1

Translesion synthesis past acrolein-derived DNA adduct,

γ-hydroxypropanodeoxyguanosine, by yeast and human DNA polymerases η.

Irina G. Minko, M. Todd Washington, Manorama Kanuri, Louise Prakash, Satya Prakash,

and R. Stephen Lloyd*#

Running title: Bypass of γ-hydroxy-1,N2-propano-2'deoxyguanosine by polymerase η

Sealy Center for Molecular Science, University of Texas Medical Branch, Galveston,

Texas, USA 77555

* Holds Mary Gibbs Jones Distinguished Chair in Environmental Toxicology from

the Houston Endowment.

# To whom correspondence should be addressed: FAX: 409-772 1790;

Tel: 409-772 2179; E-mail: rslloyd@utmb.edu

This work was supported in part by National Institute of Health Grants, ES06676 (RSL), ES00267 (RSL), and GM19261 (LP).

Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on October 24, 2002 as Manuscript M207774200 by guest on D

ecember 26, 2019

http://ww

w.jbc.org/

Dow

nloaded from

2

SUMMARY

γ-Hydroxy-1,N2-propano-2'deoxyguanosine (γ-HOPdG) is a major

deoxyguanosine adduct derived from acrolein, a known mutagen. In vitro, this adduct has

previously been shown to pose a severe block to translesion synthesis by a number of

polymerases (pol). Here we show that both yeast and human pol η can incorporate a C

opposite γ-HOPdG at ~ 190- and ~100-fold lower efficiency relative to the control

deoxyguanosine and extend from a C paired with the adduct at ~ 8- and ~ 19-fold lower

efficiency. While DNA synthesis past γ-HOPdG by yeast pol η was relatively accurate,

the human enzyme misincorporated nucleotides opposite the lesion with frequencies of ~

10-1 to 10-2. Since γ-HOPdG can adopt both ring closed and ring opened conformations,

comparative replicative bypass studies were also performed with two model adducts,

propanodeoxyguanosine and reduced γ-HOPdG. For both yeast and human pol η, the ring

open reduced γ-HOPdG adduct was less blocking than γ-HOPdG, whereas the ring closed

propanodeoxyguanosine adduct was a very strong block. Replication of DNAs containing

γ-HOPdG in wild type and xeroderma pigmentosum variant (XPV) cells revealed a

somewhat decreased mutation frequency in XPV cells. Collectively, the data suggest that

pol η might potentially contribute to both error- free and mutagenic bypass of γ-HOPdG.

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

3

INTRODUCTION

Acrolein (Fig. 1), the simplest α,β-unsaturated aldehyde, is an environmental

contaminant and a product of inborn metabolism. In organisms, acrolein is generated via

a number of pathways, such as the oxidation of polyamines and lipid peroxidation (1, 2).

Like many other bifunctional aldehydes, acrolein reacts with DNA bases to form several

DNA adducts, among which the γ-hydroxy-1,N2-propano-2'deoxyguanosine (γ−HOPdG1)

was identified as a major deoxyguanosine (dG) derivative (3, 4). Importantly, γ−HOPdG

has been detected in DNA from mammalian tissues (5-7), suggesting that this adduct is

generated in vivo. The γ−HOPdG adduct is formed by conjugate addition of acrolein to

N2 of dG to produce N2-(3-oxopropyl)dG. Ring closure at N1 leads to the formation of

the cyclic adduct (Fig. 1). In the nucleoside and presumably in single stranded DNA,

γ−HOPdG predominantly exists in the cyclic form, such that at physiological pH, the ring

open species cannot be detected spectrophotometrically (8). However, in the presence of

a reducing agent, the acyclic form can be trapped as the N2-(3-hydroxypropyl) adduct

(Fig. 1).

Another dG derivative, 1,N2-propanodeoxyguanosine (PdG) (Fig. 1), whose

structure is similar to that of the ring closed γ−HOPdG, has been extensively exploited as

a model compound for the γ−HOPdG and other exocyclic dG adducts in both structural

and biological studies. NMR spectroscopy of the PdG-adducted oligodeoxynucleotides

has revealed that when placed opposite dC, PdG adopts a syn orientation within the

duplex and introduces a localized structural perturbation that is pH- and sequence-

dependent (9, 10). The inability of PdG to form normal Watson-Crick hydrogen bonds,

severely blocks DNA synthesis both in vitro (11, 12) and in vivo (13-16) and the

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

4

replication that does occur, results in mutations (13-16). Specifically, PdG induced base

substitutions occurred at an overall frequency of 8.5 x 10-2 and 7.5 x 10-2 / translesion

synthesis in the COS-7 (14) and in the nucleotide excision repair deficient human cells

(16), respectively. In both strains, G to T transversions predominated.

Recently, the structure of the γ−HOPdG-containing oligodeoxynucleotide was

solved by NMR spectroscopy (17). These data have indicated that within the duplex,

γ−HOPdG exists primarily in the ring open form. In such a conformation, the modified

base participates in standard Watson-Crick base pairing by adopting a regular anti

orientation around the glycosidic torsion angle, with the N2-propyl chain in the minor

groove pointing toward the solvent (17). The structural differences between PdG and

γ−HOPdG within the duplex have led to the hypothesis that the latter lesion would be less

blocking for replication and less mutagenic than the former.

Biological studies aimed to test the cytotoxic and mutagenic effects of acrolein-

modified DNAs and of site-specific γ−HOPdG adduct have generated conflicting results.

It is known that acrolein itself causes mutations in both bacterial (18) and mammalian

(19) systems and has tumor- initiating activity (20). When a DNA vector was treated with

acrolein and propagated in human cells, the majority of mutations were single, tandem,

and multiple base substitutions that predominantly occurred in G:C base pairs (21).

However in bacteria, γ−HOPdG, the major acrolein-derived dG adduct, is not a strong

block for DNA synthesis, nor a miscoding lesion (22-24). Analyses of mutations caused

by γ−HOPdG in wild type Escherichia coli and in polB, dinB, and umuDC deficient

strains revealed that in the absence of these “SOS” polymerases, the efficiency and

accuracy of the translesion synthesis were not significantly affected (22). In contrast to

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

5

the prokaryotic data, γ−HOPdG caused mutations at an overall frequency of 7.4 x 10-2 /

translesion synthesis when a single stranded, site-specifically modified vector was

propagated in COS-7 cells (24). Interestingly, both the frequencies and types of mutations

were remarkably similar to those reported for the PdG adduct (14, 16). However,

γ−HOPdG was shown to be only marginally miscoding (≤ 1 % base substitution) when

double stranded vector was utilized (16). In this investigation, a number of cell lines

including HeLa, a nucleotide excision repair-deficient xeroderma pigmentosum group A,

and polymerase η deficient xeroderma pigmentosum variant, were examined.

Although replication across γ−HOPdG in vivo was predominantly error- free (from

93 to 100 % of the translesional events), the adduct was shown to be a severe block and a

miscoding lesion during in vitro DNA synthesis by a number of polymerases.

Particularly, replication across γ−HOPdG by the Klenow exo- fragment of E. coli

polymerase I was significantly inhibited and extremely error-prone (22, 23). γ−HOPdG

also strongly blocked DNA synthesis by two major eukaryotic polymerases, pol δ and pol

ε (24). In the presence of proliferating cell nuclear antigen, little bypass of the adduct by

pol δ was achieved, and it appeared to be highly mutagenic (24). We hypothesized

therefore that in mammalian cells, specialized, translesion DNA synthesis polymerases

(25, 26) are involved in promoting replication across γ−HOPdG.

Among DNA polymerases, proficient in translesion synthesis, yeast polymerase η

(a product of the RAD30 gene) (27) and its human counterpart (a product of the RAD30A

(XPV, POLH) gene) (28, 29) both possess a unique ability to replicate efficiently and

accurately past a cis-syn cyclobutane pyrimidine dimer (30, 31), the predominant DNA

lesion caused by ultraviolet irradiation. In the yeast Saccharomyces cerevisiae, deletion

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

6

of RAD30 confers moderate sensitivity to UV irradiation and leads to increased UV-

induced mutagenesis (32). Mutations in the human RAD30A gene cause the variant form

of xeroderma pigmentosum (XPV), suggesting that predisposition of XPV individuals to

sunlight- induced skin cancer is due to the lack of accurate translesion DNA synthesis

across UV-induced DNA lesions (28, 29, 33). Yeast and human pol η also efficiently

bypass a product of oxidative DNA damage, the 7,8-dihydro-8-oxoguanine, and do so in

a predominantly error-free manner (34). In addition, several other DNA lesions were

reported to be substrates for human (35-39) and yeast (35, 40) pol η.

In the present study, the ability of yeast and human pol η to perform translesion

DNA synthesis across γ−HOPdG has been examined and the efficiency and fidelity of

synthesis have been tested using steady-state kinetic analyses. To further explore the

bypass mechanism, comparative studies were also performed with two model DNA

adducts, PdG, that mimics the cyclic form of γ−HOPdG, and N2-(3-hydroxypropyl)dG,

which is similar to γ−HOPdG in its ring open form. In addition, the mutagenic potential

of γ−HOPdG was tested in vivo in both human fibroblasts and pol η deficient XPV cells

utilizing a site-specifically modified single stranded pMS2 vector.

EXPERIMENTAL PROCEDURES

Materials - T4 DNA ligase, T4 polynucleotide kinase, and EcoRV were obtained

from New England BioLabs (Beverly, MA). S1 nuclease and proteinase K were

purchased from Life Technologies, Inc. (Rockville, MD). [γ32P]-ATP was purchased

from NEN Life Science Products Inc. (Boston, MA). Bio-Spin columns were purchased

from Bio-Rad (Hercules, CA). Centricon 100 concentrators were obtained from Amicon

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

7

Inc. (Beverly, CA). Slide-A-Lyzer Dialysis Cassettes were obtained from Pierce

(Rockford, IL).

Strains and vectors - Single stranded pMS2 DNA was a generous gift from Dr. M.

Moriya (State University of New York, Stony Brook, NY). SV40 transformed cTAG

derived from XP4BE cells and SV80 normal human fibroblasts were obtained from Dr.

Marila Cordeiro-Stone (University of North Carolina, Chapel Hill, NC). E. coli DH10B

cells used for amplification of transformed DNA isolated from mammalian cells were

purchased from Life Technologies Inc. (Rockville, MD).

Oligodeoxynucleotides - 12-mer oligodeoxynucleotide modified with γ-HOPdG,

5′-GCTAGC (γ−HOPdG) AGTCC-3′, was kindly provided by Dr. T. M. Harris and Dr.

C. M. Harris (Vanderbilt University, Nashville, TN), and it was prepared by a previously

described procedure (8). 24-mer oligodeoxynucleotide, 5′-

GCAGTATCGCGC(PdG)CGGCATGAGCT-3′, adducted with PdG was synthesized as

described (41) and was a generous gift from Dr. L. J. Marnett (Vanderbilt University,

Nashville, TN). Nondamaged 12-mer and 24-mer with a dG in place of γ−HOPdG or

PdG, respectively, were purchased from Midland Certified Reagent Co. (Midland, TX).

All other oligodeoxynucleotides were synthesized by the Molecular Biology Core

Laboratory of the NIEHS Toxicology Center at the University of Texas Medical Branch,

Galveston, Texas, and purified by electrophoresis through a 15% denaturing PAGE (in

the presence of 7 M urea).

Construction of site-specifically modified linear templates for in vitro replication

assays was done according to the previously described procedure (24). Sequences of the

resulting oligodeoxynucleotides were identical: 5′-

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

8

GCTAGCGAGTCCGCGCCAAGCTTGGGCTGCAGCAGGTC-3′, where the

underlined G is either γ−HOPdG or non-adducted dG and 5′-

GCAGTATCGCGCGCGGCATGAGCTGCGCCAAGCTTGGGCTGCAGCAGGTC-3′,

where the underlined G is either PdG or non-adducted dG. To obtain the N2-(3-

hydroxypropyl)dG-containing DNA substrate, 10 µl of 1 M NaBH4 dissolved in 1 M

Hepes buffer (pH 7.4) were added twice to 200 µl of the γ−HOPdG-adducted 38-mer

oligodeoxynucleotide (1-2 µM). Each addition of the reducing agent was followed by

incubation at room temperature for 4 hr. DNA was then dialyzed against 10 mM Tris-

HCl (pH 7.0), 1 mM EDTA overnight using Slide-A-Lyzer Dialysis Cassette (3,500

MWCO). To confirm completeness of reduction, the polypeptide trapping technique was

utilized (42) modified by A. J. Kurtz for γ−HOPdG-containing DNAs. Briefly, probes of

both γ−HOPdG- and reduced γ−HOPdG-adducted oligodeoxynucleotides (50 nM) were

incubated with 50 mM lysine-tryptophan- lysine- lysine in the presence of 25 mM

NaCNBH3 and 100 mM Hepes (pH 7.4) for 5 hr. Reactions were terminated by addition

of an equal volume of 95% (v/v) formamide, 20 mM EDTA, 0.02 % (w/v) xylene cyanol,

and 0.02 % (w/v) bromphenol blue and heating at 90 oC for 2 min. Next, DNAs were

resolved through a 15 % denaturing PAGE and visualized with PhosphorImager Screen.

Under these conditions, no trapping was detected in reactions with γ−HOPdG-containing

oligodeoxynucleotide whereas the γ−HOPdG-containing DNA was completely

complexed with the polypeptide.

Pol η purification - Purifications of yeast pol η and human pol η were done as

described in (27) and (31), respectively.

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

9

DNA polymerase reaction - 21-mer oligodeoxynucleotides were used as primers

for in vitro polymerase reactions. Their sequences were: 5′-

CCTGCTGCAGCCCAAGCTTGG-3′, that is complementary to the 38-mer γ−HOPdG-

containing template DNAs from positions -9 to -29 relative to the site of lesion (-9

primer) as well as complementary to the PdG-adducted 50-mer from positions -15 to -35

(-15 primer); 5′-AGCCCAAGCTTGGCGCGGACT-3′ and 5′-

AGCTTGGCGCAGCTCATGCCG-3′, that are complementary form the position -1 to -

21 to the γ−HOPdG-containing template and the PdG-containing template, respectively,

(-1 primers); 5′-GCCCAAGCTTGGCGCGGACTC-3′ and 5′-

GCTTGGCGCAGCTCATGCCGC-3′, which overlap the lesion site in modified

templates (0 primers). Primer oligodeoxynucleotides were phosphorylated with T4

polynucleotide kinase using [γ32P]ATP and purified using P-6 Bio-Spin columns supplied

with 10 mM Tris-HCl buffer (pH 7.4). The [γ32P]-labeled primers were mixed with the

oligodeoxynucleotide substrates at a molar ratio of 1:2 in the presence of 25 mM Tris-

HCl buffer (pH 7.6), 50 mM NaCl, heated at 90oC for 2 min, and cooled to room

temperature overnight.

Primer extension and single-nucleotide incorporation experiments with yeast pol

η were carried out as described (27) and with human pol η as in (31). Briefly, the

reaction mixture (10 µl) contained 5 nM primer annealed to a template, 25 mM Tris-HCl

buffer (pH 7.5), 10 mM NaCl, 5 mM MgCl2, 10% glycerol, 100 µg/ml of BSA, 5 mM

DTT, 100 µM of each of the four dNTPs (primer extension experiments) or 10 µM

individually (single-nucleotide incorporation experiments), and yeast or human pol η at

the concentrations as indicated in the figure legends. Reactions were incubated at 22oC

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

10

and terminated by the addition of 4 x excess of stop solution consisting of 95% (v/v)

formamide, 20 mM EDTA, 0.02 % (w/v) xylene cyanol, and 0.02 % (w/v) bromphenol

blue. Reaction products were resolved through a 20% denaturing PAGE and visualized

by PhosphorImager screen.

Steady-State Kinetic Analysis - Steady-state kinetic assays were carried out under

the same conditions as the DNA polymerase assays except that 1nM yeast or human pol

η and 20 nM DNA substrates were used with various concentrations of one of the four

nucleotides. Reactions were quenched after 5 min. Quantitative analyses were performed

using a PhosphorImager screen and Image-Quant 5.0 software (Molecular Dynamics,

Sunnyvale, CA). Calculations of rates of nucleotide incorporation were done as given in

(43). The rates of nucleotide incorporation were graphed as a function of nucleotide

concentration, and kcat and Km parameters were obtained from the best fit of the data to

the Michaelis-Menten equation.

Construction of circular single stranded pMS2 DNA modified with γ−HOPdG —

The 12-mer oligodeoxynucleotides containing either γ−HOPdG or a nondamaged dG

were phosphorylated at the 5′ end with ATP and inserted into single stranded pMS2

shuttle vector as described earlier (24). The two ligated samples were designated

pMS2(dG) and pMS2(γ−HOPdG).

Mutagenesis experiments - Transfection of pMS2(dG) and pMS2(γ−HOPdG) into

cTAG and SV80 cells, isolation of DNA, amplification in E. coli DH10B cells, and

differential hybridization analysis were done as previously described (24). Hybridization

with the progeny plasmid DNA was performed using [γ32P] ATP labeled 18-mer

oligodeoxynucleotide probes, [5′-GATGCTAGCNAGTCCATC-3′] where N refers to A,

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

11

T, G, or C. Whatman 541filters containing hybridized colonies were exposed to X-

OMAT AR film overnight and autoradiographs were developed to identify mutation

frequency and types of mutations. Representative colonies were subjected to dideoxy

sequencing (44) to confirm the presence of the mutations. A 20-mer primer (5′-

CCATCTTGTTCAATCAT GCG-3′) sequence around 100 nucleotides downstream of

the adduct, was used for sequencing the region containing the 12-mer

oligodeoxynucleotide in progeny plasmid DNA.

RESULTS

In Vitro Lesion Bypass with Yeast DNA Polymerase η - In order to examine

whether yeast pol η was able to replicate past a γ−HOPdG adduct, running start primer

extension experiments were performed (Fig. 2 A). A 21-mer primer was annealed to the

template DNA so that it allowed the addition of 9 nucleotides before encountering the

adduct (-9 primer). On the nondamaged DNA substrate, primers were efficiently

extended by yeast pol η (Fig. 2 A, lanes 1-4). On the γ−HOPdG-containing substrate

(Fig. 2 A, lanes 5-8), yeast pol η appeared to be capable of bypassing the lesion and

forming full- length products. However, DNA synthesis was partially inhibited right

before the DNA lesion and opposite from it.

To understand better the importance of ring opening during replication, primer

extension experiments were carried out using two model DNA substrates: the PdG

adduct, which is an analogue of the ring closed form of the γ−HOPdG, and the reduced

γ−HOPdG, which is similar to the ring open form of the natural adduct. In the case of the

50-mer PdG-containing substrate, 21-mer primer was positioned on the template so that

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

12

the incorporation of 15 nucleotides was needed before reaching the lesion (-15 primer).

Since both efficiency and accuracy of the DNA synthesis are known to be sequence-

dependent (43, 45), an additional nondamaged control 50-mer DNA template was utilized

that had the same sequence as the PdG-adducted template. These data revealed that the

PdG adduct was a much stronger block for replication by yeast pol η than γ−HOPdG.

Under conditions which allowed an efficient replication of the nondamaged DNA

template (Fig. 2 A, lanes 13-16), DNA synthesis on the PdG-adducted template was

greatly inhibited one nucleotide before the lesion and synthesis was completely aborted

after incorporating a nucleotide opposite the lesion (Fig. 2A, lanes 17-20). However,

replication by yeast pol η beyond the PdG can be achieved, but at much higher

concentrations of enzyme (data not shown). With the reduced γ−HOPdG-adducted

template (Fig. 2 A, lanes 9-12), the bypass efficiency by yeast pol η seemed to be

comparable with that on the γ−HOPdG-adducted template.

The specificity of nucleotide incorporation by yeast pol η opposite and beyond

the lesions was also tested. To identify the nucleotide that is incorporated by this

polymerase opposite the adducted base, single-nucleotide incorporation experiments were

carried out using standing start DNA substrates in which 3′ terminus of the primer was

located one nucleotide before the lesions (-1 primers) (Fig. 2 B). On both nondamaged

substrates, yeast pol η preferentially incorporated a C opposite G (Fig. 2 B, lanes 3 and

18). Incorporation of a T and to a lesser extent an A and a G was also observed,

especially on the 38-mer template. Interestingly, incorporation of a correct nucleotide (C)

was predominant opposite each of the modified bases, namely the γ−HOPdG (Fig. 2 B,

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

13

lane 8), the reduced γ−HOPdG (Fig. 2 B, lane 13), and the PdG (Fig. 2 B, lane 23)

adducts.

To test whether any misincorporation occurred past the lesion site, single-

nucleotide incorporation experiments were carried out using DNA substrates in which the

correct nucleotide (C) was primed with the adducted base (0 primers). No nucleotide

misincorporation was observed on any of the adducted templates examined (data not

shown).

Thus, yeast pol η is capable of bypassing the γ−HOPdG adduct, and in contrast to

all other polymerases tested so far (22-24), it predominantly incorporates the correct

nucleotide opposite and downstream of the lesion. In addition, these data show that a

cyclic PdG is a much stronger block for replication by yeast pol η than an acyclic

reduced γ−HOPdG, but neither of the model adducts seem to be particularly miscoding

for this polymerase.

In Vitro Lesion Bypass with Human DNA Polymerase η - Primer extension

reactions and single-nucleotide incorporation experiments were carried out with human

pol η (Fig. 3) using the same set of the primer/templates as with the yeast enzyme.

Similar to the yeast pol η, human polymerase was able to replicate past the γ−HOPdG

(Fig. 3 A, lanes 5-8) and the reduced γ−HOPdG lesions (Fig. 3 A, lanes 9-12). However,

unlike yeast pol η, at higher enzyme concentrations human pol η appeared to bypass the

PdG adduct (Fig. 3 A, lanes 17-20).

Single-nucleotide incorporation experiments with human pol η revealed

significant differences between the human and yeast enzymes in their discrimination

abilities during nucleotide insertion opposite the γ−HOPdG adduct. Whereas yeast pol η

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

14

preferentially incorporated the correct nucleotide (C) opposite the lesion, human

polymerase extended the -1 primer almost equally well in the presence of A, C, and G

(Fig. 3 B, lanes 6-10). On the PdG-adducted template, the difference between these two

polymerases was even more striking. In contrast to the yeast pol η that incorporated a C

opposite PdG, human polymerase inserted A, G, and T better than the correct nucleotide

(Fig. 3 B, lanes 21-25). Interestingly, incorporation by human pol η is much more

accurate opposite the reduced γ−HOPdG-adduct (Fig. 3 B, lanes 11-15) than that found

opposite the non-reduced adduct (Fig. 3 B, lanes 6-10).

Single-nucleotide incorporation experiments were carried also out using 0 primers

with the C primed with the adducted base. Yielding data similar to that of the yeast pol η,

human polymerase preferentially incorporated the correct nucleotide on all five substrates

tested (data not shown).

Efficiency of Nucleotide Incorporation and Extension – To compare the efficiency

of translesion synthesis by yeast and human pol η, steady-state kinetic parameters kcat and

Km were first determined for the correct nucleotide (C) incorporation opposite dG in two

different sequence contexts and also opposite γ−HOPdG, reduced γ−HOPdG, and PdG

adducts. The reactions were performed using the same 21-mer -1 primers as in the single-

nucleotide incorporation experiments. For yeast pol η, C is incorporated opposite the ring

closed PdG adduct with a 1,600-fold lower efficiency (kcat/Km) than C is incorporated

opposite the unadducted dG (Table 1). In contrast, yeast pol η incorporates a C opposite

the ring open reduced γ−HOPdG with only a 12-fold lower efficiency than opposite the

unadducted dG. The efficiency of incorporation opposite the γ−HOPdG adduct is in

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

15

between these two extremes with a 190-fold reduction relative to the unadducted dG. The

same trends were also observed with human pol η (Table 2).

Next, the steady-state kinetic parameters were determined for the extension from

a C residue paired with the modified bases and were used to determine the efficiency of

extending from each adduct relative to the extension from an unadducted dG (Tables 1

and 2). For both yeast and human pol η, the efficiencies of extensions from the

γ−HOPdG and the reduced γ−HOPdG were reduced ~ 5- to 30-fold relative to the

unadducted dG. In contrast, the extension from the PdG was blocked to much greater

extent, especially in the case of the yeast enzyme (6,800-fold; Table 1).

Fidelity of nucleotide incorporation by yeast and human pol η opposite

γ−HOPdG – In the single-nucleotide incorporation experiments, yeast and human pol η

displayed different accuracies of replication across the γ−HOPdG adduct. In order to

further evaluate the accuracy of nucleotide incorporation opposite the lesion, kinetic

analyses were carried out using -1 primer, and the frequencies of misincorporation were

calculated as the ratio of kcat/Km of the incorrect nucleotide to the correct nucleotide (43).

These data showed that yeast pol η synthesizes past γ−HOPdG relatively accurately with

efficiency of incorporation of a C ~ 75 times higher than that of the next most preferred

nucleotide (G) (Table 1). In contrast, human pol η discriminated poorly between the

correct and wrong nucleotides incorporating opposite γ−HOPdG. Particularly, high

misincorporation frequencies were observed for A and G (Table 2).

Mutagenicity of γ−HOPdG modified single stranded pMS2 vectors in normal

human fibroblasts and XPV cells - Table 3 shows the outcomes of in vivo replication of

pMS2 (dG) and pMS2 (γ−HOPdG) in SV80 and XPV cells. The data presented for XPV

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

16

cells were obtained from five independent experiments. All the 1104 E. coli

transformants resulting from replication of modified pMS2 (γ−HOPdG) in XPV cells

were picked and grown in 96 well plates. Hybridization analysis revealed that 767

colonies hybridized with either one of the four probes while 337 colonies did not

hybridize with any of the four probes. Of those transformants that did not hybridize with

any sequence-specific probe, none of those hybridized to sequences immediately

upstream of the oligodeoxynucleotide ligation site, suggesting that this deletion was not

caused by the adduct. While 96% of the hybridized transformants did not contain any

targeted mutations (Table 3), 1.3% (10/767) were G to A transitions, 0.5% (4/767) were

G to C transversions, and 2.1% (16/767) were G to T transversions. Sequencing of

plasmid DNA prepared from these colonies confirmed the presence of T, C, or A,

respectively, opposite the site of the adducted guanine. No mutations were observed

when 192 colonies were screened out of transformants obtained from nonadducted

pMS2(dG).

When these experiments were repeated in SV80 normal human fibroblasts, all the

288 transformed colonies subsequently obtained from two experiments were analyzed for

mutations by differential hybridization strategy. Although only 92 colonies hybridized

with either one of the four probes, 89% (82/92) contained the correct base opposite the

adducted guanine, while 8.6% (8/92) were G to T transversions and 1.1% (1/92) were G

to C and G to A mutations. None of the colonies from the control pMS2(dG)

transformants showed any mutation. Thus, XPV cells appeared to have a lower mutation

frequency (3.9%) when compared with normal human fibroblast cells (11%).

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

17

DISCUSSION

The γ-HOPdG adduct was not a significant block for replication when site-

specifically modified vectors were propagated in E. coli (22-24) or in mammalian cells

(16, 24). In E. coli, the adduct appeared not to be miscoding (22-24). Depending on the

cell type and vector used, 93 to 100 % of the translesion events were non-mutagenic

during in vivo replication in mammalian cells (16, 24). Thus, in both prokaryotic and

eukaryotic systems, DNA polymerases exist that are able to synthesize past γ-HOPdG

efficiently and in a predominantly error- free manner. On the other hand, none of the

polymerases examined in vitro so far, namely, Klenow exo- fragment of E. coli pol I (22,

23), calf thymus pol δ (24), and human pol ε (24), were able to incorporate the correct

nucleotide opposite this adduct. In the present study, yeast pol η has been identified as

the first polymerase, that possesses an ability to replicate across the γ-HOPdG adduct

relatively accurately. Comparable efficiency of DNA syntheses past γ-HOPdG was also

observed for human pol η, but this polymerase displayed a much higher propensity for

misincorporation. Single-nucleotide experiments as well as steady-state analyses showed

that human pol η frequently incorporates an A or a G opposite γ-HOPdG and therefore, is

likely to introduce G to T and G to C transversions.

We note that the observed kcat for C incorporation opposite the undamaged G

template (~5 min-1; Table 1) is slower than the rate of nucleotide incorporation measured

during processive synthesis (~80 min-1; (46)) for yeast pol η. This suggests that kcat

reflects the rate of DNA release and thus, is an underestimate of the actual rate of

nucleotide incorporation. Nevertheless, as the observed Km is expected to be decreased

with the kcat in a compensatory manner, the efficiencies of nucleotide incorporation

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

18

(kcat/Km) determined under steady-state conditions provide a measure of catalytic

efficiencies of the enzyme. More detailed kinetic studies are however needed to more

accurately define the mechanisms controlling pol η’s fidelity opposite these DNA

adducts.

The nucleotide incorporation data for pol η are in agreement with results of the in

vivo replication assays when site-specifically modified single stranded pMS2 vector was

propagated in XPV cells. Overall mutagenic frequency determined in the XPV cells

(3.9x10-2/translesion synthesis) was about two and three times less than that in COS-7

(24) and normal human cells, respectively. Importantly, lower frequencies of

transversions (particularly G to T) in XPV cells, but not G to A transitions, accounted for

the observed differential between two types of cells. Thus, pol η might potentially

contribute to the bypass of the γ-HOPdG adduct in mammalian cells being responsible for

both error-free and error-prone replicative events.

Based on the NMR spectroscopy data, a model of error- free bypass of γ-HOPdG

has been proposed in which the incoming dCTP triggers a structural rearrangement of the

adduct from the ring closed to the ring open form. This change allows the formation of

the standard Watson-Crick hydrogen bonds, stabilizes the structure, and facilitates the

subsequent extension reaction (17). In order to examine the role of ring opening during

replication by pol η, we compared the efficiency of incorporation opposite γ-HOPdG to

the incorporation opposite the two model adducts, PdG and reduced γ-HOPdG. For both

yeast and human pol η, cyclic PdG was a very strong block for the incorporation of a C

relative to the acyclic reduced γ-HOPdG. For incorporation opposite γ-HOPdG, both

polymerases had an intermediate incorporation efficiency. Ring opening was also

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

19

important for the extension from a C paired with the adduct. For both yeast and human

pol η, relative efficiencies of extension were similar when γ-HOPdG- and reduced γ-

HOPdG- modified DNA substrates were used. By contrast, the cyclic PdG adduct is a

very strong block for extension by these polymerases, especially for the yeast enzyme.

Overall, these data are consistent with the proposed model of de los Santos (17), such that

ring opening of γ-HOPdG is essential not only for efficient incorporation opposite the

lesion by yeast and human pol η, but also for efficient extension. However, from these

data it cannot be concluded whether the incoming nucleotide causes the transformation of

the adduct from the ring closed to the ring open form or whether the equilibrium is

shifted towards ring open conformation by protein-DNA interactions in the polymerase

active site.

The steady-state kinetic analyses and single-nucleotide incorporation experiments

have revealed significant differences between yeast and human pol η with respect to their

accuracies of replication across modified bases. For the human enzyme, frequencies of

misincorporation opposite γ-HOPdG were on average, one order of magnitude higher

than for the yeast enzyme. In addition, the incorporation by human pol η opposite PdG

was extremely error-prone, whereas yeast pol η inserted the correct nucleotide

preferentially.

The proficient ability of yeast and human pol η to replicate across the ring open

form of γ-HOPdG strongly indicates that inspite of the fact that it is located in the minor

groove, the presence of this adduct on the templating residue poses no significant

hindrance to these polymerases. This suggests the lack of any specific contact of these

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

20

enzymes with the minor groove of the templating residue, which would permit pol η to

replicate across DNA adducts, which protrude into the minor groove.

Although DNA synthesis past γ-HOPdG by pol η is very efficient when the

adduct exists in its ring open form, in vivo replication data (16, this report) clearly show

that pol η is not solely responsible for bypass of this lesion in humans. Thus, another

polymerase is likely involved in translesion synthesis across γ-HOPdG. The yet

unidentified polymerase may be able to efficiently bypass the ring closed form of γ-

HOPdG and perhaps other exocyclic dG adducts (1, 2), in which N1 modification

prevents Watson-Crick pairing.

Acknowledgments – We acknowledge Dr. Masaaki Moriya, Department of

Pharmacological Sciences, State University of New York at Stony Brook, NY, for the

generous gift of pMS2 vector, Dr. Lawrence J. Marnett, Department of Biochemistry,

Center in Molecular Toxicology, Vanderbilt University at Nashville, TN, for the

generous gift of PdG-adducted oligodeoxynucleotide, and Dr. Marila Cordeiro-Stone,

Department of Pathology and Laboratory Medicine, University of North Carolina, Chapel

Hill, NC, for the generous gift of XPV cells. We are grateful to Dr. Lubomir V. Nechev,

Dr. Thomas M. Harris, and Dr. Constance M. Harris, Department of Chemistry, Center in

Molecular Toxicology, Vanderbilt University, Nashville, TN, for synthesis of γ-HOPdG-

adducted oligodeoxynuc leotide and for helpful discussions. We also acknowledge the

Molecular Biology Core Laboratory, NIEHS Toxicology Center, University of Texas

Medical Branch, Galveston, TX, for oligodeoxynucleotide synthesis.

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

21

REFERENCES

1. Chung, F.-L., Nath, R. G., Nagao, M., Nishikawa, A., Zhou, G.-D., and

Randerath, K. (1999) Mut. Res., 424, 71-81.

2. Pan, J., and Chung, F.-L. (2002) Chem. Res. Toxicol., 15, 367-372.

3. Chung, F.-L., Young, R., and Hecht, S. S. (1984) Cancer Res. 44, 990-995

4. Singer, B., and Bartsch, H. (1999) Exocyclic DNA adducts as new risk markers

for DNA damage in man. In: Exocyclic DNA Adducts in Mutagenesis and

Carcinogenesis, IARC Scientific Publications No. 150, International Agency for

Research on Cancer, Lyon, France

5. McDiarmid, M. A., Iype, P. T., Kolodner, K., Jacobson-Kram, D., and Strickland,

P. T. (1991) Mutat. Res. 248, 93-99

6. Nath, R. G., and Chung, F.-L. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7491-

7495

7. Penn, A., Nath, R. G., Pan, J., Chen, L. C., Widmer, K., Henk, W., and Chung, F.-

L. (2001) Environ. Health. Perspect. 109, 219-224

8. Nechev, L. V., Harris, C. M., and Harris, T. M. (2000) Chem Res. Toxicol. 13,

421-429

9. Singh, U. S., Moe, J. G., Reddy, G. R., Weisenseel, J. P., Marnett, L. J., and

Stone, M. P. (1993) Chem. Res. Toxicol., 6, 825-836

10. Weisenseel, J. P., Reddy, G. R., Marnett, L. J., and Stone, M. P. (2002) Chem.

Res. Toxicol., 15, 127-139.

11. Hashim, M. F., and Marnett, L. J. (1996) J. Biol. Chem. 271, 9160-9165

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

22

12. Hashim, M. F., Schnetz-Boutaud, N., and Marnett, L. J. (1997) J. Biol. Chem.

272, 20205-20212

13. Benamira, M., Singh, U., and Marnett, L. J. (1992) J. Biol. Chem. 267, 22392-

22400

14. Moriya, M., Zhang, W., Johnson, F., and Grollman, A. P. (1994) Proc. Natl.

Acad. Sci. U. S. A. 91, 11899-11903

15. Burcham, P. C., and Marnett, L. J. (1994) J. Biol. Chem. 269, 28844-28850

16. Yang, I.-Y., Johnson, F., Grollman, A. P., and Moriya, M. (2002) Chem. Res.

Toxicol. 15, 160-164.

17. de los Santos, C., Zaliznyak, T., and Johnson, F. (2001) J. Biol. Chem. 276,

9077-9082

18. Marnett, L. J., Hurd, H. K., Hollstein, M. C., Levin, D. E., Esterbauer, H., and

Ames, B. N. (1985) Mutat. Res. 148, 25-34

19. Curren, R. D., Yang, L. L., Conklin, P. M., Grafstrom, R. C., and Harris, C. C.

(1988) Mutat. Res. 209, 17-22

20. Cohen, S. M., Garland, E. M., St. John, M., Okamura, T., and Smith, R. A. (1992)

Cancer Res. 52, 3577-3581

21. Kawanishi, M., Matsuda, T., Nakayama, A., Takebe, H., Matsui, S., and Yagi, T.

(1998) Mutat. Res. 417, 65-73

22. Yang, I.-Y., Hossain, M., Miller, H., Khullar, S., Johnson, F., Grollman, A., and

Moriya, M. (2001) J. Biol. Chem. 276, 9071-9076

23. VanderVeen, L. A., Hashim, M. F., Nechev, L. V., Harris, T. M., Harris, C. M.,

and Marnett, L. J. (2001) J. Biol. Chem. 276, 9066-9070

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

23

24. Kanuri, M., Minko, I. G., Nechev, L. V., Harris, T. M., Harris, C. M., and Lloyd,

R. S. (2002) J. Biol. Chem. 277, 18257-18265

25. Ohmori, H., Friedberg, E. C., Fuchs, R. P., Goodman, M. F., Hanaoka, F., Hinkle,

D., Kunkel, T. A., Lawrence, C. W., Livneh, Z., Nohmi, T, Prakash, L., Prakash,

S., Todo, T., Walker, G. C., Wang, Z., and Woodgate, R. (2001) Mol. Cell 8, 7-8

26. Wang, Z. (2001) Mutat. Res. 486, 59-70

27. Johnson, R. E., Prakash, S., and Prakash, L. (1999) Science 283, 1001-1004

28. Johnson, R. E., Kondratick, C. M., Prakash, S., and Prakash, L. (1999) Science

285, 263-265

29. Masutani, C., Kusumoto, R., Yamada, A., Dohmae, N., Yokoi, M., Yuasa, M.,

Araki, M., Iwai, S., Takio, K., and Hanaoka, F. (1999) Nature 399, 700-704

30. Washington, M. T., Johnson, R. E., Prakash, S., and Prakash, L. (2000) Proc.

Natl. Acad. Sci. U. S. A. 97, 3094-3099

31. Johnson, R. E., Washington, M. T., Prakash, S., and Prakash, L. (2000) J. Biol.

Chem. 275, 7447-7450

32. McDonald, J. P., Levine, A. S., and Woodgate, R. (1997) Genetics 147, 1557-

1568

33. Broughton, B. C., Cordonnier, A., Kleijer, W. J., Jaspers, N. G. J., Fawcett, H.,

Raams, A., Garritsen, V. H., Stary, A., Avril, M.-F., Boudsocq, F., Masutani, C.,

Hanaoka, F., Fuchs, R. P., Sarasin, A., and Lehmann, A. R. (2002) Proc. Natl.

Acad. Sci. U. S. A. 99, 815-820

34. Haracska, L., Yu, S.-L., Johnson, R. E., Prakash, L., and Prakash, S. (2000) Nat.

Genet. 25, 458-461

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

24

35. Haracska, L., Prakash, S., and Prakash, L. (2000) Mol. Cell Biol. 20, 8001-8007.

36. Zhang, Y., Yuan, F., Wu, X., Rechkoblit, O., Taylor, J.-S., Geacintov, N. E., and

Wang, Z. (2000) Nucleic Acids Res. 28, 4717-4724

37. Levine, R. L., Miller, H., Grollman, A., Ohashi, E., Ohmori, H., Masutani, C.,

Hanaoka, F., and Moriya, M. (2001) J. Biol. Chem. 276, 18717-18721

38. Kuraoka, I., Robins, P., Masutani, C., Hanaoka, F., Gasparutto, D., Cadet, J.,

Wood, R. D., and Lindahl, T. (2001) J. Biol. Chem. 276, 49283-49288

39. Kusumoto, R., Masutani, C., Iwai, S., and Hanaoka, F. (2002) Biochemistry 41,

6090-6099

40. Minko I. G., Washington, M. T., Prakash, L., Prakash, S., and Lloyd, R. S. (2001)

J. Biol. Chem. 276, 2517-2522

41. Marinelli, E. R., Johnson, F., Iden, C. R., and Yu, P. L. (1990) Chem. Res.

Toxicol. 3, 49-58

42. Kurtz, A. J., Dodson, M. L., and Lloyd, R. S. (2002) Biochemistry 41, 7054-7064

43. Creighton, S., Bloom, L. B., and Goodman, M. F. (1995) Methods Enzymol. 262,

232-256

44. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A.

74, 5463-5467

45. Echols, H., and Goodman, M. F. (1991) Annu. Rev. Biochem. 60, 477-511

46. Washington, M. T., Prakash, L., and Prakash, S. (2001) Cell 107, 917-927

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

25

FOOTNOTES

1 The abbreviations used are: γ-HOPdG, γ-hydroxy-1,N2-propano-2'deoxyguanosine;

PdG, 1,N2-propanodeoxyguanosine; pol, DNA polymerase; XPV, xeroderma

pigmentosum variant; T-T dimer, cis-syn cyclobutane pyrimidine dimer

FIGURE LEGEND

Figure 1. Structures of the acrolein and related deoxyguanosine adducts.

Figure 2. Primer extension (A) and single-nucleotide incorporation (B) catalyzed by

S. cerevisiae pol η on the γ-HOPdG-, reduced γ-HOPdG-, and PdG-adducted

templates. The 21-mer primers were annealed to the nondamaged (ND-38), γ-HOPdG-,

or reduced γ-HOPdG-adducted 38-mer templates or to the nondamaged (ND-50) or PdG-

adducted 50-mer DNA templates. The DNA substrates (5 nM) were incubated at 22 oC in

the presence of all four dNTPs (100 µM) with 1 nM S. cerevisiae pol η for a period of

time as indicated (A) or in the presence of one of the four dNTPs (- = no nucleotide

added, A = dATP, C = dCTP, G = dGTP, T = dTTP) and 4 nM S. cerevisiae pol η for 20

min (B). G* indicates the position of the modified G on the template.

Figure 3. Primer extension (A) and single-nucleotide incorporation (B) catalyzed by

human pol η on the γ-HOPdG-, reduced γ-HOPdG-, and PdG-adducted templates.

The 21-mer primers were annealed to the nondamaged (ND-38), γ-HOPdG-, or reduced

γ-HOPdG-adducted 38-mer templates or to the nondamaged (ND-50) or PdG-adducted

50-mer DNA templates. The DNA substrates (5 nM) were incubated at 22 oC for 20 min

in the presence of all four dNTPs (100 µM) and increased concentrations (from 0.4 nM to

4 nM) of human pol η (A) or in the presence of one of the four dNTPs (- = no nucleotide

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

26

added, A = dATP, C = dCTP, G = dGTP, T = dTTP) and 1 nM human pol η (B). G*

indicates the position of the modified G on the template.

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

TABLE 1 Steady-state kinetics of nucleotide incorporation by S. serevisiae pol η

Substrate

dNTP kcat

(min-1) Km

(µM) kcat /Km

(µM-1min-1) Fold reduction in

efficiency* Fidelity of

incorporation** - 1 primer

dG (38-mer) dATP 0.90 ± 0.15 200 ± 70 4.5 x 10-3 - 1.7 x 10-4 dCTP 4.9 ± 0.2 0.19 ± 0.02 26 - - dGTP 0.69 ± 0.04 81 ± 14 8.5 x 10-3 - 3.3 x 10-4 dTTP 0.39 ± 0.04 8.7 ± 4.0 4.5 x 10-2 - 1.7 x 10-3

γ-HOPdG dATP 0.28 ± 0.01 210 ± 30 1.3 x 10-3 - 9.3 x 10-3 dCTP 0.28 ± 0.02 2.0 ± 0.5 1.4 x 10-1 190 - dGTP 0.17 ± 0.003 88 ± 5 1.9 x 10-3 - 1.4 x 10-2 dTTP 0.098 ± 0.014 190 ± 80 5.2 x 10-4 - 3.7 x 10-3

reduced γ-HOPdG

dCTP

0.35 ± 0.009

0.16 ± 0.01

2.2

12

-

dG (50-mer) dCTP 3.2 ± 0.08 0.13 ± 0.01 25 - -

PdG dCTP 0.35 ± 0.01 22 ± 2 1.6 x 10-2 1,600 -

0 primer

dG (38-mer) dGTP 2.3 ± 0.1 0.19 ± 0.03 12 - - γ-HOPdG dGTP 0.94 ± 0.003 0.57 ± 0.09 1.6 7.5 - reduced γ-HOPdG

dGTP

0.89 ± 0.03

0.35 ± 0.06

2.5

4.8

-

dG (50-mer) dGTP 2.2 ± 0.1 0.27 ± 0.05 8.1 - - PdG dGTP nd > 100 1.2 x 10-3 6,800 -

*For nucleotide incorporation opposite a given adduct, the fold reduction in efficiency was calculated as (kcat /Km)G/(kcat/Km)adduct. Similarly, the fold reduction in the efficiencies for extension were calculated as (kcat/Km)normal primer terminal base paired/(kcat /Km)adducted primer

terminal base paired. **Fidelity of incorporation was calculated as (kcat/Km)incorrect /(kcat /Km)correct .

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

TABLE 2 Steady-state kinetics of nucleotide incorporation by human pol η

Substrate

dNTP kcat

(min-1) Km

(µM) kcat /Km

(µM-1min-1) Fold reduction in

efficiency* Fidelity of

incorporation** - 1 primer

dG (38-mer) dATP 0.27 ± 0.02 27 ±4 1.0 x 10-2 - 3.0 x 10-3 dCTP 0.85 ± 0.05 0.26 ± 0.04 3.3 - - dGTP nd nd < 5.0 x 10-4 - > 1.5 x 10-4 dTTP 0.72 ± 0.02 170 ± 10 4.2 x 10-3 - 1.3 x 10-3

γ-HOPdG dATP 0.20 ± 0.008 57 ± 8 3.5 x 10-3 - 1.1 x 10-1 dCTP 0.24 ± 0.009 7.5 ± 1.0 3.2 x 10-2 100 - dGTP 0.06 ± 0.002 15 ± 2 4.0 x 10-3 - 1.3 x 10-1 dTTP 0.11 ± 0.01 320 ± 70 3.4 x 10-4 - 1.1 x 10-2

reduced γ-HOPdG

dCTP

0.26 ± 0.01

0.053 ± 0.010

4.9

0.67

-

dG (50-mer) dCTP 0.57 ± 0.03 0.14 ± 0.04 4.1 - -

PdG dCTP 0.23 ± 0.02 120 ± 20 1.9 x 10-3 2,200 -

0 primer

dG (38-mer) dGTP 0.65 ± 0.05 0.20 ± 0.05 3.3 - - γ-HOPdG dGTP 0.17 ± 0.01 1.0 ± 0.3 1.7 x 10-1 19 - reduced γ-HOPdG

dGTP

0.25 ± 0.03

2.5 ± 0.7

1.0 x 10-1

33

-

dG (50-mer) dGTP 0.85 ± 0.13 1.9 ± 0.4 4.5 x 10-1 - - PdG dGTP 0.17 ± 0.005 53 ± 7 3.2 x 10-3 140 -

*For nucleotide incorporation opposite a given adduct, the fold reduction in efficiency was calculated as (kcat /Km)G/(kcat/Km)adduct. Similarly, the fold reduction in the efficiencies for extension were calculated as (kcat/Km)normal primer terminal base paired/(kcat /Km)adducted primer

terminal base paired. **Fidelity of incorporation was calculated as (kcat/Km)incorrect /(kcat /Km)correct .

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

TABLE 3

Single base pair substitutions in cTAG (XPV) cells and SV80 (normal human fibroblasts)

transformed with single stranded pMS2(dG) and pMS2(γ−HOPdG)

Base Pair Substitutions SPECIES

TRANSFORMED

Total Transformants

Non-Hybridized

Colonies G- G G - A

G – C

G -T

TOTAL MUTATION %

cTAG (XPV) pMS2(dG)

192 72 120 0 0 0 0

pMS2(γ−HOPdG)

1104 337 737 10 4 16 3.9

SV80 (NORMAL HUMAN

FIBROBLASTS)

pMS2 (dG)

96 36 60 0 0 0 0

pMS2(γ−HOPdG) 288 196 82 1 1 8 11

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

O

N

N N

NO

NH dR

HN

N N

NO

NH dR

OOH

N

N N

NO

NH dR

HN

N N

NO

NH dR

OH

Acrolein

reduction

γ-HOPdG(γ-Hydroxy-1,N -propano- 2'-deoxyguanosine)

2 N -(3-Oxopropyl)-2'-deoxyguanosine

2

PdG (1,N -Propano-2'-deoxyguanosine)

2 reduced γ-HOPdG(N -(3-Hydroxypropyl)- 2'-deoxyguanosine

2

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

DNA substrate: ND-50 PdGND-38 γ-HOPdG reducedγ-HOPdG

A 5'-gctagcGagtccgcgccaagcttgggct---3'ggttcgaacccga---5'

*

yeast pol ηreaction time: 0 15 30 600 15 30 600 15 30 60 0 15 30 600 15 30 60

5'---cgcgcGcggcatgagctgcgccaagct---3'*ggttcga---5'

-15 primer -15 primer-9 primer-9 primer -9 primer

DNA substrate: ND-50 PdGND-38 γ-HOPdG reducedγ-HOPdG

B 5'-gctagcGagtccgcgccaagcttgggct---3'tcaggcgcggttcgaacccga-5'

* 5'---cgcgcGcggcatgagctgcgccaagct---3'*gccgtactcgacgcggttcga-5'

dNTP: - A C G T - A C G T- A C G T- A C G T- A C G T

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

G*G*

G*

Figure 2

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

DNA substrate: ND-50 PdGND-38 γ-HOPdG reducedγ-HOPdG

A

human pol η:

-15 primer-15 primer-9 primer -9 primer -9 primer

- -- - -

DNA substrate: ND-50 PdGND-38 γ-HOPdG reducedγ-HOPdG

B

dNTP: - A C G T - A C G T- A C G T- A C G T- A C G T

5'-gctagcGagtccgcgccaagcttgggct---3'tcaggcgcggttcgaacccga-5'* 5'---cgcgcGcggcatgagctgcgccaagct---3'*

gccgtactcgacgcggttcga-5'

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

*G*G

*G

Figure 3

5'-gctagcGagtccgcgccaagcttgggct---3'ggttcgaacccga---5'

* 5'---cgcgcGcggcatgagctgcgccaagct---3'*ggttcga---5'

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from

and R. Stephen LloydIrina G. Minko, M. Todd Washington, Manorama Kanuri, Louise Prakash, Satya Prakash

SRC="/math/eta.gif" ALIGN="BASELINE" ALT="eta ">-hydroxypropanodeoxyguanosine, by yeast and human DNA polymerases <IMG

γTranslesion synthesis past acrolein-derived DNA adduct,

published online October 24, 2002J. Biol. Chem. 

  10.1074/jbc.M207774200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on Decem

ber 26, 2019http://w

ww

.jbc.org/D

ownloaded from