Click here to load reader

03 joris veltman

  • View
    710

  • Download
    3

Embed Size (px)

DESCRIPTION

Op dinsdag 22 juni 2010 was er REshape UnConference X Pecha Kucha. Op 12 oktober 2010 is de tweede editie. Kijk op www.reshapehealthcare.eu.

Text of 03 joris veltman

  • 1. Joris Veltman
    (onderzoeker)
  • 2. Personalized genomic medicine
    Joris Veltman
    [email protected]
    www.genomicdisorders.nl
  • 3. Het probleem; Ineffectieve medicijnen!
  • 4. 1953
  • 5. Het humane genoom
    receptenboek voor leven
    6 miljard bouwstenen
    2001
  • 6.
  • 7. NIJMEGEN INTERNATIONALE EXPERT ERFELIJKE ZIEKTEN
    VCAN
    CFH
    CHM
    USH2Aisob
    RPGRIP1
    TECTA
    NDP
    EHMT1
    EYS
    MYCN
    FXYD2
    DFNB59
    TSPAN12
    ABCA4
    CDH7
    ESRRB
    P63
    LARGE
    PDE6C
    SETBP1
    RPGRIP1L
    OFD1
    17Q21
    LRTOMT
    TKS4
    IKAROS
    MAOA
    SS18/SSX
    CEP290
    SENP1/MESDC2
    ZNF674
    CNTNAP2
    GRXCR1
    TET2
    CRB1
    PRPS1
    TBX4
    RPGR
    TRPN
    L1/L2
    LCA5
    ROR2
    EPCAM
    COL4A3
  • 8. Complexiteit genonderzoek beperkt klinische impact!
    Fout in bouwstenen DNA ? OF Fout in aantal chromosomen?
  • 9. Genomics wordt spotgoedkoop!
    Kosten in kaart brengen 1 genoom
  • 10. Genoomdiagnostiek in 2015
    DNA
    ?
    Genoomsequentie
    < 1 uur
    < 500 euro
  • 11. Nijmegen investeert in genoomsequencing
    Roche, GS FLX Titanium
    Since 11-2008
    Life Technologies, SOLiD
    Since 9-2009
  • 12. Van sequentie tot genoom:Veel puzzelwerk
    Miljoenen korte sequenties per individu
    Supercomputers en
    Bioinformatica expertise!
    Totale genoomsequentie 1 individu
  • 13. ACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAGTCGA
    ATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCACA
    CGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGA
    TCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGCGGGGCAAACGCACCG
    GCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCCAACCAC
    GCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAATCGATCGATCGA
    ATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCGCGCTCG
    CTAGCTAGCTAGCTACGATACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTACGATCG
    GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGTCGT
    CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCACTCGCTA
    CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCAGCTAGCTAGCTC
    CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAAGCT
    GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACGC
    GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACACT
    CACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATTCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGAC
    GCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCACT
    GCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAATCGATCGCG
    ATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCGCGCTCGGCT
    CTAGCTAGCTAGCTACGATACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGA
    GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGGAC
    CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCATCG
    CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCATC
    CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACGA
    GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAATC
    GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCCAC
    CACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATTCGCGCGGGGGCAAACGCACCAACCACCACAGCGGGGGCAAAGGGGCCAA
    GCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAATCGATCGAAACGCAC
    ATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCGCGCTCGGTGC
    CTAGCTAGCTAGCTACGATACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGAT
    GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACG
    CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCAAGC
    CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCATTAGCTA
    CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAAACG
    GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACCC
    GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACTCGA
    CACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGAT TCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCCAACT
    GCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCT
    GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGTCGT
    CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCACTCGCTA
    CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCAGCTAGCTAGCTC
    CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAAGCT
    GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACGC
    GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACACT
  • 14. NRC 13 feb 2010
  • 15. Personal genomics en impact op geneeskunde
  • 16. Waarom reageren mensen verschillend op medicijnen?Oftewel: Hoe verschillend zijn ze nu echt?
    5,999 miljard
    overeenkomsten
    1 miljoen
    verschillen
  • 17.
  • 18. Wie ben ik en wat zijn mijn gezondheidsrisocos?
    Hoe zit het bij mij?
  • 19.
  • 20. Een ander probleem; Recessieve ziekten
    Kans op
    dragerschap
    1: 1000
    Kans op
    dragerschap
    1: 1000
    Indien beide drager
    Dan kans van 1 op 4!
    Kans op ziekte
    1: 4,000,000
  • 21. Personalizedmedicine and the role of genomics
    PERSONALIZED GENOMIC MEDICINE
    DE TOEKOMST VAN DE GENEESKUNDE!
  • 22. THANK YOU !
  • 23. NEXT

Search related