8/12/2019 Tan et al 2012

1/9

O R I G I N A L A R T I C L E Aquaculture

Global gene expression analysis of gill tissues from normaland thermally selected strains of rainbow trout

Engkong Tan Chaninya Wongwarangkana Shigeharu Kinoshita Yutaka Suzuki

Kenshiro Oshima Masahira Hattori Toshinao Ineno Koichi Tamaki Akio Kera

Koji Muto Takashi Yada Shoji Kitamura Shuichi Asakawa Shugo Watabe

Received: 20 January 2012 / Accepted: 5 March 2012/ Published online: 18 July 2012

The Japanese Society of Fisheries Science 2012

Abstract The objective of the study reported here was to

investigate genes related to upper temperature tolerance inrainbow trout Oncorhynchus mykiss, a cold-water species

with considerable economic importance, by global gene

expression analysis using a next generation sequencing

system. Fifty million paired sequences were collected from

the gill tissues of each of five individuals of a thermally

selected strain developed by selective breeding and from the

gill tissues of a standard Donaldsonstrain andassembled into

transcripts. The data of both strains were integrated, and a

BLASTX search identified 13,092 independent, known

genes. A back-mapping of raw reads from both strains onto

the genes, conducted to investigate their frequency ofexpression, revealed that 324genes showedat least a twofold

higher expression in the thermally selected strain than in the

Donaldson strain. In addition, 44.4 % of commonly

expressed genes were categorized into 38 functional groups

by annotation. Genes encoding heat shock proteins and

c-fos-related proteins were highly expressed in the thermally

selected strain. Our strategy to employ next generation

sequencing provedto be very useful to findgenes responsible

for upper temperature tolerance of rainbow trout.

Keywords Oncorhynchus mykiss

Thermally selected strain

Next generation sequencing

Gill Global gene expression HSP gene c-fos geneS. Asakawa and S. Watabe contributed equally to this work.

Electronic supplementary material The online version of thisarticle (doi:10.1007/s12562-012-0522-4 ) contains supplementarymaterial, which is available to authorized users.

E. Tan C. Wongwarangkana S. Kinoshita S. Asakawa

Laboratory of Aquatic Molecular Biology and Biotechnology,

Graduate School of Agricultural and Life Sciences,

The University of Tokyo, 1-1-1 Yayoi, Bunkyo,

Tokyo 113-8657, Japan

e-mail: asakawa@mail.ecc.u-tokyo.ac.jp

Y. SuzukiLaboratory of Functional Genomics, Graduate School of Frontier

Science, The University of Tokyo, 5-1-5 Kashiwano-ha,

Kashiwa, Chiba 277-8561, Japan

K. Oshima M. Hattori

Department of Computational Biology, Graduate School

of Frontier Sciences, The University of Tokyo,

5-1-5 Kashiwano-ha, Kashiwa, Chiba 277-8561, Japan

T. Ineno K. Tamaki A. Kera

Kobayashi Branch, Miyazaki Prefectural Fisheries Research

Institute, Kobayashi, Miyazaki 886-0005, Japan

K. Muto T. Yada

Nikko Station, National Research Institute of Aquaculture,

Fisheries Research Agency, Nikko, Tochigi 321-1661, Japan

S. Kitamura

General Planning and Coordination Department, Headquarters,

Fisheries Research Agency, Yokohama, Kanagawa 236-8648,

Japan

S. Watabe (&)

Laboratory of Marine Biochemistry, Graduate School

of Agricultural and Life Sciences, The University of Tokyo,

1-1-1 Yayoi, Bunkyo, Tokyo 113-8657, Japan

e-mail: awatabe@mail.ecc.u-tokyo.ac.jp

1 3

Fish Sci (2012) 78:10411049

DOI 10.1007/s12562-012-0522-4

http://dx.doi.org/10.1007/s12562-012-0522-4http://dx.doi.org/10.1007/s12562-012-0522-4

8/12/2019 Tan et al 2012

2/9

Introduction

Rainbow trout Oncorhynchus mykiss is a cold-water aqua-

culture species of considerable economic importance.

Between 1989 and 2009 the global annual production of

rainbow trout almost tripledfrom 259,161 to 732,432 tons

[1]. Rainbow trout is originally a North American native fish,

but since 1874 it hasbeen introduced to all continents, andit iscurrently one of the most popular aquaculture species. The

first introduction of rainbow trout to Japan was in 1877, and its

mass production started in the 1950s [2] when the Donaldson

strain (established by Dr. Donaldson of the University of

Washington [3]) was introduced into Japan. The Donaldson

strain has several advantages over wild-type rainbow trout,

such as increased growth rate, disease resistance, and

enhanced egg production.

The Miyazaki Prefectural Fisheries Research Institute

initiated a traditional selective breeding program in 1966 with

the aim of developing a thermally selected strain of rainbow

trout based on the Donaldson strain [4]. The strain thusdeveloped acquired upper temperature tolerance, as revealed

by the observation that the strain grows normally and feeds

actively at 24 C, in contrast to the optimum water tempera-

ture for the normal strain, which is\20 C. In addition, the

thermally selected strain survived from occasional exposure

to heated water at 3035 C for 15 min [4]. These qualities

have enabled the culture of this species in higher water tem-

perature regions, such as lower mountain areas or even in the

moresouthern areas of Japan. Furthermore,upper temperature

tolerance in rainbow trout is a desirable character in aqua-

culture production given the potential for exposure to climate

change, such as global warming.

Several studies have investigated the genes possibly

responsive to upper temperature tolerance in fish. Heat

shock proteins (HSPs) have been reported to be associated

with heat stress in tilapia Oreochromis niloticus [5], com-

mon killifish Fundulus heteroclitus [6], and rainbow trout

[79]. Certain microsatellite loci have also been identified

as upper temperature tolerance-related candidates for

Arctic charr Salvelinus alpinus [10,11] and rainbow trout

[1114] with quantitative trait loci analysis. Furthermore,

previous research indicates that mitochondrial cytochrome

c oxidase subunit II gene is associated with upper tem-

perature tolerance in eggs and embryos of rainbow trout

[15]. Although these studies provide clues on the identity

of upper temperature tolerance-related genes, current

knowledge on genes involved in upper temperature toler-

ance remains insufficient.

Next generation sequencing technologies are currently

being widely utilized [16] and have greatly improved the

speed and efficiency of transcriptome analysis not only in

mammals [1719], but also in fish [20,21], plants [22,23],

and insects [24,25].

The objective of the study reported here was to inves-

tigate genes related to upper temperature tolerance in

rainbow trout by utilizing next generation sequencing. The

comparative analysis between the thermally selected and

Donaldson strain revealed the identity of several strong

candidate genes that are responsible for the upper tem-

perature tolerance of the thermally selected strain.

Materials and methods

Fish candidates for sequencing

The thermally selected strain that has been developed since

1966 at the Kobayashi Branch, Miyazaki Prefectural

Fisheries Research Institute, as described above was used

in this study. Five 1-year-old juveniles of the thermally

selected strain (length 16.418.4 cm; weight 81107 g)

were selected as sequencing candidates. Five juveniles of

the Donaldson strain (length 1415.4 cm; weight 4051 g),cultured at the Nikko Station, the National Research

Institute of Fisheries Science, Tochigi Prefecture, Japan,

were used as the normal control fish candidates. Prior to

collect samples, individuals of both strains were acclimated

in 10 C freshwater for 1 month, and no apparent unheal-

thy effects were observed.

RNA extraction and cDNA library construction

Prior to this study, we performed preliminary transcriptome

assemblies and back-mapping using sequence reads from

the brain, gill, heart, liver, and muscle tissues and found

that the gene encoding HSP70b had an extremely high

expression level in gill tissues. Thus, we chose gill tissues

as the target tissue to analyze in our study. Total RNAs

were extracted from the gill tissues of all study fish (those

of the thermally selected strain and Donaldson strain) with

QIAzol regent (QIAGEN, Valencia, CA) using standard

protocols. In order to obtain high-quality sequencing data,

we required a sufficient amount of total RNA for the fol-

lowing sequencing step. Thus, the sample containing the

highest amount of total RNA was selected and used as a

representative sequencing template for both the thermally

selected and Donaldson strains. Total RNAs of both strains

were used to construct cDNA libraries with the Illumina

Paired End Sample Prep kit (Illumina, San Diego, CA).

The average sizes of cDNAs for paired-end sequencing

were adjusted to be about 150 bp.

Next generation sequencing and data analysis

The cDNA libraries were sequenced with a HiSeq

2000 sequencing platform (Illumina) according to the

1042 Fish Sci (2012) 78:10411049

1 3

8/12/2019 Tan et al 2012

3/9

manufacturers protocol. Pair-end reads (76 bp 9 2) with

150-bp insert size were obtained from the sequencer. The

file formats were converted from the Illumina QSEQ for-

mat to the conventional FASTQ format by ABySS (abyss-

to-fastq) [26]. In order to perform high-quality assembly,

reads that contained N-base or low Q-score base were fil-

tered out by the software FASTX-toolkit [27]. We then

selected 50 million paired reads among the filtered data ofthe thermally selected and Donaldson strains. These data

were applied to the Velvet (ver. 1.2.01 [28]) and Oases

(ver. 0.2.04; http://www.ebi.ac.uk/*zerbino/oases/) soft-

ware packages to generate contigs and transcripts, respec-

tively. Twenty one-mer size was selected for the de Bruijn

graph [29] to build contigs from raw reads. Final transcripts

were constructed by linking contigs with the pair-end dis-

tance information.

To increase the accuracy of the homology search step,

we discarded de novo assembled transcripts of\1,000 bp.

Duplicated and highly similar sequences were removed by

the software CD-HIT (ver. 4.5.6. option, -c 0.9 [30]). Thehomology searches of these transcripts were conducted

using BLASTX (evalue 1e-10) against the NCBI protein

database. If two or more transcripts were matched to the

same gene after the BLASTX step, the numbers of mapped

reads were summed and counted as one gene. The tran-

scripts assigned as unnamed protein products or unchar-

acterized proteins by BLASTX were excluded from further

analysis. Expression profiles of genes were obtained by

mapping 50 million raw reads back on the de novo

assembled transcripts of both strains using the software

Bowtie (ver. 0.12.7, option, -v 0 [31]). Only perfectly

matched reads were kept and counted. A read matched with

more than one transcript was always assigned to the first

transcript. File conversion from SAM to BAM format and

counting were accomplished using software Samtools [32].

A comprehensive profile of common genes expressed in the

gill was constructed by joining the average expression

count for each gene from both the thermally selected and

Donaldson strains. These commonly expressed transcripts

were annotated by software Blast2Go (ver. 2.5.0 [33]) to

assign gene ontology (GO) terms, and matched genes were

then divided into three main ontologies: molecular func-tion, biological process, and cell component.

Sequence data sets analyzed in this study have been

registered to DDBJ Sequence Read Archive (Project

number DRA000529).

Real-time PCR analysis

Selected genes that were up-regulated or down-regulated in

the thermally selected strain in comparison with the Don-

aldson strain in the global gene expression analysis were

examined by real-time PCR. The forward and reverse

primers were designed for each gene and the product sizewas 101 bp. The sequences of primer sets are listed in

Table1. Total RNAs extracted from five individuals of

each two strain were used. The PCR mixture contained 1 ll

cDNA, 20 lM each of forward and reverse primers, 10 ll

29 SYBR premix ExTaq kit (Takara, Tokyo, Japan), and

0.3 lL ROX reference dye, filled to a final volume of 20 ll

with sterilized distilled water. The PCR cycling program

consisted of denaturation at 95 C for 30 s, followed by 40

cycles of denaturation at 95 C for 5 s and annealing and

extension at 60 C for 1 min. Real-time PCR was per-

formed with an ABI Prism 7300 sequence detection system

(Applied Biosystems, Foster City, CA). A housekeeping

gene encoding elongation factor-1alpha (EF-1alpha) was

selected as reference. The relative expression levels of each

Table 1 Primer information of eight selected and one housekeeping genes examined by real-time PCR

Gene Accession no. Forward primer Reverse primer

Heat shock protein 70-kDa

isoform b

AB176855 TTAGTATCACTGCACACAATTTACTATTCAG ATGTCCAGCAATGCAATATGGTAT

dnaJ homolog subfamily a

member 1-like

XP_003440484 CTCTCAGACTCCGGGTTTGACTT TCAGAAGGGTCTCCTCCATTGA

c-fos protein BAC77046 CCTATGACCTAGTTAATTGCTTTTTTTG AGAGGAAATGGTGTTGTGTGGAA

ccaat enhancer-binding

protein beta

NP_001117919 TAGTTGTACATTCGTTGCACCTTCT TCCAGGATGTTACGTTTGTGTACAG

DNA damage-inducible

transcript 4 protein

ACO14087 CTCTCAGACTCCGGGTTTGACTT TCAGAAGGGTCTCCTCCATTGA

junB protein NP_001117992 CTTGCCCTTTTTTGGACTTATAAATT GTCATGATAGAAAGGCTGTTCCATT

dsx and mab-3 related

transcription factor 4

ABU53616 TCTGTAAACACCGTGCCAAGAATAT ATCCGTTGTTTAGGTTGTACTTGGT

Dual specificity protein

kinase clk2-like

XP_003452484 TTATGACCCTGTGTGTGCTTCATC ACTCACAAATCAGACCCCATACAAC

Elongation factor-1alpha AF498320 GGATTGCCACACTGCTCACA CGACGGTCGATCTTCTTCTTG

Fish Sci (2012) 78:10411049 1043

1 3

http://www.ebi.ac.uk/~zerbino/oases/http://www.ebi.ac.uk/~zerbino/oases/http://www.ebi.ac.uk/~zerbino/oases/http://www.ebi.ac.uk/~zerbino/oases/

8/12/2019 Tan et al 2012

4/9

gene were calculated from the means of triplicated PCR

experiments, each with five individuals, using the com-

parative CT difference method. The differences between

the two strains were examined using Students t test. The

results of real-time PCR were also compared with the back-

mapping results in which the sequencing read was mapped

to the target region in real-time PCR for each gene in order

to standardize the target size of back-mapping of individualgenes. The actual target size in back-mapping individual

genes was 300 bp (of which 101 bp was the real-time PCR

product in the center).

Results

De novo assembly of gill tissue transcripts

An analytical workflow of bioinformatics is presented [Elec-

tronic Supplementary Material (ESM) Fig. S1]. The total

lengths of the sequenced reads were 9,918,270,256 bp for thethermally selected strain and 8,081,204,488 bp for the Don-

aldson strain. Fifty million high-quality paired sequences

selected from gill tissues of each individual fish from the

thermally selectedand Donaldson strains wereassembled into

1,379,536 contig (127,022,700 bp) and 1,432,796 contig

(132,243,594 bp), respectively, by the Velvet software. These

contigs were further combined using the paired-end infor-

mation to formsequences of transcripts by the Oases software.

For the thermally selected strain, 220,242 transcripts with a

mean length of 680 bp were assembled, whereas for the

Donaldson strain, 229,641 transcripts with a mean length of

750 bp were assembled (Table2). After size selection, there

remained 47,750 and 55,498 transcripts for the thermally

selected strain and Donaldson strain, respectively. To obtain

unique transcripts, redundant and highly similar sequences

were removed. The final transcripts for gill tissues of the

thermally selected strain contained 21,125 sequences with an

average length of 1,741 bp; in comparison, there were 23,838

sequenceswithan average lengthof 1,874 bpfor gill tissues of

the Donaldson strain.

Read mapping and gene annotation

BLASTX was used to identify genes from the assembled

transcripts. A search against the NCBI non-redundant

protein database revealed that there were 16,417 (78 %)

and 18,977 sequences (80 %) in the thermally selected and

Donaldson strains, respectively, which matched known

genes. After the BLASTX search, 1,804 sequences wereremoved for future analysis because they were considered

to be hypothetical proteins, unnamed protein products, or

uncharacterized proteins. The transcripts matched with the

same gene were integrated into one gene. We then com-

bined the lists of the genes obtained from the thermally

selected and Donaldson strains and established an inte-

grated gene list consisting of 13,092 independent genes

(ESM Table S1). Concurrently, 50 million raw reads of the

thermally selected strain were mapped back onto the

transcripts of both the thermally selected and Donaldson

strains using the Bowtie software. The 50 million raw

reads of the Donaldson strain were also mapped. Thenumber of raw reads onto the multiple transcripts of a

single gene was then summed. Surprisingly, each gene was

shown to be commonly expressedthat is, at least one raw

read was mapped on each of 13,092 genes in both datasets

of the thermally selected and Donaldson strains after back-

mapping. For each gene, we then calculated an average

number of raw reads onto the datasets of the thermally

selected and Donaldson strains and regarded the score as an

expression frequency (ESM Table S1).

Among these 13,092 genes, 324 genes showed a twofold

or higher expression frequency in the thermally selected

strain than in the Donaldson strain. On the contrary, 413

genes were down-regulated (B0.5-fold) in the thermally

selected strain in comparison with the Donaldson strain. In

the thermally selected strain, compared to the Donaldson

strain, a higher number of genes were down-regulated than

up-regulated genes, whereas up-regulated genes showed a

much greater expression frequency than down-regulated

ones (ESM Table S1; Fig. 1). For the GO annotation, 5,818

genes (44.4 % of the 13,092 sequences) were annotated by

Table 2 Summary of

sequencing of cDNAs from gill

tissues of the thermally selected

and Donaldson strains

a Transcript sequences which

had similarities of[90 % were

removed and the transcript with

the maximum length was

chosen by CD-HIT software

Feature Number

Thermally

selected

Donaldson

Raw reads for de novo assembly 50M 50M

De novo assembled transcripts (C100 bp) 220,242 229,641

Average length (bp) 680 750

Transcripts (C1,000 bp in length) 47,750 55,498

Transcripts after removing redundant transcriptsa

21,125 23,838

Average length of cDNAs annotated (bp) 1,741 1,874

Minimum/maximum length of transcripts (bp) 1,000/9,267 1,000/9,643

1044 Fish Sci (2012) 78:10411049

1 3

8/12/2019 Tan et al 2012

5/9

Blast2GO (Fig.2a). These were separated into 38 func-

tional groups. Compositions of annotated the GO terms in

gill are shown in Fig. 2b.

Thermally selected strain-specific highly expressed

genes

Among the 324 genes that were more distinctly expressed

in the thermally selected strain than in the Donaldson

strain, extremely high expression levels were observed in

several genes, such as those encoding HSP70b (2,657-

fold), dnaj homology subfamily a member 1-like protein

(89-fold), and interleukin-1 beta (73-fold). Interestingly,

the expression frequency of the HSP70b gene varied from

112- (junb protein gene) to more than 2,800-fold (c-fos-

related antigen 1 gene) higher than that of the other dis-

tinctly expressed genes in the thermally selected strain

(Table3). In contrast, the fold changes of those genes

down-regulated in the thermally selected strain relative to

the Donaldson strain were not less than 1:7 (Table 4, ESM

Table S1). Housekeeping genes, such as those encoding

EF-1 alpha, elongation factor 2 and beta actin, which are

commonly used as internal control genes in real-time PCR

analyses, showed comparable expression levels between

the two strains (Table4).

The results of the expression ratio, as determined by

real-time PCR analyses, between the representative indi-

viduals sequenced from the thermally selected and Don-

aldson strains were almost consistent with those of the

standardized global gene expression analysis for the rep-

resentative six up-regulated and two down-regulated genes

(Table5). In addition, the means of the mRNA expression

ratio, as determined by real-time PCR analyses for these

same genes, for the thermally selected and Donaldson

strains calculated from each of five individuals were also

consistent with those of the global gene expression analysis

(Table6).

Discussion

Taking the advantages of next generation sequencing

technologies and newly developed assembly software

packages, we generated comprehensive expression profiles

of gill tissues of rainbow trout thermally selected and

Donaldson strains and examined the expression differences

between the two strains. Several projects have been

undertaken to sequence the rainbow trout transcriptome

[21,34,35], but the expression profiles generated in these

studies were based on normalized cDNA libraries of mixed

tissues and were of low sequence coverage. To the best of

our knowledge, our study is the first report of a global geneexpression analysis using such a deep coverage of next

generation sequencing data in rainbow trout. A total of

14,896 known genes (1,804 genes belonging to hypothet-

ical proteins, unnamed or uncharacterized) in the gill were

retrieved from the NCBI database. However, 9,569 novel

transcripts in our data sets remain without matches.

Many HSP genes were identified among those genes

which were more highly expressed in the thermally selec-

ted strain than in the Donaldson strain. HSP genes have

been extensively studied in many species [36,37], and they

are the major stress-induced proteins responding to exter-

nal stimuli [38]. The 70-kDa HSPs are one of the most

extensively studied family of HSPs [79]. Two isoforms,

HSP70a and HSP70b, have been well characterized in

rainbow trout [7]. In our study, HSP70b was expressed at

an extremely high level in the thermally selected strain

compared with the Donaldson strain. In contrast, the

expression level of another HSP member, heat shock

cognate 70 kDa, was similar for both strains. This result is

consistent with the previous finding that the heat shock

cognate 70 kDa gene is expressed in a constitutive way

[39]. Ojima et al. [40] also demonstrated that under non-

heat-shock conditions HSP70, HSP60, and HSP40 were

expressed significantly higher at the protein level in those

individuals with a high thermotolerance than in those with

a low thermotolerance. Earlier research indicated that

HSP70s are regulated by HSP40 [41], which may explain

why the homolog of HSP40, dnaJ homolog subfamily a,

was also highly expressed in the thermally selected strain.

Another HSP family member, HSP47, is also a well-known

heat stress-related protein [42,43], and the gene encoding

it was up-regulated in the thermally selected strain relative

to the Donaldson strain.

-1

-0.5

0

0.5

1

1.5

2

2.5

10,000 13,0915,000

Gene number in descending order

log10

ratio

Fig. 1 Global gene expression profiles of the thermally selected

strain compared with the Donaldson strain. The comparative expres-

sion levels of 13,091 commonly expressed genes in gill tissues of the

thermally selected strain compared with the Donaldson strain are

represented by their log10 value, except for a highly expressed gene

encoding heat shock protein 70b (HSP70b), which was excluded from

this figure because it is the only gene having a log10 value of[2.5

Fish Sci (2012) 78:10411049 1045

1 3

8/12/2019 Tan et al 2012

6/9

No GO

a

Commonly expressed genes in gill

7,274

5,818

Total13,092

Molecular function Biological process Cellular component

Molecular function

%

Biological process Cellular component

1. molecular transducer

activity2. structural molecule activity3. antioxidant activity4. enzyme regulator activity5. binding6. catalytic activity7. channel regulator activity8. transporter activity9. transcription factor activity

10. multicellular organismal process

11. cellular component biogenesis12. biological adhesion13. multi-organism process14. localization15. metabolic process16. signaling17. cellular process18. reproduction19. response to stimulus

20. biological regulation21. immune system process

22. growth

23. death24. viral reproductive process25. pigmentation26. developmental process27. cellular component organization28. cell proliferation29. locomotion30. rhythmic process

31. cell part

32. cell projection33. endomembrane system34. extracellular region part35. membrane-bounded organelle36. protein complex37. vesicle38. organelle part

b

0

10

20

30

40

50

60

70

80

90

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

Distribution

Functional groups

Annotated with GO

Fig. 2 Annotation of commonly expressed genes in the gill (a) withtheir terms in gene ontology (GO) (b). The 13,092 commonly

expressed genes in the gill were subjected to annotation by Blast2GO,

and 5,818 of these genes were assigned to 38 functional groups withthree main GO terms: molecular function, biological process, and cell

component

Table 3 List of genes showing higher expression in the thermally selected strain than in the Donaldson strain

Gene Accession no. Expression frequencya

Thermally selected Donaldson Ratio

Heat shock protein 70 kDa isoform b AB176855 2,875,242 1,082 2,657.3

dnaJ homolog subfamily a member 1-like XP_003440484 6,326 71 89.1

Interleukin-1 beta 2 precursor CAB53541 6,254 86 72.7

c-fos related antigen 1 NP_001155024 1,009 21 48

c-fos protein BAC77046 9,409 293 32.1

Nuclear receptor subfamily 4 XP_003441554 1,713 68 25.1

ccaat enhancer-binding protein beta NP_001117919 10,081 749 13.4

DNA damage-inducible transcript 4 protein ACO14087 2,750 257 10.7

junB protein NP_001117992 25,670 2,812 9.1

Heat shock protein 47 precursor NP_001117706 8,318 1,283 6.4

a The number in 50 million raw reads

1046 Fish Sci (2012) 78:10411049

1 3

8/12/2019 Tan et al 2012

7/9

The expression of HSP family genes in the thermally

selected strain seems to be in a state of continuous

up-regulation as there was no high temperature exposure or

other stressors prior to the sampling of both strains. This is

quite interesting because HSP family members act as

molecular chaperons in the protein quality control process

and give organisms tolerance to various stresses, including

high temperature, by protecting cells from damage (for

review, see [44]). Over-expression of HSPs by transgenesis

causes marked stress tolerance in plants [45] and mice [46].

Consequently, the up-regulated HSP family members in

our study are interesting candidate molecules for deter-

mining upper temperature tolerance in the rainbow trout.

Our previous study using this strain revealed that the

Table 4 Representative down-regulated genes in the thermally selected strain compared to the Donaldson strain and comparably expressed

genes in both strains

Gene Accession no. Expression frequencya

Thermally selected Donaldson Ratio

Down-regulated

dsx and mab-3 related transcription factor 4 ABU53616 344 1,469 0.23

Serum albumin 1 precursor NP_001117137 240 1,016 0.23

Immunoglobulin heavy chain AAV48553 269 1,020 0.26

Type II cytoskeletal 8-like XP_003458136 657 2,196 0.3

Dual specificity protein kinase clk2-like XP_003452484 970 2,977 0.33

60 s ribosomal subunit protein L15 ACH70977 10,713 24,144 0.44

60 s ribosomal subunit protein L28 NP_001133165 4,401 9,669 0.46

Proteasome subunit beta type 8 NP_001158688 1,350 3,017 0.45

Galactose-specific lectin ACO13356 13,655 28,344 0.48

MHC class I heavy chain AAG53684 32,869 67,708 0.48

Comparably expressed

Elongation factor EF1 alpha ACP56687 153,661 173,687 0.88

Elongation factor 2 ACN58590 29,006 35,561 0.81

Beta actin NP_001117707 340,020 435,886 0.78

Heat shock cognate 70 kDa protein NP_001117704 249,165 218,832 1.14

aThe number in 50 million raw reads

Table 5 Comparison of the expression ratios, as determined by real-time PCR and the standardized global gene expression analysis, of the

representative six up-regulated and two down-regulated genes from the representative individuals of the thermally selected and Donaldson strains

Gene Accession no. Real-time PCRa

Global gene expression analysisb

Thermally

selected

Donaldson Ratio Thermally

selected

Donaldson Ratio

Heat shock protein 70 kDa isoform b AB176855 16.038 0.0037 4,332.4 217,342 45 4,829.8

dnaJ homolog subfamily a member 1-like XP_003440484 0.085 0.0021 40.3 1,607 15 107.1

c-fos protein BAC77046 0.148 0.0029 50.2 2,278 54 42.2

ccaat enhancer-binding protein beta NP_001117919 0.113 0.0084 13.5 2,783 145 19.2

DNA damage-inducible transcript 4 protein ACO14087 0.027 0.0023 11.4 523 39 13.4

junB protein NP_001117992 0.126 0.0131 9.7 6,581 634 10.4

dsx and mab-3 related transcription factor 4 ABU53616 0.003 0.0021 1.52 57 274 0.21

Dual specificity protein kinase clk2-like XP_003452484 0.0028 0.0072 0.39 115 238 0.48

a The values were calculated from data collected on the representative individuals and normalized to the elongation factor-1alpha (EF-1alpha)

geneb

The results obtained from the back-mapping of raw reads to the standardized regions (300 bp) in which the real-time PCR products were

included

Fish Sci (2012) 78:10411049 1047

1 3

8/12/2019 Tan et al 2012

8/9

cytochrome c oxidase (COX) gene in the thermally selec-

ted strain was constitutively up-regulated at early devel-

opmental stages [15]. It has been reported that HSP family

members are involved in the assembly of COX subunits

(for review, see [44]).

Notable differences in the expression level of several

c-fos protein-related genes, including genes coding for

interleukin, c-fos-related antigen, c-fos, and junb, were also

found in the thermally selected strain. The c-fos gene has

been reported to be one of the early immediate genes that

responds to a wide variety of stimulations [47]. Although

the relationships between the upper temperature tolerance

and the expression of the c-fos genes are still unclear,

Wilkerson et al. [48] reported that heat shock factor 2, a

transcription factor which binds to heat shock element

(HSE) in the promoter region of the HSP genes and induces

their expression, also binds to HSE in the c-fos gene pro-

moter and enhances its expression in the HeLa cell. These

lines of information, together with the over-expression of

HSP family members observed in this study, suggest that

genes containing HSE within their promoter region are

constitutively up-regulated in the thermally selected strain.Other than gill tissues, we also collected heart, liver,

muscle, and brain tissues. Data from these tissues will

provide additional insights into upper temperature toler-

ance, which will be published elsewhere in the near future.

Future studies based on these results will provide more

detailed information for the genes and mutations that are

responsible for upper temperature tolerance in fish.

Acknowledgments This study was supported in part by a grant

from the Ministry of Agriculture, Forestry, and Fisheries of Japan.

References

1. Food and Agriculture Organization of the United Nations (2009)

Global aquaculture production of Oncorhynchus mykiss. FAO

Fishery Statistic, FAO, Geneva

2. Masuda H, Amaoka K, Araga T, Ueno T, Yoshino T (1992) The

fishes of the Japanese archipelago. Tokai University Press, Tokyo

3. Donaldson LR, Olson PR (1955) Development of rainbow trout

bloodstock by selective breeding. Trans Am Fish Soc 85:93101

4. Ineno T, Tsuchida S, Kanda K, Watabe S (2005) High temper-

ature tolerance of rainbow trout Oncorhyncus mykiss selected by

high temperature breeding. Fish Sci 71:767775

5. Chen JD, Yew FH, Li GC (1988) Thermal adaptation and heat

shock response of tilapia ovary cells. J Cell Physiol 134:189199

6. Fangue NA, Hofmeister M, Schulte PM (2006) Intraspecific

variation in thermal tolerance and heat shock protein gene

expression in common killifish, Fundulus heteroclitus. J Exp Biol

209:28592872

7. Ojima N, Yamashita M, Watabe S (2005) Comparative expres-

sion analysis of two paralogous Hsp70s in rainbow trout cells

exposed to heat stress. Biochim Biophys Acta 1681:99106

8. Ojima N, Yamashita M, Watabe S (2005) Quantitative mRNA

expression profiling of heat shock protein families in rainbow

trout cells. Biochem Biophys Res Commun 329:5157

9. Heredia-Middleton P, Brunelli J, Drew RE, Thorgaard GH (2008)

Heat shock protein (HSP70) RNA expression differs among

rainbow trout (Oncorhynchus mykiss) clonal lines. Comp Bio-chem Physiol Part B 149:552556

10. Quinn NL, McGowan CR, Cooper CA, Koop BF, Davidson WS

(2011) Identification of genes associated with heat tolerance in

Arctic charr exposed to acute thermal stress. Physiol Genomics

43:685696

11. Somorjai IML, Danzmann RG, Ferguson MM (2003) Distribution

of temperature tolerance quantitative trait loci in Arctic charr

(Salvelinus alpinus) and inferred homologies in rainbow trout

(Oncorhynchus mykiss). Genetics 165:14431456

12. Danzmann RG, Jackson TR, Ferguson MM (1999) Epistasis in

allelic expression at upper temperature tolerance QTL in rainbow

trout. Aquaculture 173:4558

Table 6 The ratios of the mean values for the expression levels, as

determined by real-time PCR analyses, of five individuals from the

thermally selected strain to those of the Donaldson strain for the

representative six up-regulated and two down-regulated genes in

comparison with the corresponding ratios determined by global gene

expression analysis on the representative individuals

Gene Accession no. Real-time PCRa Global gene expression analysisb

Thermally

selected

Donaldson Ratio Thermally

selected

Donaldson Ratio

Heat shock protein 70 kDa isoform b AB176855 26.27 0.027 985.3

c

2,875,242 1,082 2,657.3dnaJ homolog subfamily a member 1-like XP_003440484 0.1 0.0035 27.9

c6,326 71 89.1

c-fos protein BAC77046 0.097 0.0028 34.3c

9,409 293 32.1

ccaat enhancer-binding protein beta NP_001117919 0.19 0.0193 9.8c 10,081 749 13.5

DNA damage-inducible transcript 4 protein ACO14087 0.038 0.0025 14.9c

2,750 257 10.7

junB protein NP_001117992 0.153 0.027 5.6c 25,670 2,812 9.1

dsx and mab-3 related transcription factor 4 ABU53616 0.0014 0.0031 0.44 344 1,469 0.23

Dual specificity protein kinase clk2-like XP_003452484 0.0047 0.008 0.59 970 2,977 0.33

aThe values are calculated from the mean of five individuals and normalized to those of the EF-1alpha gene

b The results obtained from global gene expression analysis are listed for comparison (see Tables 3,4)c The differences in the relative expression levels between the thermally selected strain and the Donaldson strain are significantly different

(Students ttest, P\0.05)

1048 Fish Sci (2012) 78:10411049

1 3

8/12/2019 Tan et al 2012

9/9

13. Perry GM, Danzmann RG, Ferguson MM, Gibson JP (2001)

Quantitative trait loci for upper thermal tolerance in outbred

strains of rainbow trout (Oncorhynchus mykiss). Heredity

86:333341

14. Jackson TR, Ferguson MM, Danzmann RG, Fishback AG, Ihssen

PE, OConnell M, Crease TJ (1998) Identification of two QTL

influencing upper temperature tolerance in three rainbow trout

(Oncorhynchus mykiss) half-sib families. Heredity 80:143151

15. Ikeguchi K, Ineno T, Itoi S, Kondo H, Kinoshita S, Watabe S

(2005) Increased levels of mitochondrial gene transcripts in the

thermally selected rainbow trout (Oncorhynchus mykiss) strain

during embryonic development. Mar Biotechnol 8:178188

16. Shendure J, Ji H (2008) Next-generation DNA sequencing. Nat

Biotechnol 26:11351145

17. Pan Q, Shai O, Lee LJ, Frey BJ, Blencowe BJ (2008) Deep sur-

veying of alternative splicing complexity in the human transcrip-

tome by high-throughput sequencing. Nat Genet 40:14131415

18. Jager M, Ott C, Grunhagen J, Hecht J, Schell H, Mundlos S, Duda

GN, Robinson PN, Lienau J (2011) Composite transcriptome

assembly of RNA-seq data in a sheep model for delayed bone

healing. BMC Genomics 12:158

19. Martin JA, Wang Z (2011) Next-generation transcriptome

assembly. Nat Rev Genet 12:671682

20. Salem M, Rexroad CE, Wang J, Thorgaard GH, Yao J (2010)

Characterization of the rainbow trout transcriptome using Sanger

and 454-pyrosequencing approaches. BMC Genomics 11:564

21. Hale MC, McCormick CR, Jackson JR, Dewoody JA (2009)

Next-generation pyrosequencing of gonad transcriptomes in the

polyploid lake sturgeon (Acipenser fulvescens): the relative

merits of normalization and rarefaction in gene discovery. BMC

Genomics 10:203

22. Weber AP, Weber KL, Carr K, Wilkerson C, Ohlrogge JB (2007)

Sampling the Arabidopsis transcriptome with massively parallel

pyrosequencing. Plant Physiol 144:3242

23. Wang W, Wang Y, Zhang Q, Qi Y, Guo D (2009) Global char-

acterization ofArtemisia annuaglandular trichome transcriptome

using 454 pyrosequencing. BMC Genomics 10:465

24. Crawford JE, Guelbeogo WM, Sanou A, Traore A, Vernick KD,

Sagnon N, Lazzaro BP (2010) De novo transcriptome sequencing

inAnopheles funestus using Illumina RNA-seq technology. PLoS

One 5:e14202

25. Bonizzoni M, Dunn WA, Campbell CL, Olson KE, Dimon MT,

Marinotti O, James AA (2011) RNA-seq analyses of blood-

induced changes in gene expression in the mosquito vector spe-

cies, Aedes aegypti. BMC Genomics 12:82

26. Simpson JT, Wong K, Jackman SD, Schein JE, Jones SJ, Birol I

(2009) ABySS: a parallel assembler for short read sequence data.

Genome Res 19:11171123

27. Pearson WR, Wood T, Zhang Z, Miller W (1997) Comparison of

DNA sequences with protein sequences. Genomics 46:2436

28. Zerbino DR, Birney E (2008) Velvet: algorithms for de novo

short read assembly using de Bruijn graphs. Genome Res

18:821829

29. Pevzner PA, Tang H, Waterman MS (2001) An Eulerian pathapproach to DNA fragment assembly. Proc Natl Acad Sci USA

98:97489753

30. Li W, Godzik A (2006) Cd-hit: a fast program for clustering and

comparing large sets of protein or nucleotide sequences. Bioin-

formatics 22:16581659

31. Langmead B, Trapnell C, Pop M, Salzberg SL (2009) Ultrafast

and memory-efficient alignment of short DNA sequences to the

human genome. Genome Biol 10:R25

32. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N,

Marth G, Abecasis G, Durbin R (1000) Genome Project Data

Processing Subgroup (2009) The sequence alignment/map (SAM)

format and SAMtools. Bioinformatics 25:20782079

33. Conesa A, Gotz S, Garca-Gomez JM, Terol J, Talon M, Robles

M (2005) Blast2GO: a universal tool for annotation, visualization

and analysis in functional genomics research. Bioinformatics

21:36743676

34. Rexroad CE, Lee Y, Keele JW, Karamycheva S, Brown G, Koop

B, Gahr SA, Palti Y, Quackenbush J (2003) Sequence analysis of

a rainbow trout cDNA library and creation of a gene index.

Cytogenet Genome Res 102:347354

35. Govoroun M, LeGac F, Guiguen Y (2006) Generation of a large

scale repertoire of expressed sequence tags (ESTs) from norma-

lised rainbow trout cDNA libraries. BMC Genomics 7:196

36. Srensen JG, Kristensen TN, Loeschcke V (2003) The evolu-

tionary and ecological role of heat shock proteins. Ecol Lett

6:10251037

37. Feder ME, Hofmann GE (1999) Heat-shock proteins, molecular

chaperones, and the stress response: evolutionary and ecological

physiology. Annu Rev Physiol 61:243282

38. Roberts RJ, Agius C, Saliba C, Bossier P, Sung YY (2010) Heat

shock proteins (chaperones) in fish and shellfish and their

potential role in relation to fish health: a review. J Fish Dis

33:789801

39. Boone AN, Vijayan MM (2002) Constitutive heat shock protein

70 (HSC70) expression in rainbow trout hepatocytes: effect of

heat shock and heavy metal exposure. Comp Biochem Physiol C

132:223233

40. Ojima N, Mekuchi M, Ineno T, Tamaki K, Kera A, Kinoshita S,

Asakawa S, Watabe S (2012) Differential expression of heat-

shock proteins in F2 offspring of a thermally-selected rainbow

trout strain. Fish Sci. doi:10.1007/s12562-012-0523-3

41. Summers DW, Douglas PM, Ramos CH, Cyr DM (2009) Poly-

peptide transfer from Hsp40 to Hsp70 molecular chaperones.

Trends Biochem Sci 34:230233

42. Pearson DS, Kulyk WM, Kelly GM, Krone PH (1996) Cloning

and characterization of a cDNA encoding the collagen-binding

stress proteins Hsp47 in zebrafish. DNA Cell Biol 15:263271

43. Basu N, Todgham AE, Ackerman PA, Bibeau MR, Nakano K,

Schulte PM, Iwama GK (2001) Heat shock protein genes and

their functional significance in fish. Gene 295:173183

44. Vogt S, Portig I, Irqsusi M, Ruppert V, Weber P, Ramzan R

(2011) Heat shock protein expression and change of cytochrome

c oxidase activity: presence of two phylogenic old systems to

protect tissues in ischemia and reperfusion. J Bioenerg Biomembr

43:425435

45. Montero-Barrientos M, Hermosa R, Cardoza RE, Gutierrez S,

Nicolas C, Monte E (2010) Transgenic expression of the Trich-

oderma harzianum hsp70 gene increases Arabidopsis resistance

to heat and other abiotic stresses. J Plant Physiol 167:659665

46. Dedeoglu A, Ferrante RJ, Andreassen OA, Dillmann WH, Beal

MF (2002) Mice overexpressing 70-kDa heat shock protein show

increased resistance to malonate and 3-nitropropionic acid. ExpNeurol 176:262265

47. Sheng M, Greenberg ME (1990) The regulation and function of

c-fos and other immediate early genes in the nervous system.

Neuron 4:477485

48. Wilkerson DC, Skaggs HS, Sarge KD (2007) HSF2 binds to the

Hsp90, Hsp27, and c-Fos promoters constitutively and modulates

their expression. Cell Stress Chaperones 12:283290

Fish Sci (2012) 78:10411049 1049

1 3

http://dx.doi.org/10.1007/s12562-012-0523-3http://dx.doi.org/10.1007/s12562-012-0523-3