of an pbhsp70

promoter and terminator (Fig. 11). To confirm that pac::egfp functionally expressed eGFP,

in vivo pyrimethamine selection of pXL/hdhfr-pac::egfp-transfected parasites was performed

23

prior to in vitro puromycin selection. The expression of eGFP was confirmed by

fluorescence microscopy.

After transfection of pXL/hdhfr-pac::egfp, in vitro puromycin selection was conducted

three times. Fluorescence microscopy confirmed the expression of the eGFP signal (Fig.

12A). Fluorescence analyses showed that more than 60% of parasites expressed egfp after

the second selection (Fig. 12B). The mutant ratio increased significantly between first and

second selections, but there was no significant difference between second and third selections

(Fig. 12B). Based on these results, pac::egfp is suitable as a dual marker for fluorescence

and drug selection.

Application of the in vitro selection method to the hdhfr-WR99210 system

To examine the universality of our in vitro selection method, I used the hdhfr-WR99210

system as a model. Preliminary experiments showed that the optimal WR99210

concentration for selection was 6.25 ng/ml (1.6 × 10-2 μM). A wild type parasite was

transfected with pXL/hdhfr-pac-egfp, after which WR99210 selection was performed.

Proportions of eGFP-positive parasites increased significantly up to the fourth and fifth

selections, and the mutant ratio reached more than 90% after the fifth selection (Figs. 13A,

13B). A typical transfectant line was also analyzed using flow cytometry. Over 90% of

parasites were expressing eGFP after the fifth selection (Fig. 13C). These results show that

the employed in vitro selection method may be suitable for application in drug selection

systems other than the pac-puromycin system.

24

1-4: Discussion

Reverse genetics has been a powerful approach in studying the biology of malaria

parasites (18, 50). However, the limited number of selection markers has hampered the

development of the method (6, 16). To provide further selection markers, I developed a pac

marker in P. berghei based on a novel in vitro selection method.

I established this method by combining repeated short-term in vitro cultures with

parasite recovery in vivo. The pac marker conferred sufficient resistance to the P. berghei

parasite for puromycin selection. Its resistance made it possible to isolate the mutant

parasites using piggyBac transposon mutagenesis and gene targeting by homologous

recombination. I showed that pac::egfp was also an effective drug selection marker and

might constitute a useful tool for imaging experiments. Blood stage parasite growth

analyses of Pac-expressing clones indicated that our pac marker cassette did not inhibit

parasite growth. While currently available positive selection markers for this parasite only

confer resistance to antifolates (71), pac is independent of antifolate pathways (19). Thus,

the pac-puromycin system can be used in conjunction with the traditional antifolate resistant

markers (hdhfr and pbdhfr-ts). The small size of pac (600 bp) is one of its advantages; in

Plasmodium, assembling targeting constructs causes a transfection bottleneck because

large-sized constructs often result in instability in E. coli caused by the AT-rich Plasmodium

genome.

I confirmed the universality of this in vitro selection method by using the traditional

hdhfr-WR99210 system as a model. The results indicate that our in vitro method has

potential for use in other drug selection systems already established for P. falciparum (69).

In addition, this system could also be used for negative selection in vitro, to recycle markers.

A further benefit of our method is its relative cheapness, as WR99210 is approximately 100

25

times more expensive than pyrimethamine (based on Sigma Aldrich prices). The new

system significantly reduces the amount of WR99210 required (0.001%) relative to the

conventional in vivo method.

The in vitro selection method can enrich mutant parasites by more than 90% within 2

weeks after transfection, using 2 mice. This level of efficacy has great advantages for

cloning mutant parasites, and may reduce the number of mice required to obtain the desired

production. Traditional cloning procedures involve using the in vivo limiting dilution

method. In our experience, the percentage of target KO parasites obtained when using the

conventional selection method is around 10–20%, so double limited dilution procedures and

at least 20 mice are required to isolate a single cloned parasite. The in vitro pac-puromycin

system, however, allows us to isolate a clone using fewer than five mice. This reduction

may save significant expense, time, and labor in rearing mice, and has obvious animal welfare

benefits. Furthermore, the method allows the ready generation of several mutants in parallel.

In some cases, the drug-selected parasites can be used directly without cloning or flow-sorting

steps (71).

A further advantage of this system is its flexible application for sequential manipulation

to mutant parasite generated using traditional antifolate-resistant markers. While various

strategies have successfully used negative selection in the P. berghei model (6, 70), the

disadvantage of the traditional marker recycling method is its complexity and the time

requirement of several months for the isolation of a double mutant parasite (6, 66). The

“gene out marker out” (GOMO) strategy was developed to address this problem (70).

However, this method is inapplicable to parasites already carrying antifolate resistant markers

as it requires positive selection using antifolates. Our in vitro pac-puromycin system can

readily be used in sequential manipulation experiments (for example when employing gene

26

complementation methods) with the mutant parasites established in past malaria research,

using any type of selection method including traditional antifolate markers. In our

experiment, the target-cloned parasite was obtained within 3 weeks using less than 10 mice.

In summary, I succeeded in establishing a novel in vitro selection method using the pac

marker in P. berghei. This in vitro pac-puromycin selection system exhibited high selection

efficacy relative to the conventional in vivo method. The method should allow the

generation of multiple mutants with greater flexibility and help develop our in-depth

understanding of malaria parasite biology.

27

1-5: Summary

The malaria parasite Plasmodium berghei is one of the main rodent malaria models. A

shortcoming of this model parasite is its low flexibility in genetic manipulation. As this

parasite cannot be continuously propagated in cell cultures, in vivo drug selection procedures

are necessary to isolate genetic mutants. Drugs harmful to rodents therefore cannot be used

for drug selection, which restricts the range of genetic manipulation. In this Chapter, I

addressed this problem by establishing a novel in vitro culture drug selection method, which I

used in combination with other established methods to successfully isolate genetically

manipulated parasites. The target mutants were enriched to the desired level within two

weeks. I show that my selection system can also be used for sequential genetic manipulation

of parasites carrying the traditionally used selection markers, demonstrate the procedure’s

versatility, and show its use in isolating specific genetically manipulated parasites. This

novel in vitro selection method increases the number of available selection markers, allowing

more extensive genetic manipulation in malaria parasite research.

28

Fig 1. Schematic diagram of in vitro pac-puromycin selection system. In vitro selection method is based on short-term in vitro culture with a drug followed by parasite recovery in vivo. Two repetitions of the procedures are needed to enrich desired mutants >90%.

Transfection

2

8

Day

3

9

12

0

pigggyBac experiments Homologous recombination experiments

Parasite recovery

1st selection

>90% of mutant parasite

2nd selection

Parasite recovery

29

Fig 2. Schematic diagram of the piggyBac transposon vector containing hdhfr, pac and egfp expression cassettes (pXL/hdhfr-pac-egfp). The constructs contains contain hdhfr and pac as a positive selection marker, and egfp as a reporter. hdhfr was used for in vivo pyrimethamine selection. This plasmid was also used in the experiment of Figs. 2, 3, 4 and 13. 5’ef-1α: 5’pbef-1α, 5’hsp70: 5’pbhsp70, 3’hsp70: 3’pbhsp70, and ITR: inverted terminal repeat.

30

Fig 3. Expression of pac confers resistance to puromycin (B) Growth inhibition of wild type (WT) and pXL/hdhfr-pac-egfp (Fig. 2)-transfected parasites (HSP70-PAC) was assessed by determining schizont development at a range of puromycin concentrations.

31

Fig 4. Desired mutant parasites could be enriched more than 90% with two repetitions of the puromycin selection procedure. (A) Fluorescence images of parasites after each selection. Parasites were stained with Hoechst 33342. The scale bar represents 10 μm. (B) eGFP-positive parasite ratio after each puromycin selection. The ratio was analyzed using fluorescence microscopy. Each bar represents the mean ± SD of three independent experiments. ** p < 0.01, n.s.: not significant (paired t-tests). (C) Flow cytometry analysis of eGFP positive mutant ratio after each puromycin selection. Numbers above bracketed lines indicate percent parasites with eGFP expression.

32

Fig 5. Integration of pac didn’t inhibit parasite growth. (A) Southern blot analysis of three mutant clones. Genomic DNA was digested using EcoRV and hybridized with a pac probe. The predicted sizes of restriction fragments are shown. WT: wild type. cl.: clone. (B) Growth assay of three clones. cl.: clone. WT: wild type. * p < 0.05 (two-tailed unpaired t-tests).

WT cl. 1 cl. 2 cl. 3

6.2

4.8

kbp

5.7

A B

33

Fig 6. Schematic diagram showing the targeting of gfp by pac through double crossover homologous recombination. gfp in the GFP expressing mutant was replaced by pac through double crossover homologous recombination. The location of the probe and the expected sizes of the fragments detected by Southern blot analysis of genomic DNA digested with EcoRI are shown. 5’hsp70: 5’pbhsp70, and 3’hsp70: 3’pbhsp70.

EcoRI EcoRI EcoRI EcoRI

EcoRI EcoRI EcoRI EcoRI

34

Fig 7. Desired mutant parasites generated by double-crossover homologous recombination could be enriched more than 90% with two repetitions of the puromycin selection procedure. (A) Fluorescence images of parasites after each selection. Parasites were stained with Hoechst 33342. The scale bar represents 10 μm. (B) GFP negative parasite ratio after each puromycin selection. The ratio was analyzed using fluorescence microscopy. Each bar represents the mean ± SD of three independent experiments. ** p < 0.01, * p < 0.05, n.s.: not significant (paired t-tests). (C) Flow cytometry analysis of GFP positive mutant ratio after each puromycin selection. Numbers above bracketed lines indicate percent parasites with GFP expression.

35

Fig 8. Desired mutant clone generated through double crossover homologous recombination were successfully isolated. Southern blot analyses of two independent clones. Genomic DNA was digested with EcoRI and hybridized with gfp, pac, and 5′pbhsp70 probes. The predicted sizes of restriction fragments are shown. WT: wild type, GFP: GFP-expressing parasite (parental line), 5’hsp70: 5’pbhsp70, and cl.: clone.

36

Fig 9. Schematic diagram showing the targeting of gfp by pac through double crossover homologous recombination. pac expression cassette was integrated into spect2 locus through double crossover homologous recombination. The binding sites of primers used in genotyping PCR are indicated by small arrows. The location of the probe and the expected sizes of the fragments detected by Southern blot analysis of genomic DNA digested with EcoRI are shown. 5’hsp70: 5’pbhsp70, and 3’hsp70: 3’pbhsp70.

EcoRI EcoRI EcoRI

EcoRI EcoRI EcoRI

37

Fig 10. Generation of double mutants using pac and pbdhfr-ts markers. (A) Southern blot analysis showing the ratio of spect2 KO mutants after each selection. Genomic DNA was digested using EcoRI and hybridized with a spect2 probe. WT: wild type, KO: spect2 KO. (B) Fluorescence images of parental GFP-expressing parasites and a spect2 KO mutant parasite population after the second selection containing pac and pbdhfr-ts markers. Parasites were stained with Hoechst 33342. The scale bar represents 10 μm. Before: parental GFP-expressing mutant. (C) PCR analysis of genomic DNA isolated from mutant parasites recovered after each selection. Location of PCR primers and the expected products size are shown in Fig. 9. Confirmation of the predicted recombination events was achieved with primer combinations specific for 5′ (P3 + P4) or 3′ integration (P5 + P6). An additional primer combination (P1 + P2) was used to assess integration of the pac cassette. P: primer The primer sequences can be found as Table 2.

Selection

)

3.7

9.7

kbp

Selection

locus

WT

KO

GFP

Hoe

chst

Mer

ge2nd

(c)

SelectionBefore

(d)

P3 + P4 P5 + P6P1 + P2

Selection

3.02.0

0.3

.0

kbp

Selection

B A

C

38

Fig 11. Schematic diagram of piggyBac transposon vector containing the pac::egfp fusion marker (pXL/hdhfr-pac::egfp). The constructs contains contain hdhfr and pac::egfp expression cassette. hdhfr was used for in vivo pyrimethamine selection. 5’ef-1α: 5’pbef-1α, 5’hsp70: 5’pbhsp70, 3’hsp70: 3’pbhsp70, and ITR: inverted terminal repeat.

39

Fig 12. Generation of mutants using the pac::egfp fusion marker. (A) Fluorescence images of parasites before selection and after the third selection containing the pac::egfp fusion marker. Parasites were stained with Hoechst 33342. The scale bar represents 10 μm. (B) eGFP-positive parasite ratios after each puromycin selection. Ratios were analyzed using fluorescence microscopy. Each bar represents the mean ± SD of four independent experiments. *** p < 0.001, n.s.: not significant (paired t-tests).

A B

40

Fig 13. Application of the hdhfr-WR99210 system to in vitro selection. (A) Fluorescence images of WT and parasites after the fifth selection containing the hdhfr marker. Parasites were stained with Hoechst 33342. WT: wild type. The scale bar represents 10 μm. (B) eGFP-positive parasite ratio transfected with pXL/hdhfr-pac-egfp after each WR992210 selection, analyzed using fluorescence microscopy. Each bar represents the mean ± SD of three independent experiments. * p < 0.05, *** p < 0.001, n.s.: not significant (paired t-tests). (C) Flow cytometry analysis of eGFP positive mutant ratio after each WR99210 selection. Numbers above bracketed lines indicate percent parasites with eGFP expression.

Before 1st 2nd

3rd

eGFP

Cou

nt

4th 5th

0.01% 0.20% 0.62%

13.34% 66.54% 90.87%

Selection

A B

C

41

Table 1. piggyBac transposon insertion sites.

Clone Locus Insertion site

1 Chromosome 13, 136517-136518 TTATTCTATTAA-piggyBac-TTAATATTTACA

2 Chromosome 13, 2294432-2294433 AAATAATTTTAA-piggyBac-TTAAAAAAGAAA

3 Chromosome 14, 1045361-1045362 TAATATTGTTAA-piggyBac-TTAATAAAAATG

42

Table 2. Primer sequences used in spect2 KO experiments.

Primer name Sequence (5’ to 3’)

P1 ACCCGTCTTTGGTCATTTGT

P2 AACAGCGCAGTTGAGTTGTAG

P3 TGTGCATATTATTTGTCATTTTTATG

P4 GGCTTGTACTCGGTCATGGT

P5 CTCGAGAGATCCCGTTTTTC

P6 TGGCCATTAAATCCACCATT

5’spect2-F CGGATCCGCTAACACATAGCGAAACCATGTTGTC

5’spect2-R CGCGAATTCTATAATCGTCATAATCATCTTCATCATCACC

3’spect2-F CCGCTCGAGAAAGATGAAGAACAAAATGAGCATATAGATA

3’spect2-R CGGTACCGCCAATTGTGTATTTTATGCAGTTTGACT

43

CHAPTER 2

Development of a bsd-blasticidin selection system in P. berghei

2-1: Introduction

The reverse genetics approach has been established in P. berghei and used to study

malaria parasite biology (18, 50), however, the limited number of selection markers has

restricted the range of genetic manipulation (6, 16, 32). In Chapter 1, to overcome this

problem, I developed an in vitro culture drug selection method for P. berghei, based on

short-term in vitro culture with a drug followed by parasite recovery in vivo. The most

important advantage of the in vitro method was to enable the use of drugs (such as

puromycin) that are toxic for the rodent host. Another advantage of this in vitro selection

method is that the target mutant parasite can be enriched to the desired level (>90%) within

two weeks. This high selection efficacy allows for the easy isolation of a mutant clone by

reducing the number of mice, the amount of time needed, and the cost of the cloning

procedure.

In Chapter 2, I attempted to establish an additional selection system using in vitro

selection method to perform sequential genetic manipulation in P. berghei. The blasticidin S

deaminase (bsd) gene is isolated from Aspergillus terreus; it confers blasticidin S (blasticidin)

resistance and is widely used for genetic manipulation of eukaryotic cells (57). Blasticidin

inhibits protein synthesis in both prokaryotic and eukaryotic cells. This method has been

used in human malaria studies with P. falciparum (69); however, it has not been used in P.

berghei because of its toxicity to rodent hosts. I solved this host toxicity problem by

applying it in our in vitro selection method. I describe the establishment of a novel

44

blasticidin selection system using bsd as a marker. Furthermore, I describe the first

demonstration of triple sequential manipulation in P. berghei using independent positive

markers.

45


Ethics statement


for Laboratory Animals from the Obihiro University of Agriculture and Veterinary Medicine.

The Committee of Animal Experiments of the Obihiro University of Agriculture and

Veterinary Medicine approved the protocol (permit number 29-146).


ICR and BALB/c (five-week old) mice were obtained from CLEA Japan, inc. (Tokyo,

Japan). The BALB/c mice were used for the parasite cloning and growth assays, and the

ICR mice were used for the other experiments. I used two parasite strains, the wild type P.

berghei ANKA strain (WT) (obtained from Dr. M. Torii, Ehime University) and a strain

constitutively expressing GFP (PbDHFR-GFP) (44) (obtained from Dr. M. Yuda, Mie

University).

Plasmid construct

Elements of the pXL/hdhfr-bsd-egfp plasmid were sequentially ligated into a

pXL-BacII-DHFR plasmid backbone (4, 65). Firstly, the hdhfr expression cassette was

excised from pXL-BacII-DHFR, namely pXL-BacII-DHFR (-). Next, hdhfr was cloned into

pXL-BacII-DHFR (-) under control of the P. berghei elongation factor 1 alpha (pbef-1α)

promoter and the pbdhfr-ts terminator. Then, egfp was excised from the pCX-EGFP Vector

(79) under control of the pbhsp70 promoter and terminator. This was cloned into the

plasmid pXL-BacII-DHFR (-) that also contained the hdhfr expression cassette. The bsd

gene was then excised using pCMV/Bsd (Invitrogen, Carlsbad, CA, USA) under control of

46

the pbhsp70 promoter and terminator and cloned into the pXL-BacII-DHFR (-) that contained

the hdhfr and egfp expression cassettes. The promoters and terminators were excised from a

Yuda 2 plasmid (obtained from Dr. M. Yuda, Mie University). pXL/hdhfr-bsd-egfp was

transected with the transposase expression vector EGF-pgT.

Elements of pBS/bsd were generated into a pBS backbone. The bsd expression

cassette was flanked by the pbhsp70 promoter and terminator.

The correct sequences of all plasmid inserts were confirmed by DNA sequencing using

an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems).


Parasite transfection experiments followed standard protocols as described in Chapter 1

(51). All in vitro drug selection procedures were performed separately from the in vivo drug

selection procedures that used pyrimethamine or WR99210, and basically followed as

described in Chapter 1.

In the piggyBac experiments, approximately 7 μl of infected P. berghei blood was

collected from the tail, placed in 0.5 ml of culture medium with 2 μl of heparin solution, and

centrifuged at 500 g for 5 min at RT. The supernatant was discarded, and the parasites were

resuspended in 0.5 ml of culture medium. The suspension (450 μl, parasitemia 0.5-3.0%)

was placed into a 24-well plate (Thermo Fisher Scientific), and 50 μl of blasticidin S stock

solution (Funakoshi, Osaka, Japan, 5 mg/ml, dissolved in RPMI 1640 medium) was added to

form a final concentration of 500 μg/ml (approximately 5-fold IC90 value of PBDHFR). The

parasites were incubated for approximately 20 h (36.5 °C, 5% CO2, 5% O2, 90% N2). After

incubation, the parasites were collected by centrifuging at 500 g for 5 min at RT, resuspended

in 100 μl of PBS, and injected intravenously into a naïve mouse. This selection procedure

47

was repeated when the parasitemia reached 0.5-3.0%.

In double crossover homologous recombination experiments, 200 μl of infected P.

berghei blood was collected and placed in 5 ml of culture medium, centrifuged at 500 × g for

8 min at RT, and the supernatant was discarded. The blood was resuspended in 10.8 ml of

culture medium. The suspension was placed into a 25 cm2 flask (Thermo Fisher Scientific)

with 1.2 ml of blasticidin stock solution to form a final concentration of 500 μg/ml and a total

volume of 12 ml. This suspension was incubated for 20 h. After incubation, the sample

was centrifuged at 500 g for 8 min at RT, resuspended in 100 μl of PBS, and injected

intravenously into a naïve mouse.


Parasites were identified with the Hoechst 33342 stain and quantified using fluorescent

microscopy as previously described in Chapter 1. The parasites were distinguished from

white blood cells by fluorescence intensity and morphology of nuclei stained with Hoechst.

The mutant ratio was calculated by dividing the number of eGFP-positive parasites by the

number of Hoechst-positive parasites. In experiments where transfection was performed

with GFP-positive parasites, the mutant ratio was calculated by dividing the number of

GFP-negative parasites by the number of Hoechst-positive parasites.

Fluorescence analysis and flow cytometry analysis

Fluorescent images of parasites were obtained using a BZ-9000 fluorescence

microscope (Keyence, Osaka, Japan) under 400× magnification and were analyzed using a

BZ-II Analyzer (Keyence). For the flow cytometry analysis, infected P. berghei blood was

stained with the cell-permeant DNA dye SYTO59 (Thermo Fisher Scientific) for counter

48

staining, and analyzed with an EPICS ALTRA flow cytometer (Beckman Coulter) as

previously described in Chapter 1. 525 nm and 675 nm band pass emission filters were used

to analyze eGFP and GFP, and SYTO59 fluorescence, respectively.

Drug sensitivity test

Drug sensitivity tests were performed as previously described (16, 53). Briefly,

infected P. berghei blood (parasitemia 1.0-3.0%) was resuspended in a culture medium to a

final hematocrit value of 2%. A 500-μl cell suspension was cultured with various

concentrations of blasticidin (BSD: 0-1000 μg/ml, WT: 0-250 ug/ml and PBDHFR: 0-125

μg/ml) for 20 h in a 24-well plate. The harvested sample was analyzed using

Giemsa-stained thin blood smear films. The number of mature schizonts per 100 parasites

was counted and normalized to the control. Three experiments were performed in triplicate.

IC50 values were calculated using the program GraphPad Prism ver.5 (GraphPad).


Southern blot analysis was performed as described in Chapter 1. Genomic DNA was

extracted by proteinase K-SDS method (28). Two micrograms of extracted genomic DNA

were digested using SpeI (Fig. 17) or EcoRI (Fig. 20), separated on a 1% agarose gel,

transferred onto a Hybond N+ membrane (GE Healthcare), and then hybridized with bsd or

3’pbhsp70 probes labeled with AP (AlkPhos Direct Kit, GE Healthcare). The signal was

detected using a CDP-star (GE Healthcare or Thermo Fisher Scientific). The digital

chemiluminescence images were taken by an Ez-Capture MG (ATTO, Tokyo Japan). 1Kb

Plus DNA Ladder (Thermo Fisher Scientific) was used as a marker.

49


Statistical analyses comparing each bsd-integrated parasite clone against the wild type

parasite were performed using two-tailed unpaired t-tests. The mutant ratio of each selection

was compared using paired t-tests. IC50 values were calculated using the program GraphPad

Prism ver.5 (GraphPad). Statistical analyses comparing IC50 values were performed using

Dunnett’s multiple comparisons tests.

50

2-3: Results

Determination if bsd confers blasticidin resistance to P. berghei.

I analyzed the IC50 values for blasticidin of wild type parasites (WT),

pyrimethamine-resistant pbdhfr-ts marker-integrated parasites (PBDHFR), and

pXL/hdhfr-bsd-egfp-transfected parasites that were selected by pyrimethamine (BSD) (Fig.

14). The IC50 values were 29.87 ± 12.55 μg/ml for WT, 27.13 ± 8.47 μg/ml for PBDHFR,

and 159.15 ± 103.54 μg/ml for BSD (Fig. 15). The IC50 value of BSD tended to increase, as

compared with that of WT (p=0.0684) and PBDHFR (p=0.0637). BSD showed significantly

decreased susceptibility to blasticidin at the concentrations above the IC70 value compared

with WT and PBDHFR (p < 0.05). Therefore, bsd is functional in P. berghei and can confer

blasticidin resistance for the parasite.

Use of bsd as a selection marker in P. berghei.

Drug sensitivity test described above confirmed that the optimum concentration of

blasticidin was 500 μg/ml (approximately IC70 value of BSD and 5-fold IC90 value of

PBDHFR). The in vitro selection procedure for the pXL/hdhfr-bsd-egfp-transfected parasite

was performed three times with the 500 μg/ml concentration of blasticidin, and the

egfp-expressing mutant ratio was monitored after each selection. The ratio was 3.29 ± 1.57,

92.33 ± 1.97, and 94.64 ± 1.98 (Mean ± SD) % after each selection, respectively (Figs. 16A,

16B). It took 1-2 days from transfection to 1st selection (parasitemia 1.89 ± 1.53%), 6-7

days from 1st to 2nd selection (parasitemia 1.46 ± 0.23%), and 5 days (parasitemia 0.98 ±

0.51%) from 2nd to 3rd selection. Two clones were isolated from the mutant parasites

population selected in Fig. 16B by in vivo limiting dilution method to confirm that bsd was

integrated into the genome. Southern blot analysis confirmed that bsd was integrated into

51

the genome (Fig. 17A). Insertion sites of the piggyBac transposon were confirmed by

inverse PCR (Table 3). The growth of the two clones was analyzed to determine whether the

integration of bsd affected parasite growth. The two clones showed no significant difference

from wild type parasites in vivo (Fig. 17B). A typical transfection line was also analyzed

using flow cytometry. More than 96% of the parasites expressed eGFP after the second

selection (Fig. 16C). Therefore, bsd can be used as a positive selection marker in P. berghei.

Use of a bsd marker for gene targeting.

I constructed a targeting vector that contained a bsd expression cassette which replaced

the gfp expression cassette of the GFP-expressing mutant (PbDHFR-GFP) (44) through

double crossover homologous recombination (Fig. 18). The targeting vector was transfected

to PbDHFR-GFP, and the gfp negative mutant ratio was monitored after each in vitro

selection. The ratio was 4.74 ± 0.99, 6.88 ± 0.69, and 98.57 ± 2.35 (Mean ± SD) % after

each selection, respectively (Figs. 19A, 19B). It took 2-3 days from transfection to 1st

selection (parasitemia 1.09 ± 0.92%), and 5-6 days from 1st to 2nd selection (parasitemia 1.80

± 0.86%). Two clones were isolated and Southern blot analysis confirmed that bsd was

integrated into the genome with the expected size (Wild: 11.5 kbp with 3’pbhsp70 probe,

GFP: 11.5 kbp and 8.9 kbp with 3’pbhsp70 probe, cl.1 and cl. 2: 7.6 kbp with bsd probe, 11.5

kbp and 7.6 kbp with 3’pbhsp70 probe) (Fig. 20). A typical transfection line was also

analyzed using flow cytometry. More than 99% of the parasites did not express GFP after

the second selection (Fig. 19C). Therefore, bsd can be used for gene targeting, as well as for

random insertion using the piggyBac transposon.

Use of a bsd marker with two established markers.

52

The targeting vector pBS/bsd was transfected to the GFP-expressing spect2 KO

parasites containing pac and pbdhfr-ts markers (PbDHFR-GFP+PAC) (Fig. 21). The in vitro

selection procedure was repeated twice, with the gfp negative mutant ratio monitored after

each selection. The ratio was 3.87 ± 1.77, 8.02 ± 2.39, and 99.29 ± 0.74 (Mean ± SD) %

after each selection, respectively (Fig. 22A). The clone PbDHFR+PAC+BSD was isolated.

Correct modification of the mutant clone with parasites in each stage was confirmed with

fluorescent microscopy (Fig. 22B), flow cytometry analysis (Fig. 22C) and Southern blot

analysis (Fig. 23). Therefore, bsd can be used in sequential triple genetic manipulation with

the established pac and traditional pbdhfr-ts markers.

53

2-4: Discussion

The number of available selection markers has restricted the range of genetic

manipulations of P. berghei, emphasizing the need for the establishment of additional

selection markers. I established an in vitro selection method in order to overcome this

problem in Chapter 1. In Chapter 2, I developed a selection marker in P. berghei that can be

used with this in vitro method. Blasticidin S deaminase is a useful selection marker in

several organisms (57). The bsd marker is tractable due to its small size (399 bp), with

blasticidin stable in both solid state and in solution (<pH 8.0) (46). The bsd marker is used

in P. falciparum studies, but has not been used in P. berghei studies because of blasticidin

toxicity in the rodent host. I solved this problem by applying it in the in vitro selection

method.

Plasmodium berghei was shown to be susceptible to blasticidin and bsd is functional in

P. berghei. Blasticidin S deaminase didn’t inhibit growth of 2 clones of

pXL/hdhfr-bsd-egfp-transfected parasite and conferred an approximate 5-fold decrease

susceptibility to P. berghei ANKA. Indeed, the desired mutants could be selected by

blasticidin at the concentration that BSD showed significantly decreased susceptibility.

These results suggest that bsd can be used as a selection marker in P. berghei.

The desired bsd-integrated mutant clones were isolated using both random insertion

with piggyBac transposon and homologous recombination methods. In the piggyBac

experiments, inverse PCR and sequencing analysis of two independent parasite clones

identified the unique TTAA piggyBac insertion sites. Southern blot analysis also confirmed

a single unique integration occurring in each clone at the identified locus with expected

fragment size obtained from PlasmoDB database. In double crossover homologous

recombination experiments, Southern blot analysis of two isolated clones also confirmed that

54

integration of bsd at the correct gfp locus of parental line through double crossover

homologous recombination. I confirmed that integration of bsd did not affect parasite

growth. Therefore, bsd can be used as a selection marker. The bsd-blasticidin selection

system was applied to the in vitro selection method together with pac-puromycin and

hdhfr-WR99210, using the different modes of action of each drug. This indicates the

universality of the in vitro selection method, and its potential use for further markers (69).

It was possible to enrich the desired mutants by more than 90% with two repetitions of

the selection procedure using the bsd-blasticidin system. This high selection efficacy was

comparable to the in vitro pac-puromycin system, and permits the easy cloning of target

mutants using in vivo cloning methods with only five mice needed.

The bsd-blasticidin system provides a useful platform for sequential genetic

manipulation. The bsd-blasticidin system is independent from antifolate and puromycin

systems (101), so bsd can be used with traditional antifolate and pac markers. These results

suggest that bsd can readily be used in sequential manipulation experiments with the mutant

parasites established in past malaria research using any type of selection marker, including

reference lines expressing fluorescence protein (27, 78). This is the first demonstration of

sequential genetic manipulation in P. berghei using three independent positive selection

markers without marker recycling.

Furthermore, another advantage is that the bsd-blasticidin system permits easy isolation

of double mutants together with the pac-puromycin system. In traditional marker recycling

methods, more than 100 days are required for double mutant isolation because of the complex

process including cloning at each step (6, 66). However, in our in vitro systems, only one

cloning procedure is needed at the final step because of the high selection efficacy.

Additionally, negative selection is not required. Therefore, isolation of target double

55

mutants can be obtained within 40 days.

In summary, I established bsd as a novel selection marker in P. berghei. Furthermore,

the bsd marker can be used together with pac and traditional antifolate markers. These

results significantly improve the flexibility of genetic manipulation of P. berghei, and thus

permits us a deeper understanding of malaria parasite molecular biology using a reverse

genetics approach.

56

2-5: Summary

Plasmodium berghei is used as a rodent model for the study of malaria. However,

multiple genetic manipulations are restricted by the paucity of selectable markers. The

bsd-blasticidin selection system is widely used for eukaryotic cells; however, it could not

previously be used for P. berghei due to toxicity to the rodent host. In this Chapter, I

described the application of this selection system in P. berghei using an in vitro selection

method. The desired bsd integrated mutants were enriched by more than 90% within two

weeks when using this system. Furthermore, the bsd marker can be used sequentially with

established pyrimethamine and puromycin resistant markers. This system allows deeper

understanding of malaria parasite biology through extensive genetic manipulation of P.

berghei.

57

Fig 14. Schematic diagram of the piggyBac transposon vector containing hdhfr, bsd, and egfp expression cassettes (pXL/hdhfr-bsd-egfp). The construct contains hdhfr and bsd as a positive selection marker. The construct also contains egfp as a reporter. hdhfr was used for in vivo pyrimethamine selection. 5’ef-1α: 5’pbef-1α, 5’hsp70: 5’pbhsp70, 3’hsp70: 3’pbhsp70, and ITR: inverted terminal repeat.

58

Fig 15. Expression of bsd confers resistance to puromycin. Growth inhibition of wild type parasites (WT), pXL/hdhfr-bsd-egfp-transfected parasites (BSD), and GFP-expressing mutants (PBDHFR) was evaluated by determining schizont development within a range of blasticidin concentrations.

59

Fig 16. Generation of mutants using the bsd marker and the piggyBac transposon. (A) Fluorescence images of parasites after each selection. Parasites were stained with Hoechst 33342. The scale bar represents 10 μm. (B) The eGFP-positive parasite ratio after each blasticidin selection. The ratio was analyzed using fluorescence microscopy. Each bar represents the mean ± SD of three independent experiments. *** p < 0.001, ** p < 0.01, n.s.: not significant (paired t-tests). (C) Flow cytometry analysis of the typical transfection line of eGFP positive mutant ratio after each blasticidin selection. Numbers above the bracketed lines indicate the percentage of parasites with eGFP expression.

A

C

60

Fig 17. Integration of bsd did’t inhibit parasite growth. (A) Southern blot analysis of two mutant clones. Genomic DNA was digested using SpeI and hybridized with a bsd probe. Wild: wild type. cl.: clone. (B) Growth assay of two bsd integrated clones. Female BALB/c mice were infected intravenously with 1,000 infected P. berghei erythrocytes. Parasitemia of infected mice (n=5) was monitored daily by examination of blood smears. cl.: clone. WT: wild type.

61

Fig 18. Schematic diagram showing the targeting of gfp by bsd through double crossover homologous recombination. gfp in the GFP expressing mutant was replaced by bsd through double crossover homologous recombination. The location of the probe and the expected sizes of the fragments detected by Southern blot analysis of genomic DNA digested with EcoRI are shown. 5’hsp70: 5’pbhsp70, and 3’hsp70: 3’pbhsp70.

62

Fig 19. Demonstration of gene targeting using the bsd marker. (A) Fluorescence images of parasites after each selection. Parasites were stained with Hoechst 33342. The scale bar represents 10 μm. (B) The GFP negative parasite ratio after each blasticidin selection. The ratio was analyzed using fluorescence microscopy. Each bar represents the mean ± SD of three independent experiments. *** p < 0.001, n.s.: not significant (paired t-tests). (C) Flow cytometry analysis of the GFP positive mutant ratio after each blasticidin selection. Numbers above the bracketed lines indicate the percentage of parasites with GFP expression.

C

A B

63

Fig 20. Desired mutant clone generated through double crossover homologous recombination were successfully isolated. Southern blot analyses of two independent clones. Genomic DNA was digested using EcoRI and hybridized with bsd and 3′hsp70 probes. The predicted sizes of restriction fragments are shown in Fig. 18. Wild: wild type, GFP: GFP-expressing parasite (parental line), 3’hsp70: 3’pbhsp70, and cl.: clone.

64

Fig 21. Schematic diagram showing the sequential manipulation using three markers. The location of the probe and the expected sizes of the fragments detected by Southern blot analysis of genomic DNA digested with EcoRI are shown. In the third manipulation, gfp in the GFP expressing spect2 KO mutant was replaced by bsd through double crossover homologous recombination. pbdhfr-ts was used to obtain the parent GFP transgenic parasite by in vivo pyrimethamine selection. 5’hsp70: 5’pbhsp70, and 3’hsp70: 3’pbhsp70.

65

Fig 22. Sequential genetic manipulation using three markers. (A) The GFP negative parasite ratio after each blasticidin selection. The ratio was analyzed using fluorescence microscopy. Each bar represents the mean ± SD of three independent experiments. *** p < 0.001, * p < 0.05 (paired t-tests). (B) Fluorescence images of each transfection stage mutant clone. Parasites were stained with Hoechst 33342. The scale bar represents 10 μm. Wild: wild type, PbDHFR-GFP: GFP-expressing parasite containing the pbdhfr-ts marker, PbDHFR-GFP+PAC: GFP-expressing parasite containing the pbdhfr-ts and pac markers, PbDHFR+PAC+BSD: mutant parasite containing the pbdhfr-ts, pac, and bsd markers. (C) Flow cytometry analysis of each transfection stage mutant clone. Numbers above the bracketed lines indicate the percentage of parasites with GFP expression. Wild: wild type, PbDHFR-GFP: GFP-expressing parasite containing the pbdhfr-ts marker, PbDHFR-GFP+PAC: GFP-expressing parasite containing the pbdhfr-ts and pac markers, PbDHFR+PAC+BSD: mutant parasite containing the pbdhfr-ts, pac, and bsd markers

Wild

GFP

Cou

nt 0.02% 97.44% 0.06%97.89%

Parasite line

PbDHFR-GFPPbDHFR-GFP

+PAC PbDHFR

+PAC+BSD C

B

A

66

Fig 23. Sequential manipulation using three markers was correctly performed. Southern blot analyses of each transfection stage mutant clone. Genomic DNA was digested using EcoRI and hybridized with pac, bsd, and gfp probes. The predicted sizes of restriction fragments are shown in Fig. 21.

67

Table 3. The piggyBac transposon insertion sites.

Clone Locus Insertion site

1 Chromosome 13, 58751-58752 ATTGTCTTTTAA-piggyBac-TTAAATAAATAA

2 Chromosome 1, 107977-107978 AAAATATTTTAA-piggyBac-TTAACAAAAAAG

68

CHAPTER 3

Improvement of in vitro selection method in P. berghei

3-1: Introduction

An in vitro culture drug selection method for P. berghei was developed based on the

repeat of short-term in vitro culture with a drug followed by parasite recovery in vivo in

Chapter 1 and 2. This method enabled to use the drugs toxic to rodent host. This point was

the most important advantage of the in vitro selection method. Using this in vitro selection

method, pac and bsd could be applied as the selection marker in P. berghei. Using these

novel positive selection markers in P. berghei, I could demonstrate the triple sequential gene

manipulation using pac, bsd and traditional pbdhfr-ts markers. Furthermore, in these in vitro

selection systems, the target mutant parasite can be enriched over 90% within two weeks.

These results enabled the easy isolation of the target gene-mutated parasite clones with few

mice, short times and low costs at the in vivo cloning procedure. As mentioned above, the in

vitro selection systems had several advantages. However, there is room for improvement as

well.

Flexibility of the promoter selection is important for the Plasmodium research.

However, in Chapter 1 and 2, only pbhsp70 promoter was used to drive the marker genes. In

some cases, the over expression of the marker gene poses unexpected effects for parasite

phenotype. Therefore, it is desirable that optimal choice of promoter should be provided for

each assay. For example, in the mosquito stage studies, blood stage-specific promoter is

preferred to minimize an unknown effect. Furthermore, in some cases, size of targeting

vector poses low recombination efficacy at the gene manipulation. The choice of

bidirectional promoter reduces the size of targeting vector. In the P. berghei research, many

69

kinds of promoters have been used for regulation of gene expression in the previous studies (9,

20, 78, 84). Application of these promoters for maker gene expression may facilitate as

useful for the future Plasmodium research.

In Chapter 1 and 2, I repeated the selection procedure at least twice based on single cell

cycle in vitro culture and in vivo parasite recovery. However, this repetition was

complicated for practical use. If two cell-cycles in vitro drug selection can be applied, this

procedure may enrich the mutant parasite population to >90% without repeating the selection

procedure. In general, it is considered that continuous in vitro culture of P. berghei had

many difficulties. Jambou et al. (47) reported the improved in vitro culture method in which

they could maintain P. berghei around 5 days in vitro without increasing parasitemia.

However, this method was laborious and it had not yet been applied for drug selection for

generating transgenic parasites (47). There are many reasons for the difficulty of continuous

in vitro culture of P. berghei. Plasmodium berghei cannot propagate in vitro culture because

the merozoites cannot egress from the schozont without additional mechanical shear stress in

in vitro culture (71). It was also reported that P. berghei-infected mouse RBC maintained in

vitro at 37 °C showed mild hemolysis (47, 88), because of low stability of mouse RBC (47).

Furthermore, a restricted ability to invade mature RBC is also a bottleneck of the long-term

cultivation of P. berghei (47).

In this Chapter, I attempted to solve the problems described above. First, I attempted

to apply the pbef-1α promoter, commonly used to drive marker gene in P. berghei, as a model.

Second, I attempted to simplify the procedure of drug selection by the establishment of two

cell-cycles culture method.

70


Ethics statement


for Laboratory Animals from the Obihiro University of Agriculture and Veterinary Medicine.

The Committee of Animal Experiments of the Obihiro University of Agriculture and

Veterinary Medicine approved the protocol (permit number 29-146).


ICR and BALB/c (five-week old) mice were obtained from CLEA Japan, inc. (Tokyo,

Japan). The BALB/c mice were used for the parasite cloning and growth assays, and the

ICR mice were used for the other experiments. I used P. berghei ANKA strain (WT)

(obtained from Dr. M. Torii, Ehime University).

Codon optimization of marker genes

Codons of pac and bsd were optimized based on the P. berghei codon usage frequency

using Codon Usage Database (http://www.kazusa.or.jp/codon/), and the codons were changed

to the most preferred codon without changing amino acid sequences. The codon-optimized

markers (pac-opt and bsd-opt) were chemically synthesized by GenScript (Piscataway, NJ,

USA).

Plasmid construct

Elements of the pXL/ef-1α-pac-egfp, and pXL/ef-1α-pac-opt-egfp plasmid were

sequentially ligated into a pXL-BacII-DHFR plasmid backbone. Firstly, the hdhfr

expression cassette was excised from pXL-BacII-DHFR, namely pXL-BacII-DHFR (-).

71

Next, egfp was excised from the pCX-EGFP Vector under control of the P. berghei hsp70

promoter and terminator. This was cloned into the plasmid pXL-BacII-DHFR (-) that also

contained the hdhfr expression cassette. For pXL/ef-1α-pac-egfp, the pac gene was then

excised using a pMXs-Puro retroviral vector (Cell Biolabs, San Diego, CA, USA) under

control of the pbef-1α promoter and pbdhfr-ts terminator and cloned into the

pXL-BacII-DHFR (-) that contained the hdhfr and egfp expression cassettes (pXL/egfp).

For pXL/ef-1α-pac-opt-egfp, prepared pac-opt gene under control of the pbef-1α promoter

and pbdhfr-ts terminator and cloned into the pXL/egfp. The promoters and terminators were

excised from a Yuda 2 plasmid (obtained from Dr. M. Yuda, Mie University).

pXL/hdhfr-bsd-egfp was transected with the transposase expression vector EGF-pgT.

The correct sequences of all plasmid inserts were confirmed by DNA sequencing using

an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems)


Parasite transfection experiments followed standard protocols as described in chaper1.

All in vitro culture was performed at 36.5 °C with 5% CO2, 5% O2 and 90% N2 gas mixture.

The in vitro puromycin selection except for two cell-cycles culture method was performed as

described in Chapter 1.

In vitro drug selection using two cell-cycles culture

On day 1, 300 μl of infected P. berghei blood (parasitemia 0.5-3.0 %) was collected and

placed in 5 ml of culture medium, centrifuged at 500 × g for 8 min at RT, and the supernatant

was discarded. The blood was resuspended in 14.94 ml of culture medium. The

suspension was placed into a 25 cm2 flask (Thermo Fisher Scientific) with 1.66 ml of

72

puromycin stock solution to form a final concentration of 1.0 μg/ml and a total volume of

16.6 ml. This suspension was incubated for 20 h. On day 2, culture medium was removed

after centrifugation of the culture at 500 × g for 8 min. The pellet resuspended in 14.94 ml

of culture medium. They were filtrated using a filter unit with a 1.2 μm pore size and 32

mm diameter (Pall corporation, NY, USA), attached to a 20 ml syringe. The filtrate,

containing free merozoite was put into a 25 cm2 flask (Thermo Fisher Scientific), and soon

mixed with 300 μl of non-infected mouse RBC prepared by two washes using culture medium

and centrifugation at 500 × g for 8 min. The flask was placed on a shaker (NA-M101,

NISSIN, Tokyo, Japan) and incubated at around 40-60 rpm, for approximately 2 h. After

incubation, 1.66 ml of puromycin solution were added into the flask to form a final

concentration of 1.0 μg/ml and a total volume of 16.6 ml, and then incubated for around 20 h.

On day 3, the parasites were collected by centrifuging at 500 g for 5 min at RT, resuspended

in 100 μl of PBS, and injected intravenously into a naïve mouse.


Parasites were identified with the Hoechst33342 stain and quantified using fluorescent

microscopy as described in Chapter 1.


Southern blot analysis was performed as described in Chapter 1. Genomic DNA was

extracted by proteinase K-Sodium dodecyl sulfate (SDS) method (28). Two micrograms of

extracted genomic DNA were digested using NdeI, separated on a 1% agarose gel, transferred

onto a Hybond N+ membrane (GE Healthcare), and then hybridized with pac-opt probes

labeled with AP (AlkPhos Direct Kit, GE Healthcare). The signal was detected using a

73

CDP-star (GE Healthcare). The digital chemiluminescence images were taken by an

Ez-Capture MG (ATTO, Tokyo, Japan). 1Kb Plus DNA Ladder (Thermo Fisher Scientific)

was used as a marker.


Statistical analyses comparing each pac-opt-integrated parasite clone against the wild

type parasite were performed using two-tailed unpaired t-tests. The mutant ratio of each

selection was compared using paired t-tests. All statistical analysis was performed using the

program GraphPad Prism ver.5 (GraphPad).

74

3-3: Results

pbef-1α promoter can be applied for in vitro puromycin selection using codon-optimized

marker.

A wild type parasite was transfected with pXL/ef-1α-pac-egfp, and then applied for

puromycin selection. However, the desired eGFP-expressing mutants could not be obtained

(Fig. 26A). This result indicated that promoter activity might be not enough for selection.

To improve expression level, pac-opt sequence was optimized for the codon usage of P.

berghei (Fig. 24), and constructed pac-opt expression vector (pXL/hdhfr-ef-1α-pac-opt-egfp)

(Fig. 25). A wild type parasite was transfected with pXL/hdhfr-ef-1α-pac-opt-egfp. The in

vitro puromycin selection was repeated twice, and the egfp-expressing mutant ratio was

monitored before and after each selection. The ratio was 0.01 ± 0.01, 15.13 ± 12.51, and

97.67 ± 1.70 (Mean ± SD) %, respectively (Fig. 26B). Three clones were isolated from the

mutant parasites population selected in Fig. 26B by in vivo limiting dilution method to

confirm integration of pac-opt into the genome. Southern blot analysis confirmed that

pac-opt was integrated into the genome. Two copies of pac-opt were integrated into cl. 1,

and one copy of pac-opt was integrated into cl. 2 and 3 (Fig. 27A). The growth of the cl. 1

and cl. 3 was compared with that of wild type. The two clones grew equally well as wild type

parasites, and the fact suggested that the integration of pac-opt did not affect the parasite

growth (Fig. 27B). Thus, pac-opt under the control of pbef-1α promoter can be used as a

positive selection marker in P. berghei.

pbef-1α promoter also can be applied for in vitro blasticidin selection using

codon-optimized marker.

To examine whether pbef-1α promoter can be applied for blasticidin selection system, I

75

designed bsd-opt sequence was optimized for the codon usage of P. berghei (Fig. 28), and

constructed bsd-opt expression vector (pXL/hdhfr-ef-1α-bsd-opt-egfp) (Fig. 29). The in

vitro selection procedure for the pXL/ef-1α-bsd-opt-egfp-transfected parasite was applied

twice as described, and the egfp-expressing mutant ratio was monitored before and after each

selection. The ratio was 0.01 ± 0.01, 2.81 ± 1.49, and 94.16 ± 2.15 (Mean ± S.D.) % after

each selection, respectively (Fig. 30). Thus, bsd-opt driven by pbef-1α promoter also can

also be used as a positive selection marker in P. berghei.

Development of improved in vitro selection method using two cell-cycles culture method.

To simplify the in vitro selection procedure, I examined whether two cell-cycles culture

method could be applied for this method. I established two cell-cycles in vitro culture

procedure utilizing filtration method (76). To determine whether this two cell-cycles culture

method can be used for in vitro selection method, I used it to select

pXL/ef-1α-pac-opt-egfp-transfected parasites. After transfection, puromycin selection was

performed by both the original method used in Chapter 1 and two cell-cycles culture method,

respectively. The egfp-expressing mutant ratio was monitored before and after each

selection. The ratio was 0.00 ± 0.01, 19.51 ± 16.20 and 97.68 ± 1.44 (Mean ± SD) %,

respectively (Fig. 31). There was no significant difference between before and 1st selection

performed by the original method, while the target mutant ratio increased significantly from

before to 1st selection performed by two cell-cycles culture method. The target mutant ratio

after two cell-cycles culture method also significantly increased compared to the method used

in Chapter 1. Thus, in vitro puromycin selection method using two cell-cycles culture

method was successfully developed in P. berghei.

76

3-4: Discussion

In this Chapter, I described the improvement of in vitro drug selection method for

generating transgenic parasite in P. berghei. I attempted to secure the variety of promoter,

and to simplify the selection procedure.

In Chapter 1 and 2, the pbhsp70 promoter was solely used to drive the marker genes.

In this Chapter, the pbef-1α promoter was successfully applied for in vitro selection method

with codon-optimized marker sequence. Previous study reported that transcription levels of

target genes driven by the pbhsp70 promoter were approximately 10 fold higher than that

driven by pbef-1α promoter (42). The pbhsp70 promoter is known to promote constitutive

and strong expression of the gene throughout the life cycle (42). However, to minimize an

unexpected effect on the parasite phenotype after the transfection, the flexibility for promoter

selection would be desirable. Therefore, the use of the pbef-1α promoter for in vitro

selection methods was examined. In pac-puromycin system, the mutant parasite with pac

marker with pbef-1α promoter could not be obtained. It was indicated that the expression

level of PAC under pbef-1α promoter was not enough for puromycin selection, although I did

not analyze the expression level of PAC. GC-richness (around 70%) of pac might affect the

expression level of this marker gene in the parasite genome with AT-richness (19, 108). To

overcome this problem, I optimized the pac sequence with the parasite codon usage. It was

reported that codon optimization of antibiotic gene resulted in improvement of the drug

selection efficacy (63) and increased translation efficacy (108). As a result in puromycin

selection, pbef-1α promoter could be used with codon-optimized pac-opt. This result

suggested that codon optimization increased the expression level of the marker gene.

Furthermore, this codon optimization strategy could also be used in blasticidin selection

system, although I did not evaluate the selection efficacy of the blasticidin selection system

77

with original bsd sequence and pbef-1α promoter sequence. Therefore, it was suggested that

selection marker with GC-richness should be applied after their sequence were optimized for

the codon usage of malaria parasite (22, 31, 60).

In this Chapter, in vitro selection method using two cell-cycles culture method was also

successfully developed. In Chapter 1 and 2, the established method needed to repeat

selection procedures twice based on in vitro culture and in vivo parasite recovery. To

simplify this procedure, two cell-cycles culture method was applied for in vitro selection

system. Plasmodium berghei merozoites cannot egress from the schizont in vitro without

mechanical shear stress (71). Therefore, it was needed to repeat in vitro culture and in vivo

parasite recovery twice in the Chapter 1 and 2. I addressed this problem for applying

filtration protocol used in P. yoelii merozoite purification (76). As a result, in vitro selection

procedure based on two cell-cycles culture with drug could be established. The desired

mutant parasites were enriched to >90% by a single in vitro selection procedure. The

selection efficacy was equivalent to that of the method used in Chapter 1 and 2. This result

could shorten the period required for generating mutant parasites. It took around 11 days to

enrich desired mutant parasite to >90% in two cell-cycles culture method, whereas it took

around 15 days in the original method used in Chapter 1 and 2.

In summary, I successfully applied pbef-1α promoter in the in vitro selection systems.

This resulted promoter variety in in vitro selection system. Furthermore, I could simplify the

in vitro selection procedure using two cell-cycles culture method. This result could

minimize the time and labor required for the original in vitro selection system. Therefore,

these improvements provide us with more flexible and user-friendly platform to perform

genetic manipulation of P. berghei.

78

3-5: Summary

In Chapter 3, improvement of the in vitro selection method was described. Flexibility

of the promoter selection is important for the Plasmodium research. Only pbhsp70 promoter

was solely used to drive the marker gene in Chapter 1 and 2. Therefore, the pbef-1α

promoter was applied as an alternative promoter choice for the marker gene expression under

the pac-puromycin and bsd-blasticidin systems. The pbef-1α promoter was successfully

applied in a combination with the parasite’s codon-optimized marker sequences, pac-opt and

bsd-opt. Furthermore, to simplify in vitro selection method, I applied two cell-cycles culture

method in which the merozoite was released by the filtration of the culture with matured

schizont. Using two cell-cycles culture selection method, the desired mutants were

successfully enriched to >90% with single selection procedure. These improvements

provide us with more user-friendly platform for genetic manipulation of P. berghei.

79

Fig 24. Nucleotide sequences of original (pac) and codon-optimized pac (pac-opt). In the pac-opt sequence, changed nucleotides are highlighted.

80

Fig 25. Schematic diagram of the piggyBac transposon vector containing pac-opt and egfp expression cassettes (pXL/ ef-1α-pac-opt-egfp). The construct contains pac-opt as a positive selection marker. The construct also contains egfp as a reporter. The location of the probe used for Southern blot analysis is shown. ITR: inverted terminal repeat.

81

Fig 26. Desired mutant parasites could be enriched by puromycin selection procedure when using codon-optimized marker. (A) The eGFP-positive parasite ratio of pac-integrated parasite before and after each puromycin selection. Three independent experiments were performed. N.D.: Not detected. (B) The eGFP-positive parasite ratio of pac-opt integrated parasite before and after each puromycin selection. The ratio was analyzed using fluorescence microscopy. Each bar represents the mean ± SD of three independent experiments. *** p < 0.001, n.s.: not significant (paired t-tests).

A B

82

Fig 27. Integration of pac-opt marker didn’t inhibit parasite growth. (A) Southern blot analysis of two mutant clones. Genomic DNA was digested using NdeI and hybridized with a pac-opt probe. Wild: wild type. cl.: clone. (B) Growth assay of two pac-opt integrated clones. Female ICR mice were infected intravenously with 1,000 infected P. berghei erythrocytes. Parasitemia of infected mice (Wild: n=5, cl.1: n=4, cl.2: n=3) were monitored daily by examination of blood smears. cl.: clone. WT: wild type.

A B

83

Fig 28. Nucleotide sequences of original (bsd) and codon-optimized bsd (bsd-opt). In the bsd-opt sequence, changed nucleotides are highlighted.

84

Fig 29. Schematic diagram of the piggyBac transposon vector containing bsd-opt and egfp expression cassettes (pXL/ ef-1α-bsd-opt-egfp). The construct contains bsd-opt under the control of the pbef-1α promoter as a positive selection marker. The construct also contains egfp under the control of the pbhsp70 promoter as a reporter. ITR: inverted terminal repeat.

85

Fig 30. Desired mutant parasites could be enriched more than 90% with two repetitions of the blasticidin selection procedure. The eGFP-positive parasite ratio before and after each blasticidin selection. The ratio was analyzed using fluorescence microscopy. Each bar represents the mean ± SD of three independent experiments. *** p < 0.001, n.s.: not significant (paired t-tests).

86

Fig 31. Development of mutants using the bsd-opt marker and the piggyBac transposon. The eGFP-positive parasite ratio before and after 1st puromycin selections performed by the method used in Chapter 1, 2 and two-cell-cycles culture method. The ratio was analyzed using fluorescence microscopy. Each bar represents the mean ± SD of three independent experiments. *** p < 0.001, 1st: 1cycle : 1st selection by the method used in Chapter 1,2, 1st :2 cycles : 1st selection by two cell-cycles culture method n.s.: not significant (paired t-tests).

87

GENERAL DISCUSSION

Plasmodium berghei is used as the main rodent malaria model. It is harmless to humans

and its full lifecycle can be completed in a laboratory. Furthermore, P. berghei is genetically

tractable, and a reverse genetics approach has been established. Therefore, numerous

transgenic parasites of P. berghei have been generated, which has led to the identification of a

novel drug target and suitable candidate for vaccines (50).

In vivo drug selection procedure with rodents is used for the isolation of genetically

manipulated P. berghei. Since this procedure rules out drugs that are harmful to mammalian

hosts, the use of popular mammalian drug selection marker genes is largely precluded. This

limitation leads to difficulties in running sequential genetic manipulation experiments.

Furthermore, the percentage of target knockout parasites obtained using the conventional in

vivo selection method is low; therefore, many mice, time and labor are required to isolate a

single cloned parasite. These circumstances have been impeding malaria research. To

overcome these problems, I developed a novel in vitro selection method in P. berghei.

This method was established by combining repeated short-term in vitro cultures with

parasite recovery in vivo (Chapters 1 and 2). The biggest advantage of this method is that it

provides a platform to develop a novel selection system using antibiotics toxic to rodent hosts.

Two selection systems were also successfully established using puromycin and blasticidin

toxic to mammalian hosts. In addition, it was confirmed that the traditional hdhfr-WR99210

system could be applied to this method. These results suggest the universality of this in vitro

selection method and its potential use for further markers.

The desired mutant parasite could be enriched to >90% in both pac-puromycin and

bsd-blasticidin selection systems. This high selection efficacy permits the easy cloning of

88

target mutants using in vivo cloning methods with only five mice needed. In the in vivo

selection method, two rounds of cloning procedures using more than 30 mice are needed to

isolate the target clone. This is a main bottleneck of genetic manipulation of P. berghei (59).

This reduction of the cloning procedure results in a rapid isolation of clones as well as

decreased cost, time, and labor.

A further advantage of an in vitro selection system is its flexible application for

sequential manipulation. While various strategies have successfully used negative selection

in the P. berghei model for sequential manipulation, the disadvantages of the traditional

marker recycling method are the complexity of the procedure and the time requirement of

several months for the isolation of a double mutant parasite. Although the GIMO and

GOMO strategies were developed to address these problems and these methods are

inapplicable to parasites already carrying the antifolate-resistant hdhfr marker which were

commonly used in previous malaria research (66, 70). The in vitro selection method

provides a useful platform for sequential genetic manipulation, such as generation of multiple

gene KO parasites or KO rescue experiments that have been rarely performed (32). In this

study, it was confirmed that both pac-puromycin and bsd-blasticidin selection systems could

be used with the traditional pbhfr-ts-pyrimethamine system. Sequential manipulations were

also successfully demonstrated using pac-puromycin, bsd-blasticidin and traditional

pbhfr-ts-pyrimethamine systems. This is the first demonstration of sequential genetic

manipulation in P. berghei using three independent positive selection markers without marker

recycling. These results also suggest that pac-puromycin and bsd-blasticidin selection

systems can readily be used in sequential manipulation experiments with the mutant parasites

established in past malaria research using any type of selection markers. Another advantage

is that the in vitro selection systems permit easy isolation of double mutants. Isolation of

89

target-double mutants can be obtained within 40 days using two in vitro selection systems.

This period is less than half the number of days compared to the marker recycling method (6,

66). These results suggested that the in vitro selection method permits practical sequential

genetic manipulation in P. berghei.

Although there are several advantages of the in vitro selection method, there is room for

improvement as well. In Chapters 1 and 2, only the pbhsp70 promoter was used to drive the

marker gene. Many kinds of promoters can be used to regulate gene expression depending

on the purpose in P. berghei (20, 40, 78). To omit an unexpected effect of parasite

phenotype, flexibility for promoter selection would be desirable.

To improve the flexibility of promoter use, I attempted to use the pbef-1α promoter as a

model. This promoter was successfully applied to both pac-puromycin and bsd-blasticidin

selection systems using a codon-optimized marker. Codon optimization has been used to

enhance protein expression for heterologous gene expression in several organisms (2, 45, 56,

90). However, an application of the pbef-1α promoter sequence with the original pac

sequence was failed. The transcription activity of the pbef-1α promoter is 2–10 times lower

than that of the pbhsp70 promoter (42). This result suggested that codon optimization

increased the expression level of the marker gene. These results also suggested that codon

optimization of selection marker not only improves the flexibility of promoter use, but also

establishes an additional GC-rich selection marker, which has not been established in malaria

parasites.

The desired mutant was able to be isolated far more easily compared to using the

traditional in vivo selection method. However, it was not simple enough because I needed to

repeat the selection procedure at least twice based on in vitro culture and in vivo parasite

recovery. Therefore, I tried to simplify the selection procedure using a two cell-cycles

90

culture selection method. Two cell-cycles culture method was developed by applying the

filtration protocol used for purification of P. yoelii merozoites (76). Using the two

cell-cycles culture selection method, the desired mutant parasites were successfully enriched

to >90% by a single in vitro selection procedure. This result suggested that this method

could reduce labor for the generation of transgenic parasites. This result also suggested that

this two cell-cycles culture method permits easy isolation of the desired mutant as well as the

in vitro selection method used in Chapters 1 and 2 due to its high efficacy. Thus, this two

cell-cycles culture method provides us a more user-friendly and simpler platform for the

genetic manipulation of P. berghei.

In summary, I successfully established novel in vitro selection methods for P. berghei

using antibiotics toxic to its rodent host. The in vitro selection systems established using

these methods exhibited high selection efficacy relative to other conventional in vivo methods.

I also improved the flexibility of the promoter use and simplified the selection procedure.

These methods should allow the generation of multiple mutants with a greater flexibility and

contribute to our in-depth understanding of malaria parasite biology.

91

GENERAL CONCLUSION

This thesis reports the development of an in vitro drug selection method and two novel

drug selection systems for generating transgenic parasites in P. berghei.

In Chapter 1, an in vitro drug selection method using antibiotics toxic to rodent hosts

was developed in P. berghei. This in vitro method consisted of repeated short-term in vitro

cultures and parasite recovery in vivo. A pac-puromycin system was also successfully

established using this method. To the best of my knowledge, this is first report of the

establishment of a selection system using an antibiotic toxic to the rodent host. In addition,

this system enriched desired mutants to more than 90% (5–10 times higher than the

conventional in vivo method) and permitted easy isolation of desired mutant parasite clones.

This system can work in conjunction with the traditional antifolate selection system.

Furthermore, it was confirmed the universality of this in vitro selection method using the

traditional hdhfr-WR99210 system as a model. Thus, pac-puromycin system was

successfully established using the in vitro drug selection method.

In Chapter 2, a bsd-blasticidin selection system was established using the in vitro

selection method to increase the number of available selection markers with high efficiency

equivalent to that of the pac-puromycin selection system. Furthermore, it was confirmed

that the bsd-blasticidin selection system could be used sequentially with established

pyrimethamine and puromycin selection systems. This was first demonstration of triple

sequential manipulations using three independent positive selection markers in P. berghei.

In Chapter 3, the in vitro selection system was improved. First, to secure the variety of

promoter use, the pbef-1α promoter was applied to the in vitro selection systems. It was

confirmed that the pbef-1α promoter could be used for an in vitro selection system using

92

codon-optimized markers. Second, to simplify the in vitro selection procedure, a two

cell-cycles culture selection method was developed. The desired mutants were successfully

enriched by more than 90% with a onetime selection procedure.

In summary, first, a novel in vitro selection method was established in P. berghei. This

in vitro selection method permits the use of antibiotics toxic to rodent hosts that have never

been used in P. berghei. Second, the pac-puromycin and bsd-blasticidin selection systems

were established in P. berghei. Third, the in vitro selection procedure was improved.

These methods should allow the generation of multiple mutants with greater flexibility and

help to develop our understanding of malaria parasite biology.

93

ACKNOWLEGEMENTS

This research work was carried out at the National Research Center for Protozoan

Diseases (NRCPD), Obihiro University of Agriculture and Veterinary Medicine. This study

was financially supported by founds from a Grant-in-Aid for scientific Research from JSPS.

I owe my gratitude to my supervisor Assoc. Prof. Shinya Fukumoto (NRCPD) for

intellectual guidance, constructive criticism and encouragement during the period of study. I

would like to express my special gratitude to Prof. Shin-ichiro Kawazu (NRCPD) and Assoc.

Prof. Yasuhiro Takashima (Gifu University) for their constructive criticism and valuable

suggestion during Ph. D. research. I am grateful to Prof. Noboru Inoue (NRCPD) and Assist.

Prof. Keisuke Suganuma (NRCPD) for valuable comments and suggestion during group

seminar.

I am thankful to Prof. Ikuo Igarashi, Prof. Hiroshi Suzuki, Prof. Xuenan Xuan, Prof.

Naoaki Yokoyama, Prof. Makoto Igarashi, Prof. Yoshifumi Nishikawa, Assoc. Prof. Kentaro

Kato and Assist. Prof. Rika Umemiya-Shirafuji for their critical reviews of my progress report

during the NRCPD seminar.

My special thanks to Prof. Tadashi Itagaki (Iwate University), Assoc. Prof. Tetsuya

Furuya (Tokyo University of Agriculture and Technology) for their valuable suggestion and

their patience in revising this dissertation. I appreciate past and present members of

NRCPD.

Finally, I wish to express my heartfelt gratitude to all of my colleagues in the research

unit for Vector Biology (NRCPD) and research unit for Advanced Preventive Medicine

(NRCPD) for technical support and help.

94

REFERENCES

1. Ahmed, M.A. and J. Cox-Singh. (2015). Plasmodium knowlesi - an emerging

pathogen. ISBT Sci Ser. 10, 134~140.

2. Algire, M.A., C. Lartigue, D.W. Thomas, N. Assad-Garcia, J.I. Glass, and C.

Merryman. (2009). New selectable marker for manipulating the simple genomes of

Mycoplasma species. Antimicrob Agents Chemother. 53, 4429~4432.

3. Ariey, F., B. Witkowski, C. Amaratunga, J. Beghain, A.C. Langlois, N. Khim, S. Kim,

V. Duru, C. Bouchier, L. Ma, P. Lim, R. Leang, S. Duong, S. Sreng, S. Suon, C.M.

Chuor, D.M. Bout, S. Menard, W.O. Rogers, B. Genton, T. Fandeur, O. Miotto, P.

Ringwald, J. Le Bras, A. Berry, J.C. Barale, R.M. Fairhurst, F. Benoit-Vical, O.

Mercereau-Puijalon, and D. Menard. (2014). A molecular marker of

artemisinin-resistant Plasmodium falciparum malaria. Nature. 505, 50~55.

4. Balu, B., D.A. Shoue, M.J. Fraser, Jr., and J.H. Adams. (2005). High-efficiency

transformation of Plasmodium falciparum by the lepidopteran transposable element

piggyBac. Proc Natl Acad Sci U S A. 102, 16391~16396.

5. Bejon, P., M.T. White, A. Olotu, K. Bojang, J.P. Lusingu, N. Salim, N.N. Otsyula, S.T.

Agnandji, K.P. Asante, S. Owusu-Agyei, S. Abdulla, and A.C. Ghani. (2013). Efficacy

of RTS,S malaria vaccines: individual-participant pooled analysis of phase 2 data.

Lancet Infect Dis. 13, 319~327.

6. Braks, J.A., B. Franke-Fayard, H. Kroeze, C.J. Janse, and A.P. Waters. (2006).

Development and application of a positive-negative selectable marker system for use

in reverse genetics in Plasmodium. Nucleic Acids Res. 34, e39.

7. Canfield, C.J., W.K. Milhous, A.L. Ager, R.N. Rossan, T.R. Sweeney, N.J. Lewis, and

95

D.P. Jacobus. (1993). PS-15: a potent, orally active antimalarial from a new class of

folic acid antagonists. Am J Trop Med Hyg. 49, 121~126.

8. Carlton, J.M., J.H. Adams, J.C. Silva, S.L. Bidwell, H. Lorenzi, E. Caler, J. Crabtree,

S.V. Angiuoli, E.F. Merino, P. Amedeo, Q. Cheng, R.M. Coulson, B.S. Crabb, H.A.

Del Portillo, K. Essien, T.V. Feldblyum, C. Fernandez-Becerra, P.R. Gilson, A.H.

Gueye, X. Guo, S. Kang'a, T.W. Kooij, M. Korsinczky, E.V. Meyer, V. Nene, I.

Paulsen, O. White, S.A. Ralph, Q. Ren, T.J. Sargeant, S.L. Salzberg, C.J. Stoeckert,

S.A. Sullivan, M.M. Yamamoto, S.L. Hoffman, J.R. Wortman, M.J. Gardner, M.R.

Galinski, J.W. Barnwell, and C.M. Fraser-Liggett. (2008). Comparative genomics of

the neglected human malaria parasite Plasmodium vivax. Nature. 455, 757~763.

9. Carvalho, T.G., S. Thiberge, H. Sakamoto, and R. Menard. (2004). Conditional

mutagenesis using site~specific recombination in Plasmodium berghei. Proc Natl

Acad Sci U S A. 101, 14931~14936.

10. Casares, S., T.D. Brumeanu, and T.L. Richie. (2010). The RTS,S malaria vaccine.

Vaccine. 28, 4880~4894.

11. Childs, G.E. and C. Lambros. (1986). Analogues of N-benzyloxydihydrotriazines: in

vitro antimalarial activity against Plasmodium falciparum. Ann Trop Med Parasitol. 80,

177~181.

12. Cohen, J., V. Nussenzweig, R. Nussenzweig, J. Vekemans, and A. Leach. (2010).

From the circumsporozoite protein to the RTS, S/AS candidate vaccine. Hum Vaccin.

6, 90~96.

13. Cowman, A.F., J. Healer, D. Marapana, and K. Marsh. (2016). Malaria: Biology and

Disease. Cell. 167, 610~624.

14. Crabb, B.S. and A.F. Cowman. (1996). Characterization of promoters and stable

96

transfection by homologous and nonhomologous recombination in Plasmodium

falciparum. Proc Natl Acad Sci U S A. 93, 7289~7294.

15. Curtis, C.F., J.E. Miller, M.H. Hodjati, J.H. Kolaczinski, and I. Kasumba. (1998). Can

anything be done to maintain the effectiveness of pyrethroid-impregnated bednets

against malaria vectors? Philos Trans R Soc Lond B Biol Sci. 353, 1769~1775.

16. de Koning-Ward, T.F., D.A. Fidock, V. Thathy, R. Menard, R.M. van Spaendonk, A.P.

Waters, and C.J. Janse. (2000). The selectable marker human dihydrofolate reductase

enables sequential genetic manipulation of the Plasmodium berghei genome. Mol

Biochem Parasitol. 106, 199~212.

17. de Koning-Ward, T.F., P.R. Gilson, and B.S. Crabb. (2015). Advances in molecular

genetic systems in malaria. Nat Rev Microbiol. 13, 373~387.

18. de Koning-Ward, T.F., C.J. Janse, and A.P. Waters. (2000). The development of genetic

tools for dissecting the biology of malaria parasites. Annu Rev Microbiol. 54,

157~185.

19. de Koning-Ward, T.F., A.P. Waters, and B.S. Crabb. (2001).

Puromycin-N-acetyltransferase as a selectable marker for use in Plasmodium

falciparum. Mol Biochem Parasitol. 117, 155~160.

20. Dechering, K.J., A.M. Kaan, W. Mbacham, D.F. Wirth, W. Eling, R.N. Konings, and

H.G. Stunnenberg. (1999). Isolation and functional characterization of two distinct

sexual-stage-specific promoters of the human malaria parasite Plasmodium falciparum.

Mol Cell Biol. 19, 967~978.

21. Dondorp, A.M., F. Nosten, P. Yi, D. Das, A.P. Phyo, J. Tarning, K.M. Lwin, F. Ariey,

W. Hanpithakpong, S.J. Lee, P. Ringwald, K. Silamut, M. Imwong, K. Chotivanich, P.

Lim, T. Herdman, S.S. An, S. Yeung, P. Singhasivanon, N.P. Day, N. Lindegardh, D.

97

Socheat, and N.J. White. (2009). Artemisinin resistance in Plasmodium falciparum

malaria. N Engl J Med. 361, 455~467.

22. Drocourt, D., T. Calmels, J.P. Reynes, M. Baron, and G. Tiraby. (1990). Cassettes of

the Streptoalloteichus hindustanus ble gene for transformation of lower and higher

eukaryotes to phleomycin resistance. Nucleic Acids Res. 18, 4009.

23. Engwerda, C., E. Belnoue, A.C. Gruner, and L. Renia. (2005). Experimental models of

cerebral malaria. Curr Top Microbiol Immunol. 297, 103~143.

24. Fidock, D.A. and T.E. Wellems. (1997). Transformation with human dihydrofolate

reductase renders malaria parasites insensitive to WR99210 but does not affect the

intrinsic activity of proguanil. Proc Natl Acad Sci U S A. 94, 10931~10936.

25. Fonager, J., B.M. Franke-Fayard, J.H. Adams, J. Ramesar, O. Klop, S.M. Khan, C.J.

Janse, and A.P. Waters. (2011). Development of the piggyBac transposable system for

Plasmodium berghei and its application for random mutagenesis in malaria parasites.

BMC Genomics. 12, 155.

26. Franke-Fayard, B., J. Fonager, A. Braks, S.M. Khan, and C.J. Janse. (2010).

Sequestration and tissue accumulation of human malaria parasites: can we learn

anything from rodent models of malaria? PLoS Pathog. 6, e1001032.

27. Franke-Fayard, B., H. Trueman, J. Ramesar, J. Mendoza, M. van der Keur, R. van der

Linden, R.E. Sinden, A.P. Waters, and C.J. Janse. (2004). A Plasmodium berghei

reference line that constitutively expresses GFP at a high level throughout the

complete life cycle. Mol Biochem Parasitol. 137, 23~33.

28. Fukumoto, S., X. Xuan, S. Shigeno, E. Kimbita, I. Igarashi, H. Nagasawa, K. Fujisaki,

and T. Mikami. (2001). Development of a polymerase chain reaction method for

diagnosing Babesia gibsoni infection in dogs. J Vet Med Sci. 63, 977~981.

98

29. Ganesan, S.M., J.M. Morrisey, H. Ke, H.J. Painter, K. Laroiya, M.A. Phillips, P.K.

Rathod, M.W. Mather, and A.B. Vaidya. (2011). Yeast dihydroorotate dehydrogenase

as a new selectable marker for Plasmodium falciparum transfection. Mol Biochem

Parasitol. 177, 29~34.

30. Garnham, P.C. (1965). The structure of early sporogonic stages of Plasmodium

berghei. Ann Soc Belges Med Trop Parasitol Mycol. 45, 259~264.

31. Giordano, T.J. and W.T. McAllister. (1990). Optimization of the hygromycin B

resistance~conferring gene as a dominant selectable marker in mammalian cells. Gene.

88, 285~288.

32. Goldberg, D.E., C.J. Janse, A.F. Cowman, and A.P. Waters. (2011). Has the time come

for us to complement our malaria parasites? Trends Parasitol. 27, 1~2.

33. Goonewardene, R., J. Daily, D. Kaslow, T.J. Sullivan, P. Duffy, R. Carter, K. Mendis,

and D. Wirth. (1993). Transfection of the malaria parasite and expression of firefly

luciferase. Proc Natl Acad Sci U S A. 90, 5234~5236.

34. Greenwood, B. and O.K. Doumbo. (2016). Implementation of the malaria candidate

vaccine RTS,S/AS01. Lancet. 387, 318~319.

35. Gresch, O., F.B. Engel, D. Nesic, T.T. Tran, H.M. England, E.S. Hickman, I. Korner, L.

Gan, S. Chen, S. Castro-Obregon, R. Hammermann, J. Wolf, H. Muller-Hartmann, M.

Nix, G. Siebenkotten, G. Kraus, and K. Lun. (2004). New non-viral method for gene

transfer into primary cells. Methods. 33, 151~163.

36. Hafalla, J.C., O. Silvie, and K. Matuschewski. (2011). Cell biology and immunology

of malaria. Immunol Rev. 240, 297~316.

37. Hall, N., M. Karras, J.D. Raine, J.M. Carlton, T.W. Kooij, M. Berriman, L. Florens,

C.S. Janssen, A. Pain, G.K. Christophides, K. James, K. Rutherford, B. Harris, D.

99

Harris, C. Churcher, M.A. Quail, D. Ormond, J. Doggett, H.E. Trueman, J. Mendoza,

S.L. Bidwell, M.A. Rajandream, D.J. Carucci, J.R. Yates, 3rd, F.C. Kafatos, C.J. Janse,

B. Barrell, C.M. Turner, A.P. Waters, and R.E. Sinden. (2005). A comprehensive

survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic

analyses. Science. 307, 82~86.

38. Hansen, D.S. (2012). Inflammatory responses associated with the induction of

cerebral malaria: lessons from experimental murine models. PLoS Pathog. 8,

e1003045.

39. Hargreaves, K., L.L. Koekemoer, B.D. Brooke, R.H. Hunt, J. Mthembu, and M.

Coetzee. (2000). Anopheles funestus resistant to pyrethroid insecticides in South

Africa. Med Vet Entomol. 14, 181~189.

40. Helm, S., C. Lehmann, A. Nagel, R.R. Stanway, S. Horstmann, M. Llinas, and V.T.

Heussler. (2010). Identification and characterization of a liver stage-specific promoter

region of the malaria parasite Plasmodium. PLoS One. 5, e13653.

41. Hemingway, J., L. Field, and J. Vontas. (2002). An overview of insecticide resistance.

Science. 298, 96~97.

42. Hliscs, M., C. Nahar, F. Frischknecht, and K. Matuschewski. (2013). Expression

profiling of Plasmodium berghei HSP70 genes for generation of bright red fluorescent

parasites. PLoS One. 8, e72771.

43. Ishino, T., Y. Chinzei, and M. Yuda. (2005). A Plasmodium sporozoite protein with a

membrane attack complex domain is required for breaching the liver sinusoidal cell

layer prior to hepatocyte infection. Cell Microbiol. 7, 199~208.

44. Ishino, T., Y. Orito, Y. Chinzei, and M. Yuda. (2006). A calcium-dependent protein

kinase regulates Plasmodium ookinete access to the midgut epithelial cell. Mol

100

Microbiol. 59, 1175~1184.

45. Iwamoto, M., C. Mori, Y. Hiraoka, and T. Haraguchi. (2014). Puromycin resistance

gene as an effective selection marker for ciliate Tetrahymena. Gene. 534, 249~255.

46. Izumi, M., H. Miyazawa, T. Kamakura, I. Yamaguchi, T. Endo, and F. Hanaoka.

(1991). Blasticidin S-resistance gene (bsr): a novel selectable marker for mammalian

cells. Exp Cell Res. 197, 229~233.

47. Jambou, R., F. El-Assaad, V. Combes, and G.E. Grau. (2011). In vitro culture of

Plasmodium berghei-ANKA maintains infectivity of mouse erythrocytes inducing

cerebral malaria. Malar J. 10, 346.

48. Janse, C.; Available from:

https://www.lumc.nl/org/parasitologie/research/malaria/berghei-model/general-introdu

ction/.

49. Janse, C.J., B. Franke-Fayard, and A.P. Waters. (2006). Selection by flow-sorting of

genetically transformed, GFP-expressing blood stages of the rodent malaria parasite,

Plasmodium berghei. Nat Protoc. 1, 614~623.

50. Janse, C.J., H. Kroeze, A. van Wigcheren, S. Mededovic, J. Fonager, B. Franke-Fayard,

A.P. Waters, and S.M. Khan. (2011). A genotype and phenotype database of

genetically modified malaria-parasites. Trends Parasitol. 27, 31~39.

51. Janse, C.J., J. Ramesar, and A.P. Waters. (2006). High-efficiency transfection and drug

selection of genetically transformed blood stages of the rodent malaria parasite

Plasmodium berghei. Nat Protoc. 1, 346~356.

52. Janse, C.J. and A.P. Waters. (1995). Plasmodium berghei: the application of cultivation

and purification techniques to molecular studies of malaria parasites. Parasitol Today.

11, 138~143.

101

53. Janse, C.J., A.P. Waters, J. Kos, and C.B. Lugt. (1994). Comparison of in vivo and in

vitro antimalarial activity of artemisinin, dihydroartemisinin and sodium artesunate in

the Plasmodium berghei-rodent model. Int J Parasitol. 24, 589~594.

54. Jemmely, N.Y., M. Niang, and P.R. Preiser. (2010). Small variant surface antigens and

Plasmodium evasion of immunity. Future Microbiol. 5, 663~682.

55. Jin, Y., C. Kebaier, and J. Vanderberg. (2007). Direct microscopic quantification of

dynamics of Plasmodium berghei sporozoite transmission from mosquitoes to mice.

Infect Immun. 75, 5532~5539.

56. Kanda, K., T. Ishida, R. Hirota, S. Ono, K. Motomura, T. Ikeda, K. Kitamura, and A.

Kuroda. (2014). Application of a phosphite dehydrogenase gene as a novel dominant

selection marker for yeasts. J Biotechnol. 182~183, 68~73.

57. Karreman, C. (1998). New positive/negative selectable markers for mammalian cells

on the basis of Blasticidin deaminase-thymidine kinase fusions. Nucleic Acids Res. 26,

2508~2510.

58. Kaushansky, A., L.S. Austin, S.A. Mikolajczak, F.Y. Lo, J.L. Miller, A.N. Douglass, N.

Arang, A.M. Vaughan, M.J. Gardner, and S.H. Kappe. (2015). Susceptibility to

Plasmodium yoelii preerythrocytic infection in BALB/c substrains is determined at the

point of hepatocyte invasion. Infect Immun. 83, 39~47.

59. Kenthirapalan, S., A.P. Waters, K. Matuschewski, and T.W. Kooij. (2012). Flow

cytometry-assisted rapid isolation of recombinant Plasmodium berghei parasites

exemplified by functional analysis of aquaglyceroporin. Int J Parasitol. 42,

1185~1192.

60. Kochupurakkal, B.S. and J.D. Iglehart. (2013). Nourseothricin N-acetyl transferase: a

positive selection marker for mammalian cells. PLoS One. 8, e68509.

102

61. Kocken, C.H., A. van der Wel, and A.W. Thomas. (1999). Plasmodium cynomolgi:

transfection of blood-stage parasites using heterologous DNA constructs. Exp

Parasitol. 93, 58~60.

62. Kooij, T.W., M.M. Rauch, and K. Matuschewski. (2012). Expansion of experimental

genetics approaches for Plasmodium berghei with versatile transfection vectors. Mol

Biochem Parasitol. 185, 19~26.

63. Kucho, K., K. Kakoi, M. Yamaura, M. Iwashita, M. Abe, and T. Uchiumi. (2013).

Codon-optimized antibiotic resistance gene improves efficiency of transient

transformation in Frankia. J Biosci. 38, 713~717.

64. Leclere, P.G., A. Panjwani, R. Docherty, M. Berry, J. Pizzey, and D.A. Tonge. (2005).

Effective gene delivery to adult neurons by a modified form of electroporation. J

Neurosci Methods. 142, 137~143.

65. Li, X., R.A. Harrell, A.M. Handler, T. Beam, K. Hennessy, and M.J. Fraser, Jr. (2005).

piggyBac internal sequences are necessary for efficient transformation of target

genomes. Insect Mol Biol. 14, 17~30.

66. Lin, J.W., T. Annoura, M. Sajid, S. Chevalley-Maurel, J. Ramesar, O. Klop, B.M.

Franke-Fayard, C.J. Janse, and S.M. Khan. (2011). A novel 'gene insertion/marker out'

(GIMO) method for transgene expression and gene complementation in rodent malaria

parasites. PLoS One. 6, e29289.

67. Liu, H., E.W. Cupp, K.M. Micher, A. Guo, and N. Liu. (2004). Insecticide resistance

and cross-resistance in Alabama and Florida strains of Culex quinquefasciatus

[correction]. J Med Entomol. 41, 408~413.

68. Maasho, K., A. Marusina, N.M. Reynolds, J.E. Coligan, and F. Borrego. (2004).

Efficient gene transfer into the human natural killer cell line, NKL, using the Amaxa

103

nucleofection system. J Immunol Methods. 284, 133~140.

69. Mamoun, C.B., I.Y. Gluzman, S. Goyard, S.M. Beverley, and D.E. Goldberg. (1999).

A set of independent selectable markers for transfection of the human malaria parasite

Plasmodium falciparum. Proc Natl Acad Sci U S A. 96, 8716~8720.

70. Manzoni, G., S. Briquet, V. Risco-Castillo, C. Gaultier, S. Topcu, M.L. Ivanescu, J.F.

Franetich, B. Hoareau-Coudert, D. Mazier, and O. Silvie. (2014). A rapid and robust

selection procedure for generating drug-selectable marker-free recombinant malaria

parasites. Sci Rep. 4, 4760.

71. Matz, J.M. and T.W. Kooij. (2015). Towards genome-wide experimental genetics in

the in vivo malaria model parasite Plasmodium berghei. Pathog Glob Health. 109,

46~60.

72. McAbee, R.D., K.D. Kang, M.A. Stanich, J.A. Christiansen, C.E. Wheelock, A.D.

Inman, B.D. Hammock, and A.J. Cornel. (2004). Pyrethroid tolerance in Culex pipiens

pipiens var molestus from Marin County, California. Pest Manag Sci. 60, 359~368.

73. Menard, D., J. Clain, and F. Ariey. (2018). Multidrug-resistant Plasmodium falciparum

malaria in the Greater Mekong subregion. Lancet Infect Dis. 18, 238~239.

74. Mielke, C., M. Tummler, and J. Bode. (1995). A simple assay for puromycin

N-acetyltransferase: selectable marker and reporter. Trends Genet. 11, 258~259.

75. Mota, M.M., V. Thathy, R.S. Nussenzweig, and V. Nussenzweig. (2001). Gene

targeting in the rodent malaria parasite Plasmodium yoelii. Mol Biochem Parasitol.

113, 271~278.

76. Mutungi, J.K., K. Yahata, M. Sakaguchi, and O. Kaneko. (2015). Isolation of invasive

Plasmodium yoelii merozoites with a long half-life to evaluate invasion dynamics and

potential invasion inhibitors. Mol Biochem Parasitol. 204, 26~33.

104

77. Naing, C., M.A. Whittaker, V. Nyunt Wai, and J.W. Mak. (2014). Is Plasmodium vivax

malaria a severe malaria?: a systematic review and meta-analysis. PLoS Negl Trop Dis.

8, e3071.

78. Natarajan, R., V. Thathy, M.M. Mota, J.C. Hafalla, R. Menard, and K.D. Vernick.

(2001). Fluorescent Plasmodium berghei sporozoites and pre-erythrocytic stages: a

new tool to study mosquito and mammalian host interactions with malaria parasites.

Cell Microbiol. 3, 371~379.

79. Okabe, M., M. Ikawa, K. Kominami, T. Nakanishi, and Y. Nishimune. (1997). 'Green

mice' as a source of ubiquitous green cells. FEBS Lett. 407, 313~319.

80. Orr, R.Y., N. Philip, and A.P. Waters. (2012). Improved negative selection protocol for

Plasmodium berghei in the rodent malarial model. Malar J. 11, 103.

81. Pfahler, J.M., M.R. Galinski, J.W. Barnwell, and M. Lanzer. (2006). Transient

transfection of Plasmodium vivax blood stage parasites. Mol Biochem Parasitol. 149,

99~101.

82. Portugal, S., H. Drakesmith, and M.M. Mota. (2011). Superinfection in malaria:

Plasmodium shows its iron will. EMBO Rep. 12, 1233~1242.

83. Prudencio, M., A. Rodriguez, and M.M. Mota. (2006). The silent path to thousands of

merozoites: the Plasmodium liver stage. Nat Rev Microbiol. 4, 849~856.

84. Rankin, K.E., S. Graewe, V.T. Heussler, and R.R. Stanway. (2010). Imaging

liver-stage malaria parasites. Cell Microbiol. 12, 569~579.

85. Reece, S.E. and J. Thompson. (2008). Transformation of the rodent malaria parasite

Plasmodium chabaudi and generation of a stable fluorescent line PcGFPCON. Malar J.

7, 183.

86. Russo, I., A. Oksman, B. Vaupel, and D.E. Goldberg. (2009). A calpain unique to

105

alveolates is essential in Plasmodium falciparum and its knockdown reveals an

involvement in pre-S-phase development. Proc Natl Acad Sci U S A. 106, 1554~1559.

87. Schofield, L. and G.E. Grau. (2005). Immunological processes in malaria

pathogenesis. Nat Rev Immunol. 5, 722~735.

88. Smalley, M.E. and G.A. Butcher. (1975). The in vitro culture of the blood stages of

Plasmodium berghei. Int J Parasitol. 5, 131~132.

89. Smith, R.C. and C. Barillas-Mury. (2016). Plasmodium Oocysts: Overlooked Targets

of Mosquito Immunity. Trends Parasitol. 32, 979~990.

90. Uji, T., R. Hirata, S. Fukuda, H. Mizuta, and N. Saga. (2014). A codon-optimized

bacterial antibiotic gene used as selection marker for stable nuclear transformation in

the marine red alga Pyropia yezoensis. Mar Biotechnol (NY). 16, 251~255.

91. van der Wel, A.M., A.M. Tomas, C.H. Kocken, P. Malhotra, C.J. Janse, A.P. Waters,

and A.W. Thomas. (1997). Transfection of the primate malaria parasite Plasmodium

knowlesi using entirely heterologous constructs. J Exp Med. 185, 1499~1503.

92. van Dijk, M.R., A.P. Waters, and C.J. Janse. (1995). Stable transfection of malaria

parasite blood stages. Science. 268, 1358~1362.

93. Vara, J.A., A. Portela, J. Ortin, and A. Jimenez. (1986). Expression in mammalian

cells of a gene from Streptomyces alboniger conferring puromycin resistance. Nucleic

Acids Res. 14, 4617~4624.

94. Vincke, L.H. and J. Bafort. (1968). [Results of 2 years of observation of the cyclical

transmission of Plasmodium berghei]. Ann Soc Belges Med Trop Parasitol Mycol. 48,

439~454.

95. Waters, A.P., A.W. Thomas, M.R. van Dijk, and C.J. Janse. (1997). Transfection of

malaria parasites. Methods. 13, 134~147.

106

96. White, N.J. (2008). Plasmodium knowlesi: the fifth human malaria parasite. Clin

Infect Dis. 46, 172~173.

97. WHO. (2014) World Malaria Report 2014.

98. WHO. (2015). Guidelines for th treatment of malaria - 3rd edition.

99. WHO. (2017). Status report on artemisinin and ACT resistance (April 2017).

100. WHO. (2017). World Malaria Report 2017.

101. Wilson, D.N. (2009). The A-Z of bacterial translation inhibitors. Crit Rev Biochem

Mol Biol. 44, 393~433.

102. Wu, Y., L.A. Kirkman, and T.E. Wellems. (1996). Transformation of Plasmodium

falciparum malaria parasites by homologous integration of plasmids that confer

resistance to pyrimethamine. Proc Natl Acad Sci U S A. 93, 1130~1134.

103. Wu, Y., C.D. Sifri, H.H. Lei, X.Z. Su, and T.E. Wellems. (1995). Transfection of

Plasmodium falciparum within human red blood cells. Proc Natl Acad Sci U S A. 92,

973~977.

104. Wykes, M.N. and M.F. Good. (2009). What have we learnt from mouse models for the

study of malaria? Eur J Immunol. 39, 2004~2007.

105. Yawson, A.E., P.J. McCall, M.D. Wilson, and M.J. Donnelly. (2004). Species

abundance and insecticide resistance of Anopheles gambiae in selected areas of Ghana

and Burkina Faso. Med Vet Entomol. 18, 372~377.

106. Yuvaniyama, J., P. Chitnumsub, S. Kamchonwongpaisan, J. Vanichtanankul, W.

Sirawaraporn, P. Taylor, M.D. Walkinshaw, and Y. Yuthavong. (2003). Insights into

antifolate resistance from malarial DHFR-TS structures. Nat Struct Biol. 10, 357~365.

107. Zaim, M. and P. Guillet. (2002). Alternative insecticides: an urgent need. Trends

Parasitol. 18, 161~163.

107

108. Zhou, Z., Y. Dang, M. Zhou, L. Li, C.H. Yu, J. Fu, S. Chen, and Y. Liu. (2016). Codon

usage is an important determinant of gene expression levels largely through its effects

on transcription. Proc Natl Acad Sci U S A. 113, E6117~E6125.

Documents

Studies on the Development of the High Efficacy Methods for … · shifting between invasive and replicative stages in both the mammalian host and mosquitoes. Parasite development