Chuyển hóa acid nucleic

  • View
    542

  • Download
    7

Embed Size (px)

Text of Chuyển hóa acid nucleic

  • Trao i trc tuyn ti:

    http://www.mientayvn.com/Y_online.html

  • CHUYEN HOA ACID NUCLEIC

  • #MUC TIEU1. Viet c s o chi tiet cua s thoai hoa base purin

    2. Neu c cac bc trong qua trnh tong hp purin va pyrimidin nucleotid

    3. Neu c cac chi tiet ve benh gut

    4. Mo ta c s tong hp ADN hay s nhan oi ADN

    5. Mo ta c s tong hp ARN hay s chuyen ma

    6. Phan biet c s khac biet gia s chuyen ma te bao nhan s va s chuyen ma te bao nhan thc.

  • #NI DUNG1.THOI HA ACID NUCLEIC

    i cng v thoi ha acid nucleic Thoi ha nucleotid purin Thoi ha nucleotid pyrimidin

    2.TNG HP ACID NUCLEIC

    Tng hp nucleotid purin Tng hp nucleotid pyrimidin Tng hp DNA Tng hp ARN

  • #

  • #

  • #

  • #

  • #

  • #1. THOAI HOA ACID NUCLEIC1.1. S o tong quat

    Acid nucleic (ADN, ARN)H2O Nuclease

    NucleotidPvc Nucleotidase

    NucleosidNucleosidase

    Base N + Pentose

  • #Base N + Pentose

    Purin Pyrimidin

    Acid uric NH3 , CO2

    Ure

  • #1.2. Thoai hoa base purin

    nucleosidase Xanthin oxidase

    2 loi phn ng ch yu: kh amin thu phn v oxy ho

    ADA deficiency

    (ADA)

  • #H

    Xanthin oxidase

    Xanthin

    oxidase

  • #

  • #NgiChim Acid uric NT

    Mot so bo sat San pham

    thoai hoa cuoi cungMot so bo sat khac

    a so V co vu AlantoinNhuyen the

    Uricase

  • # Sn phm thoi ha cui cng ca purin khc nhau gia cc

    loi.

    a s cc loi V c v, acid uric c chuyn thnh

    allantoin tan trong nc nh uricase.

    ngi, thiu uricase nn sn phm cui cng ca thoi

    ha purin l acid uric.

  • #Bnh thng:-Acid uric/mau 3 6 mg%-Acid uric /NT 500-800 mg/ 24 gi

    Benh gut (goutte, gout, thong phong): Acid uric/mau : >10mg% 15-20mg% Co tinh the Natri Urat sun, xng ac biet la cac khp Viem khp cap

    Soi ng tieu.

  • #

  • #1.3.Thoai hoa base PyrimidinChu yeu gan

  • #

  • #

  • #-Aminoisobutyrate l tin

    cht to thnh Succinyl-CoA

    CoA

  • #2.TONG HP ACID NUCLEIC

    Nguyen lieu:H3PO4: t thc anRibose: t con ng HMP---->Ribose-5- PBase N: c the tong hp.

    Hai con ng :

    Con ng tng hp mi (de novo pathway) : t nhng tincht chuyn ha (acid amin, ribose 5-P, CO2, NH3 )

    Con ng tn dng (salvage pathway) : ti s dng base nitv nucleosid t do gii phng t qu trnh thoi ha acidnucleic.

  • #2.1.Tong hp Purin va Purin NucleotidPurin nucleotid : AMP, IMP,GMP.

    T base PurinQua 2 con ng

    T Ribose-5- P

    Deoxyribonucleotid c to thnh t ribonucleotid nh s kh oxy

  • #Hai con ng tng hp purin nucleotid

  • #

  • #3 giai on:

    G 1: Tng hp PRPP t ribose-5-P

    G 2: Tri qua nhiu p to thnh IMP

    G 3: To thnh AMP v GMP t IMP

    TH purin nucleotid t ribose 5-phosphat

  • #GIAI ON 1 :To thnh 5-phosphoribosyl-1-pyrophosphate(PRPP)

    5-phosphoribosyl 1 Pyrophosphate

  • #GIAI ON 2 : To thnh IMP t PRPP

  • #GIAI ON 3 : To thnh AMP v GMP t IMP

    Adenine ribose-P

    Guanine ribose-P

  • # Gm 3 c ch c chngc (c ch enzym) 3 G

    G3 :

    IMP AMP cn c GTPIMP GMP cn c ATP s tng hp 2nucleotid ny c khuynhhng cn bng.

    1

    2

    3

    IU HA TNG HP PURIN NUCLEOTID

  • #HGPRT

    TH purin nucleotid t vic ti s dng base nit v nucleosid t do

    Allopurinol allopurinol ribonucleotid bt hot (*)

    Trong HC Lesch-Nyhan: hot tnh HGPRT gim (*) khng xy ra, nn allopurinol khng c tc dng.

    PRPP

    HGPRT

  • #BNH GT NGUYN PHT

    PRPP synthase tng hot tnh hoc HGPRT khim khuyt:

    tng to purin nucleotid tng acid uric/mu

  • #Dung pp ong v vi 14C va 15N xac nh c nguon goc cac nguyen t trong nhan Purin:

  • #2.2. Tong hp Pyrimidin va Pyrimidin nucleotid2 giai oan:

  • #dUMP

    dTMP

  • #

  • #d

    1

    2

    Megaloblastic anemia: do thiu CTP, TMP, UTP gim sn xut HCiu tr bng Uridin

  • #IU HA TNG HP

    PYRIMIDIN NUCLEOTID1

    2

    CTP c ch ngc enzym aspartate transcarbam

    oylase.

    CTP c ch aspartate transcarbamoylase (hnh bn)UMP c ch CAP synthaseTTP khng c vai tr trong c ch ngc trn s tng hp pyrimidin

  • #Nhiu thuc dng trong iu tr (ho tr K) tc dng ln enzym ca qu trnh tng hp nucleotid

  • #Nguon goc cac phan t tren Pyrimidin:

  • #

  • #1

    3

    4

    6

  • #2.3. Tong hp cac deoxyribonucleotidkh oxy C2

    Ribonucleotid Deoxyribonucleotid Qua trnh khac nhau cac loai:*E.coli:

    NDP dNDP

    *Lactobacillus:NTP dNTP

    *Tong hp cac dNTP t dNDP:dNDP dNTP

    ATP ADP

  • #KH RIBONUCLEOTID THNH DEOXYRIBONUCLEOTID

    Kh nhm 2-hydroxyl ca ribonucleotid diP

    Phc hp enzym ribonucleotid reductase

  • #S tao thanh cac Nucleosid di va triphosphat:Bng p phosphoryl ha

  • #2.4. Tong hp ADN2.4.1.S nhan oi ban bao ton- Mo hnh: cau truc xoan oi- Watson va Crick: gia thuyet ve c che ban

    bao ton cua s tong hp ADN.

  • #

  • #2.4.2.Cau truc chac ba cua ADN (replication fork)

  • #

  • #2.4.3.Qua trnh nhan oi ADNt nhat 20 enzym va yeu to Protein tham gia

    he thong Replicase (Replisom) hoat ong vi toc o rat nhanh va rat chnh xac:

    Tien chat: 4 loai dNTP

    Bo may nhan oi

  • #Qua trnh nhan oi ADN, 5 giai oan:1. Nhan biet iem m au va thao xoan tach

    biet 2 si ADN me (he thong Replicase)

    2 loai protein chnh tham gia qua trnh nay:

    ADN helicase, tach ri hai si

    Protein gan ADN si n (single strand DNA binding protein hay SSB protein), gi cho 2 si ADN n trang thai ri nhau va on nh

  • #

  • #

  • #2. Tao ARN moi nh primasePrimase ket hp ADN helicase tao primosom

    3.Tong hp hai si ADN mi nh ADN polymerase (ADN Polymerase III)-si dan,

    -si sau oan Okazaki

    4. Loai ARN moi nh ADN polymerase I. Sau o cac oan ADN mi tiep tuc c keo dai.

    5. Noi nhng oan ADN mi nh ADN ligase

  • #

  • #

  • #2.4.4. Sa cha ADN :E.coli, t le sai sot 1/109 1010 nucleotid.Nh ADN polymerase I va III co the lui lai

    tach va loai bo nucleotid sai, gan nucleotid ung.

    ARN polymerase khong co tac dung t sa cha.

    S nhan oi ADN tb nhan that va tb nhan s eu tng t nh nhau.

  • #

  • #2.5.Tong hp ARN (S chuyen ma)

    CCCACAGCCGCCAGTTCCGCTGCGCATTTT

    ADN-si m ha

    GGGTGTCGGCGGTCAAGGCGACGCGTAAAA

    ADN-si khun

    CCCACAGCCGCCAGUUCCGCUGCGCAUUUU

    ARN m

  • #2.5.1. tb nhan sa. Giai oan khi au:ARN polymerase: Holoenzym: 2.Enzym loi (core enzyme): 2

    Tieu n v se tm mot iem co gen khi ong

  • #

  • #S tong hp ARN khong can mot oan moi. au 5 cua nhng chuoi ARN mi eu bat au bang

    pppG hoac pppA.S tong hp ARN xay ra theo chieu 5 3, giong s

    tong hp ADN.

    b. Giai oan keo dai:

  • #ARN Polymerase khong co hoat tnh nuclease. Mc o sai sot cua s tong hp ARN la 1/104 hoac 1/105

    c. Giai oan ket thuc

  • #ieu chnh ARN: ARNm c ieu chnh rat t hoac khong can ieu

    chnh sau khi ARN c tong hp. Mot so ARN c giai ma ngay trong qua trnh chuyen ma.

    tien ARNt va tien ARNr:- b cat oan bi nuclease va c ieu chnh thanh

    nhng si ARN mi. - them mot so nucleotid vao au ARN.V du, CCA

    c them vao au 3 cua mot so phan t ARNt nao cha co san trnh t chuoi nay au.

    - thay oi ve base va ribose cua ARNr. mot so base c methyl hoa ;

    - tao base hiem ARNt

  • #

  • #2.5.2. te bao nhan that:a. S chuyen ma va giai ma phan cach nhau ve khong

    gian vathi gian Xay ra trong nhan.

    Tao ra rat nhieu ARN sau nay se thanh ARNm.

    Nhng ban sao tien phat can co mot cai chop au 5 va mot uoi polyA au 3.

    Hau het cac tien ARNm te bao co nhan that bac cao eu c qua mot qua trnh cat noi (splicing).

  • #

  • #

  • #

  • #

  • #b. ARN te bao co nhan thc c tong hp bi 3 loai ARN polymerase

    Loai V tr Ban sao I Hach nhan ARNr 18S, 5.8S va28S

    II Nhan chat tien ARNm va ARN hn

    III Nhan chat ARNt va ARNr 5S

  • #c. Nhng gen khi ong te bao nhan thc co cha mot hop TATA va co them nhng trnh t chuoi ngc dong

    -----------5 TATAAAA 3---------+1---------25

    Hop TATA

    d. Co nhng protein ac hieu c goi la nhng yeu to chuyen ma (transcription factors) tng tac vi nhng gen khi ong te bao co nhan thc

  • #e. Nhng chuoi tang cng (enhancer sequences) co the kch thch s chuyen ma cach iem khi au hang nghn base

    f. Tien ARNm c gan chop au 5 trong qua trnh chuyen ma Tien ARNm:

    - chop 7-methylguanosin au 5 - uoi polyadenylat, dai khoang 250 goc A, au 3.- khi b mat uoi polyA, no c chuyen ra khoi nhan va c dung lam khuon cho s tong hp protein.

    ARNt va ARNr : khong co chop.

  • #g. Nhng iem cat noi cua tien ARNm th c xac nh achieu bi nhng trnh t chuoi cuoi intron

    Cat loai chnh xac intron khoi tien ARNm. Trnh t chuoi cua mot intron:

    GU AG.

    Thalassemia: - do mot s cat noi sai gay nen. - hau qua: ARNm c tao ra se cha mot loat nhng mama bnh thng th khong thay hien dien.

    au 3 bnh thng cua intron

    Bnh thng5CCTATTGGTCTATTTTCCACCCTTAG