1
B C A Supplementary Figure 1 SW620 CoCl 2 (h) 0 2 4 8 24 Nur77 β -actin β -actin Nur77 HCT116 RT-PCR Western Blot DFX (h) 0 2 4 8 24 SW480 Nur77 β -actin HT29 Nur77 β -actin HT29 Nur77 18s rRNA Nur77 β -actin SW620 Nur77 18s rRNA Nur77 β -actin HT29 * * * * SW620 * * * * * * * * * * * * * * * * * * * * * * * * HT29 * * * * SW620 0 2 4 8 24 1% O 2 (h) 0 2 4 8 24 1% O 2 (hr) CoCl 2 (h) 0 2 4 8 24 DFX (h) 0 2 4 8 24 Supplementary Figure 1. Hypoxic conditions induce the mRNA and protein levels of Nur77. Colon cancer cells were serum starved for 24 h, and then (A) incubated at 1% O 2 level in a modulator; or treated with the hypoxia mimetic (B) cobalt chloride (CoCl 2 , 100 mM) or (C) desferrioxamine (DFX, 100 M) for the time indicated. Total RNA or proteins were extracted from cell lysates for subsequent RT-RCR and Western blotting to determine the mRNA and protein expression respectively. Whole-cell lysates were analyzed by immunoblotting. β- actin was used as internal control for these analyses. Immunoblots were quantified by densitometry and the values were normalized with β-actin. All blots shown are representative of three independent experiments. bar, ± SD. *, P < 0.05.

Supplementary Figure 1

  • Upload
    kendis

  • View
    21

  • Download
    1

Embed Size (px)

DESCRIPTION

Supplementary Figure 1. A. RT-PCR. Western Blot. 1% O 2 (hr). 0 2 4 8 24. 1% O 2 (h). 0 2 4 8 24. Nur77. Nur77. HT29. β -actin. 18s rRNA. SW620. HT29. *. *. *. *. *. *. *. *. HT29. SW620. Nur77. Nur77. SW620. B. *. *. - PowerPoint PPT Presentation

Citation preview

Page 1: Supplementary Figure 1

B

C

A

Supplementary Figure 1

SW620

CoCl2 (h) 0 2 4 8 24

Nur77

β -actin

β -actin

Nur77HCT116

RT-PCR Western Blot

DFX (h) 0 2 4 8 24

SW480 Nur77

β -actin

HT29 Nur77

β -actin

HT29Nur77

18s rRNA

Nur77

β -actin

SW620Nur77

18s rRNA

Nur77

β -actin

HT29

* * **

SW620

*

* * *

**

**

** *

*

*

* * *

* **

*

**

* *

HT29*

** *

SW620

0 2 4 8 241% O2 (h) 0 2 4 8 241% O2 (hr)

CoCl2 (h) 0 2 4 8 24

DFX (h) 0 2 4 8 24

Supplementary Figure 1. Hypoxic conditions induce the mRNA and protein lev els of Nur77. Colon cancer cells were serum starved for 24 h, and the n (A) incubated at 1% O2 level in a modulator; or treated with the hypoxia mimetic (B) cobalt chloride (CoCl2, 100 mM) or (C) desferrioxamine (DFX, 100 M) for the time indicated. Total RNA or proteins were extracted from cell lysates for subsequent RT-RCR and Western blotting to determine the mRNA and protein expression respectively. Whole-cell lysates were analyzed by immunoblotting. β-actin was used as internal control for these analyses. Immunoblots were quantified by densitometry and the values were normalized with β-actin. All blots shown are representative of three independent experiments. bar, ± SD. *, P < 0.05.

Supplementary Figure S1

Supplementary Figure S1

Documents
MoleculardynamicssuggestsantiviralcompoundsactiveagainstDe ... · shown in supplementary figure 7 (SF7). No significant secondary structure rearrangementsweredetectedinthisexperimenteither(SF4).Onthewhole,thedata

MoleculardynamicssuggestsantiviralcompoundsactiveagainstDe ... · shown in supplementary figure 7 (SF7). No significant secondary structure rearrangementsweredetectedinthisexperimenteither(SF4).Onthewhole,thedata

Documents
Supplementary Figure 1-8 - images.nature.com · VZ 100μm WT Disc1 LI 0 100 200 300 400 Number of BrdU- positive cells WT Disc1 LI BrdU BrdU / DAPI Supplementary Figure 1 SVZ VZ a

Supplementary Figure 1-8 - images.nature.com · VZ 100μm WT Disc1 LI 0 100 200 300 400 Number of BrdU- positive cells WT Disc1 LI BrdU BrdU / DAPI Supplementary Figure 1 SVZ VZ a

Documents
Supplementary Figure 1

Supplementary Figure 1

Documents
Supplementary Figure 1

Supplementary Figure 1

Documents
Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Documents
Supplementary Figure 1 - Hindawi Publishing …downloads.hindawi.com/journals/omcl/2015/379538.f1.docx · Web viewSupplementary Figure 5 Representative images of murine peritoneal

Supplementary Figure 1 - Hindawi Publishing …downloads.hindawi.com/journals/omcl/2015/379538.f1.docx · Web viewSupplementary Figure 5 Representative images of murine peritoneal

Documents
-SMA α- Tubulin CLIC4 AD-CLIC4 - + - + TGF- - - + + Supplementary Figure 1 Supplementary Figure 1. Exogenous CLIC4 expression enhances α-SMA expression

-SMA α- Tubulin CLIC4 AD-CLIC4 - + - + TGF- - - + + Supplementary Figure 1 Supplementary Figure 1. Exogenous CLIC4 expression enhances α-SMA expression

Documents
Supplementary figure 1. Supplementary figure 1: TNF-α receptor 2 expression in the skin keratinocytes of C57 wild-type mice after TNF-α induction. (A)

Supplementary figure 1. Supplementary figure 1: TNF-α receptor 2 expression in the skin keratinocytes of C57 wild-type mice after TNF-α induction. (A)

Documents
Supplementary Figure S1

Supplementary Figure S1

Documents
Supplementary Figure 1 - images.nature.com › original › nature-assets › nm › journal › v1… · Supplementary Figure 2: b-AP15 induces apoptosis and inhibits cell survival

Supplementary Figure 1 - images.nature.com › original › nature-assets › nm › journal › v1… · Supplementary Figure 2: b-AP15 induces apoptosis and inhibits cell survival

Documents
Supplementary Figure 1. mRNA induction/repression kinetics of HXK1 , GAL1::FMP27 and INO1

Supplementary Figure 1. mRNA induction/repression kinetics of HXK1 , GAL1::FMP27 and INO1

Documents
Supplementary Figure 1 | Schematic illustration of the …mai.group.whut.edu.cn/chs/lw/slected/201703/P... · 2017-06-04 · Supplementary Figure 7 | XPS analysis of NiMoO 4 electrode

Supplementary Figure 1 | Schematic illustration of the …mai.group.whut.edu.cn/chs/lw/slected/201703/P... · 2017-06-04 · Supplementary Figure 7 | XPS analysis of NiMoO 4 electrode

Documents
Supplementary Figure 1. HNF4α re-expression is confined to ...dm5migu4zj3pb.cloudfront.net/manuscripts/73000/73137/JCI73137… · Supplementary Figure 1. HNF4α re-expression is

Supplementary Figure 1. HNF4α re-expression is confined to ...dm5migu4zj3pb.cloudfront.net/manuscripts/73000/73137/JCI73137… · Supplementary Figure 1. HNF4α re-expression is

Documents
Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

Documents
Supplementary Figure S1 SDS-PAGE analysis of the purified … · biobatteries connected in series powering up a digit clock (b) and a LED (c) are shown. 7 Supplementary Figure S7

Supplementary Figure S1 SDS-PAGE analysis of the purified … · biobatteries connected in series powering up a digit clock (b) and a LED (c) are shown. 7 Supplementary Figure S7

Documents
Supplementary Figures - VIVE LA RÉVOLUTIONmai68.org/spip/IMG/pdf/ncomms3543-s1.pdfSupplementary Figures Supplementary Figure S1. Frequency distribution maps for mtDNA haplogroups

Supplementary Figures - VIVE LA RÉVOLUTIONmai68.org/spip/IMG/pdf/ncomms3543-s1.pdfSupplementary Figures Supplementary Figure S1. Frequency distribution maps for mtDNA haplogroups

Documents
Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Documents
Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Documents
Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Documents
Supplementary Figure 1. Confirmation of knockdown ... · Supplementary Figure 11. Basal MyoII oscillation is inhibited by the light-induced Talin-GFP clustering. a, c. Time-lapse

Supplementary Figure 1. Confirmation of knockdown ... · Supplementary Figure 11. Basal MyoII oscillation is inhibited by the light-induced Talin-GFP clustering. a, c. Time-lapse

Documents
0DWHULDO (6, IRU/DE RQD&KLS 7KLV · -2-Supplementary Figure 1.NaCl concentration profile, and pSTL1-qV expression in each chamber of the experiment shown in Figure 2B. Supplementary

0DWHULDO (6, IRU/DE RQD&KLS 7KLV · -2-Supplementary Figure 1.NaCl concentration profile, and pSTL1-qV expression in each chamber of the experiment shown in Figure 2B. Supplementary

Documents
Figure S1 : Toya et al. - images.nature.com · SUPPLEMENTARY INFORMATION. 2 . Figure S2. Control experiments. (a) Control experiments for the phspho-specific AIR-1 antibody

Figure S1 : Toya et al. - images.nature.com · SUPPLEMENTARY INFORMATION. 2 . Figure S2. Control experiments. (a) Control experiments for the phspho-specific AIR-1 antibody

Documents
Letter to the Editors · 48 Supplementary Figures Supplementary Figure 1. Injection of liver purified iNKT cells, depleted of iNKT cells, failed to increase the survival of PR8 infected

Letter to the Editors · 48 Supplementary Figures Supplementary Figure 1. Injection of liver purified iNKT cells, depleted of iNKT cells, failed to increase the survival of PR8 infected

Documents
Supplementary Materials - Cancer Research...2011/02/07  · Supplementary Materials Supplementary Figure 1. Functional independence of the HIF-1α–ARNT pathway and the HIF-1α–c-Myc

Supplementary Materials - Cancer Research...2011/02/07  · Supplementary Materials Supplementary Figure 1. Functional independence of the HIF-1α–ARNT pathway and the HIF-1α–c-Myc

Documents
Supplementary Figure 1. Examination of neural cells and Wnt … · 2012-08-17 · Supplementary Figure 8. DF19-9-11T, DF6-9-9T, and H9 cell lines demonstrate β-catenin nuclear localization

Supplementary Figure 1. Examination of neural cells and Wnt … · 2012-08-17 · Supplementary Figure 8. DF19-9-11T, DF6-9-9T, and H9 cell lines demonstrate β-catenin nuclear localization

Documents
Supplementary Figure S1: Dictyosteliumyusukeman.org/Supplement_Tractionforce.pdf · Supplementary Figure S2: (a)-(d) Changes in the distribution of the forces exerted by a vegetative

Supplementary Figure S1: Dictyosteliumyusukeman.org/Supplement_Tractionforce.pdf · Supplementary Figure S2: (a)-(d) Changes in the distribution of the forces exerted by a vegetative

Documents
Supplementary Figure 1. Relevant molecular structures ... fileSupplementary Figure 4. Energy profiles along MS-CASPT2 optimized reaction paths for methyl (left) and OH (right) dissociation

Supplementary Figure 1. Relevant molecular structures ... fileSupplementary Figure 4. Energy profiles along MS-CASPT2 optimized reaction paths for methyl (left) and OH (right) dissociation

Documents
Supplementary figure 1 Supplementary Fig. S1: Age dependent changes in db/db and db/dm mice. Representative images of PAS-stained kidney sections of db/db

Supplementary figure 1 Supplementary Fig. S1: Age dependent changes in db/db and db/dm mice. Representative images of PAS-stained kidney sections of db/db

Documents
Supplementary Figure S2

Supplementary Figure S2

Documents