29
김진수 서울대학교 화학부 기초과학연구원 유전체교정 연구단 CRISPR 유전자 가위로 세상을 바꾼다

CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

  • Upload
    others

  • View
    2

  • Download
    0

Embed Size (px)

Citation preview

Page 1: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

1

김진수

서울대학교 화학부

기초과학연구원 유전체교정 연구단

CRISPR 유전자 가위로 세상을 바꾼다

Page 2: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

2

• 유전자의 차이가 개체의 차이를 대부분 설명함

• 유전자에 따라 질병에 대한 감수성이 달라짐

유전적 다양성

Page 3: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

3

유전질환: Genetic Disorders

• 혈우병, 겸상 적혈구증 등 10,000 종이 있음

• 전체 신생아의 1%가 유전질환자임

• 소아과 진료의 40%에 해당

• 대부분 완치 불가능

• 돌연변이 유전자를 다음 세대에 물려 줌

Page 4: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

4

정상 적혈구와 낫모양 적혈구

• 흑인 500명 중 한 명 비율로 발생하는 빈혈증

• 단일염기 변이로 인해 헤모글로빈 아미노산 한 개가 바뀜

• 낫모양 적혈구 형성, 기능 상실

Page 5: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

5

유전체 교정: Genome Editing

• 유전자가위를 사용해 세포 내 유전자 DNA를 절단함

• 절단된 DNA가 수선되는 과정에서 변이가 발생함

• 유전질환, 암, 감염성 질환의 치료법으로 개발되고 있음

• 가축, 농작물, 어류, 곤충 등에 널리 활용됨

Page 6: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

유전자가위: Programmable Nuclease

CRISPR/Cas-derived RNA-guided endonuclease (RGEN)

Page 7: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

7

Comparison of Programmable Nucleases

ZFN TALEN RGEN

Success rate ~24% >99% ~90%

Average mutation rate

<10% ~20% ~20%

Length of target site 20 to 36 bp 30 to 40 bp 23 bp

Restriction in target site

Guanine-rich Start with T and end with A

End with GG (PAM)

Design density One per ~100 bp One per every bp One per 8 bp

Off-target effects High Low Variable

Size 2 x ~2 kbp 2 x ~3 kbp 4.2 kbp + gRNA

Kim H & Kim JS, Nat. Rev. Genet. (2014)

Page 8: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

8

CRISPR

RNA-Guided ENdonuclease

Page 9: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

9

Thomson Reuters Hot Papers

Page 10: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

10

Double-Strand Break Repair

• Gene-targeting efficiency is boosted drastically by DSBs.

• DSBs also induce NHEJ, an error-prone DSB repair system.

Kim H & Kim JS, Nat. Rev. Genet. (2014)

Page 11: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

What Is Genome Editing?

• Targeted gene knockout and knock-in

• Single base change, gene correction, gene addition, gene disruption, etc.

• Targeted chromosomal rearrangements: large deletion, inversion, translocation

Page 12: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

12

CRISPR: Adaptive Immune System in Bacteria

• Clusters of Regularly Interspaced Palindromic Repeats

• CRISPR-Cas9: RNA-guided programmable nucleases

Page 13: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

RNA-Guided ENdonuclease (RGEN)

Guide RNA

GG

GG

Cas9

Page 14: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

CAATCTATGACATCAATTATTATA-CATCGGAGCCCTGCCAAAAAATCAA WTCAATCTATGACATCAATTATTATAACATCGGAGCCCTGCCAAAAAATCAA +1CAATCTATGACATCAATTATTAT--------------GCCAAAAAATCAA -13CAATCTATGACATC---------------GGAGCCCTGCCAAAAAATCAA -14CAATCTATGACAT-------------------GCCCTGCCAAAAAATCAA -18CAATCTATGACATCAATTATTAT--------------------AAATCAA -19 CAATCTATGACATC-------------------------CAAAAAATCAA -24CAATCTATGACA-------------------------------AAATCAA -30

CCR5

Indels (%) :

Guide RNA :

Purified Cas9 protein:

2.7 8.3 33 51 57

- +-+

Plasmid-free Gene Knockout in Human Cells

• Purified Cas9 protein and in vitro transcribed sgRNA are used.

• Mutation frequencies range from 1% to 98%.

+

Page 15: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

15

Gene/cell therapy targeting CCR5

• CCR5 is an essential co-receptor of HIV infection.

• CCR5 ∆32 deletion leads to resistance to HIV infection.

• Homozygote CCR5 ∆32 carriers are healthy (1% of Caucasian)

Page 16: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

16

Page 17: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

17

• T cells from HIV+ patients are treated with a programmable nuclease.

• CCR5-inactive T cells are delivered back to patients

Page 18: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

18

혈우병: The Royal Disease

• British Queen Victoria was a carrier of the hemophilia gene.

• Almost half of the severe form of hemophilia A is caused by DNA inversion.

Queen Victoria (1819-1901)

Queen Victoria and her royal family

Page 19: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

19

F8 유 전 자

F8 유전

F8 유 전 자

F8 유전

유전자가위

일반인

혈우병환자

유전자복구 (치료)

Page 20: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

20

(A) Chromosomal Flip-Flop in Human iPS Cells

Homolog 1

Homolog 2

Inversion 1

Inversion 2

Inverted clones

Pa WT #1 #2 #1 #2 #3 #3

Reverted clones WT Inv 1 Inv 2 Rev 1 Rev 2 Rev 3

Factor VIII

GAPDH

FOXA2

Sox17

Prof. Dong Wook Kim at Yonsei Univ.

• A TALEN was used to create F8 gene-inverted clones and to revert them.

Page 21: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

21

환자체세포

환자유래분화만능줄기세포

유전자교정된줄기세포

분화된세포

세포분화

유전자가위

세포역분화

검출

이식

유전병환자

줄기세포와 유전자 교정

Page 22: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

Targeted gene knockout in mice

• RNA transcripts encoding ZFNs/TALENs were injected into the embryos.

• 49 to 77% of F0 contained mutations.

Prof. Han-Woong Lee at Yonsei Univ.

Page 23: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

Naturally-occurring MSTN KO animals

• Myostatin inhibits muscle differentiation and growth.

• Animals lacking myostatin have extensive muscles.

Page 24: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

24

MSTN KO Pigs Created Using TALENs

• No naturally-occurring MSTN -/- pigs have been found.

• MSTN KO pigs may be exempted from GMO regulation.

Page 25: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

• Banana is infected by a fungus.

• Gros Michel is an old banana variety extinct in 1950’s.

• Cavendish banana will be extinct in 10~20 years.

• Genome editing can be used to make banana resistant to the fungus.

Bananageddon and Banana Save Project

Page 26: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

26

CRISPR Revolution

• Biomedical research

• Drug target discovery

• Gene and cell therapy

• Plant biotechnology

• Animal biotechnology

Page 27: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

27

유전체교정 기술과 맞춤형 아기

• 가타카 (1997): 미국 SF 영화

• 인간 생식세포 유전자 교정

• 유전자 강화된 맞춤형 아기

• 유전체 교정 기술 개발로 실현 가능성 대두

• 일부 과학자들, 모라토리움 요청

Page 28: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

Genome Engineering Center

28

Stem Cell Group

Animal Research

Group

Cell Therapy Group

Plant Research

Group

Core Group

Therapeutics

Pig genome engineering

Human Genome KO

Plant geneticsPlant biotechnology

Center for Genome Engineering

Page 29: CRISPR 유전자가위로세상을바꾼다kstam.kofst.or.kr/file/2015/sym01.pdf · 2019-06-10 · 7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99%

29

Acknowledgments

Dr. Seokjoong Kim, ToolGen, Inc.

Dr. Eunji Kim, ToolGen, Inc.

Prof. Cheol-Hee Kim, Chungnam Nat. Univ.

Prof. Dong Wook Kim, Yonsei Univ.

Prof. Han-Woong Lee, Yonsei Univ.

Prof. Narry Kim, Seoul National Unv.

Prof. Xi Jun Yin, Yanbian Univ.

Prof. Hyongbum Kim, Hanyang Univ.

Prof. Emery Bresnick, Univ. of Wisconsin

Prof. Jae Jung, Univ. of Southern California

Home page: http://cge.ibs.re.krE-mail: [email protected]