Dit2 Plant Cell Physiol 2004 Taniguchi 187 200

8/6/2019 Dit2 Plant Cell Physiol 2004 Taniguchi 187 200

1/14

Plant Cell Physiol. 45(2): 187200 (2004)

JSPP 2004

187

Differentiation of Dicarboxylate Transporters in Mesophyll and BundleSheath Chloroplasts of Maize

Yojiro Taniguchi1, Junko Nagasaki1, Michio Kawasaki1, Hiroshi Miyake1, Tatsuo Sugiyama2and

Mitsutaka Taniguchi1, 31 Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya, Aichi, 464-8601 Japan2 RIKEN Plant Science Center, Yokohama, Kanagawa, 230-0045 Japan

;

In NADP-malic enzyme-type C4 plants such as maize

( Zea mays L.), efficient transport of oxaloacetate and

malate across the inner envelope membranes of chloro-

plasts is indispensable. We isolated four maize cDNAs,

ZmpOMT1 andZmpDCT1 to3, encoding orthologs of plas-

tidic 2-oxoglutarate/malate and general dicarboxylate

transporters, respectively. Their transcript levels were

upregulated by light in a cell-specific manner; ZmpOMT1

and ZmpDCT1 were expressed in the mesophyll cell (MC)

and ZmpDCT2 and 3 were expressed in the bundle sheath

cell (BSC). The recombinant ZmpOMT1 protein expressed

in yeast could transport malate and 2-oxoglutarate but not

glutamate. By contrast, the recombinant ZmpDCT1 and 2

proteins transported 2-oxoglutarate and glutamate at simi-

lar affinities in exchange for malate. The recombinant pro-

teins could also transport oxaloacetate at the same binding

sites as those for the dicarboxylates. In particular,

ZmpOMT1 transported oxaloacetate at a higher efficiency

than malate or 2-oxoglutarate. We also compared the activ-

ities of oxaloacetate transport between MC and BSC chlo-

roplasts from maize leaves. TheKm value for oxaloacetate inMC chloroplasts was one order of magnitude lower than

that in BSC chloroplasts, and was close to that determined

with the recombinant ZmpOMT1 protein. Southern analy-

sis revealed that maize has a single OMT gene. These find-

ings suggest that ZmpOMT1 participates in the import of

oxaloacetate into MC chloroplasts in exchange for stromal

malate. In BSC chloroplasts, ZmpDCT2 and/or ZmpDCT3

were expected to import malate that is transported from

MC.

Keywords: Chloroplast C4 photosynthesis Dicarboxy-

late transporterMaizeOxaloacetate transporter2-Oxoglutarate/malate transporter.Abbreviations: BSC, bundle sheath cell; DCT, general dicarboxy-

late transporter; EST, expression sequence tag; GOGAT, glutamate

synthase; GS, glutamine synthetase; GSS, genome survey sequence;

MC, mesophyll cell; ME, malic enzyme; OAT, oxaloacetate trans-

porter; OMT, 2-oxoglutarate/malate transporter; PEPC, phosphoe-

nolpyruvate carboxylase; RT-PCR, reverse transcription-polymerase

chain reaction; Rubisco, ribulose-1,5-bisphosphate carboxylase/oxyge-

nase.

Nucleotide sequence data reported are available in the DDBJ/

EMBL/GenBank databases under the accession numbers of AB112936

(ZmpOMT1), AB112937 (ZmpDCT1), AB112938 (ZmpDCT2) and

AB112939 (ZmpDCT3).

Introduction

In NADP-malic enzyme (ME)-type C4 plants such as

maize and sorghum, bicarbonate is fixed by phosphoenolpyru-

vate carboxylase (PEPC) in mesophyll cell (MC) cytoplasm.

The carboxylation product, oxaloacetate, is transported to chlo-

roplasts, where it is reduced to malate. The malate produced is

transported from MC chloroplasts to bundle sheath cell (BSC)

chloroplasts, where malate is decarboxylated to pyruvate by

NADP-ME. The decarboxylation product, pyruvate, is trans-

ported back to MC chloroplasts (Kanai and Edwards 1999,

Furbank et al. 2000). High rates of both intra- and intercellular

transport of these metabolites are crucial to the efficient opera-

tion of C4 photosynthetic cycle and particularly important in

view of many attempts to genetically modify photorespirationand to introduce C4 characteristics into C3 plants (Leegood

2002).

Movement of metabolites between chloroplasts and

cytosol is mediated by multiple transporters located in the inner

envelope membranes (Flgge 2000), but most of the transport-

ers involved in the C4 cycle remain to be characterized at a

molecular level (Leegood 2000). Efficient transport of phos-

phoenolpyruvate in exchange for inorganic phosphate is

observed in C4-MC chloroplasts, although the C3 chloroplasts

poorly accepted phosphoenolpyruvate (Gross et al. 1990). The

exchange of phosphoenolpyruvate for inorganic phosphate is

thought to be mediated by triose phosphate/phosphate translo-cators and their cDNAs were isolated from maize MC and Fla-

veria trinervia, an NADP-ME type C4 plant (Fischer et al.

1994). Transport of pyruvate through chloroplast envelope

membranes is activated by light in C4-MC chloroplasts but not

in C4-BSC and C3 chloroplasts (Flgge et al. 1985,Ohnishi and

Kanai 1987a). The pyruvate uptake by C4-MC chloroplasts is

driven by light-enhanced cotransport with proton or Na+(Ohnishi and Kanai 1987b, Ohnishi and Kanai 1990). From

these findings, it is becoming clear that some chloroplast trans-

3 Corresponding author: E-mail, [email protected]; Fax: +81-52-789-4063.

a

a

a

sa

s

y

,

pp

j

asg

a
http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/


2/14

Dicarboxylate transporters in maize188

porters participating in the C4 photosynthetic pathway are func-

tionally differentiated from the C3 counterparts.

On the other hand, the molecular basis for C4 dicarboxy-

late transport in MC and BSC chloroplasts of C4 plants remainsuncertain. In NADP-ME type C4 photosynthesis, import of

oxaloacetate and export of malate in MC chloroplasts, and

import of malate into BSC chloroplasts are necessary. In gen-

eral, transport of dicarboxylates such as malate, 2-oxoglutarate,

glutamate and oxaloacetate across the inner plastid envelope

membranes is thought to be facilitated by at least three distinct

types of counter-exchange transporters: 2-oxoglutarate/malate

transporter (OMT), general dicarboxylate transporter (DCT)

and oxaloacetate transporter (OAT) (Flgge 2000, Neuhaus and

Wagner 2000). DCT transports various dicarboxylates rather

nonspecifically, although OMT mainly transports 2-oxoglutarate

in exchange for malate but does not transport glutamate oraspartate (Flgge et al. 1988). Measurement of malate uptake

into maize MC chloroplasts has revealed that malate, oxaloace-

tate, glutamate, aspartate, and 2-oxoglutarate are exchangeable

(Day and Hatch 1981). OMT and DCT participate in a double

transporter system that functions in the transfer of 2-oxoglutar-

ate as a carbon skeleton to, and the export of glutamate synthe-

sized by, the stromal glutamine synthetase-glutamate synthase

(GS-GOGAT) cycle for ammonium reassimilation (Woo et al.

1987, Glvez et al. 1999). This OMT/DCT system is also

involved in assimilation of ammonium that is derived from

photorespiration. Measurements of oxaloacetate uptake by MC

chloroplasts from maize and spinach revealed that OAT is a

high-affinity transporter specific for oxaloacetate and the

apparent Km value for oxaloacetate is one or two orders of mag-

nitude lower than those for malate and 2-oxoglutarate (Hatch et

al. 1984). OAT takes part in a malateoxaloacetate shuttle

known as a malate valve that exports excess reducing equiva-

lents from stroma and balances the stromal ATP/NADPH ratio

(Heineke et al. 1991, Noctor and Foyer 2000).

A cDNA clone for OMT was first identified in spinach

and its name was assigned as DiT1 (Weber et al. 1995,Weber

and Flgge 2002). Furthermore, Arabidopsis genes encoding

plastidic OMT,AtpOMT1, and DCTs,AtpDCT1 andAtpDCT2,

have been identified by us (Taniguchi et al. 2002). In the study,

T-DNA insertional mutants ofAtpDCT1 were non-viable in

normal air but could grow under a high CO2 condition which

suppresses photorespiration. This observation indicates thatAtpDCT1 is a component necessary for photorespiratory nitro-

gen recycling. The AtpOMT1 recombinant proteins could

transport oxaloacetate with a Km value for oxaloacetate one

order of magnitude lower than those for malate and 2-oxogluta-

rate. The expression ofAtpOMT1 was prominently induced by

light and nitrate supplementation. These kinetic properties and

gene expression profiles suggested that AtpOMT1 functions as

OAT in the malateoxaloacetate shuttle in addition to its role in

the OMT/DCT double transporter system (Taniguchi et al.

2002).

In this study, we isolated maize cDNAs encoding

homologs of AtpOMT1 and AtpDCT1. The transcripts werelargely accumulated in green tissues in a light-inducible man-

ner. In particular, their expression in leaf blades was MC or

BSC specific. The recombinant proteins of the maize OMT and

DCT showed transport properties that were consistent with

those of the AtpOMT1 and AtpDCT1 proteins, respectively.

Based upon the results, we will discuss the physiological func-

tions of each dicarboxylate transporter in maize.

Results

Isolation and characterization of cDNAs for OMT and DCT

A maize expression sequence tag (EST) (Acc. No.

AI665141) encoding a predicted amino acid sequence similar

to that of spinach chloroplastic OMT (SoDiT1) was used as a

probe to isolate the full-length cDNA clone from a cDNA

library of maize greening leaves. Several positive clones were

isolated and sequencing revealed that these clones originated

from the same gene but with different poly(A) additional sites.

The longest cDNA named ZmpOMT1 was 1,907 bp long and

the putative open reading frame encoded a polypeptide of 578

amino acids with a calculated molecular mass of 59.9 kDa(Fig. 1). The ZmpOMT1 protein showed 77% identity to

SoDiT1 (Weber et al. 1995) at the amino acid level.

Fig. 1 Structures of cDNAs encodingZmpOMT1 andZmpDCT1 to 3. Open and shaded regions indicate non-coding and coding regions, respec-

tively. The PCR primers used for amplification of DNA fragments for hybridization probes are indicated by arrows below each cDNA.

a

a

a

sa

s

y

,

pp

j

asg

a


3/14

Dicarboxylate transporters in maize 189

A sorghum partial cDNA, HHU51 (Acc. No. H55022),

was obtained as a BSC-specific gene by differential screening

(Wyrich et al. 1998). Although the cDNA was reported to

encode a chloroplastic OMT, the partial protein (188 amino

acids) encoded by the HHU51 cDNA had relatively low iden-

tity to SoDiT1 (42%). We speculated that the HHU51 cDNA

encodes another type of transporter and tried to isolate a maize

cDNA encoding a counterpart of the HHU51 protein. The

maize cDNA library was screened with the HHU51 cDNA that

was synthesized from greening sorghum leaf RNA by reverse

transcription-polymerase chain reaction (RT-PCR). Several

positive clones were isolated and the sequence analysis

revealed that these clones originated from the same gene. The

longest cDNA namedZmpDCT1 was 2,109 bp long and gave a

putative open reading frame that encoded a 554-amino acid

polypeptide with a calculated molecular mass of 59.6 kDa(Fig. 1). ZmpDCT1 showed 49% and 77% identity to SoDiT1

and HHU51, respectively, at the amino acid level. We further

screenedthemaizecDNAlibrarieswiththeHHU51cDNAasa probe and identified two different cDNAs. The cDNAs

(ZmpDCT2 and ZmpDCT3) were 1,992 bp and 1,990 bp long,

respectively, and their nucleotide sequences closely resembled

each other. There were 11 substitutions of nucleotides between

the two cDNAs and only four amino acid substitutions

occurred between the deduced ZmpDCT2 and ZmpDCT3

proteins.Thetwoproteinsconsistedof551aminoacidswith

Fig. 2 Phylogenetic tree of OMTs and DCTs. The deduced amino acid sequences in putative mature regions were aligned with a ClustalX pro-

gram (Thompson et al. 1997) and the tree was designed with a TreeView program (Page 1996). The sequences were taken from cDNAs or

genomic DNAs encoding plastidic DCT (Arabidopsis AtpDCT1, At5g64290; AtpDCT2, At5g64280; sorghum, AY123844, BG159483 and

CD431362; spinach, AY123846; tobacco, AY123847; Flaveria bidentis, AY123845), plastidic OMT (spinach SoDiT1, U13238; Arabidopsis

AtpOMT1, At5g12860) and eubacterial transporters (Bacillus subtilis yflS, Z99108;Escherichia coli CitT, P77405; YgjE, P39414; YbhI, P75763;

Haemophilus influenzae YbhI, Q57048). The putative amino acid sequences of rice OsOMT1, OsDCT1 and OsDCT2 were predicted from nucle-

otide sequences of rice chromosomes 12, 9 and 8, respectively. The amino acid sequences of sorghum DCTs (BG159483 and CD431362) are

deduced from EST clones and, therefore, are partial.

a

a

a

sa

s

y

,

pp

j

asg

a


4/14


a molecular mass of 58.6 kDa and they showed 46% and76% identities to SoDiT1 and ZmpDCT1, respectively. These

ZmpDCT2 andZmpDCT3 genes are presumed to be alleles (see

Discussion).

Although there was no homology at the N-terminal

sequences of the deduced ZmpOMT1 and ZmpDCT1 to 3

polypeptides, a prediction program for the subcellular location,

TargetP (Emanuelsson et al. 2000), strongly suggested that

these proteins are targeted to the chloroplast like SoDiT1 (datanot shown). The putative mature proteins of ZmpOMT1 and

ZmpDCT1 to 3 also showed high identities to those of

AtpOMT1 and AtpDCT1, respectively (84% and 7880%).

The hydropathy profiles of the four transport proteins strongly

resembled those of SoDiT1, AtpOMT1 and AtpDCT1, all com-

posed of 12 putative transmembrane segments and intervening

hydrophilic loops (Weber et al. 1995, Taniguchi et al. 2002).

Some nucleotide sequences homologous to ZmpOMT1 or

ZmpDCT1 to 3 have been identified from several organisms

and a phylogenetic tree from the putative amino acid sequences

of the OMT and DCT genes was constructed (Fig. 2). The

OMT and DCT proteins of higher plants formed distinct groups

as pointed out previously (Weber and Flgge 2002). In each of

the OMT and DCT groups, member proteins from monocot and

dicot plants formed two distinct subgroups. This finding indi-

cates that divergence of ZmpDCTs occurred after a split of

monocots and dicots in the evolution of angiosperms. The plau-

sible bacterial homologues also contain 12 putative transmem-

brane helices and highly resemble plastidic OMTs and DCTs in

higher plants (Pos et al. 1998, Weber and Flgge 2002).

Number of genes coding for OMT in maize

To estimate the copy number of plastidic OMT gene(s),

Southern blot analysis of maize genomic DNA was performed

under a low-stringency hybridization condition (Fig. 3). A

same single fragment for each restriction enzyme hybridized

with both the 3-untranslated region and coding region of

ZmpOMT1 cDNA clone. This suggests that there is one copy of

plastidic OMT gene in the maize genome. By contrast, threedifferent cDNAs encoding ZmpDCT were isolated and, there-

fore, it was thought that maize has multiple gene copies of

plastidic DCT. Southern blot analysis detected several frag-

ments for the same set of restriction enzymes when hybridized

with probes ofZmpDCT1 (data not shown).

Expression profiles of the OMT and DCT genes

Total RNA was isolated from leaf blades, leaf sheaths,

husk leaves, stems, silk, young corns, anthers, rachises and

roots of maize plants and analysed by Northern hybridization

(Fig. 4). Approximately 2.2-kb transcripts of ZmpOMT1,

ZmpDCT1, and ZmpDCT2 and 3 were detected in all organs

tested, and a higher expression level was detected in the green

tissues. The mRNA levels of ZmpOMT1, ZmpDCT1, and

ZmpDCT2 and 3 were higher in leaf blades than in leaf sheaths,

and the basal regions of leaf blades accumulated the transcripts

at a higher level than the middle and tip regions. The transcript

levels in root tissues were significantly lower. These findings

suggest that maize ZmpOMT1, ZmpDCT1, and ZmpDCT2 and

3 mainly function in actively developing photosynthetic cells.

The transcripts of the OMT and DCT genes have been identi-

fied as several maize EST clones. These EST clones were

derived not only from green tissues but also from non-green tis-

Fig. 3 Southern blot analysis of the genomic DNA. Genomic DNA

from maize was digested with NdeI (N), EcoRV (EV), BamHI (B),

XhoI (X), KpnI (K), EcoRI (EI) and HindIII (H), and fractionated on

an agarose gel, blotted onto a nylon membrane, and hybridized with

ZmpOMT1 cDNA fragments corresponding to the 3-untranslated

region (A) or 3-untranslated and coding regions (B). The size of the

markers is shown on the left.

Fig. 4 Distribution of transcripts for ZmpOMT1, ZmpDCT1, andZmpDCT2 and 3 in different organs of maize. Ten g of total RNAs

from 22-day-old young plants or mature plants were electrophoresed,

transferred to a nylon membrane, and hybridized with cDNAs encod-

ingZmpOMT1,ZmpDCT1,ZmpDCT2 and 3, and ubiquitin (UBQ).

a

a

a

sa

s

y

,

pp

j

asg

a


5/14


6/14


ZmpDCT2 recombinant proteins determined by measuring

uptake activities with proteoliposomes that had been preloadedwith a variety of substrates. The three recombinant proteins

could transport malate, 2-oxoglutarate and oxaloacetate effec-

tively in exchange for external malate, although they accepted

glutamine to a lesser extent. Glutamate was poorly transported

by ZmpOMT1, but ZmpDCT1 and ZmpDCT2 could transport

glutamate effectively. This low affinity for glutamate in

ZmpOMT1 is a common property of OMTs, spinach plastidic

OMT, SoDiT1 (Menzlaff and Flgge 1993), and AtpOMT1

(Taniguchi et al. 2002). To examine the transport properties in

detail, we determined the apparent Km values for malate and the

corresponding Ki values for 2-oxoglutarate (Table 2). The Km

values for malate were not significantly different among thethree recombinant proteins, although the Ki value for 2-

oxoglutarate was lower in ZmpOMT1 than in ZmpDCT1 and

ZmDCT2. The higher affinity for 2-oxoglutarate was also

detected in the Arabidopsis AtpOMT1 recombinant proteins

(Taniguchi et al. 2002).

We previously reported that AtpOMT1 and AtpDCT1 can

transport oxaloacetate efficiently at the same binding sites as

those for other dicarboxylates such as malate and 2-oxoglutar-

ate (Taniguchi et al. 2002). In particular, AtpOMT1 showed a

much lower Km value for oxaloacetate than that of AtpDCT1.

To examine whether these kinetic properties are conserved in

maize transporters, we measured the uptake of [14C]oxaloace-

tate by the ZmpOMT1, ZmpDCT1 and ZmpDCT2 recombinant

proteins in exchange for internal malate (Table 2). The apparent

Km value for oxaloacetate of ZmpOMT1 was lower than the

apparent Ki (malate) or Ki (2-oxoglutarate) and close to the

apparent Km (oxaloacetate) determined with intact chloroplasts

from maize (0.045 mM) (Hatch et al. 1984). This Km value was

more than one order of magnitude lower than that of

ZmpDCT1, which is expressed in the same MC chloroplasts.The apparent Ki value for 2-oxoglutarate in the uptake of

malate or oxaloacetate was much lower in ZmpOMT1 than in

ZmpDCT1 and ZmpDCT2 (Table 2). This kinetic property has

also been found in Arabidopsis (Taniguchi et al. 2002). These

findings indicate that ZmpOMT1 may function in the transport

of oxaloacetate in addition to 2-oxoglutarate and malate in MC

chloroplasts.

Transport characteristics of MC and BSC chloroplasts

Northern analysis suggested that BSC does not possess

plastidic OMT (Fig. 6). The characterization of the transport by

the recombinant OMT and DCT proteins showed thatZmpOMT1 has a higher affinity for oxaloacetate than either

ZmpDCT1 or ZmpDCT2 (Table 2). These findings suggested

Fig. 7 Changes of mRNA levels during greening of etiolated maize

seedlings. Maize seedlings, grown in the dark for 12 d, were illumi-

nated with continuous white light, and leaf blades were harvested at

the times indicated. Total RNA was extracted and 20 g was separated

by gel electrophoresis, blotted and hybridized with each specific

probe.

Fig. 8 Changes of mRNA levels in maize leaf blades during recovery from nitrogen deficiency. Maize seedlings grown with 0.8 mM NaNO3 for

18 d were transferred to a culture solution containing 16 mM nitrate at day 0 and leaf blades were harvested at the indicated times. (A) Total

RNAs (10 g) were subjected to Northern analyses with each specific probe as indicated, together with an appropriate probe of ubiquitin (UBQ)

as a loading control. RNA samples isolated from plants at time zero and 2 d after transfer to the culture solution with the same composition

(0.8 mM NaNO3) were also analysed as a control. (B) The signal intensities were quantified and the mRNA levels for ZmpOMT1 (triangles),

ZmpDCT1 (circles),ZmpDCT2 and 3 (squares), C4Ppc1 (crosses) and C4Me1 (asterisks) normalized to the ubiquitin content are shown as rela-

tive values with zero time values taken as one.

a

a

a

sa

s

y

,

pp

j

asg

a
http://-/?-http://-/?-http://-/?-http://-/?-http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://-/?-http://-/?-http://-/?-http://-/?-


7/14


that MC chloroplasts may show higher affinity for oxaloace-

tate transport than BSC chloroplasts. Transport of oxaloacetate

into MC chloroplasts is an indispensable step in the NADP-

ME-type C4 photosynthetic pathway and, therefore, rapid

uptake of oxaloacetate is essential to maintain high photosyn-

thetic activity. We isolated MC and BSC chloroplasts from

maize leaves and examined the activities of oxaloacetate uptake

into the chloroplasts. Because the oxaloacetate transport was

rapid, the transport activities were measured at 4C with a dou-

ble silicone-oil-layer filtering centrifugation technique (Gross

et al. 1990). The transport time in our measurement system was

estimatedtobe2.0s(datanotshown).Adoublereciprocalplot indicated that the apparent Km value for oxaloacetate

uptake into MC chloroplasts was0.0340.007 mM (n =5)(Fig. 9A). This value is similar to Km values that were previ-

ously determined with oxaloacetate-dependent O2 evolution or

[14C]oxaloacetate reduction in illuminated chloroplasts (Hatch

et al. 1984). The apparent Km value of BSC chloroplasts was

calculated to be 0.470.07 mM (n = 4) and was one order of

magnitude higher than that of MC chloroplasts (Fig. 9B).

Discussion

Molecular evolution of OMT and DCT genes

Rapid transport of C4 dicarboxylates, malate and oxaloac-

etate, through chloroplastic envelope membranes is essential in

the NADP-ME-type C4 photosynthetic pathway and, therefore,

highly efficient transporters for dicarboxylates should exist in

the inner envelopes of MC and BSC chloroplasts. In this study,

we isolated cDNAs,ZmpOMT1 andZmpDCT1 to 3, by screen-ing a maize leaf cDNA library with probes of maize cDNA and

sorghum EST, and investigated whether the encoded proteins

were the transporters functioning in the C4 photosynthetic path-

way. The deduced amino acid sequences ofZmpOMT1 and

ZmpDCT1 to 3 were homologous to the previously identified

plastidic OMT and DCT, respectively (Fig. 2). Each of the plas-

tidic OMT and DCT genes can be grouped into two subgroups

of monocot and dicot members. Moreover, maize DCT gene

has diverged to ZmpDCT1 and ZmpDCT2 and 3 after the

monocot/dicot split. Therefore, each of the ZmpDCT genes has

Table 1 Substrate specificities of the reconstituted ZmpOMT1, ZmpDCT1 and ZmpDCT2 a

a Cell membranes of yeast transformed with pTV3e vector, ZmpOMT1-pTV3e, ZmpDCT1-pTV3e, or

ZmpDCT2-pTV3e were reconstituted into liposomes preloaded with the indicated substrates (50 mM) and

the uptake of [14C]malate (0.2 mM) into the proteoliposomes for 2 min was measured. The activities are

given as the percentage of the activity measured for proteoliposomes which had been preloaded with malate

(ZmpOMT1, 1.1 nmol (mg protein)1 min1; ZmpDCT1, 0.97 nmol (mg protein)1 min1; ZmpDCT2, 0.45

nmol (mg protein)1 min1). The values are the means of three independent experiments SE.

Internal substrate ZmpOMT1 ZmpDCT1 ZmpDCT2

KCl 61.6 212.0 31.5

Malate (100) (100) (100)

2-oxoglutarate 934.2 613.4 8213.5Glutamate 171.9 741.8 681.1

Oxaloacetate 852.3 1046.7 1331.1

Glutamine 152.2 321.0 286.0

Table 2 Apparent Km and Ki values of malate or oxaloacetate uptake by the reconstituted

ZmpOMT1, ZmpDCT1 and ZmpDCT2

a The uptake of external [14C]malate in exchange for internal malate (50 mM) for 1 min was assayed in the

absence or presence of 1 mM 2-oxoglutarate.b The uptake of external [14C]oxaloacetate in exchange for internal malate (30 mM) was measured. The trans-

port was assayed without competing substrate, in the presence of 1 mM malate or 2-oxoglutarate. The valuesare the means of three independent experiments SE.

ZmpOMT1 (mM) ZmpDCT1 (mM) ZmpDCT2 (mM)

[14C]malate uptake a

Malate Km (app) 0.610.07 1.10.1 0.850.44

2-oxoglutarate Ki (app) 0.800.37 2.91.3 1.51.3

[14C]oxaloacetate uptake b

Oxaloacetate Km (app) 0.0900.006 1.10.01 0.270.01

Malate Ki (app) 0.400.07 1.90.7 0.450.15

2-oxoglutarate Ki (app) 0.170.01 4.11.6 0.790.24

a

a

a

sa

s

y

,

pp

j

asg

a


8/14


acquired a distinct cell-specific expression mechanism during

the evolution to C4 plants.

The three cDNAs encoding ZmpDCT1 to 3 were isolated

with a sorghum partial cDNA, HHU51, as a probe. The expres-

sion of the sorghum gene for HHU51 is BSC specific (Wyrich

et al. 1998). Its full-length cDNA (Acc. No. AY123844) has

been isolated and expression of the gene was confirmed to be

restricted to BSC (Renn et al. 2003). The deduced amino acid

sequences in putative mature region encoded by the AY123844

clone is more homologous to ZmpDCT1 than ZmpDCT2 and 3

(identity at the amino acid level: 86% vs. 79%, Fig. 2). This

finding seems paradoxical because expression ofZmpDCT1 is

restricted in MC in contrast to the BSC-specific expression ofZmpDCT2 and 3. However, we found other sorghum EST

clones that were more homologous toZmpDCT1 orZmpDCT2

and 3. A partial amino acid sequence encoded by the sorghum

EST clone, BG159483, is much more similar to ZmpDCT1

than to ZmpDCT2 (94% and 77%, respectively). On the other

hand, a partial amino acid sequence encoded by the sorghum

EST clone, CD431362, is much more similar to ZmpDCT2 and

3 than to ZmpDCT1 (95% and 81%, respectively). These high

identities indicate that the sorghum genes encoding BG159483

and CD431362 are orthologs ofZmpDCT1, andZmpDCT2and 3, respectively. The gene expression profiles of the newsorghum EST clones have not been examined, but theirexpression is expected to be MC or BSC specific like

ZmpDCT1, and ZmpDCT2 and 3. Although several clones for

ZmpDCT1 to 3 can be found in maize EST databases, a maize

ortholog clone of the sorghum AY123844 has not been found

in the databases. The maize ortholog gene needs to be identi-

fied to further elucidate molecular evolution of dicarboxylate

transporter genes in Gramineae.

The nucleotide sequences ofZmpDCT2 and 3 cDNAs

closely resemble each other and only 11 nucleotides are differ-

ent between them. Because the maize cultivar, Golden Cross

Bantam T51, used in this study is a hybrid between parental

lines, P39 and P51B, there is a possibility thatZmpDCT2 and 3

genes are alleles. To investigate this possibility, we searched

genome sequences encodingZmpDCT2 or 3 in GenBank data-

base. No data of full-length genes was available but we found

that 11 genome survey sequences (GSSs) from a maize inbred

B73 strain contained the same nucleotide sequences with the

ZmpDCT2 cDNA (data not shown). Although the identified

GSSs were short (558932 bp), they overlapped the coding

region of theZmpDCT2 cDNA. Intron insertion positions of the

ZmpDCT2 genes are conserved among the homologs from

maize, rice and Arabidopsis (data not shown). On the other

hand, no nucleotide sequence encoding ZmpDCT3 was found

from the GSS database of B73 strain. If the ZmpDCT2 and 3genes are overlapping genes that have recently duplicated, we

would find some ZmpDCT3 GSSs from the inbred B73 strain

in addition to theZmpDCT2 GSSs. These findings suggest that

the inbred line B73 probably possesses only the ZmpDCT2 and

theZmpDCT2 and 3 genes from the Golden Cross Bantam T51

strain should be alleles.

Arabidopsisalsopossesses twoDCTgenes,AtpDCT1andAtpDCT2,thatarelocatedtandemlyonchromosome5(Taniguchi et al. 2002). The two genes are thought to have orig-

inated from a gene duplication event, but AtpDCT1 is more

closely related to the DCT proteins from other higher plants

including ZmpDCT1 to 3 than to the AtpDCT2 protein (Fig. 2).

Our previous experiments showed that the AtpDCT2 recom-

binant protein could not transport malate and AtpDCT2 could

not compensate for the lack of AtpDCT1 in planta (Taniguchi

et al. 2002). Therefore, the AtpDCT2 gene diverged from the

plastidic DCT gene family prior to the monocot/dicot split and

the AtpDCT2 protein may have differentiated to possess

another physiological role.

Cell-specific expression of ZmpOMT and ZmpDCT genes

The transcripts for AtpOMT1 and AtpDCT1 are accumu-

lated in all tissues ofArabidopsis at similar levels (Taniguchi et

Fig. 9 LineweaverBurk plots of the [14C]oxaloacetate uptake by MC and BSC chloroplasts. Uptake of [14C]oxaloacetate by the purified MC

(A) and BSC (B) chloroplasts was measured by the double silicone layer filtration centrifugation method.

a

a

a

sa

s

y

,

pp

j

asg

a


9/14


al. 2002). This universal distribution of the transcripts inArabi-

dopsis is consistent with our speculation that AtpOMT1 and

AtpDCT1 participate mainly in the double transporter system

that exists in plastidic envelope membranes and links between

carbon metabolism and nitrogen metabolism in green and non-

green tissues. By contrast, the transcripts for four maize genes,

ZmpOMT1 and ZmpDCT1 to 3, were largely accumulated in

green tissues (Fig. 4). Moreover, the expression ofZmpOMT1

andZmpDCT1 to 3 genes was inducible by light in leaf tissues

in concert with other photosynthetic enzyme genes (Fig. 7),

specific to MC or BSC (Fig. 6), and upregulated in response to

nitrogen availability similarly to some C4 photosynthetic genes

(Fig. 8). All of these expression profiles suggested that

ZmpOMT1 and ZmpDCT1 to 3 participate in the C4 photosyn-

thetic pathway and accommodate the physiological specializa-

tion of each type of cell. The gene encoding mitochondrial

OMT in Panicum miliaceum, a NAD-ME-type C4 plant, was

also highly expressed in leaves, and was upregulated during

greening and cell development in concert with C4 photosyn-

thetic enzymes (Taniguchi and Sugiyama 1997). This expres-

sion profile is unique to the P. miliaceum gene, because the

ortholog genes of Arabidopsis and tobacco are expressed

nearly constitutively in all tissues (Picault et al. 2002). Further-

more, the expression of the P. miliaceum mitochondrial OMT

gene was restricted in BSC where the mitochondrial OMT is

thought to be necessary to accommodate the high rates of

Table 3 Oligonucleotide primers used in this study

a Nucleotide numbers relate to cDNA sequences of AI665141, HHU51 (Acc. No. H55022),ZmpOMT1 (AB112936),ZmpDCT1 (AB112937) and

ZmpDCT2 (AB112938). Nucleotide numbers ofMubG1 relate to a genomic clone (U29159) and a size of a PCR product fromMubG1 cDNA is

calculated to be 1,664 bp.b Extra nucleotides that are not included in cDNAs are underlined.

Gene Primer Position a Sequence b

From To 53

Screening probes

AI665141 AI-S 122 140 CTCACCACAGCCCGATTAT

AI-A 537 518 CTACCTCAACAAATTCGGGC

HHU51 HHU-S 8 29 TGGGGATGCTATTGGTGTGTCT

HHU-A 613 592 TGTCATCACTTCCAACACCACC

Hybridization probes

ZmpOMT1 OMT1-S1 1742 1760 ATAATCGGGCTGTGGTGAG

OMT1-A1 1908 1888 TGGGTTGCATTGCGATCATGT

OMT1-S2 273 289 ATCCAGTGCCGGTTCCA

ZmpDCT1 DCT1-S1 1728 1748 CATTTGGCACTGGTCGAATTG

DCT1-A1 2103 2085 CCATCAAGCCGACGAGTTC

DCT1-S2 278 296 ACTGGTGCGAAGCTACTGC

DCT1-A2 1664 1641 TTCCAACAACTCCCCATATTAACG

ZmpDCT2 DCT2-S1 1694 1712 GTCTTTATTGAGTGTCGGGDCT2-A1 1992 1976 TTCAAAAGTCCCTCATGCA

MubG1 MUB-S 1299 1320 ATCTCCCCCAAATCCACCCGTC

MUB-A 3967 3944 CGGCAGCTTAAACGACCCATGACT

RT-PCR

ZmpOMT1 OMT1-S3 468 489 CCATCGTCGGCATCATCACCCA

OMT1-A2 1595 1578 CCATGAGGTTCGAGAGGA

ZmpDCT1 DCT1-S3 593 612 ATCGCCACCTACTTCGTCAA

DCT1-A3 1748 1728 CAATTCGACCAGTGCCAAATG

ZmpDCT2 DCT2-S2 457 473 TTCCTTGGCCTCACAGC

DCT2-A2 1811 1793 GGCCCTCGGAAGAAAAACG

Expression constructs

ZmpOMT1 OMT1-S4 329 348 GGAATTCCCGAAGAAGCCCGCGCTGCA

OMT1-A3 1756 1734 CCATCGATTAGTGGTGGTGGTGGTGGTGCCACAGCCCGATTATCTTCCACC

ZmpDCT1 DCT1-S4 260 280 GGAATTCGAACCTGTGCCCGAGCCCACT

DCT1-A4 1693 1671 CCATCGATTAGTGGTGGTGGTGGTGGTGGTACAGACCCAAAAATTTCCACC

ZmpDCT2 DCT2-S3 268 285 GGAATTCGCGGCGTCGGCGGCATCT

DCT2-A3 1701 1679 CCATCGATTAGTGGTGGTGGTGGTGGTGATAAAGACCCAAAAATTTCCACC

a

a

a

sa

s

y

,

pp

j

asg

a


10/14


exchange of C4 photosynthetic metabolites across mitochon-

drial membranes. To adapt to the decrease in atmospheric CO2concentration, C4 plants are thought to have acquired the C4pathways by duplication of genes that ancestral C3 plants pos-

sessed (Monson 1999, Miyao 2003). The metabolite transport

across organelle membranes would have been altered drasti-cally in accordance with the modification of the metabolic

pathways and the expression profiles of genes for some mem-

brane transporters including plastidic OMT and DCT, and

mitochondrial OMT would have been changed accordingly.

Functional characterization of ZmpOMT and ZmpDCT proteins

The transport properties of ZmpOMT1 and, ZmpDCT1

and 2 closely resembled those of AtpOMT1 and AtpDCT1,

respectively. The yeast-expressed ZmpOMT1 recombinant pro-

teins transported malate and 2-oxoglutarate but not glutamate

(Table 1). Their Km or Ki values for malate and 2-oxoglutarate

were comparable (Table 2). On the other hand, the recom-binant ZmpDCT1 and ZmpDCT2 proteins transported gluta-

mate more efficiently than ZmpOMT1 (Table 1) and their affin-

ities to 2-oxoglutarate were lower than those to malate (Table 2).

These findings suggest that ZmpOMT1 is a 2-oxoglutarate/

malate transporter, and that ZmpDCT1 and ZmpDCT2 are gen-

eral dicarboxylate transporters. ZmpDCT1 and ZmpDCT 2

were expected to be differentiated in the transport properties to

accommodate the physiological specialization of two types of

photosynthetic cells, but their kinetic properties were not sig-

nificantly different. Although glutamine seems to be barely

accepted as a countersubstrate for malate transport on the

ZmpOMT1, ZmpDCT1 or ZmpDCT2 recombinant proteins

(Table 1), competition experiments in [14C]malate uptake ordirect measurements of [14C]glutamine transport showed that

the three maize recombinant proteins cannot transport

glutamine at the same binding sites for dicarboxylates simi-

larly to AtpOMT1 and AtpDCT1 (Taniguchi et al. 2002) (data

not shown).

The recombinant ZmpOMT1 protein showed high-affinity

transport of oxaloacetate at the same binding site for dicar-

boxylates (Table 2). This property was also confirmed in

AtpOMT1 and may be a characteristic common to plastidic

OMT proteins. The Km value for oxaloacetate of ZmpOMT1

(90 M) is one order magnitude lower than that of ZmpDCT1

(1.1 mM) and close to the Km

value determined with maize MC

chloroplasts (45 M) (Hatch et al. 1984). Judging from the

gene expression profiles and kinetic data of ZmpOMT1, it is

expected that ZmpOMT1 is integrated in the C4 photosynthetic

pathway and functions in the uptake of oxaloacetate into MC

chloroplasts in exchange for stromal malate. However, the

recombinant ZmpOMT1 proteins showed relatively high affin-

ity for malate compared with the data obtained with the iso-

lated MC chloroplasts; the apparent Ki values for malate

against oxaloacetate uptake were 0.40 mM and 7.5 mM (Hatch

et al. 1984), respectively. If the ratio for the Ki for malate to the

Km for oxaloacetate is low, transport of oxaloacetate into chlo-

roplasts on OMT is highly susceptible to inhibition by cytosolic

malate. The malate concentration in maize MC cytosol is

thought to be orders of magnitude higher than that of oxaloace-

tate (Leegood 2000) and, therefore, it was speculated that there

is an additional high affinity OAT in maize MC chloroplasts

that is little affected by malate (Hatch et al. 1984). The kineticdata of the recombinant ZmpOMT1 proteins are not suited for

the metabolite levels in MC and there is currently no direct evi-

dence that ZmpOMT1 participates in exchange of oxaloacetate

and malate. However, the high affinity OAT other than OMT

has not been identified at a molecular level yet. The C4 cycle

works at a high rate in the daytime and high concentration of

oxaloacetate should be produced by cytosolic PEPC. Therefore,

the concentration of oxaloacetate in the MC cytoplasm should

be maintained at a high level and preferential uptake of oxaloa-

cetate may occur on ZmpOMT1. Another possible cause of the

discrepancy between the recombinant ZmpOMT1 proteins and

the MC chloroplasts is different measuring systems; singlerecombinant proteins reconstituted in proteoliposomes and

complex membrane proteins existing in chloroplastic envelope

membranes. It may also be necessary to check the reconstitu-

tion system of the recombinant proteins into liposomes, e.g. the

phospholipid content and ratio of proteins to lipid.

Putative physiological functions of ZmpOMT and ZmpDCT

proteins

Northern analysis showed that the transcript for

ZmpOMT1 was hardly detectable in BSC (Fig. 6). Since there

is one copy of plastidic OMT gene in the maize genome (Fig.

3), BSC chloroplasts should lack OMT. Measurement of

oxaloacetate uptake into chloroplasts supported this hypothesis:the affinity for oxaloacetate in BSC chloroplasts was lower

than that in MC chloroplasts, and the apparent Km value for

oxaloacetate observed in BSC chloroplasts was closer to that of

the DCT recombinant protein than to that of OMT (Table 2 and

Fig. 9). If BSC chloroplasts do not possess plastidic OMT pro-

teins, the uptake of malate into BSC chloroplasts may be facili-

tated mainly by ZmpDCT2 and 3 that are localized in BSC.

Because the photorespiration pathway exists only in BSC (Ku

and Edwards 1975, Ohnishi and Kanai 1983), BSC chloroplasts

are also the site of photorespiratory ammonium assimilation

(Sakakibara et al. 1992). Although the plastidic OMT/DCT

double transporter system is thought to function in the trans-

port of cytosolic 2-oxoglutarate in exchange for stromal gluta-

mate to assimilate photorespiratory ammonium via the stromal

GS-GOGAT cycle, ZmpDCT2 and/or ZmpDCT3 may solely

undertake this exchange of 2-oxoglutarate and glutamate in

BSC chloroplasts. Indeed, plastidic OMT is not always neces-

sary to operate the photorespiratory ammonium assimilation

reaction, because the Arabidopsis AtpOMT1 knockout plants

could grow normally under photorespiratory conditions(Taniguchi et al. 2002). By contrast, Renn et al. detected a

weak signal for OMT transcripts in sorghum BSC, while its

signal intensity was much higher in MC (Renn et al. 2003).

a

a

a

sa

s

y

,

pp

j

asg

a
http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-


11/14


They speculated that the OMT/DCT double transporter system

in BSC chloroplasts participates in the assimilation of ammo-

nium generated by photorespiration and nitrate reduction. We

cannot explain the reason of the conflicting data between maize

and sorghum at the moment, but it is necessary to ascertain

whether sorghum also has a single plastidic OMT gene and

whether the OMT protein exists in BSC chloroplasts.

High activities of malate transport in exchange for oxaloa-

cetate, glutamate, aspartate and 2-oxoglutarate were detected in

MC chloroplasts from maize (Day and Hatch 1981). Judging

from the substrate specificity, this transport activity may be

attributed to ZmpDCT1. Nitrate assimilation enzymes are

located predominantly in MC (Harel et al. 1977, Moore and

Black 1979) and, therefore, MC is thought to be the main site

for primary nitrate assimilation (Sakakibara et al. 1992). In this

case, transport of glutamate across inner envelope membranes

of MC chloroplasts is necessary and ZmpDCT1 whose expres-

sion level is abundant in MC but not in BSC may facilitate apart of this transport process.

It is expected that AtpOMT1 functions as an oxaloacetate

transporter in the malateoxaloacetate shuttle across chloro-

plast membranes (Taniguchi et al. 2002). This malate valve sys-

tem is necessary in maize MC to remove excess amounts of

stromal reducing equivalents to cytosol, because MC chloro-

plasts unlike BSC chloroplasts possess photosystem II activity

and generate the reducing equivalents. When maize plants are

exposed to some stresses such as high light, cold temperature

and salinity, and the reducing power is accumulated in MC

stroma, ZmpOMT1 may export stromal malate in exchange for

cytosolic oxaloacetate. By contrast, maize BSC chloroplastslack photosystem II activity and, therefore, the malate valve

may be dispensable in BSC chloroplasts.

The semiquantitative RT-PCR experiment indicated that

ZmpOMT1 andZmpDCT1 to 3 are expressed in root tissues at a

much lower level than in leaf tissues (Fig. 5). Northern analy-

sis (Fig. 4) and the EST data indicated that ZmpOMT and

ZmpDCT genes are also expressed in reproductive organs and

endosperms. Ammonium assimilation also occurs in plastids of

non-photosynthetic organs, and ZmpOMT1 and ZmpDCT1 to

3 expressed in these non-photosynthetic tissues should partici-

pate in the nitrogen metabolism. The high level expression of

ZmpOMT1 and ZmpDCT1 to 3 in green tissues is consistent

with the fact that these transporters are much in demand in C 4photosynthesis and nitrogen assimilation in the photosynthetic

cells. Although rice, a C3 monocot plant, also has OMT and

DCT genes that are highly homologous to maize ZmpOMT1,

andZmpDCT2 and 3, respectively (Fig. 2), their transcript lev-

els were relatively constant between rice leaf and root tissues

similar withArabidopsis (data not shown). It is speculated that

maize has conferred the mass-expression system in a cell-

specific manner on existing plastidic OMT and DCT without

drastic modification of transport properties. Further refined

study with gene-modified maize plants such as gene knockout

is needed to identify the precise physiological functions of

ZmpOMT and ZmpDCTs.

Materials and Methods

Plant materials and growth conditions

Maize ( Zea mays L. cv. Golden Cross Bantam T51) and sor-

ghum (Sorghum bicolor (L.) Moench cv. Tx430) were grown in agrowth chamber with 14 h of illumination (500E m2 s1) at 28C

and 10 h of darkness at 20C per day. Plants were fertilized regularly

with Arnon and Hoagland solution (Arnon and Hoagland 1940) dur-

ing growth. In the greening experiment, the seeds were grown in the

dark at 23C for 12 d and the etiolated seedlings were exposed to con-

tinuous fluorescent light at an intensity of about 120 E m2 s1 at

26C. For the analysis of induction by nitrate, seedlings were grown in

vermiculite with the Arnon and Hoagland solution containing 0.8 mMNaNO3 for 18 d. For supplementation of nitrogen, the concentration of

NaNO3 in the culture solution was changed to 16 mM. A third regionfrom the base of the third leaves was harvested and plunged into liq-

uid N2. For the analysis of cell specificity of gene expression, meso-

phyll protoplasts and bundle sheath strands were isolated by digestionof green maize leaves by a method reported previously (Ohnishi and

Kanai 1983).

Construction of cDNA library and isolation of cDNAs

Total RNA was prepared from the 19-h-greened maize leaves by

a guanidine thiocyanate procedure (McGookin 1984). Poly(A) RNA

was purified with Oligotex-dT30 (Takara Bio Inc., Shiga). A maize

cDNA library was constructed from the poly(A) RNA using a ZAP-

cDNA Synthesis Kit (Stratagene, La Jolla, CA, U.S.A.). The cDNA

library was screened by colony hybridization using DNA fragments of

maize EST (AI665141) and sorghum HHU51 cDNA (H55022). The

partial maize cDNA was amplified from total RNA of the greening

maize leaves by RT-PCR with synthetic oligonucleotides, AI-S and -A,

shown in Table 3. The sorghum partial cDNA was also amplified from

total RNA of the greening sorghum leaves by RT-PCR with syntheticoligonucleotides, HHU-S and -A. The probes were labeled with[-32P]dCTP using the Multiprime DNA Labeling System (Amersham

Biosciences, Piscataway, NJ, U.S.A.). Hybridization was performed

for 18 h at 42C in a solution containing 50 mM sodium phosphate,

pH 6.5, 5 SSC, 5 Denhardts solution, 0.1% (w/v) SDS, 50% (v/v)

formamide and 250 g ml1 salmon sperm DNA. The membranes were

washed twice with 2 SSC and 0.1% (w/v) SDS for 15 min at 42C,

and then once with 0.1 SSC and 0.1% (w/v) SDS for 15 min at 42C.

The membranes were exposed to X-ray films. The cDNA inserts in

positive phage clones were subcloned to pBluescript II vector and

sequenced by the dideoxynucleotide chain-termination method with a

sequencing kit (BigDye; Applied Biosystems, Foster City, CA, U.S.A.)

using a DNA sequencer (Model 373A; Applied Biosystems).

Southern blot analysis

Genomic DNA was isolated from etiolated seedlings by using a

DNA extraction kit (Nucleon PhytoPure, Amersham Biosciences).

Five g of DNA was digested with appropriate restriction enzymes,

fractionated on a 0.8% (w/v) agarose gel by electrophoresis and blot-

ted to a nylon membrane (Hybond-N+, Amersham Biosciences). After

fixation, the membranes were hybridized with 32P-labeled probes.

DNA fragments for the 3-untranslated and coding regions of

ZmpOMT1 and ZmpDCT1 were amplified from the cDNA clones by

PCR with combinations of oligonucleotide primers shown in Table 3

(OMT1-S1 and -A1 for ZmpOMT1 3-untranslated region, OMT1-S2

and -A1 for ZmpOMT1 coding and 3-untranslated regions, DCT1-S1

and -A1 for ZmpDCT1 3-untranslated region, DCT1-S2 and -A2 for

a

a

a

sa

s

y

,

pp

j

asg

a
http://-/?-http://-/?-http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://-/?-http://-/?-


12/14


ZmpDCT1 coding region). The positions of each the primer on the

cDNAs are indicated in Fig. 1. The hybridization and washing condi-

tions were similar to those for cDNA screening described above.

Northern blot analysis

Total RNA was isolated from appropriate organs and tissues of

maize in the presence of aurinetricarboxylic acid as an inhibitor of

nucleases (Hallick et al. 1977) followed by lithium chloride precipita-

tion and phenol extraction. The RNA samples were electrophoresed in

a 1.2% (w/v) agarose gel containing formaldehyde (Sambrook and

Russell 2001), and blotted on the Hybond-N+ membranes. After fixa-

tion, the membranes were hybridized with 32P-labeled probes. The 3-

untranslated regions ofZmpOMT1, ZmpDCT1 andZmpDCT2 cDNAs

were used as specific probes for respective genes. DNA fragment for

the 3-untranslated region ofZmpDCT2 cDNA was amplified from the

ZmpDCT2 cDNA clone by PCR with oligonucleotide primers (DCT2-

S1 and -A1). Because the nucleotide sequences in the 3-untranslated

regions of ZmpDCT2 and ZmpDCT3 cDNAs are similar, the

ZmpDCT2 probe would hybridize both of the ZmpDCT2 and

ZmpDCT3 transcripts. Other cDNAs used as probes were a 1.3-kb

EcoRI fragment of maize pM52 cDNA clone for C4Ppc1 (Izui et al.1986), a full-size insert of maize SS1 cDNA clone for rbcS-m1 (Sheen

and Bogorad 1986), a full-size insert of maize C4Me1 for NADP-ME

(Rothermel and Nelson 1989), a coding region of maizeMubG1 cDNA

for ubiquitin (Liu et al. 1995), and 3.7-kb EcoRI fragment of Vicia

faba VER17 for 25S rRNA (Yakura and Tanifuji 1983). The MubG1

cDNA was amplified from total maize RNA by RT-PCR with oligonu-

cleotide primers, MUB-S and -A, shown in Table 3. The hybridization

and washing conditions were described previously (Taniguchi et al.

2002). The washed membranes were exposed and analyzed on a bio-

imaging analyzer (BAS 2500, Fujix, Tokyo).

RT-PCR analysis

Maize plants were grown hydroponically in Arnon and Hoag-

land solution for 14 d and total RNA was isolated from their roots and

leaf blades by a guanidine thiocyanate procedure (McGookin 1984).First-strand cDNA was synthesized with an oligo(dT) primer using an

AMV Reverse Transcriptase First-strand cDNA Synthesis Kit (Life

Sciences, Inc., St. Petersburg, FL, U.S.A.). DNA fragments of

ZmpOMT1,ZmpDCT1, andZmpDCT2 and 3 were amplified from the

cDNA templates by PCR with synthetic oligonucleotides (OMT1-S3

and -A2 for ZmpOMT1, DCT1-S3 and -A3 for ZmpDCT1, DCT2-S2

and -A2 for ZmpDCT2 and 3). As an internal control, ubiquitin was

also amplified with a specific primer set for MubG1 (MUB-S and

MUB-A).

Heterologous expression of OMT and DCT in yeast cells and measure-

ment of transport activities

The DNA coding for the putative mature proteins of the

ZmpOMT1, ZmpDCT1 and ZmpDCT2 were PCR-amplified from the

cDNA clones by Pfu DNA polymerase (Stratagene) with oligonucle-

otide primers (OMT1-S4 and -A3 for ZmpOMT1, DCT1-S4 and -A4

forZmpDCT1, DCT2-S3 and -A3 forZmpDCT2). A restriction site for

EcoRI was introduced at the 5 ends of the amplified DNA fragments.

At the 3 end, a sequence encoding a C-terminal (His)6 tag, stop codon

and ClaI site was attached (Table 3). The resulting PCR products were

digested with EcoRI and ClaI, and then the DNA fragments were

replaced with the open reading frame of GAL2 in a GAL2-pTV3e

(Nishizawa et al. 1995). The DNA inserts were checked by sequenc-

ing. The pTV3e vector and the resulting constructs (ZmpOMT1-

pTV3e, ZmpDCT1-pTV3e and ZmpDCT2-pTV3e) were transformed

into Saccharomyces cereviciae LBY416 strain. Transformed cells har-

boring the pTV3e constructs were selected on agar minimal selection

plates [2% (w/v) glucose, 0.67% (w/v) yeast nitrogen base without

amino acid (Difco Laboratories, Detroit, MI, U.S.A.), yeast synthetic

drop-out medium supplements without Trp (Sigma, St. Louis, MO,

U.S.A.), and 2% (w/v) agar]. The selected yeast transformants were

grown on a large scale and the crude yeast membrane fractions were

prepared as described previously (Taniguchi et al. 2002). The recom-

binant proteins of ZmpOMT1, ZmpDCT1 and ZmpDCT2 werereconstituted into liposomes and the uptake of external 14C-labeled

substrates was measured (Taniguchi et al. 2002). The net transport

activities were calculated by subtracting the activities of the liposomes

reconstituted with pTV3e vector transformant from those of the lipo-

somes reconstituted with ZmpOMT1-pTV3e, ZmpDCT1-pTV3e or

ZmpDCT2-pTV3e transformant.

Measuring the transport activities of chloroplasts

MC chloroplasts were prepared from MC protoplasts. The pre-

pared MC protoplasts were suspended in a chloroplast isolation

medium (0.35 M sorbitol, 25 mM HEPES-KOH, pH 7.8, 5 mM EDTA

and 1 mg ml1 bovine serum albumin) and broken by two passages

through a 20-m nylon mesh attached to a plastic syringe. The solu-

tion was layered onto the chloroplast isolation medium containing15% (v/v) Percoll (Amersham Biosciences) and centrifuged at 1,600g

for 1 min. The pellets were resuspended in the chloroplast isolation

medium. BSC chloroplasts were isolated by the method of Jenkins and

Boag (Jenkins and Boag 1985). The BSC chloroplasts were purified by

centrifugation through 20% (v/v) Percoll at 700g for 3 min. The

uptake of [4-14C]oxaloacetate into the purified chloroplasts was meas-

ured at 4C in the light (300 E m2 s1) with a double silicone-oil-

layer filtering centrifugation system (Gross et al. 1990). The used sili-

con oils were mixtures of SH550 and SH556 (Dow Corning Toray Sili-

cone, Tokyo) (3 : 1 for BSC and 2 : 1 for MC chloroplasts). The final

specific activity of [4-14C]oxaloacetate was 0.35 MBq nmol1. The

actual transport time for the double silicone-oil-layer centrifugation

system was estimated to be 2.0 s by comparing oxaloacetate uptake

measured in the double layer system and those obtained using a single

layer system with different time points. Stromal spaces were deter-mined by incubation with 3.7 kBq [U-14C]sorbitol (ICN Biomedicals,

Costa Mesa, CA, U.S.A.) and 26.9 kBq 3H2O (Moravek Biochemicals,

California, U.S.A.) (Heldt 1980). Average stromal volumes for BSC

and MC chloroplasts were 39.1 and 24.4 l (mg Chl)1, respectively.

The chlorophyll concentration was determined in 96% ethanol (Win-

termans and De Mots 1965).

Acknowledgments

We wish to thank Dr. Michihiro Kasahara (Teikyo University) for

the generous gift of pTV3e vector, and Dr. Junji Yamaguchi (Hokkaido

University) and Dr. Kyoko Toyofuku for the technical advices for yeast

expression. This work was supported by a Grant-in-Aid for Scientific

Research (C) (Grant No. 14540593).

References

Arnon, D.I. and Hoagland, D.R. (1940) Crop production in artificial solutions

and soils with special reference to factors influencing yield and absorption of

inorganic nutrients. Soil Sci. 50: 463471.

Day, D.A. and Hatch, M.D. (1981) Dicarboxylate transport in maize mesophyll

chloroplasts.Arch. Biochem. Biophys. 211: 738742.

Emanuelsson, O., Nielsen, H., Brunak, S. and von Heijne, G. (2000) Predicting

subcellular localization of proteins based on their N-terminal amino acid

sequence.J. Mol. Biol. 300: 10051016.

Fischer, K., Arbinger, B., Kammerer, B., Busch, C., Brink, S., Wallmeier, H.,

Sauer, N., Eckerskorn, C. and Flgge, U.-I. (1994) Cloning and in vivo

a

a

a

sa

s

y

,

pp

j

asg

a
http://-/?-http://-/?-http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://pcp.oxfordjournals.org/http://-/?-http://-/?-


13/14


expression of functional triose phosphate/phosphate translocators from C3-

and C4-plants: evidence for the putative participation of specific amino acid

residues in the recognition of phosphoenolpyruvate. Plant J. 5: 215226.

Flgge, U.-I. (2000) Metabolite transport across the chloroplast envelope of C3-

plants. In Photosynthesis: Physiology and Metabolism. Edited by Leegood,

R.C., Sharkey, T.D. and von Caemmerer, S. pp. 137152. Kluwer Academic

Publishers, Dordrecht.Flgge, U.I., Stitt, M. and Heldt, H.W. (1985) Light-driven uptake of pyruvate

into mesophyll chloroplasts from maize. FEBS Lett. 183: 335339.

Flgge, I.U., Woo, K.C. and Heldt, H.W. (1988) Characteristics of 2-oxolutarate

and glutamate transport in spinach chloroplasts.Planta 174: 534541.

Furbank, R.T., Hatch, M.D. and Jenkins, C.L.D. (2000) C4 photosynthesis:

mechanism and regulation.In Photosynthesis: Physiology and Metabolism.

Edited by Leegood, R.C., Sharkey, T.D. and von Caemmerer, S. pp. 435457.

Kluwer Academic Publishers, Dordrecht.

Glvez, S., Lancien, M. and Hodges, M. (1999) Are isocitrate dehydrogenases

and 2-oxoglutarate involved in the regulation of glutamate synthesis? Trends

Plant Sci. 4: 484490.

Gross, A., Brckner, G., Heldt, H.W. and Flgge, U.-I. (1990) Comparison of

the kinetic properties, inhibition and labeling of the phosphate translocators

from maize and spinach mesophyll chloroplasts.Planta 180: 262271.

Hallick, R.B., Chelm, B.K., Gray, P.W. and Orozco, E.M.J. (1977) Use of aur-

intricarboxylic acid as an inhibitor of nucleases during nucleic acid isolation.Nucleic Acids Res. 4: 30553064.

Harel, E., Lea, P.J. and Miflin, B.J. (1977) The localisation of enzymes of nitro-

gen assimilation in maize leaves and their activities during greening. Planta

134: 195200.

Hatch, M.D., Drscher, L., Flgge, U.I. and Heldt, H.W. (1984) A specific trans-

locator for oxaloacetate transport in chloroplasts.FEBS Lett. 178: 1519.

Heineke, D., Riens, B., Grosse, H., Hoferichter, P., Peter, U., Flgge, U.-I. and

Heldt, H.W. (1991) Redox transfer across the inner chloroplast envelope

membrane. Plant Physiol. 95: 11311137.

Heldt, H.W. (1980) Measurement of metabolite movement across the envelope

and of the pH in the stroma and the thylakoid space in intact chloroplasts.

Methods Enzymol. 69: 604613.

Izui, K., Ishijima, S., Yamaguchi, Y., Katagiri, F., Murata, T., Shigesada, K.,

Sugiyama, T. and Katsuki, H. (1986) Cloning and sequence analysis of cDNA

encoding active phosphoenolpyruvate carboxylase of the C4-pathway from

maize.Nucleic Acids Res. 14: 16151628.Jenkins, C.L.D. and Boag, S. (1985) Isolation of bundle sheath cell chloroplasts

from the NADP-ME type C4 plantZea mays: capacities for CO2 assimilation

and malate decarboxylation.Plant Physiol. 79: 8489.

Kanai, R. and Edwards, G.E. (1999) The biochemistry of C4 photosynthesis.In

C4 Plant Biology. Edited by Sage, R.F. and Monson, R.K. pp. 4987. Aca-

demic Press, San Diego.

Ku, S.B. and Edwards, G.E. (1975) Photosynthesis in mesophyll protoplasts and

bundle sheath cells of various types of C4 plants. IV. Enzymes of respiratory

metabolism and energy utilizing enzymes of photosynthetic pathways.Z.

Pflanzenphysiol. 77: 1632.

Leegood, R.C. (2000) Transport during C4 photosynthesis.In Photosynthesis:

Physiology and Metabolism. Edited by Leegood, R.C., Sharkey, T.D. and von

Caemmerer, S. pp. 459469. Kluwer Academic Publishers, Dordrecht.

Leegood, R.C. (2002) C4 photosynthesis: principles of CO2 concentration and

prospects for its introduction into C3 plants.J. Exp. Bot. 53: 581590.

Liu, L., Maillet, D.S., Frappier, R.H., Walden, D.B. and Atkinson, B.G. (1995)Characterization, chromosomal mapping, and expression of different polyu-

biquitin genes in tissues from control and heat-shocked maize seedlings.Bio-

chem. Cell Biol. 73: 1930.

McGookin, R. (1984) RNA extraction by the guanidine thiocyanate procedure.

In Methods in Molecular Biology. Edited by Walker, J.M. pp. 113116.

Humana Press, New Jersey.

Menzlaff, E. and Flgge, U.-I. (1993) Purification and functional reconstitution

of the 2-oxoglutarate/malate translocator from spinach chloroplasts.Biochim.

Biophys. Acta 1147: 1318.

Miyao, M. (2003) Molecular evolution and genetic engineering of C4 photosyn-

thetic enzymes.J. Exp. Bot. 54: 179189.

Monson, R.K. (1999) The origins of C4 genes and evolutionary pattern in the C4metabolic phenotype.In C4 Plant Biology. Edited by Sage, R.F. and Monson,

R.K. pp. 377410. Academic Press, San Diego.

Moore, R. and Black, C.C. (1979) Nitrogen assimilation pathways in leaf meso-

phyll and bundle sheath cells of C4 photosynthesis plant formulated from

comparative studies withDigitaria sanguinalis (L.) Scop. Plant Physiol. 64:

309313.

Neuhaus, H.K. and Wagner, R. (2000) Solute pores, ion channels, and metabo-

lite transporters in the outer and inner envelope membranes of higher plant

plastids.Biochim. Biophys. Acta 1465: 307323.Nishizawa, K., Shimoda, E. and Kasahara, M. (1995) Substrate recognition

domain of the Gal2 galactose transporter in yeast Saccharomyces cerevisiae

as revealed by chimeric galactose-glucose transporters. J. Biol. Chem. 270:

24232426.

Noctor, G. and Foyer, C.H. (2000) Homeostasis of adenylate status during pho-

tosynthesis in a fluctuating environment.J. Exp. Bot. 51: 347356.

Ohnishi, J. and Kanai, R. (1983) Differentiation of photorespiratory activity

between mesophyll and bundle sheath cells of C4 plants. I. Glycine oxidation

by mitochondria. Plant Cell Physiol. 24: 14111420.

Ohnishi, J. and Kanai, R. (1987a) Pyruvate uptake by mesophyll and bundle

sheath chloroplasts of a C4 plant, Panicum miliaceum L. Plant Cell Physiol.

28: 110.

Ohnishi, J. and Kanai, R. (1987b) Na+-induced uptake of pyruvate into meso-

phyll chloroplasts of a C4 plant, Panicum miliaceum. FEBS Lett. 219: 347

350.

Ohnishi, J. and Kanai, R. (1990) Pyruvate uptake induced by a pH jump in mes-ophyll chloroplasts of maize and sorghum, NADP-malic enzyme type C4 spe-

cies. FEBS Lett. 269: 122124.

Page, R.D. (1996) TreeView: An application to display phylogenetic trees on

personal computers. Comp. Appli. Biosci. 12: 357358.

Picault, N., Palmieri, L., Pisano, I., Hodges, M. and Palmieri, F. (2002) Identifi-

cation of a novel transporter for dicarboxylates and tricarboxylates in plant

mitochondria. Bacterial expression, reconstitution, functional characteriza-

tion, and tissue distribution.J. Biol. Chem. 277: 2420424211.

Pos, K.M., Dimroth, P. and Bott, M. (1998) The Escherichia coli citrate carrier

CitT: a member of a novel eubacterial transporter family related to the 2-

oxoglutarate/malate translocator from spinach chloroplasts.J. Bacteriol. 180:

41604165.

Renn, P., Dreen, U., Hebbeker, U., Hille, D., Flgge, U.-I., Westhoff, P. and

Weber, A.P.M. (2003) TheArabidopsis mutant dctis deficient in the plastidic

glutamate/malate translocator DiT2.Plant J. 35: 316331.

Rothermel, B.A. and Nelson, T. (1989) Primary structure of the maize NADP-dependent malic enzyme.J. Biol. Chem. 264: 1958719592.

Sakakibara, H., Kawabata, S., Hase, T. and Sugiyama, T. (1992) Differential

effects of nitrate and light on the expression of glutamine synthetases and

ferredoxin-dependent glutamate synthase in maize. Plant Cell Physiol. 33:

11931198.

Sambrook, J. and Russell, D.W. (2001)Molecular Cloning: A Laboratory Man-

ual, 3rd edn. Cold Spring Harbor Laboratory Press, New York.

Sheen, J.-Y. and Bogorad, L. (1986) Expression of the ribulose-1, 5-bisphos-

phate carboxylase large subunit gene and three small subunit genes in two cell

types of maize leaves.EMBO J. 5: 34173422.

Sugiyama, T. (1998) Nitrogen-responsive expression of C4 photosynthesis genes

in maize.In Stress Responses of Photosynthetic Organisms. Edited by Satoh,

K. and Murata, N. pp. 167180. Elsevier Science, Amsterdam.

Taniguchi, M. and Sugiyama, T. (1997) The expression of 2-oxoglutarate/malate

translocator in the bundle-sheath mitochondria of Panicum miliaceum, a

NAD-malic enzyme-type C4 plant, is regulated by light and development.Plant Physiol. 114: 285293.

Taniguchi, M., Taniguchi, Y., Kawasaki, M., Takeda, S., Kato, T., Sato, S.,

Tabata, S., Miyake, H. and Sugiyama, T. (2002) Identifying and characteriz-

ing plastidic 2-oxoglutarate/malate and dicarboxylate transporters inArabi-

dopsis thaliana. Plant Cell Physiol. 43: 706717.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G.

(1997) The ClustalX windows interface: flexible strategies for multiple

sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24:

48764882.

Weber, A. and Flgge, U.-I. (2002) Interaction of cytosolic and plastidic nitro-

gen metabolism in plants.J. Exp. Bot. 53: 865874.

Weber, A., Menzlaff, E., Arbinger, B., Gutensohn, M., Eckerskorn, C. and

Flgge, U.-I. (1995) The 2-oxoglutarate/malate translocator of chloroplast

envelope membranes: Molecular cloning of a transporter containing a 12-

a

a

a

sa

s

y

,

pp

j

asg

a


14/14


helix motif and expression of the functional protein in yeast cells.Biochemis-

try 34: 26212627.

Wintermans, J.F.G.M. and De Mots, A. (1965) Spectrophotometric characteris-

tics of chlorophylls and their pheophytins in ethanol.Biochim. Biophys. Acta

109: 448453.

Woo, K.C., Flgge, U.I. and Heldt, H.W. (1987) A two-translocator model for

the transport of 2-oxoglutarate and glutamate in chloroplasts during ammo-

nia assimilation in the light. Plant Physiol. 84: 624632.

Wyrich, R., Dressen, U., Brockmann, S., Streubel, M., Chang, C., Qiang, D.,

Paterson, A.H. and Westhoff, P. (1998) The molecular basis of C4 photosyn-

thesis in sorghum: isolation, characterization and RFLP mapping of meso-

phyll- and bundle-sheath-specific cDNAs obtained by differential screening.

Plant Mol. Biol. 37: 319335.

Yakura, K. and Tanifuji, S. (1983) Molecular cloning and restriction analysis of

EcoRI-fragments ofVicia faba rDNA. Plant Cell Physiol. 24: 13271330.

(Received July 23, 2003; Accepted December 10, 2003)

a

a

a

sa

s

y

,

pp

j

asg

a

Documents

Dit2 Plant Cell Physiol 2004 Taniguchi 187 200