Development of standardized specimens with known concentrations for severe acute respiratory syndrome coronavirus 2 Realtime-RT-PCR testing validation

Authors:

Phan Trong Lan1*, Hoang Quoc Cuong1*, Hoang Thuy Linh3, Nguyen Trung Hieu2,

Nguyen Hoang Anh2, Tran Ton3, Tran Cat Dong6, Vu Thanh Thao6, Do Thi Hong Tuoi6,

Nguyen Duc Tuan6, Huynh Thi Kim Loan2, Nguyen Thanh Long2, Cao Minh Thang2,

Nguyen Duc Hai5, Nguyen Thi Thanh Thao2

*These authors contribute equally to this work and act as co-first authors.

1 Directorial Board, Pasteur Institute in Ho Chi Minh City, Vietnam 2 Microbiology and Immunology Department, Pasteur Institute in Ho Chi Minh City, Vietnam 3 Medical Analysis Department, Pasteur Institute in Ho Chi Minh City, Vietnam 4 Medical Testing and Calibration Centers, Ho Chi Minh City Pasteur Institute, Ho Chi Minh, Vietnam 5 Planning Division, Pasteur Institute in Ho Chi Minh City, Vietnam 6 Faculty of Pharmacy, University of Medicine and Pharmacy at Ho Chi Minh City, Vietnam

(Submitted: 14 April 2020 – Published online:20 April 2020)

DISCLAIMER

This paper was submitted to the Bulletin of the World Health Organization and was posted to the COVID-19 open site, according to the protocol for public health emergencies for international concern as described in Vasee Moorthy et al. (http://dx.doi.org/10.2471/BLT.20.251561). The information herein is available for unrestricted use, distribution and reproduction in any medium, provided that the original work is properly cited as indicated by the Creative Commons Attribution 3.0 Intergovernmental Organizations licence (CC BY IGO 3.0).

RECOMMENDED CITATION

Lan PT, Cuong HQ, Linh HT, Hieu NT, Anh NH, Ton T, et al. Development of standardized specimens with known concentrations for severe acute respiratory syndrome coronavirus 2 Realtime-RT-PCR testing validation. [Preprint]. Bull World Health Organ. E-pub: 20 April 2020. doi: http://dx.doi.org/10.2471/BLT.20.259630 

Author for Correspondence:

CQ HOANG, MD, Ph.D., Pasteur Institute in Ho Chi Minh City, Vietnam

167 Pasteur Street, District 3, Ho Chi Minh City, Vietnam (email: cuonghqpasteur@gmail.com)

Article type: research article

Word count:

Abstract: 140 words

Main text: 2865 words

Title: 134 characters; Running head: 51 characters

Short running head: Standardized specimens for SARS-COV-2 testing validation

Abstract

Objective: To develop a procedure for creating the standard specimens of known concentrations

for validation of Realtime RT-PCR testing.

Methods: We synthesized transcribed RNA based on the GenBank in order to create the

standard curve for estimating concentration among RNA extracted from an inactivated virus in

biosafety level 3.

Findings: We found that intra-assay precision, accuracy, and linearity met the accepted criterion

with RSD less than 15%, Besides, liner regression meets the accepted R2 of 0.98. The

concentrations of transcribed RNA and RNA extracted from the inactivated virus were quite

equivalent.

Conclusion: Standardized specimens of known concentration will improve the testing capacity

and support early diagnosis of infection as well as limiting the spread of the disease. In the long-

term, the standardized specimens of known concentration are applicable for evaluation,

verification, validation, and external quality assessment.

Keywords: COVID-19, SARS-COV-2, testing, pandemic, standardized specimens, low- and middle-income countries

Introduction

Novel coronavirus belongs to the coronaviridae family caused an outbreak of pneumonia

spreading around the world leading to serve threats to public health and attracted enormous

attention [1, 2]. Therefore, early testing of severe acute respiratory syndrome coronavirus 2

(SAR-CoV-2) may be of importance for halting the spread of this disease in the community.

Most diagnostic assays being applied for the diagnosis of Covid-19 infections involve real-

time RT-PCR assay [3, 4], to some extent, are obligatory, especially in the treatment and

isolation of early-infected patients [5]. Furthermore, there is an urgent need for sensitive

diagnostic testing implementation to control and manage SARS-CoV-2 in public health

laboratories [6]. Up to now, the World Health Organization (WHO) has listed only 17

countries that had the development laboratories and protocols for detection of SARS-CoV-2

[7]. Besides, WHO endorsed nations who have no testing capacity and national Covid-19

laboratories with inadequate experiences on SARS-CoV-2 testing are stimulated to send

specimens to WHO reference laboratory for confirmation [7]. Although there are over 200

available Covid-19 tests, most of them are in house assays, a few of these tests have been

obtained emergency use authorization approval. Due to the shortage of chemical reagents

for SARS-COV-2 diagnosis and the surge of SARS-COV-2 cases [8], the development of

standardized specimens with known concentration for validation is very essential. Here, we

aim to develop a procedure for creating the standardized specimens of known concentration of

RNA from inactivated SARS-COV-2.

Methods

In vitro RNA synthesis procedure

Identify the SARS-CoV-2 virus

In this study, the sequence of SARS-CoV-2 virus was used based on the database of the NCBI

gene bank (GeneBank NC_045512.2). These sequences must ensure the coverage of the primer

and probe sequences was first announced by Corman, et.al [9].

SARS-CoV-2's E gene from nucleotide no. 26132 to 26529:

ACACAATCGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAATTTATGATG

AACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTT

ATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTT

TTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATT

GTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTT

TACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAAACGA

ACTAAATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAG.

Preparation of DNA-carrying plasmids (recombinant DNA)

The synthesized, length of the gene fragments were connected to the pJET 1.2 plasmid through

gene and vector homologous sequences using the cloning eClone system (Phu Sa Corp).

Eventually, the recombinant plasmid was transformed into Escherichia coli.

E. coli bacteria transformed was spread on LB agar plates containing 100 µg/ml ampicillin.

Gene-carried Bacteria were also selected through the characteristics of the gene carrying

plasmids. Plasmid pJET1.2 contains an enzyme gene that kills host cells, which enhances the

ability to select plasmid carrying genes. When a gene segment is inserted into the plasmid, the

lethal enzyme generation system is broken down. As a result, only bacterial cells with plasmids

carrying the inserted gene segment can form colonies. Plasmids that do not carry the inserted

gene are expressed as restriction enzymes, killing host E. coli cells after transformation.

Check the transformation process

Gene colonies are usually opaque when cultured on LB agar supplemented with 100 ug/ml of

ampicillin antibiotic. Collect these 5 colonies for PCR test with specific primers and pJET1.2.Fw

and pJET1.2.Rv primers on a pJET 1.2 plasmid. The modified vector-carrying strains were

grown on Luria-Bertani broth overnight. And recover with FavorPrep Plasmid Extraction Mini

Kit (Favorgen) according to the manufacturer's recommended procedures.

The transformation results were confirmed by genetic sequencing with specific primers and

plasmid pJET1.2 primers for all products by the Sanger sequencing technique on ABI 3130

device. The sequence needs to be synthesized to select the correct sequences to use for RNA

synthesis.

RNA synthesis in vitro

Preparation of straight-line plasmids

After overnight culture in Luria-Bertani broth with 100 µg/Ml ampicillin concentration of

100μg/ml, conduct recombinant plasmid was extracted and straight-line with 2 restriction

enzymes NotI and BspEI and follow the manufacturer's instructions.

In-vitro RNA generation

Straight-line plasmid fragments after treatment with a restriction enzyme were transcribed into

RNA by the catalysis of the enzyme T7 RNA polymerase (Thermo Fisher). The procedure

complied with the manufacturer's instructions. RNA after transcription was purified and

preserved in diethyl-pyrocarbonate water. RNA was then tested on a 1.2% agarose gel

electrophoresis system using 0.5X TBE buffer.

RNA quantity and quantity

Quantity of pure RNA product (ng/µl) was determined in triplicate on a Nanodrop (Denovix).

Based on the size, nature of the target RNA structure, the yield for each control was calculated

using the Avogadro conversion factor (6,022x1023): Number of copies = (weight (ng) x

6,022x1023)/ (length x 330 x 109).

Culture

SARS-CoV-2 virus was isolated from throat swab samples of patients with Covid-19 infection

[10]. In brief, these specimens were placed in viral transport medium and refrozen, then inoculated

into Vero E6 cell culture. Vero E6 cells were cultured in Dulbecco’s minimal essential medium

(DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and anti/anti

antibiotic [11]. On the isolation day, 50 µl serum-free DMEM was added into columns 2-12 of a

96-well culture plate. One-hundred µl clinical specimens were pipetted into column 1, and then

serially diluted 2-fold across the plate. After trypsinization, Vero E6 cells was suspended in

DMEM supplemented with 10% FBS, 200 IU/ml penicillin-streptomycin, and 5 µg/ml

amphotericin B with 2.5 x 105 cells/ml. One hundred µl of cell suspension were directly added to

the clinical swab dilutions and gently mixed by pipetting. The inoculated cultures were grown in

a humidified atmosphere of 5% CO2 at 37 °C. The cytopathic effects (CPE) were daily observed

in cells after incubation for three days. Standardized plaque assays were applied for SARS-CoV-

2 according to SARS-CoV and MERS-CoV protocols [12, 13].

Real-Time Reverse Transcription Polymerase Chain Reaction Assay for SARS-CoV-2

RNA synthesis placed into a collection tube with 150 μL of virus preservation solution. In brief,

40 μL of cell lysates were transferred into a collection tube followed by vortex for 10 seconds.

After standing at room temperature for 10 minutes, the collection tube was centrifugated at 1000

rpm/min for 5 minutes. The suspension was used for real-time reverse transcription-polymerase

chain reaction (RT-PCR) assay of 2019-nCoV RNA. The E target gene was amplified and tested

during the real-time RT-PCR assay with forward primer 5′-ACAGGTACGTTAA

TAGTTAATA GCGT-3’; reverse primer 5′-ATATTGCAGCAGTACGCACACA-3’; and the

probe 5-′FAM ACACT AGCCATCCTTACTGCGCTTCGBBQ-3′. All oligonucleotides were

synthesized and provided by Tib-Molbiol (Berlin, Germany).

Real-time RT-PCR was performed in triplicate on LightCycler® 480 System using a 2019-nCoV

nucleic acid detection kit according to the manufacturer’s protocol (TIB-Molbiol reagents).

Reaction mixture contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the

Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt,

Germany; 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulfate),

1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulfate

solution (Invitrogen) [9]. RT-PCR assay was performed under the following conditions:

incubation at 55 °C for 03 minutes and 95 °C for 30 second, 45 cycles of denaturation at 95 °C

for 03 seconds, and extending and collecting fluorescence signal at 60 °C for 12 seconds. A cycle

threshold value (Ct-value) less than 36 was defined as a positive test result, and a Ct-value of 40

or more was defined as a negative test [9].

Figure 1. The development of a liner regression

equation from artificial RNA.

Figure 2. The process of producing

standardized specimens of known

concentration based on liner regress

equation.

Analysis

Data were entered using Epi-Data version 3.1 (EpiData Association, Odense, Denmark, 2005),

and all statistical analyses were carried out using Stata version 13.0 (StataCorp, TX, 2013). The

obtained sequences were manually edited with Chromas Lite 2.1.1. (Technelysium Pty Ltd,

South Brisbane, AU).

The results were summarized using mean and standardized deviation (SD), and relative

standardized deviation (RSD) for continuous variables. Linear regression analysis was performed

to estimate the linear regression equation. In this study, the percentage of RSD for accuracy,

intermediate precision and repeatability was less than 15% [14, 15].

Create cDNA based on the publicly available 

SARS‐CoV‐2 sequences

Synthesis artificial RNA

(Optical density measurement)

Dilute artificial RNA concentration  

Estimate Cycle threshold by rRT‐PCR  

Made up Liner regression equation   

Culture SARS‐CoV‐2  Inactivated SARS‐

CoV‐2  

Dilute Inactivated SARS‐CoV‐2 concentration  

Estimate Cycle threshold by rRT‐

PCR  

Estimate copy/µL based on liner 

regression equation  Produce standard specimens

Results

Synthesis of artificial DNA

DNA fragments are synthesized in vitro by assembling single stranded oligonucleotide fragments

of 60-70 nucleotides length by the catalysis of Phusion High-Fidelity DNA Polymerase (Thermo

Fisher) using PCA technique. After assembly, product inspection was 2% gel agarose

electrophoresis. After assembly, the size of the DNA fragments was determined by

electrophoresis on 2% agarose gel, then transformed into pJET1.2 plasmid and screened the

transformation. The successfully transformed plasmid was extracted and sequenced by E gene

synthesized in vitro. The sequencing results showed that the E gene was synthesized to have the

same sequence as the originally designed E gene (gene sequencing data was illustrated in

supplementary (S1)). The result of aligning the E gene sequence with the E gene sequence on

Gene Bank showed that the two sequences are similar to each other with Query cover of 100%

and E value of 0.0 successful in vitro synthesis (Figure 1). E gene sequencing data was illustrated

in supplementary (Figure S1).

Figure 1. Alignment results of synthetic E gene sequence compared with E gene sequence on

Gene Bank.

Estimated concentration of RNA

Based on A260/A280 ratio of 2.1 and the concentration was 21.83 ± 0.74 ng/ul. The number of

copies/µL was 7.94x 1011. We calculated the number of copy/µL of 157.48 x 109

Table 1. Characteristics of synthesized RNA

Gen Length A260/280 A260/230 Concentration

(copy/µL)

Numbers

(copy/µL)

Gen E/Sars CoV-2 398 bp 1.97 0.97 21.83 ± 0.74 157.48 x 109

Precision and accuracy of Ct-values and copy concentration of synthesized RNA.

In the present study, we tested a dilution series of nine replicates RNA synthesis per

concentration. The Ct-value ranged from 22.4 to 23.69, and the number of copies was 79358.30

copies/µL at the level of 103 dilutions. When dilution tends to small, the Ct-values were more

likely to increase.

There was quite consistent fluorescence at 22, 24, and 28 cycles per concentration (figure 1).

Figure 2. Ct-values of synthesized RNA.

The precision of Ct-value in each dilution concentration of synthesized RNA

Repeatability

Intra-assay precision was determined from assay results in each concentration run. The SD and

RSD of each concentration were 0.49- 0.95 cycles and 2.12- 2.69%, which reach the accepted

criterion of RSD<15% (Table 2).

Table 2. Repeatability of Ct-value in each dilution concentration of synthesized RNA.

No. Numbers

(copy/µl)

Mean

(Ct-value)

SD

(Ct-value)

Cl 95% RSD %

1 157480 22.98 0.49 22.61 - 23.35 2.12

2 15748 26.28 0.71 25.74 - 26.83 2.69

3 1574.8 29.95 0.65 29.46 - 30.45 2.17

4 157.48 34.02 0.84 33.38 - 34.67 2.48

Intermediate precision

Similarly, intra-assay precision was performed from assay results in four different runs and

three different days. The SD and RSD of each concentration were 0.06- 0.72 cycles and 0.36-

2.11%, which meets the accepted criterion of RSD less than 15% (Table 3).

Table 3. Intermediate precision of Ct-value per dilution concentration of synthesized

RNA.

No. Repeatability Numbers

(copy/µl)

Mean

(Ct-value)

SD

(Ct-value)

RSD %

(CT)

1 Day 1 157480 23.58 0.13 0.56

2 Day 2 157480 22.50 0.11 0.47

No. Repeatability Numbers

(copy/µl)

Mean

(Ct-value)

SD

(Ct-value)

RSD %

(CT)

3 Day 3 157480 22.87 0.16 0.70

4 Day 1 15748 27.15 0.36 1.31

5 Day 2 15748 25.67 0.26 1.02

6 Day 3 15748 26.03 0.14 0.55

7 Day 1 1574.8 30.70 0.06 0.20

8 Day 2 1574.8 29.28 0.28 0.96

9 Day 3 1574.8 29.89 0.27 0.91

10 Day 1 157.48 34.79 0.13 0.36

11 Day 2 157.48 33.18 0.61 1.83

12 Day 3 157.48 34.10 0.72 2.11

Accuracy of Ct-value in each dilution concentration of synthesized RNA

Three different concentrations (80 µL, 100 µL, 120 µL) were obtained by adding different

amounts of copy/ µL into the RNA synthesized specimens. The Realtime-RT-PCR was

performed by 7 replicates on different days. The percentage of RSD was 0.39-0.92% with an

RSD of <15%. The results also exhibited that the synthesized RNA specimens had a good

extraction efficiency.

Table 4. Accuracy test per each concentration for synthesized RNA.

No. Dilution (copy/µ

L)

Ct-values

Mean Ct-value

SD RSD%

1st

Time

2nd time

3rd time

4th time

5th time

6th time

7th time

1 80 29.44 29.17 29.34 28.94 28.97 29.70 29.37 29.28 0.27 0.92

2 100 29.00 29.42 29.23 29.16 29.36 29.71 29.79 29.38 0.29 0.98

3 120 29.08 28.84 28.98 29.07 28.79 28.89 28.89 28.93 0.11 0.39

Table 5. The values of Ct-value per each concentration for synthesized RNA.

No. Numbers

(copy/µL) Log

copy/µL

Mean

(Ct-value)

SD

(Ct-value)

RSD %

(CT)

1 157480 4.90 22.98 0.03 2.12

2 15748 3.90 26.28 0.11 2.40

3 1574.8 2.90 29.95 0.12 0.41

4 157.48 1.90 34.02 0.31 0.92

In this study, the linearity was created based on the Ct-value versus log copy. The linear

regression was obtained from five independent assays performed on different days. We

estimated the Linear regression equation with Y =– 3.68xlog copy/µl + 40.81, the R of the

standard linear reached -0.9989 which meets the accepted criterion of R2>0.98.

Figure 2. The linear regression based on the Ct-value versus log Copy.

In this study, intra-assay precision, the accuracy, and linearity met the accepted criterion with

RSD less than 15% (Table.5).

Table 5. Summary of the criteria for synthesized RNA.

Result Required

Linearity 0.98 0.98

Accuracy 0.39-0.92%

<15% Precision Repeatability (intra-precision) 2.12- 2.69%

Inter-precision 0.36- 2.11%

Estimated concentration of RNA extracted from SARS-COV-2 virus

In order to estimate the concentration of RNA extracted from SARS-COV-2 virus isolated from

Vero E6 cells, Realtime RT-PCR was used in a dilution series of nine replicates run and in three

different days to estimate the Ct-values based on standard curves above. The percentage of RSD

was 0.26-5.21% with an RSD of <15%.

Y = – 3.68xlog copy/µL + 40.81

20

25

30

35

40

Cyc

le th

resh

old

(C

T)

1 2 3 4 5 6Log_copy

Table 6. Concentration of RNA extracted from SARS-COV-2 virus.

No.

Ct-values Mean

(Ct-

values)

SD

(Ct-

values)

RSD %

(Ct-values)

Log

copy/µL Day 1 Day 2 Day 3

1 19.94 20.27 20.1 20.10 0.17 0.82 5.937

2 20.26 20.03 20.08 20.10 0.12 0.60 5.931

3 19.69 20.19 20.55 20.10 0.43 2.14 5.926

4 23.80 23.53 24.06 23.80 0.27 1.11 4.933

5 23.61 23.58 23.78 23.70 0.11 0.46 4.971

6 23.59 23.60 23.80 23.70 0.12 0.50 4.969

7 26.78 26.97 27.19 27.00 0.21 0.76 4.068

8 26.96 27.09 27.07 27.00 0.07 0.26 4.052

9 27.13 26.91 27.29 27.10 0.19 0.70 4.033

10 27.87 28.65 28.24 28.30 0.39 1.38 3.722

11 28.26 28.39 28.55 28.40 0.15 0.51 3.682

12 27.89 28.99 28.45 28.40 0.55 1.93 3.670

13 29.17 30.65 27.46 29.10 1.57 5.21 3.494

14 29.17 30.13 29.26 29.50 1.06 3.48 3.378

15 29.17 30.09 29.09 29.50 0.93 3.08 3.397

16 30.41 31.77 31.55 31.20 0.90 2.81 2.909

17 30.21 32.3 31.43 31.30 1.00 3.12 2.890

No.

Ct-values Mean

(Ct-

values)

SD

(Ct-

values)

RSD %

(Ct-values)

Log

copy/µL Day 1 Day 2 Day 3

18 30.27 31.49 30.96 30.90 0.90 2.84 3.001

19 34.23 33.16 34.09 33.90 0.58 1.71 2.17

20 34.51 33.66 34.04 34.00 0.43 1.25 2.15

21 33.81 33.7 34.56 35.00 0.47 1.34 1.88

22 37.66 35.88 34.58 35.80 1.55 4.33 1.68

23 36.73 34.41 35.24 36.00 1.18 3.27 1.63

24 37.36 34.95 37.05 36.50 1.31 3.60 1.49

Discussion

Standardized specimens produced according to international conference on harmonization guideline for bioanalytical method validation [14, 15, 17]. Here, the first study reported the process to develop standardized specimens of known concentration, which was RNA extracted from SARS-COV-2 virus isolated, for evaluation, verification, validation, and external quality assessment.

We found that intra-assay precision, the accuracy, and linearity met the accepted criterion with RSD less than 15%, Besides, liner regression meets the accepted R2 of 0.98 [14, 15]. After creating the standard curve, RNA extracted from the inactivated virus was performed Realtime-RT-PCR to estimate the standardized specimens of known concentration. We found that the results of RNA synthesis and RNA extracted from the inactivated virus were quite equivalent. It could be partly contributed to evaluating the reliability of SARS-COV-2 testing for use around the world.

The SARS-COV-2 pandemic posed serious threats to human health; however, shortages of chemical reagents and healthcare worker are restraining testing capacity under the growing demand for Covid-19 diagnostics around the world, especially in resource-limited settings [9]. Although, strategies from WHO emphasized the vital role of early testing of suspected cases to halt virus spread and emphasized that the need of reliable assays to detect and laboratory-confirmed cases early [16] is therefore essential to evaluate the reliability of the Realtime RT-PCR testing.

The validation of rapid diagnostic tests for COVID-19 should be a priority for diagnosis and follow-up of patients both in hospital and in the community, allowing us to detect cases early and isolate patients and close contacts rapidly. Access to reliable rapid diagnostic test could improve the pressure on laboratories and enlarge testing capacity to reach the most urgent medical and public health needs [9].

Strength and limitation

This is the first study to develop standardized specimens of known concentration for SARS-COV-2 testing. We followed the guideline on bioanalytical method validation [14, 15, 17]. Although, the A260/280 ratio was less than 2.1, it may be contained residual extraction reagent or presence of proteins, it partly estimates the number of copies per reaction based on the standardized specimens, especially in Covid-19 has spread around the world.

Policy implications

While waiting for a vaccine is completed or medicine is proven to be approval, diagnostics are a life-threatening weapon in the fight against this pandemic and, once ready to use, standardized specimens of known concentration will improve the testing capacity and support screening, earlier diagnosis of infection and isolation. In the long-term, the standardized specimens of known concentration are capable for evaluation, verification, validation, and external quality assessment.

Conclusions

In summary, synthesized RNA based on the genes published was used to build the standard curve for estimating concentration among RNA extracted inactivated virus under guideline on bioanalytical method validation. Together with our findings provided a potential opportunity for reliable testing to diagnose Covid-19.

Ethics committee approval

This is a simulation study, no patient data were included, only throat specimens for virus culture published in the previous study [10]. The emergence of Covid-19 is a significant health threat that requires a rapid public health response to protect the entire community from this severe and halt virus spread. For this reason, our request of a waiver of ethical approval.

Competing interests

The authors have no conflicts of interest.

Acknowledgment

We would like to thank Dr Ho Huu Tho at Military Medical institution and colleagues at Pasteur Institute Ho Chi Minh City for supporting the study.

Authors’ contribution

HQC, PTL, HTL, NDH, NTTT developed the idea of the producing standardized specimens of known concentration. HQC, HTL, NDH, NTTT, NHA, NTH performed the analysis and VTT, NTTT, DTHT, TCD, NDT check the results. HDN, HQC, HTL, NTTT, VTT, TCD drafted the manuscript, revised the manuscript. All authors were responsible for the final content. Both authors have read and approved the final manuscript.

Supplementary data

Table S1. The estimation of Copy/µl concentration by Ct-value based on the liner regress

equation.

No. CT Copy/µl Log copy/µl

1 20 5.655 451743

2 21 5.383 241631

3 22 5.111 129245

4 23 4.840 69131

5 24 4.568 36977

6 25 4.296 19779

7 26 4.024 10579

8 27 3.753 5659

9 28 3.481 3027

10 29 3.209 1619

11 30 2.938 866

12 31 2.666 463

13 32 2.394 248

14 33 2.122 133

15 34 1.851 71

16 35 1.579 38

17 36 1.307 20

No. CT Copy/µl Log copy/µl

18 37 1.035 11

19 38 0.764 6

20 39 0.492 3

21 40 0.220 2

Figure S1. E gene sequencing data

References

1. Bermingham, A., et al., Severe respiratory illness caused by a novel coronavirus, in a patient transferred to the United Kingdom from the Middle East, September 2012. Eurosurveillance, 2012. 17(40): p. 20290.

2. Li, J.-Y., et al., The epidemic of 2019-novel-coronavirus (2019-nCoV) pneumonia and insights for emerging infectious diseases in the future. Microbes and Infection, 2020. 22(2): p. 80-85.

3. Hadjinicolaou, A.V., et al., Development of a molecular-beacon-based multi-allelic real-time RT-PCR assay for the detection of human coronavirus causing severe acute respiratory syndrome (SARS-CoV): a general methodology for detecting rapidly mutating viruses. Archives of virology, 2011. 156(4): p. 671-680.

4. Lin, C., R. Ye, and Y. Xia, A meta-analysis to evaluate the effectiveness of real-time PCR for diagnosing novel coronavirus infections. Genet Mol Res, 2015. 14: p. 15634-15641.

5. Al-Abdallat, M.M., et al., Hospital-associated outbreak of Middle East respiratory syndrome coronavirus: a serologic, epidemiologic, and clinical description. Clinical Infectious Diseases, 2014. 59(9): p. 1225-1233.

6. Konrad, R., et al., Rapid establishment of laboratory diagnostics for the novel coronavirus SARS-CoV-2 in Bavaria, Germany, February 2020. Eurosurveillance, 2020. 25(9).

7. Organization, W.H., Laboratory testing for coronavirus disease 2019 (COVID-19) in suspected human cases: interim guidance, 2 March 2020. 2020, World Health Organization.

8. Organization, W.H., Coronavirus disease 2019 (COVID-19): situation report, 67. 2020. 9. Corman, V.M., et al., Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-

PCR. Eurosurveillance, 2020. 25(3). 10. Phan, L.T., et al., Importation and human-to-human transmission of a novel coronavirus

in Vietnam. New England Journal of Medicine, 2020. 382(9): p. 872-874. 11. Harcourt, J., et al., Isolation and characterization of SARS-CoV-2 from the first US

COVID-19 patient. bioRxiv, 2020. 12. Sims, A.C., et al., Release of severe acute respiratory syndrome coronavirus nuclear

import block enhances host transcription in human lung cells. Journal of virology, 2013. 87(7): p. 3885-3902.

13. Josset, L., et al., Cell host response to infection with novel human coronavirus EMC predicts potential antivirals and important differences with SARS coronavirus. MBio, 2013. 4(3): p. e00165-13.

14. Use, C.f.M.P.f.H., Guideline on bioanalytical method validation. European Medicines Agency, 2011.

15. HHS-FDA, C., CVM. Guidance for industry: bioanalytical method validation. Rockville, 2018.

16. Reusken, C.B., et al., Laboratory readiness and response for novel coronavirus (2019-nCoV) in expert laboratories in 30 EU/EEA countries, January 2020. Eurosurveillance, 2020. 25(6).

17. Rabenau, H.F., et al., Verification and validation of diagnostic laboratory tests in clinical virology. Journal of clinical virology, 2007. 40(2): p. 93-98.