Download pptx - Supplementary Figure 1 Kim H, et al

Transcript

Page 1: Supplementary Figure 1 Kim H, et al

Supplementary Figure 1Kim H, et al.

Day 0 Day 1 Day 2 Day 3 Day 4 Day 5

ASC (-)(9)

ASC (+)(9)

Group(n)

Peritoneal scraping

5mg of Zyin PDF (ip.)

sacrifice

2mL of PBS+ 8mL of PDF (ip.)

6x106 of rASC in 2mL of PBS+ 8mL of PDF (ip.)

A

B

C

A

B

C

Peritoneal scraping sacrifice

Procedureorder

5mg of Zyin PDF (ip.)

5mg of Zyin PDF (ip.)

2mL of PBS+ 8mL of PDF (ip.)

6x106 of rASC in 2mL of PBS+ 8mL of PDF (ip.)

5mg of Zyin PDF (ip.)

5mg of Zyin PDF (ip.)

2mL of PBS+ 8mL of PDF (ip.)

6x106 of rASC in 2mL of PBS+ 8mL of PDF (ip.)

5mg of Zyin PDF (ip.)

5mg of Zyin PDF (ip.)

2mL of PBS+ 3mL of PDF (ip.)

6x106 of rASC in 2mL of PBS+ 3mL of PDF (ip.)

5mg of Zyin PDF (ip.)

5mg of Zyin PDF (ip.)

2mL of PBS+ 3mL of PDF (ip.)

6x106 of rASC in 2mL of PBS+ 3mL of PDF (ip.)

5mg of Zyin PDF (ip.)

Recommended

Supplementary Materials - Cancer Research...2011/02/07 · Supplementary Materials Supplementary Figure 1. Functional independence of the HIF-1α–ARNT pathway and the HIF-1α–c-Myc

Supplementary Materials - Cancer Research...2011/02/07 · Supplementary Materials Supplementary Figure 1. Functional independence of the HIF-1α–ARNT pathway and the HIF-1α–c-Myc Documents

Supplementary Figure 1 - Purdue University · Supplementary Figure 1 Supplementary Figure 1. Dose-response curves of the binding of AMFs and AM 1β to soybean PYLs (GmPYL) and Arabidopsis

Supplementary Figure 1 - Purdue University · Supplementary Figure 1 Supplementary Figure 1. Dose-response curves of the binding of AMFs and AM 1β to soybean PYLs (GmPYL) and Arabidopsis Documents

Supplementary Figure S1. HGF enhanced HCC metastasis. (A ...Supplementary Figure S1. HGF enhanced HCC metastasis. (A)Serum EGF level in HCC patients pre- and postoperation.Student-

Supplementary Figure S1. HGF enhanced HCC metastasis. (A ...Supplementary Figure S1. HGF enhanced HCC metastasis. (A)Serum EGF level in HCC patients pre- and postoperation.Student- Documents

Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx Documents

Supplementary Figure S1

Supplementary Figure S1 Documents

Supplementary Figure 1-8 - images.nature.com · VZ 100μm WT Disc1 LI 0 100 200 300 400 Number of BrdU- positive cells WT Disc1 LI BrdU BrdU / DAPI Supplementary Figure 1 SVZ VZ a

Supplementary Figure 1-8 - images.nature.com · VZ 100μm WT Disc1 LI 0 100 200 300 400 Number of BrdU- positive cells WT Disc1 LI BrdU BrdU / DAPI Supplementary Figure 1 SVZ VZ a Documents

Supplementary Figure 1. Examination of neural cells and Wnt … · 2012-08-17 · Supplementary Figure 8. DF19-9-11T, DF6-9-9T, and H9 cell lines demonstrate β-catenin nuclear localization

Supplementary Figure 1. Examination of neural cells and Wnt … · 2012-08-17 · Supplementary Figure 8. DF19-9-11T, DF6-9-9T, and H9 cell lines demonstrate β-catenin nuclear localization Documents

Supplementary Figure 1. Relevant molecular structures ... fileSupplementary Figure 4. Energy profiles along MS-CASPT2 optimized reaction paths for methyl (left) and OH (right) dissociation

Supplementary Figure 1. Relevant molecular structures ... fileSupplementary Figure 4. Energy profiles along MS-CASPT2 optimized reaction paths for methyl (left) and OH (right) dissociation Documents

5 15 25 20 10 Ct value Log concentration miR-375 miR-221 Supplementary Figure S1

5 15 25 20 10 Ct value Log concentration miR-375 miR-221 Supplementary Figure S1 Documents

Supplementary Information (Aoki, K. et al., Chromosomal ...10.1038...Supplementary Figure 1 Karyotype analysis of the wild-type and Wnt signal-activated (β-cateninΔex3 and Apc–/–)

Supplementary Information (Aoki, K. et al., Chromosomal ...10.1038...Supplementary Figure 1 Karyotype analysis of the wild-type and Wnt signal-activated (β-cateninΔex3 and Apc–/–) Documents

0DWHULDO (6, IRU/DE RQD&KLS 7KLV · -2-Supplementary Figure 1.NaCl concentration profile, and pSTL1-qV expression in each chamber of the experiment shown in Figure 2B. Supplementary Documents

Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express Documents

Supplementary Figure S1 SDS-PAGE analysis of the purified … · biobatteries connected in series powering up a digit clock (b) and a LED (c) are shown. 7 Supplementary Figure S7

Supplementary Figure S1 SDS-PAGE analysis of the purified … · biobatteries connected in series powering up a digit clock (b) and a LED (c) are shown. 7 Supplementary Figure S7 Documents

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in Documents

MoleculardynamicssuggestsantiviralcompoundsactiveagainstDe ... · shown in supplementary figure 7 (SF7). No significant secondary structure rearrangementsweredetectedinthisexperimenteither(SF4).Onthewhole,thedata

MoleculardynamicssuggestsantiviralcompoundsactiveagainstDe ... · shown in supplementary figure 7 (SF7). No significant secondary structure rearrangementsweredetectedinthisexperimenteither(SF4).Onthewhole,thedata Documents

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT Documents

Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to Documents

Supplementary Figure 1 - images.nature.com › original › nature-assets › nm › journal › v1… · Supplementary Figure 2: b-AP15 induces apoptosis and inhibits cell survival

Supplementary Figure 1 - images.nature.com › original › nature-assets › nm › journal › v1… · Supplementary Figure 2: b-AP15 induces apoptosis and inhibits cell survival Documents