Supplementary Table 1

Family history Younger onset patients (first degree relative) ( 60 years old)

Screening stage 1583 35.50% 62.80%First replication 3099 3.62% 21.17%Second replication 1485 8.28% 21.62%

Number of cases

Supplementary Table 1

Allele Chromosome p Value(1/2) (position) 11 12 22 SUM MAF 11 12 22 SUM MAF (HWE)||

rs11003722 (A/G) No gene 10q (55064621) 204 720 659 1583 0.36 190 760 948 1898 0.30 0.040 1.29 (1.17~1.43) 1.04E-06rs7988900 (T/C) No gene 13q (97276536) 866 612 105 1583 0.26 888 831 176 1895 0.31 0.356 0.78 (0.69~0.86) 1.29E-06rs2600814 (T/C) No gene 14q (46054248) 3 191 1389 1583 0.06 14 325 1559 1898 0.09 0.511 0.65 (0.54~0.78) 1.72E-06rs10825073 (T/C) No gene 10q (55041607) 156 667 760 1583 0.31 151 679 1068 1898 0.26 0.004 1.28 (1.16~1.43) 4.39E-06rs6481026 (A/G) No gene 10q (55041794) 156 666 760 1582 0.31 151 679 1068 1898 0.26 0.004 1.28 (1.16~1.43) 4.65E-06rs4841926 (T/C) COL5A1 9q (136741106) 609 728 246 1583 0.39 576 979 343 1898 0.44 0.039 0.80 (0.73~0.88) 6.28E-06rs17589429 (T/C) CELSR1 22q (45294944) 892 592 99 1583 0.25 1194 630 73 1897 0.20 0.370 1.30 (1.15~1.45) 7.07E-06rs12412826 (A/G) APBB1IP 10p (26818612) 19 341 1223 1583 0.12 10 312 1576 1898 0.09 0.194 1.42 (1.21~1.66) 7.59E-06rs11745068 (T/G) No gene 5q (134503393) 475 757 351 1583 0.46 686 881 331 1898 0.41 0.098 1.25 (1.14~1.37) 7.83E-06rs4823839 (T/C) CELSR1 22q (45292438) 72 571 940 1583 0.23 73 547 1278 1898 0.18 0.134 1.31 (1.16~1.47) 7.97E-06rs6428571 (T/C) No gene 1p2 (90373522) 8 220 1355 1583 0.07 28 346 1524 1898 0.11 0.104 0.68 (0.57~0.80) 8.04E-06rs7095328 (T/C) No gene 10q (55055968) 139 664 780 1583 0.30 143 659 1095 1897 0.25 0.002 1.28 (1.15~1.42) 8.80E-06rs566750 (A/G) No gene 5q (134513184) 629 738 216 1583 0.37 877 831 190 1898 0.32 0.738 1.25 (1.14~1.39) 9.47E-06rs7906396 (T/C) No gene 10q (55061615) 545 755 283 1583 0.42 780 852 266 1898 0.36 0.175 1.25 (1.14~1.37) 9.62E-06rs17685664 (T/C) FER1L5 2q (96679297) 36 347 1199 1582 0.13 23 326 1549 1898 0.10 0.215 1.40 (1.21~1.63) 9.93E-06rs6983267 (T/G) No gene 8q (128482487) 593 757 233 1583 0.39 826 869 203 1898 0.34 0.252 1.25 (1.12~1.37) 1.08E-05rs3128591 (A/G) COL5A1 9q (136741940) 611 724 248 1583 0.39 580 977 341 1898 0.44 0.045 0.81 (0.74~0.89) 1.20E-05rs7078645 (A/G) No gene 10q (55065324) 549 752 281 1582 0.42 784 849 265 1898 0.36 0.150 1.25 (1.14~1.37) 1.24E-05rs1559050 (A/G) No gene 5q (134497929) 550 752 281 1583 0.42 771 873 253 1897 0.36 0.813 1.25 (1.12~1.37) 1.28E-05rs2314109 (T/C) No gene 2q (96607259) 36 345 1202 1583 0.13 23 325 1548 1896 0.10 0.207 1.40 (1.21~1.62) 1.35E-05rs7097226 (A/C) No gene 10q (55065386) 281 752 550 1583 0.42 265 849 784 1898 0.36 0.150 1.24 (1.13~1.37) 1.36E-05rs2579502 (T/C) No gene 2q (96562527) 36 345 1202 1583 0.13 23 326 1549 1898 0.10 0.215 1.40 (1.20~1.62) 1.48E-05rs11003740 (A/C) No gene 10q (55088093) 537 759 287 1583 0.42 755 882 261 1898 0.37 0.894 1.24 (1.12~1.37) 1.51E-05rs3909811 (T/G) No gene 5q (134516248) 604 733 246 1583 0.39 837 844 217 1898 0.34 0.848 1.24 (1.12~1.37) 1.59E-05rs2874568 (T/C) No gene 4q (165584384) 1093 452 38 1583 0.17 1438 426 34 1898 0.13 0.707 1.34 (1.18~1.54) 1.59E-05rs10238157 (A/G) No gene 7q (125324655) 694 690 199 1583 0.34 956 766 176 1898 0.29 0.209 1.25 (1.14~1.39) 1.60E-05rs2174919 (A/G) No gene 17q (72758874) 769 648 166 1583 0.31 780 873 245 1898 0.36 0.976 0.80 (0.72~0.88) 1.65E-05rs6753667 (A/G) No gene 2q (96524109) 1161 378 44 1583 0.15 1502 367 29 1898 0.11 0.229 1.37 (1.19~1.59) 1.75E-05rs3935335 (A/G) COL5A1 9q (136735987) 603 731 249 1583 0.39 575 971 344 1890 0.44 0.061 0.81 (0.74~0.89) 1.80E-05rs7042608 (A/G) No gene 9q (125991105) 6 196 1381 1583 0.07 20 317 1561 1898 0.09 0.387 0.68 (0.57~0.81) 1.80E-05rs12434073 (A/G) No gene 14q (45991015) 5 207 1371 1583 0.07 14 339 1545 1898 0.10 0.326 0.69 (0.58~0.82) 2.03E-05rs2158214 (T/G) No gene 7q (125319892) 461 763 359 1583 0.47 647 921 330 1898 0.42 0.942 1.23 (1.12~1.35) 2.09E-05rs9416286 (T/C) No gene 10q (55059036) 549 755 279 1583 0.41 777 857 263 1897 0.36 0.279 1.23 (1.12~1.37) 2.34E-05rs10514036 (A/G) No gene 18q (67894269) 865 620 98 1583 0.26 917 807 171 1895 0.30 0.730 0.80 (0.72~0.88) 2.48E-05rs260633 (T/C) EDAR 2q (108891962) 1061 472 49 1582 0.18 1393 467 38 1898 0.14 0.875 1.32 (1.16~1.49) 2.50E-05rs7837328 (A/G) No gene 8q (128492309) 209 750 624 1583 0.37 189 842 867 1898 0.32 0.458 1.23 (1.12~1.36) 2.79E-05

p Value‡SNP Gene OR (95% CI)†Case Control

SNPs were ranked according to their p Value in the screening stage of colorectal cancer. OR, Odds ratio; CI, confidence interval. ||Significance level for the departures from Hardy Weinberg equilibrium (HWE) in the control samples. †OR of minor allele from 2x2 allele frequency table. ‡p Values derived from Cochran-Armitage trend tests. Chromosomal positions are from NCBI build 36.

Supplementary Table 2 The results of screening stage analysis of colorectal cancer

Allele Chromosome Case Control p Value(1/2) (position) 11 12 22 SUM MAF 11 12 22 SUM MAF (HWE)||

rs7988900 (T/C) No gene 13q (97276536) 583 375 67 1025 0.25 888 831 176 1895 0.31 0.356 0.73 (0.65~0.82) 2.71E-07rs12412826 (A/G) APBB1IP 10p (26818612) 15 229 781 1025 0.13 10 312 1576 1898 0.09 0.194 1.52 (1.27~1.79) 2.04E-06rs3101357 (T/G) FRMD4A 10p (14159726) 435 473 117 1025 0.34 972 768 158 1898 0.29 0.717 1.32 (1.18~1.47) 2.71E-06rs11003722 (A/G) No gene 10q (55064621) 138 465 422 1025 0.36 190 760 948 1898 0.30 0.040 1.32 (1.18~1.48) 2.82E-06rs2049339 (T/G) BBX 3q (108954389) 842 174 9 1025 0.09 1673 220 5 1898 0.06 0.427 1.60 (1.32~1.96) 2.92E-06rs11847817 (T/C) No gene 14q (38089551) 548 402 75 1025 0.27 1167 645 86 1898 0.22 0.794 1.34 (1.19~1.52) 3.28E-06rs9875732 (T/C) BBX 3q (108944421) 842 174 9 1025 0.09 1671 222 5 1898 0.06 0.403 1.59 (1.30~1.92) 4.35E-06rs2614143 (A/G) FRMD4A 10p (14163465) 433 472 120 1025 0.35 964 771 163 1898 0.29 0.616 1.31 (1.16~1.47) 4.39E-06rs2158214 (T/G) No gene 7q (125319892) 285 499 241 1025 0.48 647 921 330 1898 0.42 0.942 1.29 (1.15~1.43) 5.84E-06rs4841926 (T/C) COL5A1 9q (136741106) 413 449 163 1025 0.38 576 979 343 1898 0.44 0.039 0.78 (0.70~0.87) 7.07E-06rs10238157 (A/G) No gene 7q (125324655) 439 449 137 1025 0.35 956 766 176 1898 0.29 0.209 1.31 (1.16~1.47) 7.22E-06rs5759225 (A/G) SCUBE1 22q (41970672) 607 342 76 1025 0.24 1238 596 64 1898 0.19 0.453 1.35 (1.18~1.54) 8.43E-06rs10825073 (T/C) No gene 10q (55041607) 104 435 486 1025 0.31 151 679 1068 1898 0.26 0.004 1.32 (1.17~1.48) 1.13E-05rs1403774 (T/G) BBX 3q (108962444) 23 324 678 1025 0.18 40 442 1416 1898 0.14 0.426 1.39 (1.19~1.6) 1.13E-05rs6428571 (T/C) No gene 1p (90373522) 8 128 889 1025 0.07 28 346 1524 1898 0.11 0.104 0.64 (0.52~0.78) 1.19E-05rs6481026 (A/G) No gene 10q (55041794) 104 434 486 1024 0.31 151 679 1068 1898 0.26 0.004 1.32 (1.16~1.47) 1.22E-05rs3128591 (A/G) COL5A1 9q (136741940) 413 448 164 1025 0.38 580 977 341 1898 0.44 0.045 0.78 (0.70~0.88) 1.45E-05rs6782394 (A/G) BBX 3q (108881819) 742 268 15 1025 0.15 1519 352 27 1898 0.11 0.204 1.42 (1.20~1.67) 1.64E-05rs6789529 (T/C) BBX 3q (108887391) 669 334 22 1025 0.18 1400 457 41 1898 0.14 0.607 1.37 (1.18~1.59) 1.68E-05rs7078645 (A/G) No gene 10q (55065324) 347 492 186 1025 0.42 784 849 265 1898 0.36 0.150 1.28 (1.15~1.43) 1.70E-05rs3935335 (A/G) COL5A1 9q (136735987) 410 449 166 1025 0.38 575 971 344 1890 0.44 0.061 0.79 (0.70~0.88) 1.85E-05rs7906396 (T/C) No gene 10q (55061615) 346 492 187 1025 0.42 780 852 266 1898 0.36 0.175 1.27 (1.14~1.43) 1.90E-05rs2415493 (A/G) No gene 14q (38122872) 161 536 328 1025 0.42 244 887 765 1896 0.36 0.599 1.27 (1.13~1.41) 1.99E-05rs11835096 (A/G) No gene 12q (114526338) 663 328 33 1024 0.19 1087 709 102 1898 0.24 0.327 0.75 (0.66~0.86) 2.04E-05rs4240703 (A/G) COL5A1 9q (136735749) 165 447 413 1025 0.38 339 978 581 1898 0.44 0.038 0.79 (0.71~0.88) 2.21E-05rs11003740 (A/C) No gene 10q (55088093) 341 493 191 1025 0.43 755 882 261 1898 0.37 0.894 1.27 (1.14~1.41) 2.26E-05rs10511753 (A/G) No gene 9p (25276650) 14 221 790 1025 0.12 26 275 1597 1898 0.09 0.005 1.47 (1.23~1.75) 2.33E-05

p Value‡SNP Gene OR (95% CI)†

SNPs were ranked according to their p Value in the screening stage of colon cancer. OR, Odds ratio; CI, confidence interval. ||Significance level for the departures from Hardy Weinberg equilibrium (HWE) in the control samples. †OR of minor allele from 2x2 allele frequency table. ‡ p Values derived from Cochran-Armitage trend tests. Chromosomal positions are from NCBI build 36.

Supplementary Table 3 The results of screening stage analysis of colon cancer

Allele Chromosome Case Control p Value(1/2) (position) 11 12 22 SUM MAF 11 12 22 SUM MAF (HWE)||

rs6789529 (T/C) BBX 3q (108887391) 248 152 10 410 0.21 1400 457 41 1898 0.14 0.607 1.61 (1.33~1.96) 9.32E-07rs11785575 (A/G) No gene 8p (37280959) 38 167 205 410 0.30 87 655 1156 1898 0.22 0.636 1.51 (1.27~1.78) 1.66E-06rs6782394 (A/G) BBX 3q (108881819) 280 124 6 410 0.17 1519 352 27 1898 0.11 0.204 1.67 (1.35~2.04) 2.14E-06rs1403774 (T/G) BBX 3q (108962444) 9 147 254 410 0.20 40 442 1416 1898 0.14 0.426 1.58 (1.30~1.92) 3.09E-06rs6779452 (A/G) BBX 3q (108881301) 10 148 252 410 0.20 40 455 1403 1898 0.14 0.663 1.57 (1.30~1.90) 3.34E-06rs2049339 (T/G) BBX 3q (108954389) 327 80 3 410 0.10 1673 220 5 1898 0.06 0.427 1.82 (1.41~2.38) 4.26E-06rs1996041 (A/G) No gene 12p (28649901) 42 211 157 410 0.36 371 949 578 1898 0.45 0.600 0.70 (0.60~0.82) 5.28E-06rs9875732 (T/C) BBX 3q (108944421) 327 80 3 410 0.10 1671 222 5 1898 0.06 0.403 1.79 (1.39~2.33) 5.83E-06rs4729566 (A/G) ZKSCAN1 7q (99452249) 190 169 51 410 0.33 649 918 331 1898 0.42 0.837 0.69 (0.59~0.81) 6.83E-06rs9848674 (A/C) BBX 3q (108884573) 274 130 6 410 0.17 1489 378 31 1898 0.12 0.218 1.59 (1.30~1.96) 7.58E-06rs1888871 (A/G) No gene 9p (32876639) 42 198 170 410 0.34 131 756 1011 1898 0.27 0.520 1.43 (1.22~1.68) 9.88E-06rs2163059 (A/G) XDH 2p (31456638) 114 209 87 410 0.47 716 906 276 1898 0.38 0.698 1.41 (1.20~1.64) 9.99E-06rs9809990 (A/G) MDS1 3q (170354088) 51 198 161 410 0.37 150 797 950 1897 0.29 0.337 1.42 (1.21~1.66) 1.17E-05rs234460 (A/G) No gene 14q (96919715) 174 179 57 410 0.36 993 749 156 1898 0.28 0.379 1.43 (1.22~1.69) 1.23E-05rs7988900 (T/C) No gene 13q (97276536) 243 141 26 410 0.24 888 831 176 1895 0.31 0.356 0.68 (0.57~0.81) 1.24E-05rs4790657 (T/G) FLJ42461 17p (4455025) 66 212 132 410 0.42 475 956 467 1898 0.50 0.747 0.72 (0.62~0.83) 1.57E-05rs11710737 (A/G) BBX 3q (108946860) 259 142 9 410 0.20 1419 438 41 1898 0.14 0.296 1.54 (1.25~1.85) 2.04E-05rs10238157 (A/G) No gene 7q (125324655) 161 194 55 410 0.37 956 766 176 1898 0.29 0.209 1.41 (1.20~1.64) 2.28E-05rs10450689 (T/C) No gene 12p (28685330) 142 217 49 408 0.39 547 927 423 1897 0.47 0.421 0.71 (0.61~0.83) 2.29E-05rs4949290 (A/G) LAPTM5 1p (30976447) 23 173 214 410 0.27 75 613 1210 1898 0.20 0.810 1.45 (1.22~1.72) 2.36E-05

p Value‡SNP Gene OR (95% CI)†

SNPs were ranked according to their p Value in the screening stage of proximal colon cancer. OR, Odds ratio; CI, confidence interval. ||Significance level for the departures from Hardy Weinberg equilibrium (HWE) in the control samples. †OR of minor allele from 2x2 allele frequency table. ‡ p Values derived from Cochran-Armitage trend tests. Chromosomal positions are from NCBI build 36.

Supplementary Table 4 The results of screening stage analysis of proximal colon cancer

Allele Chromosome p Value(1/2) (position) 11 12 22 SUM MAF 11 12 22 SUM MAF (HWE)||

rs7758229 (T/G) SLC22A3 6q (160760242) 53 232 292 577 0.29 97 641 1156 1894 0.22 0.506 1.46 (1.26~1.70) 5.58E-07rs1427667 (T/C) No gene 2q (218602372) 406 157 16 579 0.16 1511 362 25 1898 0.11 0.531 1.61 (1.33~1.92) 7.57E-07rs2039645 (A/G) TRPM3 9q (72642107) 34 202 343 579 0.23 55 544 1299 1898 0.17 0.830 1.46 (1.24~1.71) 3.52E-06rs3101357 (T/G) FRMD4A 10p (14159726) 237 271 71 579 0.36 972 768 158 1898 0.29 0.717 1.39 (1.20~1.59) 4.25E-06rs2275242 (T/C) TRPM3 9q (72637875) 34 202 343 579 0.23 55 546 1297 1898 0.17 0.787 1.46 (1.24~1.71) 4.30E-06rs12412826 (A/G) APBB1IP 10p (26818612) 8 137 434 579 0.13 10 312 1576 1898 0.09 0.194 1.59 (1.30~1.95) 5.71E-06rs2614143 (A/G) FRMD4A 10p (14163465) 237 269 73 579 0.36 964 771 163 1898 0.29 0.616 1.37 (1.19~1.59) 7.96E-06rs10262428 (T/G) No gene 7q (80408078) 114 274 191 579 0.57 475 977 446 1898 0.49 0.195 1.35 (1.18~1.54) 8.97E-06rs10975258 (A/C) KIAA1432 9p (5709116) 305 220 54 579 0.28 1159 643 96 1898 0.22 0.578 1.40 (1.20~1.64) 1.18E-05rs7580997 (T/C) No gene 2q (218591431) 422 144 13 579 0.15 1538 339 21 1898 0.10 0.633 1.54 (1.27~1.89) 1.24E-05rs4841926 (T/C) COL5A1 9q (136741106) 235 262 82 579 0.37 576 979 343 1898 0.44 0.039 0.75 (0.65~0.85) 1.52E-05rs11745068 (T/G) No gene 5q (134503393) 156 291 132 579 0.48 686 881 331 1898 0.41 0.098 1.35 (1.18~1.54) 1.55E-05rs2457571 (T/C) SLC22A3 6q (160754818) 78 288 213 579 0.38 197 801 895 1893 0.32 0.371 1.35 (1.18~1.55) 1.91E-05rs888934 (A/G) No gene 5q (169856310) 9 125 445 579 0.12 53 562 1283 1898 0.18 0.361 0.60 (0.54~0.80) 2.11E-05rs9364554 (T/C) SLC22A3 6q (160753654) 78 287 214 579 0.38 197 800 897 1894 0.32 0.348 1.35 (1.17~1.54) 2.17E-05rs5759225 (A/G) SCUBE1 22q (41970672) 338 194 47 579 0.25 1238 596 64 1898 0.19 0.453 1.41 (1.20~1.64) 2.20E-05rs3128591 (A/G) COL5A1 9q (136741940) 235 262 82 579 0.37 580 977 341 1898 0.44 0.045 0.75 (0.65~0.86) 2.35E-05rs3935335 (A/G) COL5A1 9q (136735987) 234 262 83 579 0.37 575 971 344 1890 0.44 0.061 0.75 (0.65~0.85) 2.38E-05

p Value‡ OR (95% CI)†SNP Case ControlGene

Supplementary Table 5 The results of screening stage analysis of distal colon cancer

SNPs were ranked according to their p Value in the screening stage of distal colon cancer. OR, Odds ratio; CI, confidence interval. ||Significance level for the departures from Hardy Weinberg equilibrium (HWE) in the control samples. †OR of minor allele from 2x2 allele frequency table. ‡p Values derived from Cochran-Armitage trend tests. Chromosomal positions are from NCBI build 36.

Allele Chromosome Case Control p Value(1/2) (position) 11 12 22 SUM MAF 11 12 22 SUM MAF (HWE)||

rs6942273 (A/G) CDKAL1 6p (21333556) 239 215 43 497 0.30 744 867 287 1898 0.38 0.189 0.71 (0.61~0.83) 9.52E-06rs10792847 (A/G) C11orf73 11q (85731067) 28 140 329 497 0.20 125 757 1016 1898 0.27 0.313 0.68 (0.57~0.81) 1.09E-05rs17697705 (A/G) No gene 16q (64460451) 151 234 112 497 0.54 393 965 540 1898 0.46 0.316 1.37 (1.19~1.57) 1.14E-05rs2908866 (C/T) No gene 16q (47608882) 16 168 312 496 0.20 32 491 1375 1898 0.15 0.115 1.47 (1.23~1.76) 1.41E-05rs901779 (A/G) GUCY1A2 11q (106162073) 29 205 263 497 0.26 78 611 1209 1898 0.20 0.942 1.42 (1.21~1.67) 1.77E-05rs3847009 (A/G) No gene 7p (33117706) 236 213 48 497 0.31 730 873 295 1898 0.39 0.205 0.72 (0.62~0.83) 1.91E-05rs7837328 (A/G) No gene 8q (128492309) 73 244 180 497 0.39 189 842 867 1898 0.32 0.458 1.36 (1.18~1.58) 2.13E-05rs2054129 (C/T) No gene 4p (34723412) 370 115 12 497 0.14 1572 300 26 1898 0.09 0.008 1.59 (1.28~1.96) 2.26E-05rs10142229 (C/T) TDRD9 14q (103534562) 1 56 440 497 0.06 24 341 1532 1897 0.10 0.311 0.54 (0.41~0.72) 2.45E-05

p Value‡SNP Gene OR (95% CI)†

Supplementary Table 6 The results of screening stage analysis of rectal cancer

SNPs were ranked according to their p Value in the screening stage of rectal cancer. OR, Odds ratio; CI, confidence interval. ||

Significance level for the departures from Hardy Weinberg equilibrium (HWE) in the control samples. †OR of minor allele from 2x2 allele frequency table. ‡p Values derived from Cochran-Armitage trend tests. Chromosomal positions are from NCBI build 36.

Allele Case Control(1/2) 11 12 22 SUM MAF 11 12 22 SUM MAF

novel v1 (A/G) 160689757 1908 6 0 1914 0.00 1809 7 0 1816 0.00 0.81 (0.27-2.44) 7.09E-01rs668871 (T/C) 160689801 149 738 1027 1914 0.27 163 766 886 1815 0.30 0.86 (0.78-0.95) 4.11E-03rs9346816 (A/G) 160702652 233 781 901 1915 0.33 244 779 794 1817 0.35 0.90 (0.82-0.99) 4.11E-02rs1018234 (T/C) 160716048 248 852 816 1916 0.35 282 866 668 1816 0.39 0.84 (0.76-0.92) 2.00E-04rs884742 (A/C) 160727422 730 903 280 1913 0.38 600 883 335 1818 0.43 0.83 (0.76-0.91) 8.71E-05novel v2 (T/C) 160748108 0 39 1876 1915 0.01 0 42 1776 1818 0.01 0.88 (0.57-1.36) 5.66E-01rs7745775 (T/G) 160753458 1046 740 130 1916 0.26 1002 694 121 1817 0.26 0.98 (0.89-1.09) 7.38E-01rs9364554 (T/C) 160753654 232 896 788 1916 0.35 190 765 861 1816 0.32 1.19 (1.09-1.32) 2.92E-04rs2457571 (T/C) 160754818 208 865 843 1916 0.33 189 768 859 1816 0.32 1.09 (0.99-1.2) 8.42E-02rs7758229 (T/G) 160760242 145 738 1032 1915 0.27 93 615 1108 1816 0.22 1.30 (1.17-1.44) 1.96E-06rs3123636 (T/C) 160762527 1033 738 145 1916 0.27 1108 615 93 1816 0.22 1.30 (1.16-1.45) 2.09E-06rs4708867 (A/G) 160762715 1371 501 43 1915 0.15 1324 449 44 1817 0.15 0.96 (0.84-1.09) 5.08E-01rs2665357 (A/C) 160768157 354 929 631 1914 0.43 405 907 506 1818 0.47 0.84 (0.76-0.91) 1.14E-04rs3106164 (T/C) 160770263 184 813 919 1916 0.31 138 691 988 1817 0.27 1.23 (1.11-1.36) 6.82E-05rs4709432 (A/G) 160773919 1102 703 111 1916 0.24 1014 695 108 1817 0.25 0.95 (0.85-1.05) 3.49E-01rs8187725 (T/C) 160778144 0 0 1915 1915 0.00 0 1 1816 1817 0.00 -- 3.05E-01novel v3 (T/C) 160783877 0 18 1896 1914 0.00 0 12 1805 1817 0.00 1.43 (0.69-2.96) 3.38E-01rs1810126 (T/C) 160792141 457 979 478 1914 0.49 406 919 491 1816 0.48 1.07 (0.98-1.18) 1.18E-01rs3088442 (A/G) 160792642 456 981 476 1913 0.49 400 912 499 1811 0.47 1.09 (1.00-1.20) 5.42E-02rs1050898 (T/C) 160792727 0 0 1912 1912 0.00 0 1 1816 1817 0.00 -- 3.05E-01rs2076828 (C/G) 160792776 457 979 477 1913 0.49 404 912 496 1812 0.47 1.08 (0.99-1.19) 7.94E-02rs41267803 (A/C) 160792998 0 1 1913 1914 0.00 0 1 1817 1818 0.00 0.95 (0.06-15.19) 9.71E-01

p Value‡SNP Position OR (95% CI)†

Supplementary Table 7 SNPs mapping to SLC22A3 along with p Value obtained from Cochran-Armitage trend tests

OR, Odds ratio; CI, confidence interval. †OR of minor allele from 2x2 allele frequency table. ‡p Values derived from Cochran-Armitage trend tests. Chromosomal positions are from NCBI build 36.

Forward primers Reverse primersexon1 CGGCGGAGTAAAGAGAGG CTGGGAGCCAGCATCGexon2 CCTTTGCAGTTATTTAAACAAAGGAT CATAAAACATTTTTCTCCCCGTAexon3 ATTTTCCCATTGTGTTGAAGAAA ACATGAGGAAGAGGAAGGTTGAexon4 GTGGAAGCCTCCGTATCTGA TTTCATTTTCATGTCTGTTTGGAexon5 CCCCATCCATTATAACCTTGC CAACAAAATCAATTCACCAGCTTexon6 TGAAAGCCCCTAGTCACTTCAG CGCTTGTGAACCTGTAGCAAexon7 TCCCTTCCTTCAAATCAGCTT TGATTCCATTGCACATTTCCexon8 GGAGGCCACTAAGCAAATACT TGAGCTAAGGAAACGACTTCAexon9 CTTCACACTTCCTTTGGTTTTT TTGGCTCTCAAAACTGAAATAGTexon10 ATTGATCTGGGATGCAGAGG CCCTGTGGATATTCAATTTTCTexon11 TGGGTTTTCATGAATGTATTTGA GATGTAGCTGAAATGCACACG

Supplementary Table 9 List of primers used for SNP discovery

List of optimal primer sequences as designed with Primer3.

OR, Odds ratio; CI, confidence interval. †OR of minor allele from 2x2 allele frequency table. ‡p Values derived from Cochran-Armitage trend tests. || Minor allele frequency of control samples in the screening stage. ¶ Minor allele frequency of healthy control samples in the screening stage. Chromosomal positions are from NCBI build 36.

Supplementary Table 8 The results of previously reported loci in screening stage Allele Chromosome(1/2) (position) OR (95% CI)† p Value‡ MAF|| OR (95% CI)† p Value‡ MAF¶

rs6983267 (T/G) No gene 8q (128482487) 1.25 (1.12~1.37) 1.08E-05 0.34 1.18 (1.04-1.33) 7.55E-03 0.35rs10795668 (A/G) No gene 10p (8741225) 0.90 (0.81~0.99) 2.47E-02 0.41 0.93 (0.83-1.05) 2.26E-01 0.40rs3802842 (A/C) No gene 11q (110676919) 1.06 (0.96~1.18) 2.31E-01 0.34 1.03 (0.91-1.16) 6.48E-01 0.35rs4444235 (T/C) BMP4 14q (53480669) 0.95 (0.86~1.05) 3.22E-01 0.40 0.95 (0.84-1.07) 3.79E-01 0.40rs4779584 (T/C) No gene 15q (30782048) 1.03 (0.91~1.18) 6.07E-01 0.17 1.06 (0.91-1.23) 4.75E-01 0.17rs9929218 (A/G) CDH1 16q (67378447) 1.01 (0.89~1.14) 8.99E-01 0.17 1.04 (0.89-1.21) 6.54E-01 0.17rs4939827 (T/C) SMAD7 18q (44707461) 1.25 (1.12~1.40) 9.54E-05 0.20 1.28 (1.11-1.48) 5.01E-04 0.20rs10411210 (T/C) RHPN2 19q (38224140) 0.93 (0.81~1.06) 2.78E-01 0.15 0.90 (0.76-1.05) 1.93E-01 0.16rs961253 (A/C) No gene 20p (6352281) 1.05 (0.90~1.21) 5.33E-01 0.11 1.02 (0.86-1.23) 7.93E-01 0.12

Screening stage (Number of Cont: 904)Screening stage (Number of Cont: 1898)SNP Gene

Allele(1/2) 11 12 22 11 12 22

Screening stage 84 375 564 97 641 1156 1.28 (1.13~1.45) 1.49E-04First replication 108 582 926 96 603 1077 1.14 (1.02~1.27) 2.71E-02Second replication 60 323 471 33 295 490 1.24 (1.05~1.45) 8.44E-03Meta-analysis|| 1.21 (1.12~1.30) 7.40E-07 0.37

Gene StageCase Control

OR (95%CI)† p Value‡ p Heterogeneity§

rs7758229 (T/G) SLC22A3

SNP

OR, Odds ratio; CI, confidence interval. † OR of minor allele from 2 x 2 allele frequency table. ‡ p Values derived from Cochran-Armitage trend tests. § Result of Breslow-Day test. || Meta-analysis of all three studies. Odds ratio and p Values for independence test were calculated by Mantel-Haenzel method.

Supplementary Table 10 Results of replication studies and meta-analysis for colon cancer in Japanese

Allele(1/2) 11 12 22 11 12 22

Screening stage 113 570 897 97 641 1156 1.19 (1.07-1.33) 2.39E-03First replication 195 1119 1782 96 603 1077 1.12 (1.01-1.23) 2.78E-02Second replication 108 532 845 33 295 490 1.19 (1.03-1.37) 1.88E-02Meta-analysis|| 1.16 (1.08-1.23) 1.31E-05 0.64

OR (95%CI)† p Value‡ p Heterogeneity§

rs7758229 (T/G) SLC22A3

SNP Gene StageCase Control

OR, Odds ratio; CI, confidence interval. † OR of minor allele from 2 x 2 allele frequency table. ‡ p Values derived from Cochran-Armitage trend tests. § Result of Breslow-Day test. || Meta-analysis of all three studies. Odds ratio and p Values for independence test were calculated by Mantel-Haenzel method.

Supplementary Table 11 Results of replication studies and meta-analysis for colorectal cancer in Japanese