www.sciencemag.org/cgi/content/full/science.1252514/DC1
Supplementary Materials for
Retrograde Semaphorin Signaling Regulates Synapse Elimination in the
Developing Mouse Brain
Naofumi Uesaka, Motokazu Uchigashima, Takayasu Mikuni, Takanobu Nakazawa,
Harumi Nakao, Hirokazu Hirai, Atsu Aiba, Masahiko Watanabe, Masanobu Kano*
*Corresponding author. E-mail: [email protected]
Published 15 May 2014 on Science Express
DOI: 10.1126/science.1252514
This PDF file includes:
Materials and Methods
Figs. S1 to S22
Tables S1 to S3
Full Reference List
Materials and methods
Animals
Sprague-Dawley (SD) rats and C57BL/6 mice were used (SLC JAPAN). All experiments
were performed in accordance with the guidelines set down by the experimental animal
ethics committees of the University of Tokyo, Hokkaido University, and the Japan
Neuroscience Society. The coding region of enhanced green fluorescent protein (GFP) was
inserted into the pL7ΔAUG vector (20, 21) and then the L7-GFP transgene was injected
into fertilized eggs to generate L7-GFP transgenic mice.
Isolation of Purkinje cells using a fluorescence-activated cell sorter (FACS)
The method has been described previously (21), but was modified slightly. Briefly, the
cerebellum was removed from L7-GFP transgenic mice at postnatal day (P)4, P6, P7, P9,
P13, P15, and P18. Cubes of cerebella were digested for 10 min at 37°C with 90 U of
papain (Worthington, NJ, USE) in a dissociation solution consisting of Ca2+
-free Hank’s
balanced salt solution (HBSS) containing 0.2 mg/ml DL-cysteine HCl, 0.2 mg/ml bovine
serum albumin, 1 mM HEPES, 1.5 mM MgSO4 and 5 mg/mL glucose (pH 7.4). The
enzymatic reaction was stopped by the addition of dissociation solution containing 5 U/mL
DNAase I. Tissues were triturated mildly through wide-bore and fine-tipped pipettes. After
centrifuging, the supernatant was removed and the cells were resuspended in Ca2+
- and
Mg2+
-free PBS. The cells were then filtered through a 40-μm nylon mesh. Cell sorting was
performed with a FACS EPICS ALTRA (Beckman Coulter, Inc., CA, USA). For sorting
Purkinje cells, cells were passed through a 70-μm nozzle at a rate of 10 000–20 000 events/s
at first sorting. After the first sorting, the passed cells were centrifuged and resuspended.
The resuspended cells were passed at a rate of 1000 events. The sort decision was based on
the measurements of forward scatter (FSC) and GFP fluorescence. Thresholds were
optimized by comparing the percentage of Purkinje cells before and after sorting.
Profiling of genes expressed in Purkinje cells
Total RNA was extracted from the isolated cells and used as a template in the GeneChip
Mouse Genome 430 2.0 DNA microarray (Affymetrix, CA, USA). Raw image files were
processed using Affymetrix GCOS and Microarray Suite (MAS) 5.0. The MAS 5.0 software
includes a detection algorithm that uses probe pair (perfect match/mismatch) intensities to
generate a detection P-value, which is then used to determine whether a transcript is present
or absent. Intensity data from each chip were normalized to a target intensity value of 500,
and expression data and absent/present calls for individual probe sets were determined. For
the analysis in the present experiment, the default threshold for a present call was used.
Candidate genes for screening were chosen by picking genes reported as membrane or
secreted molecules, or by sorting genes using the keywords “membrane” or “extracellular
space.”
Organotypic coculture of the cerebellum and medulla oblongata
The olivo-cerebellar cocultures were prepared as described previously (7, 8). In brief, the
ventral medial portion of the medulla (containing inferior olivary neurons) was dissected
from rats on embryonic day (E)15. Cerebellar slices (250 µm thick) were dissected from the
vermis of P10 mice. A block of the medulla was plated at the ventricular side of the
cerebellar slice on a membrane filter (Millicell-CM PICMORG50, Millipore, MA, USA),
which was coated with rat-tail collagen. The culture medium consisted of 50% MEM, 25%
horse serum (STEMCELL Technologies, BC, Canada), 2.5% Hank’s balanced salts solution
(Nacalai Tesque, Kyoto, Japan), 3 mM GlutaMAX (Gibco, NY, USA), 10 µM Mifepristone
(Ru486, TOCRIS, Bristol, UK), 5 mg/ml glucose, and 2% B27 supplements (Gibco). The
cultures were maintained at 37°C in an environment of humidified 95% air and 5% CO2.
Half of the culture medium was exchanged with fresh medium every other day.
Preparation of viral vector constructs
Virus vectors were constructed as previously described (7). Briefly, the vectors were
designed to express GFP, microRNA (miRNA), and/or cDNA under the control of the
murine embryonic stem cell virus (MSCV) (pCL20c-MSCV) or under the control of a
truncated L7 promoter (pCL20c-trL7) (23). The cDNA for Sema3A, Sema7A, PlxnA4, or
ItgB1 was obtained by RT-PCR of a cDNA library from P10 mouse cerebellum or medulla.
The cDNA for PlxnC1 was purchased from Origene (MD, USA). Each cDNA was
subcloned into pCL20c-trL7 or pCL20c-MSCV. The BLOCK-iT Pol II miR RNAi
expression vector kit (Invitrogen, CA, USA) was used for vector-based RNA interference
(RNAi) analysis. The following engineered microRNAs were designed according to the
BLOCK-iT Pol II miR RNAi Expression Vector kit guidelines (Invitrogen):
5'-TGCTGTATAGGTGCAGATTGGATGGAGTTTTGGCCACTGACTGACTCCATCCA
CTGCACCTATA-3' and
5'-CCTGTATAGGTGCAGTGGATGGAGTCAGTCAGTGGCCAAAACTCCATCCAATC
TGCACCTATAC-3' for Sem3A-microRNA;
5'-TGCTGAATACACGCAGACAGCTGAGTGTTTTGGCCACTGACTGACACTCAGC
TCTGCGTGTATT-3' and
5'-CCTGAATACACGCAGAGCTGAGTGTCAGTCAGTGGCCAAAACACTCAGCTGT
CTGCGTGTATTC-3' for Sema7A-microRNA;
5'-TGCTGAATCCAAGTTTCCAGATATGCGTTTTGGCCACTGACTGACGCATATCTA
AACTTGGATT-3' and
5'-CCTGAATCCAAGTTTAGATATGCGTCAGTCAGTGGCCAAAACGCATATCTGGA
AACTTGGATTC-3' for ItgB1-microRNA;
5'-TGCTGATAAACAGACGTCAGGTCAGAGTTTTGGCCACTGACTGACTCTGACCT
CGTCTGTTTAT-3' and
5'-CCTGATAAACAGACGAGGTCAGAGTCAGTCAGTGGCCAAAACTCTGACCTGA
CGTCTGTTTATC-3' for PlxnC1-microRNA;
5'-TGCTGAAAGGAAGGCTTCTGAGACAGGTTTTGGCCACTGACTGACCTGTCTC
AAGCCTTCCTTT-3' and
5'-CCTGAAAGGAAGGCTTGAGACAGGTCAGTCAGTGGCCAAAACCTGTCTCAG
AAGCCTTCCTTTC-3' for PlxnA4-microRNA;
5'-TGCTGTCAACTTGTAGACACGATTGAGTTTTGGCCACTGACTGACTCAATCGT
CTACAAGTTGA-3' and
5'-CCTGTCAACTTGTAGACGATTGAGTCAGTCAGTGGCCAAAACTCAATCGTGTC
TACAAGTTGAC-3' for PlxnA2-microRNA;
5'-TGCTGTTACATTGTAGCCCAGAGACCGTTTTGGCCACTGACTGACGGTCTCTG
CTACAATGTAA-3' and
5'-CCTGTTACATTGTAGCAGAGACCGTCAGTCAGTGGCCAAAACGGTCTCTGGG
CTACAATGTAAC-3' for FAK-microRNA. These oligonucleotides were subcloned into a
pCL20c-trL7 vector or into a pCL20c-MSCV vector. The QuikChange Lightning
site-directed mutagenesis kit (Agilent Technologies, CA, USA) was used to generate
RNAi-resistant forms of Sema3A, Sema7A, PlxnA4, PlxnC1, and ItgB1 (Sema3A-rescue,
Sema7A-rescue, PlxnA4-rescue, PlxnC1-rescue and ItgB1-rescue), which harbor sense
mutations (no alteration of amino acid codons) and constitutively active cofilin
(cofilin-CA). Sema3A-rescue, Sema7A-rescue, PlxnA4-rescue, PlxnC1-rescue,
ItgB1-rescue, FAK-rescue, or cofilin-CA were either linked in-frame to mOrange2
interposed by a picornavirus “self-cleaving” P2A peptide sequence to enable efficient
bicistronic expression, or fused to a FLAG tag, and then subcloned into pCL20c-trL7 or
pCL20c-MSCV. Scrambled control miRNA for PlxnC1, ItgB1, or PlxnA4 was designed by
shuffling the recognition region sequences. A BLAST search confirmed that the scrambled
sequences had no target gene. All constructs were verified by DNA sequencing.
Virus preparation and infection
The detailed procedure for viral vector production has been described previously (7, 8). For
in vitro virus infection, cultured Purkinje cells were infected at 0 or 1 day in vitro (DIV) by
adding 0.5 µl (0.2–1.0 × 105 TU) of viral solution per coculture directly on the
slices. For in
vivo virus infection into the cerebellum, 4–5 μl (4–5 × 105 TU) of viral solution were
injected into the cerebellar vermis of C57BL/6 mice at P1–P2. For in vivo virus infection
into the inferior olivary neurons, 1–2 µl (1–2 × 105 TU) of viral solution were injected into
the ventral medial portion of the medulla at P0–P2.
Electrophysiological recordings from Purkinje cell in cocultures
To obtain electrophysiological recordings from Purkinje cells in coculture, most of the
medullary explant was cut from the coculture to reduce responses elicited by spontaneous
firing of inferior olivary neurons. The culture preparations were recovered for at least 30
min at room temperature by incubation in a reservoir chamber bathed in a solution of 125
mM NaCl, 2.5 mM KCl, 2 mM CaCl2, 1 mM MgSO4, 1.25 mM NaH2PO4, 26 mM
NaHCO3, and 20 mM glucose bubbled with 95% O2 and 5% CO2. The preparations were
transferred to a recording chamber located on the stage of an Olympus BX51WI
microscope. The recording chamber was continuously perfused with oxygenated bath
solution supplemented with picrotoxin (TOCRIS; 0.1 mM) to block inhibitory synaptic
transmission. Whole-cell recordings were made from visually identified or fluorescent
protein-positive Purkinje cells using upright and fluorescence microscopes at 32°C. The
resistance of the patch pipettes was 1.5–2.5 MΩ when filled with an intracellular solution
comprising 60 mM CsCl, 10 mM Cs D-gluconate, 20 mM TEA-Cl, 20 mM BAPTA, 4 mM
MgCl2, 4 mM ATP, and 30 mM HEPES (pH 7.3, adjusted with CsOH). The pipette access
resistance was compensated by 70%. The holding potential for recording climbing
fiber-mediated excitatory postsynaptic currents (CF-EPSCs) was -30 mV (corrected for the
liquid junction potential). The climbing fiber innervation pattern was examined after 15–18
days by taking whole-cell recordings in knockdown and uninfected control Purkinje cells in
the same coculture. To activate climbing fibers, four tungsten electrodes (3.5–4.5 MΩ,
Catalog #UEWMGCSEKNNM, FHC, Maine, USA) were placed in the remaining portions
of the medullary explants. Single or multiple steps of CF-EPSCs were elicited in a given
Purkinje cell when the intensity of stimulation in the medullary explant was increased
gradually. The number of climbing fibers innervating the recorded Purkinje cell was
estimated based on the number of discrete CF-EPSC steps elicited in that Purkinje cell (12).
Electrophysiological recordings from Purkinje cells in acute cerebellar slices
Parasagittal cerebellar slices (250 μm) were prepared from mice (12) from P6 to P60. The
bathing and intracellular solutions were the same as those used for recording coculture
preparations. The recording chamber was continuously perfused with oxygenated bath
solution supplemented with picrotoxin (0.1 mM). The holding potential for recording
CF-EPSCs was -20 mV and that for recording EPSCs induced by parallel fiber stimulation
was -80 mV (corrected for the liquid junction potential). To record CF-EPSCs, stimuli
(duration, 0.1 ms; amplitude, 0–30 µA) were applied at 0.2 Hz. Climbing fibers were
stimulated in the granule cell layer 20–100 μm from the Purkinje cell soma. The number of
climbing fibers innervating the recorded Purkinje cell was estimated according to the
number of discrete CF-EPSC steps (12). To examine the effects of knocking down PlxnA4,
PlxnC1, or ItgB1 in climbing fibers, Purkinje cells were sampled at locations in which
virus-infected climbing fibers were rich (GFP-positive regions) and from locations in which
transfected climbing fibers were absent (GFP-negative regions). Climbing fiber innervation
patterns were compared between GFP-positive and GFP-negative regions in the same
slices.
Immunohistochemistry
Mice were placed under deep pentobarbital anesthesia (100 μg/g of body weight,
intraperitoneal injection), perfused with 4% paraformaldehyde in 0.1 M phosphate buffer,
and then processed to obtain parasagittal microsliced sections (100 μm in thickness). After
permeabilization and blockade of nonspecific binding, the following antibodies were
applied overnight at 4°C: a mouse monoclonal antibody against calbindin D-28K (diluted
1:3,000, Sigma, St. Louis, MO) to visualize Purkinje cells; an antibody against guinea pig
vesicular glutamate transporter VGluT2 (1:200, Frontier Institute, Hokkaido, Japan), to
label climbing fiber terminals; an antibody against rabbit glutamate receptor δ2 (GluD2)
(1:200, Frontier Institute, Hokkaido, Japan); an antibody against rabbit metabotropic
glutamate receptor 1 (mGluR1) (1:200, Frontier Institute, Hokkaido, Japan); an antibody
against goat Sema3A (1:100, Santa Cruz, CA, USA); or an antibody against GFP (1:1000,
Nacalai Tesque, Kyoto, Japan). After incubation with secondary antibodies (an anti-rat
Alexa Fluor 488 antibody or an anti-mouse Cy5 antibody, Jackson; 1:300; or an anti-rabbit
Cy3 antibody, Jackson; 1:300), the immunolabeled sections were washed and then
examined under a confocal laser scanning microscope (FV10i and FV1200, Olympus).
Evaluation of knockdown efficacy
HEK 293T cells in a 24-well dish were transfected with an RNAi knockdown vector
(Sema3A-knockdown, Sema7A-knockdown, PlxnA4-knockdown or ItgB1-knockdown)
and mOrange2-fused cDNA (Sema3A-mOrange, Sema7A-mOrange, PlxnA4-mOrange or
ItgB1-FLAG) using X-tremeGENE 9 reagents. One day later, the cells were observed under
a confocal laser scanning microscope (LSM 510, Zeiss). For PlxnC1, the RNAi knockdown
vector (PlxnC1-knockdown) and PlxnC1 cDNA were transfected into HEK 293T cells. One
day later, the cells were fixed. After permeabilization, blocking, and application of primary
(rabbit anti-PlxnC1, rabbit anti-DsRed, or mouse anti-FLAG) and secondary (donkey
anti-rabbit Cy3; Jackson; 1:300, or donkey anti-mouse Cy3, Jackson; 1:300) antibodies, the
fluorescence signals were examined under a confocal laser scanning microscope (LSM 510,
Zeiss).
In situ hybridization
Mouse cDNA fragments of Sema3A (nucleotides 502–2369; GenBank accession number
NM_001243072), Sema7A (8–2017, NM_011352), PlxnA4 (1376–2965, NM_175750.3),
PlxnA2 (556–2496, NM_008882.2), PlxnC1 (316–1304, NM_018797), ItgB1 (528–2188,
NM_010578), VGluT2 (934–2060; BC038375), and 67 kDa-glutamic acid decarboxylase
(GAD67; 1036–2015; NM_008077) were used. Digoxigenin (DIG)- or fluorescein-labeled
cRNA probes were prepared for simultaneous detection of multiple mRNAs by fluorescence
in situ hybridization (24). In brief, fresh frozen sections were hybridized with a mixture of
DIG- or fluorescein-labeled cRNA probes. After a stringent posthybridization wash, DIG and
fluorescein were detected using a two-step method as follows: the first detection was
performed using a peroxidase-conjugated anti-fluorescein antibody (Invitrogen) plus the
FITC-TSA plus amplification kit (PerkinElmer, MA, USA); the second detection was
performed with a peroxidase-conjugated anti-DIG antibody (Roche Diagnostics, Mannheim,
Germany) and the Cy3-TSA plus amplification kit (PerkinElmer). TOTO3 (Invitrogen) was
used for fluorescent nuclear counterstaining.
In utero electroporation
For experiments involving double knockdown of Sema3A or Sena7A in Purkinje cells and
of PlxnA4, PlxnC1 or ItgB1 in climbing fibers (Fig. 4 G to L), miRNA for Sema3A- or
Sema7A-knockdown was introduced into Purkinje cells using in utero electroporation (25,
26). Briefly, pregnant mice at embryonic day (E)11.5 or E12.5 were deeply anesthetized with
an intraperitoneal injection of sodium pentobarbital (Somnopentil; Kyoritsu Seiyaku Co.,
Tokyo, Japan). Electric pulses (40–50 V for 50 ms, five times at 950 ms intervals) were
delivered via forceps-shaped electrodes (CUY650P2 or CUY650P3, Unique Medical Imada,
Aichi, Japan) connected to an electroporator (CUY21, Nepa Gene, Chiba, Japan). Plasmids
were dissolved in water. The plasmid vector, pCL20c-trL7, was used to knockdown the
expression of Sema3A and Sema7A in Purkinje cells.
Protein preparation and expression analysis
Cerebella from wild-type and mGluR1 knockout mice (P14) were lysed in TNE buffer (1%
(w/v) Nonidet P-40, 50 mM Tris-Cl (pH 7.5), 100 mM NaCl, 5 mM EDTA, 0.2 mM
Na3VO4), the lysates resolved by sodium dodecyl sulfate polyacrylamide gel
electrophoresis, and the proteins transferred to polyvinylidene difluoride membranes
(Bio-Rad, CA, USA). The membranes were blocked with 3% bovine serum albumin
(Fraction V) and 0.1% Tween-20 in Tris-buffered saline for 10 min and blotted with the
appropriate primary antibodies, followed by the appropriate secondary antibodies. The
following commercially available antibodies were used: anti-mGluR1 (Frontier Institute,
Hokkaido, Japan), anti-semaphorin 7A (R&D Systems Inc., MN, USA), anti-tubulin (Cell
Signaling, MA, USA), anti-rabbit-IgG-AP (Santa Cruz, TX, USA), anti-mouse-IgG-AP
(Santa Cruz), anti-rabbit-IgG-HRP (GE Healthcare, NJ, USA), and anti-mouse-IgG-HRP
(GE Healthcare). Horseradish peroxidase-Renaissance Plus Reagent (Perkin-Elmer, MA,
USA) or CDP-star (Roche, Mannheim, Germany) were used to visualize the
immunoreactive proteins. Data acquisition and analysis were performed using LAS 4000
(GE Healthcare).
Surface biotinylation assay
The receptor biotinylation assay was performed using cleavable biotin, as described
previously (22). Briefly, the surface proteins expressed by cerebellar slices were
biotinylated with 1 mg/ml sulfo-NHS-SS-biotin (Pierce, IL, USA) for 20 min at 4°C. To
collect the surface proteins, the cells were lysed with lysis buffer (20 mM Tris-Cl [pH 7.5],
100 mM NaCl, 5 mM EDTA, and 1% NP-40) and the biotinylated proteins were
precipitated with NeutrAvidin resin (Pierce). Samples were subjected to immunoblotting as
described above.
Statistical analysis
Data were expressed as the mean ± SEM. The Mann–Whitney U test was used when two
independent data sets were compared (except for the immunoblotting data). Student’s t-test
was used to compare the immunoblotting data. Differences between groups were judged to
be significant when P < 0.05. For multiple comparisons, the Steel-Dwass test and two-way
ANOVA were used as indicated in the text. All statistical analyses were performed using
JMP Pro software (NC, USA).
Fig. S1. Strategy for RNA interference (RNAi) screening of retrograde signaling
molecules required for climbing fiber synapse elimination in olivo-cerebellar
cocultures.
Fig. S2. Purification of Purkinje cells from the cerebella of L7-GFP transgenic mice.
(A) Bright field and epifluorescent images of whole brain from an L7-green fluorescent
protein (GFP) transgenic mouse at P9. (B, C) Confocal micrographs of cerebellar sections
of postnatal day (P)4 (B) and P16 (C) L7-GFP transgenic mice. (D, E) Purification of
GFP-expressing Purkinje cells by cell sorting. (D) Fluorescence histograms for cerebellar
cells at first (left) and second (right) sorting. (E) A representative photomicrograph showing
Purkinje cells sorted from cerebellar cells from P9 L7-GFP transgenic mice. Note that most
cells express GFP. Scale bar, 50 µm.
Fig. S3. Efficacy of Sema3A- or Sema7A-knockdown by respective microRNA vectors.
(A) Double immunostaining for mOrange (red) and green fluorescence protein (GFP, green)
in HEK 293T cells transfected simultaneously with Sema3A-mOrange and a
GFP-expression vectors (left, “Control”), with Sema3A-mOrange and GFP-expression
vectors together with a microRNA vector against Sema3A (middle, “Sema3A-KD”), or
with an RNA interference (RNAi)-resistant Sema3A-mOrange vector and a
GFP-expression vector together with a microRNA vector against Sema3A (right,
“Sema3A-RES”). Scale bar, 30 µm. (B) Fluorescence intensity of mOrange relative to that
of GFP in control (white column, n = 8), Sema3A-KD (green column, n = 6), and
Sema3A-RES (light green column, n = 11) cells. (C) Similar to (A), but for
Sema7A-knockdown (Sema7A-KD) and Sema7A-rescue (Sema7A-RES). (D) Fluorescence
intensity of mOrange relative to that of GFP in control (n = 9), Sema7A-KD (orange
column, n = 7), and Sema7A-RES (light orange column, n = 6) cells. * P < 0.05 and ** P <
0.005 (Steel-Dwass test).
Fig. S4. Expression of mRNAs for Sema3A and Sema7A in the developing mouse
brain.
(A) Coronal sections of mouse brain showing expression of Sema3A and Sema7A mRNA
at postnatal day (P)7 and P14. SP: Fluorescent signals using a sense probe. (B–E) Triple
fluorescence in situ hybridization detecting mRNAs for Toto3 (blue, nuclei), GAD67 (green,
inhibitory neurons, including Purkinje cells) and either Sema3A (B, C) or Sema7A (D, E) in
the cerebellum at P7 (B, D) and P14 (C, E). Sema3A and Sema7A mRNAs are present in
the somata of Purkinje cells (GAD67 mRNA-positive large cells in the Purkinje cell layer)
at both P7 and P14. Arrows show the same positions in the left and right panels. EGL:
external granular layer, IGL: internal granular layer, pia: pial surface. Scale bars, 1 mm for
(A), 20 µm for (B–E).
Fig. S5. Acceleration of climbing fiber synapse elimination during postnatal
development without persistent effects in adulthood in Sema3A-knockdown Purkinje
cells.
(A–E) Frequency distribution of the number of climbing fibers innervating each Purkinje
cell in control (white columns) and Sema3A-KD (green columns) cells from postnatal day
(P)6–P7 (A, n = 21 for the controls; n = 21 for Sema3A-KD), P8–P11 (B, n = 38 for the
control; n = 37 for Sema3A-KD), P12–P14 (C, n = 55 for the controls and n = 63 for
Sema3A-KD), P15–P18 (D, n = 46 for the controls and n = 53 for Sema3A-KD), and
P21–P30 (E, n = 53 for the controls and n = 58 for Sema3A-KD). *P < 0.05 and **P <
0.005. ns indicates no significant difference (Mann–Whitney U test).
Fig. S6. Morphological evidence for the acceleration and impairment of climbing fiber
synapse elimination from somata of Purkinje cells by Sema3A-knockdown and
Sema7A-knockdown, respectively.
(A–D) Digital representation of confocal microscopic images showing immunoreactivity of
calbindin (blue, Purkinje cells), vesicular glutamate transporter VGluT2 (red, climbing
fiber terminals), and enhanced green fluorescent protein, EGFP (green) in control (A) and
Sema3A-KD (B) Purkinje cells in the same tissue slice from postnatal day (P)14 mouse
cerebellum, and in control (C) and Sema7A-KD (D) Purkinje cells in the same slice from
the cerebellum of a P21 mouse. White arrows indicate VGluT2 terminals that contact
Purkinje cells.
Fig. S7. Impairment of climbing fiber synapse elimination after P15 (with persistent
defect into adulthood) in Purkinje cells of a Sema7A-knockdown.
(A–E) Frequency distribution of the number of climbing fibers innervating each Purkinje
cell in the control (white columns) and Sema7A-KD (orange columns) during postnatal day
(P)8–P11 (A, n = 23 for the control; n = 21 for Sema7A-KD), P12–P14 (B, n = 18 for the
control; n = 22 for Sema7A-KD), P15–P18 (C, n = 38 for the control; n = 45 for
Sema7A-KD), P21–P30 (D, n = 57 for the control; n = 63 for Sema7A-KD) and P40–P60
(E, n = 32 for the control; n = 34 for Sema7A-KD). *P < 0.05, **P < 0.01, and ***P <
0.005. ns indicates no significant difference (Mann–Whitney U test).
Fig. S8. Efficacy of knocking down mGluR1 or GluD2 using microRNA vectors.
(A, B) Triple immunostaining for calbindin (blue), green fluorescent protein (GFP, green),
and metabotropic glutamate receptor 1 (mGluR1, red) in control (A) and
mGluR1-knockdown (B) Purkinje cells in the same tissue slice. (C, D) Similar to (A) and
(B), but showing staining for glutamate receptor δ2 (GluD2, red) in control (C) and
GluD2-knockdown (D) Purkinje cells in the same slice. Scale bars, 20 µm for (A–D).
Fig. S9. Effects of Sema3A- or Sema7A-knockdown on Purkinje cell synaptic
responses from parallel fibers and inhibitory interneurons.
(A, B) Representative traces (top) and the averaged input-output relationships (bottom)
between excitatory postsynaptic currents (EPSCs) induced by stimulation of parallel fibers
in control (white circles, n = 24), Sema3A-KD (green circles, n = 23), and Sema3A-RES
(light green circles, n = 12) Purkinje cells (A), and in control (n = 32) and Sema7A-KD
(orange circles, n = 20) Purkinje cells (B). The holding potential was -80 mV. Scale bars,
0.1 nA, 5 ms for (A) and 0.2 nA, 5 ms for (B). Asterisks indicate significant differences
when compared with the control (*P < 0.05, two-way ANOVA; Steel-Dwass test). (C–H)
Sample traces of miniature inhibitory postsynaptic currents (mIPSCs) (C, F) and summary
bar graphs showing the mean frequency (D, G) and amplitude (E, H) of mIPSCs for control
(white columns, n = 9) and Sema3A-KD (green columns, n = 9) cells (D, E) and for control
(n = 9) and Sema7A-KD (orange columns, n = 9) cells (E, H). Scale bars, 20 pA and 10 ms.
Fig. S10. Expression of mRNAs for PlxnA2, PlxnA4, PlxnC1, and ItgB1 in inferior
olivary neurons during postnatal development.
(A, B) Triple fluorescence in situ hybridization analysis of mRNAs for Toto3 (blue, nuclei),
the vesicular glutamate transporter VGluT2 (green, inferior olivary neurons), and PlxnA2
(top in A, red), PlxnA4 (bottom in A, red), PlxnC1 (top in B, red), or ItgB1 (bottom in B,
red) in the inferior olive at postnatal day (P)7 (top) and P14 (bottom). Signals for PlxnA2,
PlxnA4, PlxnC1, and ItgB1 mRNA are clearly present in VGluT2 mRNA-positive cells at
both P7 and P14. Arrows indicate the same positions in the left and right panels. Scale bars,
20 µm.
Fig. S11. Efficacy of PlxnA4, PlxnC1, ItgB1 or PlxnA2 knockdown using microRNA
vectors.
(A, C, E, G) HEK 293T cells were transfected with the indicated constructs and then
double immunostained with anti-GFP and anti-PlxnC1 antibodies to detect PlxnC1 (C) or
with an anti-FLAG antibody to detect PlxnA4, ItgB1, and PlxnA2 (A, E, G). Scale bars, 30
µm. (B, D, F, H) Fluorescence intensity of PlxnA4, PlxnC1, ItgB1 or PlxnA2 relative to
that of GFP in control cells (white columns, n = 13 for B; n = 17 for D; n = 17 for F; and n
= 12 for H), knockdown (KD) cells (green column, n = 11 for B; orange column, n = 13 for
D; yellow column, n = 16 for F; and blue column, n = 12 for H), cells expressing scramble
miRNAs (SCR) (light green column, n =11 for B; light orange column, n = 14 for D; and
light yellow column, n =15 for F), and cells expressing a microRNA (miRNA)-resistant
form of cDNA (RES) (deep green column, n = 12 for B; brown column, n = 14 for D; dark
yellow column, n = 9 for F). *P < 0.05, ** P < 0.01, and *** P < 0.005 (Steel-Dwass test).
Fig. S12. Gene delivery into inferior olivary neurons in vivo.
(A) Expression of enhanced green fluorescent protein (EGFP) in inferior olivary neurons at
postnatal day (P)10. Viruses expressing EGFP and one of the microRNAs (miRNAs)
against Sema3A and Sema7A receptors were injected into the ventral medial medulla of
P0–P1 mice. (B) EGFP-labeled climbing fibers in the cerebellum. Scale bars, 10 µm.
Fig. S13. Rescuing the effect of PlxnA4-knockdown, and enhanced parallel fiber to
Purkinje cell synaptic transmission by PlxnA4 knockdown.
(A) Examples of climbing fiber-mediated excitatory postsynaptic currents (CF-EPSCs) in
Purkinje cells associated with climbing fibers expressing microRNA (miRNA) for PlxnA4
together with a miRNA-resistant form of PlxnA4 (plxnA4-RES). Scale bars, 0.5 nA and 5
ms. (B) Frequency distribution of the number of climbing fibers innervating each control
(white columns, n = 26) and PlxnA4-RES (green columns, n = 25) Purkinje cells at
postnatal day (P)11–P13. ns indicates no significant difference (Mann–Whitney U test). (C)
Representative traces (top) and averaged input-output relationships (bottom) between
EPSCs induced by parallel fiber stimulation in the control (white circles, n = 28),
PlxnA4-knockdown (PlxnA4-KD, green circles, n = 11) and PlxnA4-scramble
(PlxnA4-SCR, light green circles, n = 14) Purkinje cells. The holding potential was -80 mV.
Scale bars, 0.1 nA and 5 ms.* P < 0.05, ** P < 0.01, and *** P < 0.005 (two-way ANOVA
with the Steel-Dwass test).
Fig. S14. Sema3A regulates synapse elimination through receptors located on climbing
fibers.
(A, B) Digital representation of confocal microscopic images showing immunoreactivity of
calbindin (blue, Purkinje cells), the vesicular glutamate transporter VGluT2 (red, climbing
fiber terminals), and enhanced green fluorescent protein (EGFP, green) in cerebellum tissue
with climbing fibers expressing scrambled PlxnA4 miRNA (PlxnA4-SCR) (A) or
microRNA against PlxnA4 (PlxnA4-KD) (B). White arrows indicate VGluT2 terminals that
contact Purkinje cells. (C) Frequency distribution of the number of perisomatic climbing
fiber terminals in Purkinje cells from PlxnA4-SCR (white columns, n = 38) and
PlxnA4-KD (green columns, n = 32) mice at postnatal days (P)14–P15. * P < 0.05
(Mann–Whitney U test).
Fig. S15. Knocking down PlxnA2 in climbing fibers has no effect on synapse
elimination.
(A) Examples of climbing fiber-mediated excitatory postsynaptic currents in Purkinje cells
associated with climbing fibers expressing microRNA against PlxnA2 (PlxnA2-KD) and by
cells from regions in which transfected climbing fibers were absent (Control). Scale bars,
0.5 nA and 5 ms. (B) Frequency distribution of the number of climbing fibers innervating
each control (white columns, n = 36) and PlxnA2-KD (red columns, n = 29) Purkinje cell at
postnatal day (P)12–P15. ns indicates no significant difference (Mann–Whitney U test).
Fig. S16. Rescue of the effect of PlxnC1- or ItgB1-knockdown by co-expression of
microRNA-resistant PlxnC1 or ItgB1, respectively.
(A, B) Examples of climbing fiber-mediated excitatory postsynaptic currents in Purkinje
cells associated with climbing fibers expressing a microRNA (miRNA)-resistant form of
PlxnC1 together with a miRNA against PlxnC1 (plxnC1-RES) (A), and with climbing
fibers expressing a miRNA-resistant form of ItgB1 together with a miRNA against ItgB1
(ItgB1-RES) (B), and in Purkinje cells sampled from regions in which transfected climbing
fibers were absent (Control) (A, B). Scale bars, 0.5 nA and 5 ms. (C, D) Frequency
distribution of the number of climbing fibers innervating each control (white columns, n =
30) and PlxnC1-RES (beige columns, n = 19) Purkinje cell at postnatal day (P)21–P30 (C),
and in control (n = 20) and ItgB1-RES (yellow columns, n = 19) (D) Purkinje cells. ns
indicates no significant difference (Mann–Whitney U test).
Fig. S17. Sema7A regulates synapse elimination through receptors located on climbing
fibers.
(A–D) Digital representation of confocal microscopic images showing immunoreactivity of
calbindin (blue, Purkinje cells), the vesicular glutamate transporter VGluT2 (red, climbing
fiber terminals), and enhanced green fluorescent protein (EGFP) in cerebellum tissue with
climbing fibers expressing scrambled PlxnC1 microRNA (miRNA) (PlxnC1-SCR) (A),
miRNA against PlxnC1 (PlxnC1-KD) (B), scrambled ItgB1 miRNA (ItgB1-SCR) (C), or
miRNA against ItgB1 (ItgB1-KD) (D). White arrows in (B) and (D) indicate VGluT2
signals on Purkinje cell somata with GFP-labeled climbing fibers. (E, F) Frequency
distribution of the number of perisomatic climbing fiber terminals in PlxnC1-SCR (white
columns, n = 38) and PlxnC1-KD (orange columns, n = 35) Purkinje cells during postnatal
day (P)21–P22 for (E), and for ItgB1-SCR (white columns, n = 36) and ItgB1-KD (yellow
columns, n = 33) cells (F). *P < 0.05 and **P < 0.01 (Mann–Whitney U test).
Fig. S18. Double knockdown of PlxnC1 and ItgB1 in climbing fibers impairs synapse
elimination to the same extent as a single knockdown of either molecule.
(A) Examples of climbing fiber-mediated excitatory postsynaptic currents in Purkinje cells
associated with climbing fibers expressing microRNAs against PlxnC1 and ItgB1
(PlxnC1/ItgB1-DKD), and in cells sampled from regions in which transfected climbing
fibers were absent (Control). Scale bars, 0.5 nA and 5 ms. (B) Frequency distribution of the
number of climbing fibers innervating each control (white columns, n = 30), PlxnC1-KD
(orange columns, n = 45), ItgB1-KD (yellow columns, n = 42), and PlxnC1/ItgB1-DKD
(beige columns, n = 30) Purkinje cell during postnatal day (P)21–P30. The data for
PlxnC1-KD and ItgB1-KD are taken from Figure 4D and 4F, respectively. *P < 0.05. ns
indicates no significant difference (Mann–Whitney U test).
Fig. S19. Impairment of climbing fiber synapse elimination by expression of
constitutively active cofilin in climbing fibers.
(A) Sample climbing fiber-mediated excitatory postsynaptic currents in Purkinje cells
associated with climbing fibers expressing constitutively active cofilin (CA-cofilin) and in
cells sampled from regions in which the transfected climbing fibers were absent (Control).
Scale bars, 0.5 nA and 5 ms. (B) Frequency distribution of the number of climbing fibers
innervating each Purkinje cell for the control (white columns, n = 49) and for CA-cofilin
(pink columns, n = 21) during postnatal day (P)21–P30. *P < 0.05 (Mann–Whitney U test).
Fig. S20. Impairment of climbing fiber synapse elimination by knockdown of focal
adhesion kinase (FAK) in climbing fibers.
(A) Knockdown efficacy of FAK. HEK 293T cells were transfected with the indicated
constructs and then double immunostained with an anti-GFP antibody and an anti-FLAG
antibody. Scale bar, 30 µm. (B) Fluorescence intensity of FAK relative to that of GFP in
control cells (white column), knockdown cells (purple column), and cells expressing a
microRNA (miRNA)-resistant form of cDNA (light purple column). ***P < 0.005
(Steel-Dwass test). (C) Example of climbing fiber-mediated excitatory postsynaptic
currents in Purkinje cells associated with climbing fibers expressing miRNA against FAK
(FAK-KD), a miRNA-resistant form of FAK together with a miRNA against FAK
(FAK-RES), and in Purkinje cells sampled from regions in which the transfected climbing
fibers were absent (Control). Scale bars, 0.5 nA and 5 ms. (D) Frequency distribution of the
number of climbing fibers innervating each control (white columns, n = 31), FAK-KD
(purple columns, n = 31), and FAK-RES (light purple columns, n = 31) Purkinje cell. *P <
0.05 (Mann–Whitney U test).
Fig. S21. Cofilin and focal adhesion kinase (FAK) mediate climbing fiber synapse
elimination downstream of PlxnC1 and ItgB1, respectively.
(A, C) Examples of climbing fiber-mediated excitatory postsynaptic currents in Purkinje
cells associated with climbing fibers expressing constitutively active cofilin together with a
microRNA (miRNA) against PlxnC1 (CA-cofilin/PlxnC1-KD), in cells sampled from
regions in which the transfected climbing fibers were absent (Control) (A). Examples of
climbing fiber-mediated excitatory postsynaptic currents in Purkinje cells associated with
climbing fibers expressing miRNAs against FAK and ItgB1 (FAK/ItgB1-DKD), and in
cells sampled from regions in which the transfected climbing fibers were absent (Control)
(C). Scale bars, 0.5 nA and 5 ms. (B, D) Frequency distribution of climbing fibers
innervating each control (white columns, n = 35), CA-cofilin (pink columns, n = 21), and
CA-cofilin/PlxnC1-KD (wine red columns, n = 20) Purkinje cell (B), and each control (n =
37), FAK-KD (nile blue columns, n = 31), and FAK/ItgB1-DKD (iron blue columns, n =
22) Purkinje cell (D) during postnatal day (P)19–P30. The data for CA-cofilin and
FAK-KD presented in Figure S19B and S20D are also used here. *P < 0.05. ns indicates no
significant differences (Mann–Whitney U test).
Fig. S22. Summary of the effects of Sema3A and Sema7A on climbing fiber synapse
elimination.
Previous studies demonstrate that the early phase requires P/Q-type voltage-gated Ca2+
channels (P/Q-VGCC) and GABAergic inhibition (2). The late phase depends on
GABAergic inhibition (and (presumably) also on P/Q-VGCC) (8), and on neural activity
along mossy fibers-to-parallel fibers, which drives metabotropic glutamate receptor 1
(mGluR1) signaling in Purkinje cells (2). The present results suggest that
Sema3A-to-PlxnA4 signaling maintains the synapses of weaker climbing fibers and
strengthens/maintains the synapses of the strongest climbing fibers during both the early
and late phases of climbing fiber elimination. By contrast, Sema7A-to-PlxnC1/ItgB1
signaling facilitates selective elimination of synapses from weaker climbing fibers during
the late phase of climbing fiber elimination. This process is controlled by mGluR1
signaling, which is activated by neural activity. The model presented here shows that
elimination of the weaker climbing fibers maintained by Sema3A-to-PlxnA4 signaling
depends on P/Q-VGCC, GABAergic inhibition, and mGluR1-to-Sema7A-to-PlxnC1/ItgB1
signaling.
Table S1. Expression of mRNAs for Sema3A and Sema7A
Levels of Sema3A (A) and Sema7A (B) mRNA expression in the cerebellum during
postnatal development from postnatal day (P)4–P18. Data are derived from the DNA
microarray analysis shown in Fig. S2. The expression levels of Sema3A and Sema7A were
normalized to that of an internal standard: glyceraldehyde-3-phosphate dehydrogenase
(GAPDH, top) or -actin (ACTB, bottom).
Table S2. Kinetics of CF-EPSCs for Sema3A-knockdown and PlxnA4-knockdown.
(A) Total amplitudes and disparity ratios for climbing fiber-mediated excitatory
postsynaptic currents (CF-EPSCs) in individual Sema3A-knockdown (postnatal day
(P)11–15 and P21–P30) and PlxnA4-knockdown (P11–15) Purkinje cells in vivo. The total
amplitude is lower in Sema3A-knockdown and PlxnA4-knockdown Purkinje cells than in
control Purkinje cells. There was no difference in the disparity ratio between control and
knockdown Purkinje cells. Disparity ratio = (A1/AN+ A2/AN+…..+ AN-1/AN)/(N-1); (N > 1).
Ai is the EPSC amplitude for the climbing fiber i, and N is the number of climbing fibers
for a given Purkinje cell. (B) Kinetics and paired-pulse ratio of the CF-EPSCs from
Sema3A-knockdown and PlxnA4-knockdown Purkinje cells in vivo. CF-EPSCs were
divided into three groups: CF-EPSCs from mono-innervated Purkinje cells (CF-mono), the
largest CF-EPSCs from individual multiply-innervated Purkinje cells (CF-multi-S), and
other (smaller) CF-EPSCs from individual multiply-innervated Purkinje cells (CF-multi-W).
Amplitudes are measured at a holding potential of -20 mV. Data are expressed as the mean
± SEM. P-values were determined by the Mann–Whitney U test (compared with values for
the corresponding controls). *P < 0.05 and **P < 0.01.
Table S3. Kinetics of CF-EPSCs for Sema7A-knockdown, PlxnC1-knockdown, and
ItgB1-knockdown.
(A) Total amplitudes and disparity ratios for climbing fiber-mediated excitatory
postsynaptic currents (CF-EPSCs) in individual Purkinje cells (holding potential, -20 mV)
for Sema7A-knockdown, PlxnC1-knockdown, and ItgB1-knockdown in vivo. There was no
difference in the total amplitude and disparity ratio between control and knockdown
Purkinje cells. (B) Kinetics and paired-pulse ratios of CF-EPSCs from Sema7A-knockdown,
PlxnC1-knockdown, and ItgB1-knockdown Purkinje cells in vivo. P-values were
determined by the Mann–Whitney U test (compared with values for the corresponding
controls). Amplitudes were measured at a holding potential of -20 mV. Data are expressed
as the mean ± SEM.
References and Notes
1. M. Kano, K. Hashimoto, Synapse elimination in the central nervous system. Curr. Opin.
Neurobiol. 19, 154–161 (2009). Medline doi:10.1016/j.conb.2009.05.002
2. M. Watanabe, M. Kano, Climbing fiber synapse elimination in cerebellar Purkinje cells. Eur.
J. Neurosci. 34, 1697–1710 (2011). Medline doi:10.1111/j.1460-9568.2011.07894.x
3. J. W. Lichtman, H. Colman, Synapse elimination and indelible memory. Neuron 25, 269–278
(2000). Medline doi:10.1016/S0896-6273(00)80893-4
4. M. Kano, K. Hashimoto, C. Chen, A. Abeliovich, A. Aiba, H. Kurihara, M. Watanabe, Y.
Inoue, S. Tonegawa, Impaired synapse elimination during cerebellar development in
PKC γ mutant mice. Cell 83, 1223–1231 (1995). Medline doi:10.1016/0092-
8674(95)90147-7
5. M. Kano, K. Hashimoto, H. Kurihara, M. Watanabe, Y. Inoue, A. Aiba, S. Tonegawa,
Persistent multiple climbing fiber innervation of cerebellar Purkinje cells in mice lacking
mGluR1. Neuron 18, 71–79 (1997). Medline doi:10.1016/S0896-6273(01)80047-7
6. F. Crepel, Regression of functional synapses in the immature mammalian cerebellunm. Trends
Neurosci. 5, 266–269 (1982). doi:10.1016/0166-2236(82)90168-0
7. N. Uesaka, T. Mikuni, K. Hashimoto, H. Hirai, K. Sakimura, M. Kano, Organotypic coculture
preparation for the study of developmental synapse elimination in mammalian brain. J.
Neurosci. 32, 11657–11670 (2012). Medline doi:10.1523/JNEUROSCI.1097-12.2012
8. T. Mikuni, N. Uesaka, H. Okuno, H. Hirai, K. Deisseroth, H. Bito, M. Kano, Arc/Arg3.1 is a
postsynaptic mediator of activity-dependent synapse elimination in the developing
cerebellum. Neuron 78, 1024–1035 (2013). Medline doi:10.1016/j.neuron.2013.04.036
9. K. Hashimoto, M. Tsujita, T. Miyazaki, K. Kitamura, M. Yamazaki, H. S. Shin, M. Watanabe,
K. Sakimura, M. Kano, Postsynaptic P/Q-type Ca2+
channel in Purkinje cell mediates
synaptic competition and elimination in developing cerebellum. Proc. Natl. Acad. Sci.
U.S.A. 108, 9987–9992 (2011). Medline doi:10.1073/pnas.1101488108
10. K. Hashimoto, R. Ichikawa, K. Kitamura, M. Watanabe, M. Kano, Translocation of a
“winner” climbing fiber to the Purkinje cell dendrite and subsequent elimination of
“losers” from the soma in developing cerebellum. Neuron 63, 106–118 (2009). Medline
doi:10.1016/j.neuron.2009.06.008
11. F. Crepel, N. Delhaye-Bouchaud, J. L. Dupont, Fate of the multiple innervation of cerebellar
Purkinje cells by climbing fibers in immature control, x-irradiated and hypothyroid rats.
Brain Res. 227, 59–71 (1981). Medline doi:10.1016/0165-3806(81)90094-8
12. K. Hashimoto, M. Kano, Functional differentiation of multiple climbing fiber inputs during
synapse elimination in the developing cerebellum. Neuron 38, 785–796 (2003). Medline
doi:10.1016/S0896-6273(03)00298-8
13. S. Kakizawa, M. Yamasaki, M. Watanabe, M. Kano, Critical period for activity-dependent
synapse elimination in developing cerebellum. J. Neurosci. 20, 4954–4961 (2000).
Medline
14. K. Hashimoto, R. Ichikawa, H. Takechi, Y. Inoue, A. Aiba, K. Sakimura, M. Mishina, T.
Hashikawa, A. Konnerth, M. Watanabe, M. Kano, Roles of glutamate receptor δ2 subunit
(GluRδ2) and metabotropic glutamate receptor subtype 1 (mGluR1) in climbing fiber
synapse elimination during postnatal cerebellar development. J. Neurosci. 21, 9701–9712
(2001). Medline
15. T. Miyazaki, K. Hashimoto, H. S. Shin, M. Kano, M. Watanabe, P/Q-type Ca2+
channel α1A
regulates synaptic competition on developing cerebellar Purkinje cells. J. Neurosci. 24,
1734–1743 (2004). Medline doi:10.1523/JNEUROSCI.4208-03.2004
16. R. J. Pasterkamp, Getting neural circuits into shape with semaphorins. Nat. Rev. Neurosci.
13, 605–618 (2012). Medline doi:10.1038/nrn3302
17. R. J. Pasterkamp, J. J. Peschon, M. K. Spriggs, A. L. Kolodkin, Semaphorin 7A promotes
axon outgrowth through integrins and MAPKs. Nature 424, 398–405 (2003). Medline
doi:10.1038/nature01790
18. G. A. Scott, L. A. McClelland, A. F. Fricke, A. Fender, Plexin C1, a receptor for semaphorin
7a, inactivates cofilin and is a potential tumor suppressor for melanoma progression. J.
Invest. Dermatol. 129, 954–963 (2009). Medline doi:10.1038/jid.2008.329
19. H. Hirai, T. Torashima, Japanese Patent 4975733 (2012).
20. J. Oberdick, R. J. Smeyne, J. R. Mann, S. Zackson, J. I. Morgan, A promoter that drives
transgene expression in cerebellar Purkinje and retinal bipolar neurons. Science 248,
223–226 (1990). Medline doi:10.1126/science.2109351
21. M. Tomomura, D. S. Rice, J. I. Morgan, M. Yuzaki, Purification of Purkinje cells by
fluorescence-activated cell sorting from transgenic mice that express green fluorescent
protein. Eur. J. Neurosci. 14, 57–63 (2001). Medline doi:10.1046/j.0953-
816x.2001.01624.x
22. K. W. Roche, S. Standley, J. McCallum, C. Dune Ly, M. D. Ehlers, R. J. Wenthold,
Molecular determinants of NMDA receptor internalization. Nat. Neurosci. 4, 794–802
(2001). Medline doi:10.1038/90498
23. Y. Sawada, G. Kajiwara, A. Iizuka, K. Takayama, A. N. Shuvaev, C. Koyama, H. Hirai,
High transgene expression by lentiviral vectors causes maldevelopment of Purkinje cells
in vivo. Cerebellum 9, 291–302 (2010). Medline doi:10.1007/s12311-010-0161-1
24. M. Yamasaki, M. Matsui, M. Watanabe, Preferential localization of muscarinic M1 receptor
on dendritic shaft and spine of cortical pyramidal cells and its anatomical evidence for
volume transmission. J. Neurosci. 30, 4408–4418 (2010). Medline
doi:10.1523/JNEUROSCI.5719-09.2010
25. Y. Kita, K. Kawakami, Y. Takahashi, F. Murakami, Development of cerebellar neurons and
glias revealed by in utero electroporation: Golgi-like labeling of cerebellar neurons and
glias. PLOS ONE 8, e70091 (2013). Medline doi:10.1371/journal.pone.0070091
26. J. Nishiyama, Y. Hayashi, T. Nomura, E. Miura, W. Kakegawa, M. Yuzaki, Selective and
regulated gene expression in murine Purkinje cells by in utero electroporation. Eur. J.
Neurosci. 36, 2867–2876 (2012). Medline doi:10.1111/j.1460-9568.2012.08203.x