Enhancer and Promoter Element Interactions Dictate Cyclic Adenosine Monophosphate Mediated and Cell-Specific Expression of the Glycoprotein Hormone α-Gene

Enhancer and Promoter ElementInteractions Dictate CyclicAdenosine MonophosphateMediated and Cell-SpecificExpression of the GlycoproteinHormone a-Gene

J. Larry Jameson*, Alvin C. Powerst, Gloria D. Gallagher, andJoel F. Habener

Laboratory of Molecular Endocrinology (A.C.P., J.F.H.)and the Thyroid Unit (J.L.J., G.D.G.)Massachusetts General Hospitaland Howard Hughes Medical Institute,Harvard Medical SchoolBoston, Massachusetts 02114

The glycoprotein hormone a-gene is preferentiallyexpressed in placental cell lines, but it is also ex-pressed in several other cell lines indicating that thedifferential activity of the a-gene regulatory ele-ments in various cell types is more quantitative thanqualitative. The 5'-flanking region of the a-genecontains several distinct DNA regulatory sequencesincluding an upstream regulatory element [(URE)-181 to -150 base pairs (bp)] that stimulates basalexpression and an 18 bp twice-repeated cAMP-re-sponsive element [(CRE) -146 to -111 bp]. Weconstructed an array of fusion genes containing theURE and/or the CRE linked to different truncatedpromoters [a-gene, somatostatin (SRIF), glucagon,Simian Virus 40]. These constructions were tran-siently expressed in placental, fibroblast, or islet celllines to identify regulatory sequences involved incell-specific expression as well as interactions be-tween the URE, the CRE, and different promoterelements. The URE, CRE, and a-promoter elementscontribute approximately 3-, 6-, and 5-fold, respec-tively, to preferential expression in JEG-3 cells. InJEG-3 cells, the URE is strictly dependent on theCRE for activity, but it functions in a promoter-inde-pendent manner. In contrast, the CRE is markedlypromoter dependent. When linked to heterologousenhancers, the a-promoter is more active in JEG-3cells than in other cell lines, thereby contributingsubstantially to preferential expression in placentalcells. Although the CREs derived from the a andSRIF genes both activate expression of the a pro-moter, only the aCRE activates the SRIF promoter inJEG-3 cells. Thus, the a and SRIF CREs are not

0888-8809/89/0763-0772$02.00/0Molecular EndocrinologyCopyright © 1989 by The Endocrine Society

entirely interchangeable and enhancer-promoter in-teractions can dramatically influence patterns ofcell-specific expression. These studies indicate thatenhancer-promoter combinations determine prefer-ential expression of the a-gene in JEG-3 cells. (Mo-lecular Endocrinology 3: 763-772, 1989)

INTRODUCTION

The glycoprotein hormone family includes the pituitaryhormones TSH, LH, and FSH as well as the placentalhormone, CG. Each of the glycoprotein hormones areheterodimers that contain distinct a- and j8-subunits (1).The a-subunit is encoded by a single gene and iscommon to each of the glycoprotein hormones (2). Incontrast, the /3-subunits are unique and are encodedby separate genes (3).

The a-gene is expressed in several different cell typesand is subject to regulation by a myriad of differentfactors involved in the production and secretion of thevarious glycoprotein hormones (3). For example, the a-gene is expressed in two different pituitary cell types,gonadotropes and thyrotropes, in which the hormonalinfluences affecting a-gene expression are quite differ-ent, reflecting the roles of LH and FSH in reproductionand TSH in the regulation of thyroid hormones. The a-gene is also expressed very early in fetal developmentin the synctiotrophoblast cells of the placenta whichproduce CG, a hormone that maintains the corpusluteum of pregnancy. In addition to production of gly-coprotein hormones in normal physiology, a number ofneoplasms produce the a- and j8-subunits of CG, allow-ing this hormone to be used as a marker of tumoractivity (4, 5). In some neoplasms, the a-subunit is

763

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 31 August 2014. at 08:08 For personal use only. No other uses without permission. . All rights reserved.

MOL ENDO-1989764

Vol 3 No. 5

produced in the absence of /?-subunits (5), leading tothe concept that there is less stringent control of a-gene expression than /3-subunit gene expression.

We are interested in defining regions of the humana-subunit gene that regulate its expression in variouscell types and in response to different hormonal signals.Some of the regulatory DNA sequences of the 5'-flanking region of the a-gene have already been definedby analyses of the effects of deletional mutagenesis ontranscriptional activity in transient expression assays(6-11). The a-gene 5'-flanking region contains at leastthree different functional domains (8-10). A basal pro-moter region contains canonical sequences for a TATAbox and CCAAT box elements. This region, subse-quently referred to as the a-gene promoter, is notsufficient for transcription without additional upstreamregulatory sequences (9, 10). A second functional do-main in the a-gene involves two copies of a cAMP-response element (CRE) that contains a palindrome 5'TGACGTCA 3'. The a-gene CREs are orientation in-dependent and function when moved away from thepromoter, albeit with lower activity (6, 7, 9). Adjacentto the CREs, there is a third domain, previously de-scribed as the upstream regulatory element (URE) (10).Deletion of this sequence reduces the level of basaltranscription but does not affect the degree of cAMP-responsiveness (9,10). Unlike the CRE, the URE doesnot function when tested using a heterologous pro-moter such as the thymidine kinase promoter (9). How-ever, in combination with the CREs, the URE stimulatesbasal transcription from either the a-gene promoter orthe thymidine kinase promoter in placental cells (9).

Nuclear proteins from choriocarcinoma cells bind toboth the CRE and URE domains and there is evidencefor cooperative binding to sequences containing bothdomains (10). Although protein(s) that bind to the CREare found in many cell types (9,12), protein binding andfunctional activity of the URE has only been observedin choriocarcinoma cells (9), suggesting that the UREmay confer cell-specific expression.

In this report, we examined interactions between a-gene regulatory DNA elements and different promotersthat are normally expressed in distinct cell types. Wefind that expression in different cell lines cannot beattributed to a single tissue-specific regulatory element.Rather, three distinct domains contribute independentlyto preferential expression of the a-gene in a placentalcell line. Moreover, interactions between enhancer andpromoter elements can either activate or restrict thefunction of a given regulatory element in different celltypes, thereby adding an additional level of control tocell-specific expression.

RESULTS

Transient Expression of a-ChloramiphenicolAcetyltransferace (aCAT) Fusion Genes in DifferentCell Lines

Previous studies have shown that aCAT expression isrelatively restricted to cell lines that product the a-

subunit endogenously (7, 9). However, examination ofa-gene expression in a number of cell lines of endocrineand nonendocrine origin revealed several cell lines inaddition to JEG-3 cells that express aCAT fusion genesat relatively high levels (Table 1). The activity of -846aCAT was compared in the basal and cAMP-stimulatedstate with that of a strong viral enhancer and promoter(rous sarcoma virus, RSVCAT) to assess relative activ-ities of aCAT in various cell lines. Compared toRSVCAT, expression of aCAT varies widely from lowlevels of basal activity in INR1-G9 (1%) and Y-1 (2%)cells to relatively high levels in GH4 (5%), BHK (21%),RIN1027-B2 (100%), and JEG-3 (110%) cells. With theexception of BHK cells, these cell lines are relativelyrestrictive for expression of several other mammaliangenes [e.g. somatostatin (SRIF), glucagon (Glue), CGjS](data not shown), indicating that regulatory elements inthe 5'-flanking region of the a-gene are active in avariety of cell types.

The degree of stimulation of aCAT expression bytreatment with 8-bromo-cAMP is also variable in thedifferent cell lines. In some cell lines, such as INR1-G9and GH4 cells, cAMP causes only 2- to 4-fold stimula-tion of aCAT expression, whereas in the other cell lines,the degree of cAMP stimulation of aCAT expressionranges from 8- to 50-fold. After stimulation with 8-bromo-cAMP, aCAT activity in three of the cell lineswas equal to or greater than expression of RSVCAT.In several other cell lines such as HeLa, CV-1, andMCF-7 cells, the activity of aCAT was substantiallylower than that of RSVCAT, even after cAMP stimula-tion (data not shown). These data indicate that -846aCAT is expressed at relatively high levels in a numberof cell lines of both endocrine and nonendocrine originand that the degree of cAMP-stimulated expressionvaries widely in different cell lines. Thus, aCAT is ex-pressed preferentially in JEG-3 cells, but expression isnot restricted to these cells and it is therefore not cellspecific. We chose a subset of these cell lines for furtherstudy to examine the contributions of a-gene enhancerand promoter elements to expression in different cells.

Properties of the URE and CRE Cassettes

The various individual and combined URE and CREcassettes are illustrated in Fig. 1. The borders of theURE and CRE regions were selected based on DNaseI protection analyses (9, 10). The cassettes containcompatible cohesive ends to allow insertion of one ormore elements upstream of various truncated pro-moters (Fig. 1B). Initially, the properties of the putativeregulatory cassettes were tested with the a-promoterin JEG-3 cells to confirm that they were functional whencombined with the homologous a-promoter (Fig. 2).The truncated a-promoter (-100 aCAT) has negligibleexpression in the absence of additional regulatory ele-ments. As shown previously (7), cassettes that containeither single or repeated copies of an 18 base pair (bp)a-gene CRE element activate both basal and cAMP-stimulated expression. In contrast, a URE cassette


Regulation of Glycoprotein Hormone a-Gene Expression 765

Table 1. Expression of -846 «CAT in Different Cell Lines

Cell Line

JEG-3BHKINR1-G9RIN1027-B2Y-1GH4

Origin

Human placentaHamster fibroblastHamster isletRat isletMouse adrenalRat pituitary

CAT Activity (%

-CAMP

11021

1100

25

RSVCAT)"

+CAMP

1202164

2

10615

Fold Stimulationby 8-Bromo-

cAMP

11x8x2x

53x3x

a Data are the mean of triplicate transfections that differ by less than 20%. There was negligible stimulation of RSVCAT aftertreatment with 8-bromo-cAMP. RIN1027-B2 cells were not studied with 8-bromo-cAMP treatment.

(-187 to -151 bp) does not stimulate basal expressionof -100 «CAT and exhibits no discernable cAMP re-sponsiveness. However, insertion of the URE cassetteupstream of the CRE further activates basal expressionwithout altering the degree of responsiveness to cAMP.These data confirm previous studies (9) that demon-strated that the activity of the URE is not manifest inJEG-3 cells unless it is linked to the CRE. In this respect,the functional characteristics of the regulatory cas-settes are similar to those of the native gene, facilitatinganalyses of their activity with other promoters and inother cell lines.

Activation of Heterologous Promoters by a-GeneEnhancers in JEG-3 Cells

a-Gene sequences that contain the CREs and UREwere linked to five different promoters to assess thecontributions of promoter elements to expression inJEG-3 cells. The selected heterologous promoters en-compass a variety of phenotypic patterns of expression.The Simian virus 40 (SV40) promoter is expressed inmany cell types, including JEG-3 cells and it is receptiveto a wide variety of enhancer elements. The SRIF andGlue promoters are not expressed in JEG-3 cells whenlinked to their own enhancers (see below). Like a-promoter, the SRIF promoter is responsive to cAMP-response elements (13). The CG/3 promoter is normallyexpressed in JEG-3 cells, albeit at lower levels than thea-promoter(14).

The activities of the various promoters when linkedto a-enhancer elements are summarized in Table 2.The truncated promoters, without enhancer elements,were expressed at very low levels (1-2% of -846aCAT). The increase in basal expression conferred todifferent promoters by the a-enhancers varies widely.Expression from the SV40, Glue, and CGjS promotersis increased 2- to 3-fold by a-enhancer elements.Expression from the SRIF and a-promoters is increased6- and 18-fold, respectively by a-enhancers. Thus, inJEG-3 cells the a and SRIF promoters are most recep-tive to a-gene enhancers. Furthermore, because theSRIF promoter is not expressed in JEG-3 cells whenlinked to its own regulatory elements, the a-gene en-hancer sequences between -236 and -100 bp confer

expression in placental cells to a gene that is otherwiseinactive in this cell line.

In contrast to the variable effects of the a-enhancerson basal expression, the degree of cAMP stimulation issimilar for the different promoters and varies from 7-fold for the CG/3 promoter to 18-fold for the a-promoter.Thus, the different promoters predominantly influencethe level of basal expression, whereas the extent ofcAMP responsiveness is promoter independent. Fromthese comparisons, it is apparent that the a-promotercontributes a major component (as much as 5-fold) toselective expression of the a-gene in JEG-3 cells.

Enhancer Contributions to Preferential Expressionin JEG-3 Cells

The previous experiments indicate a clear role of the «-promoter in directing preferential expression in JEG-3cells. However, it is also apparent that the a-geneenhancers can activate expression of certain genesthat are otherwise inactive in JEG-3 cells (e.g. SRIF;Tables 2, 3). We attempted to dissect the relativecontributions of the CREs vs. the URE to expression inJEG-3 cells by inserting these regulatory elements aloneor in combination upstream of four different promoters(Table 3). The URE as an independent element fails toactivate expression from any of the promoters in JEG-3 cells. In contrast, the CREs increase basal expressionof the a and SRIF promoters, but their activity is notreadily detected when linked to the Glue or SV40 pro-moters. However, when stimulated with cAMP, CREactivation of the Glue and SV40 promoter is detectedat low levels (data not shown). Addition of the URE tothe CREs raises the level of basal expression from eachof the promoters by about 3-fold. Thus, in JEG-3 cells,the CREs can activate a wide range of cellular and viralpromoters, but in a manner that is very promoter de-pendent. The URE activates basal expression in apromoter independent manner, but it has a strict de-pendence on the CRE for activity. Therefore, CRE-promoter interactions play a dominant role in determin-ing the basal level of expression, and the URE amplifiesthis response by approximately 3-fold in a promoter-independent manner.


MOL ENDO-1989766

Vol 3 No. 5

A Regulatory Elements

a URE + CREs (Bam HI) ACTCTCTTTTCATGGGCTGACCTTGTCGTCACCATCACCTGAAAAT

GGCTCCAAACAA |AAATGACCTAAGGGTTGAAACAA| GATAAGATC

AARTTGACGTCATGGTAAAAATTGACGTCATGGTAATTACACCAAGT (BAM HI)

• * • -100

a URE (Bam HI)TCCAAACAA|AAATGftCCTAflGGGTTGAAACfiA|GATAA (Bgl II)

a CRE Repeats (Bam HI) AAATTGACGTOtTGGTAfiAfiATTGRCGTCATGGTAA (Bgl II)

-128 -HI(I. CRE (B°m HI) AAATTGACGTCATGGTAA(Bgl II)

S M S CRE (Bam HI) CCTTGGCTGACGTCAGAGAGAGA (Bgl II)

-168Bam HI

-100Bgl II

I—

-128Bgl II

• • • •

-65 orBam

I

ji_n

_ [-42HI f-

_ [

[

FTLJ

+ 44— •

CAT ;

+ 54

+ 54— •

+72— •

CAT ;

CAT |

CAT

Promoters

OC Promoter

SMS Promoter

Glucagbn Promoter

SV40 Promoter

Fig. 1. Nucleotide Sequences of Regulatory Elements in theGlycoprotein Hormone a and SRIF (SMS) Genes

A, The sequences are numbered relative to transcriptionalinitiation sites. Linker sites are shown in parentheses. TheURE sequences are denoted by boxed areas and the con-served CRE palindrome is underlined with arrows. The elementaURE + CREs was derived from a restriction enzyme fragmentfrom the a-gene. The remainder of the sequences were syn-thesized as complementary strands of DNA. B, Expressionvectors containing truncated promoter regions from the humana-gene, rat SRIF (SMS) gene, rat Glue gene, and SV40 earlygene are illustrated schematically. Each of the vectors arelinked to the bacterial CAT gene. The numbering system forthe promoter sequences is relative to the transcriptional initi-ation site, except for the SV40 sequences which are denotedaccording to conventional coordinates. The locations of the 21bp repeats in the SV40 promoter are indicated by boxes. BglWor BamH\ linker sites used for cloning are indicated.

Activity of a-Enhancer and Promoter Elements inDifferent Cell Lines

As shown in Table 1, aCAT fusion genes are expressedin several cell lines other than choriocarcinoma cells.The regulatory elements involved in expression in othercells might be different from those involved in expres-sion in JEG-3 cells. We therefore examined the activitiesof the URE and CREs in BHK fibroblasts and INR1-G9islet cells in comparison with JEG-3 choriocarcinoma

cells (Table 3). The URE and CRE enhancers werelinked alone or in combination to the a, SRIF, Glue, orSV40 promoters. The activity of the a-gene enhancerelements can thereby be assessed in combination withthe SRIF or Glue promoters which are poorly expressedin JEG-3 cells, but are very active in INR1-G9 islet cells.Similarly, the interactions of enhancer elements withthe SV40 promoter can be examined in all three celllines in which the SV40 promoter is actively expressedwhen linked to its own enhancer.

The activity of the aCREs are both promoter and cell-type specific. For example, the CREs markedly (at least9-fold) activate expression of the a-promoter in JEG-3cells, but only weakly activate its expression in BHK orINR1-G9 cells. These properties are not due to inactivityof the aCREs in cell lines other than JEG-3 cells asindicated by the fact that the aCREs markedly activate(36-fold) the SRIF promoter in INR1-G9 cells. However,the aCREs do not activate either the a or Glue pro-moters in INR1-G9 cells despite the fact that both ofthese promoters are active in this cell line when linkedto other enhancers. Thus, promoter elements differen-tially restrict or enhance responses to the CREs indifferent cell lines.

The URE element alone is insufficient to activate anyof the truncated promoters in JEG-3 cells. However,when paired with the aCREs, the URE accounts for a2- to 4-fold increase in expression independent of thepromoter to which the enhancers are linked. In othercell lines, the URE elements alone can act as a weakpositive transcription element. For example, in BHKcells, the URE stimulates the a-promoter by 2-fold andthe SV40 promoter by 15-fold, but it does not activatethe SMS promoter. Thus, in BHK cells and to a lesserdegree in INR1-G9 cells, URE sequences appear to befunctional in the absence of a CRE suggesting that theinterdependence of the URE and CRE may be uniqueto JEG-3 cells.

The activity of the a-promoter in the different celllines was also assessed by insertion of the SV40 en-hancer upstream of the a-promoter and comparing theactivity of this construction with that of the SV40 en-hancer linked to its native SV40 promoter. In JEG-3cells, the SV40 enhancer-stimulated activity is 3.5-foldgreater when linked to the a-promoter in comparisonwith the SV40 promoter. In contrast to JEG-3 cells,SV40 enhancer activity in BHK and INR1-G9 cells isgreater when linked to the SV40 promoter than the a-promoter. These results are consistent with the otherdata (Table 2) that indicate a prominent role for the a-promoter in preferential expression in JEG-3 cells.

Comparison of Properties of a and SRIF CREs andPromoters in JEG-3 Cells

It is particularly informative to compare the propertiesof enhancers and promoters in the a and SRIF genes.The rat SRIF gene contains a functional CRE (13) thatincludes a 8 bp element between -48 and -41 bp thatis identical to the 8 bp palindrome (TGACGTCA) in the



CAT Activity (%-846 a CAT)

10 20 30 40 50 + cAMP

-146

URE CRE CRE

-187 | 1 » » -111

Fig. 2. Properties of URE and CRE Cassettes in JEG CellsDNA regulatory elements were inserted upstream from the a-promoter as described in Fig. 1. The a-promoter is indicated by a •representing sequences between -100 and +44. The CREs are shown as arrows and the URE is indicated by a M. The SV40early enhancer is indicated by a filled-in oval. Basal CAT activity is shown relative to -846 aCAT and is the mean of triplicatetransfections. Fold stimulation of CAT expression after treatment with 1 mM 8-bromo-cAMP for 20 h is shown at the right side ofthe figure.

Table 2. Activity of a-Gene Regulatory Elements with Different Promoters in JEG-3 Cells

Promoter* a-Gene Enhancers"

CAT Activity(Fold Stimulation by

Enhancers)0Fold Stimulation

by 8-Bromo-

aSRIFSV40GlueCG)3

-236 t o - 1 0 0-236 t o - 1 0 0-846 to +44-236 t o - 1 0 0-846 to +44

-cAMP

186332

+CAMP

32191482913

181516107

" The truncated promoters are illustrated in Fig. 1 except for the CG/3 promoter which includes 282 bp of 5'-flanking sequence and273bpofexon1 (14).b a-Gene enhancer elements were inserted upstream of each of the truncated promoters as described in Materials and Methods.The a-gene elements between -236 and -100 bp were inserted upstream of the a, SRIF and Glue promoters. a-Gene sequencesbetween -846 and +44 were inserted upstream of the SV40 and CG/3 promoters. All constructions contain both copies of the a-gene CREs and the URE in reverse orientation relative to the promoters.c CAT activity is relative to that of the truncated promoters without enhancer elements, which were assigned on activity of 1. Dataare the mean of triplicate transfections that differ by less than 20%.

a-gene CRE (Fig. 1). As shown in Table 3, both the a

and the SRIF promoters are receptive to stimulation by

the aCRE in JEG-3 cells. To evaluate whether the a

and SRIF CREs are interchangeable in the context of

their native flanking bases, the properties of the CREs

were examined in JEG-3 cells both in the absence and

in the presence of treatment with 8-bromo-cAMP (Fig.

3).In -42 SRIF, six bases of the CRE have been deleted

and both basal and cAMP-stimulated expression are

very low (Fig. 3A). -65 SRIFCAT, created by Bal 31

deletion, contains the entire SRIFCRE as well as 17

additional upstream bases. Although basal activity is 2-

fold greater than that of -42 SRIFCAT, -65 SRIFCAT

is unresponsive to cAMP treatment in JEG-3 cells (Fig.

3B). Thus, when linked to its native promoter, the

SRIFCRE is inactive in JEG-3 cells.

Unlike the aCRE, insertion of the URE upstream of

the SRIFCRE in -65 SRIFCAT does not stimulate basal

expression. The lack of stimulation by the URE in this

construction is not attributable to the SRIF promoter.

Insertion of an a-gene sequences (-236 to -100 bp)


MOL ENDO-1989768

Vol 3 No. 5

Table 3. Enhancer-Promoter Interactions in Different Cell Lines

Promoter"CAT Activity (%-846 aCAT)"

JEG-3

19325565

100

cvj

5

CVI

1344971

1114

<1

<-,<1<1216

BHK

810169354

100

47235689270230453—

————

<-,3151068

INR1-G9

5571089—100

10362263932126018624

116832333001394

377550100116

-100«CAT+aCREs+URE+URE + aCREs+SV40 enhancer+SRIFCRE

-846 aCATSRIF

-42 SRIFCAT+aCREs+URE+URE + aCREs+SRIFCRE+URE + SRIFCRE+URE + aCREs + SRIFCRE

-900 SRIFCATGlue

-168GlucCAT+aCREs+URE+URE + aCREs

-HOOGIucCATSV40

pAIOCATH-aCREs+URE+URE + aCREs+SV40 enhancer

—, Not performed.8 The truncated promoters and enhancer cassettes are illustrated in Fig. 1. Enhancers were inserted alone or in the indicatedcombinations upstream of the truncated promoters as described in Materials and Methods.b CAT activity was determined in the absence of 8-bromo-cAMP and is expressed relative to the activity of -846 aCAT within agiven cell line. Results are the mean of at least triplicate transfections which differ by less than 20%.

that contain the URE and CREs upstream of either -42SRIFCAT (Fig. 3F) or -65 SRIFCAT (data not shown)activate both basal and cAMP-stimulated expressionmore than that observed with the aCREs alone (Table3).

In contrast to the SRIFCRE (Fig. 3B), a single copyof the aCRE in combination with the SRIF promoteractivates both basal and cAMP-stimulated expression.In INR1-G9 or BHK cells, the SMS promoter is equallyor more active when driven by the SRIFCRE ratherthan by the aCRE (Table 3), indicating that the SRIF-CRE/SRIF promoter construction is active in other celllines. Thus, the distinct properties of the « and SRIFCREs in JEG-3 cells reflect cell-specific influences ofthe CREs in the context of their surrounding bases.Relative to the SRIFCRE, the aCRE contributes about6-fold to preferential expression of the SRIF promoterin JEG-3 cells.

Although the SRIFCRE is not functional in JEG-3cells when linked to its own promoter (Fig. 3B), it isquite active when linked to the a promoter (Fig. 3E). Inconjunction with the a-promoter, the SRIFCRE in-

creases basal activity to a level comparable to thatobtained with the aCRE and cAMP-stimulated expres-sion is increased by 10-fold. These results suggest thatthe SMSCRE is functional in JEG-3 cells, but it requiresthe a-promoter for full activity.

Protein Binding to a-Gene URE and CRESequences

DNase I protection of the a-gene fragment between-100 and -236 bp was examined using nuclear pro-teins extracted from several different cell lines to cor-relate the activities of the regulatory elements withprotein binding. The repeated copies of the CREs areprotected (-143 to -114 bp) by extracts from two isletcell lines (RIN1027-B2, INR1-G9), an adrenal medullacell line (PC-12), and the JEG-3 cell line (Fig. 4). Thesomatostatin CRE, which is located downstream of theURE in this construction, was also protected by eachof these extracts (data not shown). Two different pro-tected regions (-161 to -150 bp; -184 to -162 bp)are identified upstream with the aCREs using extracts



JEG-3 Cells

B

-CAMP I *cAMP ' I -cAMP -CAMP • »cAMP

mm

-42 I—H CATSMS1

CAMP I .CAMP

z 1

V , ,°fetHjCAMP I •CAMP -CAMP • »cAMP

25 49 13 267

Fig. 3. Comparison of the Properties of a and SRIF (SMS)CREs in JEG-3 Cells

The structures of the expression vectors are illustratedschematically above representative CAT assays. The meanvalue for CAT assays from triplicate transfections, relative tobasal -846 aCAT, is shown at the bottom of the figures.

from JEG-3 cells. Both regions are selectively protectedby JEG-3 extracts but not by extracts from RIN1027-B2 or INR1-G9 cells. URE 1 (-161 to -150), but notURE 2 (-184 to -162) is also protected by extractsfrom PC-12 cells. Thus, proteins that bind to the CREsare ubiquitous whereas proteins that bind to the a-geneupstream elements vary in different cell lines and aremost abundant in JEG-3 cells.

DISCUSSION

Transient expression of the a-gene is not restricted toJEG-3 cells and our results indicate that the differentialactivity of the a-gene elements in various cell types ismore quantitative than it is qualitative. We find that atleast three different elements are involved in directingmaximal expression of the a-gene in JEG-3 cells. TheURE activates a-gene expression in JEG-3 cells, but itis strictly dependent upon the aCRE for activity. Theactivity of the URE in JEG-3 cells is, however, inde-pendent of the promoter to which it is linked. The a-gene CRE can function as an independent regulatory

CRE

§1 . ^Fig. 4. DNase I Protection of «-Gene Regulatory Elements byProteins Extracted from Different Cell Types

The D N A is labeled on the noncoding strand of a construc-tion containing the a-gene sequence (-100 to -236) in theinverted orientation relative to -65 SRIFCAT. Fifty microgramsof nuclear protein extract were used for each of the indicatedcell types except JEG-3 in which 20 M9 protein were added.G and C+T chemical cleavage reactions are shown at the leftof the figure and are numbered relative to the transcriptionalstart site. The protected domains and a-gene regulatory ele-ments are illustrated schematically. URE domains 1 and 2together comprise the URE element used for studies of expres-sion.

element, but its activity is markedly restricted by pro-moters that are not normally driven by a CRE. Althoughthe aCRE exhibits low levels of activity in nonplacentalcell lines, it is preferentially active in JEG-3 cells, partic-ularly in combination with either the a or SRIF promoter.The a-gene promoter, when deleted to -100 also ex-hibits cell-specific properties in that it is preferentiallyexpressed in JEG-3 cells when linked to heterologoussequences such as the SRIF CRE or the SV40 enhan-cer. These findings justify drawing two broad conclu-sions. First, the activity of the individual a-gene elementis less than that of the combined elements and each ofthe elements contributes in part to maximal expressionin JEG-3 cells. Second, although each of the a-geneelements contributes to cell-specific expression, theirfunctional properties are highly dependent on interac-tions between different regulatory elements, and theseproperties vary in different cell lines.


MOL ENDO-1989770

Vol 3 No. 5

The properties of the a-gene elements are reminis-cent of those of regulatory elements found in othergenes. For example, there are several genes in whichtwo or more regions contribute to tissue-specificexpression. These include the human immunoglobulin(15, 16), rat insulin 1 (17), rat POMC (18), mouse aA

crystallin (19), mouse ^ antitrypsin (20), and mouse a-fetoprotein (21) genes among several others. In thesecases, the individual enhancers exhibit partial activity,and all of the defined elements are required for maximalexpression. In addition to these cellular genes, the SV40enhancer has also been found to consist of distinctdomains that exhibit maximal activity only when anindividual element is duplicated or when the discretedomains are combined (22). At least for these exam-ples, a picture is emerging in which the expression of agiven gene in some cell types and not others, is acomplex process involving multiple interacting se-quence elements (23).

We have shown previously that the core sequenceof the aCRE, TGACGTCA, represents a minimal ele-ment for CRE activity, but that substitution of the basesthat flank it on either side of the palindrome dramaticallyinfluences whether the core CRE will or will not betranscriptionally active (11). These findings emphasizethe importance of the DNA sequence context in whichthe activity of a given element is examined and suggestthat surrounding bases may influence protein recogni-tion of the core DNA element. This view is supportedby the fact that CRE elements that are active in tran-sient expression assays specifically bind proteinwhereas inactive CREs do not bind protein (11, 24).We now show that the activity of CREs is dependentnot only upon the context of the bases that immediatelysurround it, but also upon the presence or absence ofother independent DNA regulatory sequences. For ex-ample, the CREs are known to be functional in thecontext of either the native SRIF or a-gene sequences.However, the SRIFCRE is inactive in JEG-3 cells whenlinked to the SRIF promoter, but not to the a-promoter.Thus, it appears that sequences in the a-promoter arepermissive for expression of the SRIFCRE, whereassequences in the SRIF promoter are restrictive for thisCRE in JEG-3 cells. These results are in part due tofactors in JEG-3 cells as when the identical construc-tions are expressed in either fibroblast or islet cell lines,the SRIFCRE is fully active when combined with itsnative promoter, but the aCRE is no longer active whenlinked to the SRIF promoter.

We cannot exclude the possibility that differences inthe CRE/promoter combinations are due to omissionor inclusion in our regulatory elements of flanking basesthat alter the activity of the CREs. Moreover, in theconstruction of fusion genes, one must consider pos-sible influences of stereospecific alignment of enhancerand promoter elements (23). An argument against aprominent influence for these effects is that the inactiveSRIFCRE and SRIF promoter construction (-65 SRIF-CAT) is derived from Bal 31 deletion mutagenesis ratherthan by insertion of synthetic cassettes. In addition,

plasmids that were inactive in one cell type were func-tional in other cell lines indicating that the activity of theregulatory elements are not irreversibly altered duringconstruction of the fusion genes. Definitive resolutionof the basis for the differences in the functional prop-erties of the a and SRIF elements will be facilitated bypurification and characterization of the proteins thatinteract with these sequences (12, 24).

CRE binding proteins were found to be ubiquitouswhen assessed by DNase I protection analyses (Fig.4). In cell lines such as RIN1027-B2 and INR1-G9,specific CRE binding proteins are clearly present eventhough the CRE-containing plasmids exhibit minimalstimulation in response to treatment of these cells withcAMP (Table 1 and data not shown). However, theCREs do stimulate basal expression in these islet celllines (Table 3) possibly acting via CRE binding proteinsthat are constitutively activated in the absence of ex-ogenously added cAMP. In contrast to CRE binding,there are striking differences in protection of the UREusing extracts from different cell lines. JEG-3 extractsprovide strong protection of a region that encompassesthe entire URE (-184 to -150 bp). Thus, as Delegeaneet a/. (9) proposed in previous studies, selective pro-duction of URE binding proteins in placental cells mayprovide one mechanism for preferential expression ofthe a-gene in JEG-3 cells.

By interchanging various regulatory elements andpromoters, it is apparent that the processes that governa-gene expression in different cell lines cannot be at-tributed entirely to a single cell-specific regulatory ele-ment. Rather, we find that the URE, the CRE, andproximal promoter elements all exhibit properties thatcontribute to cell-preferential expression. In particular,the a-promoter plays a predominant role in activatingexpression on JEG-3 cells. In addition, we find thatcertain combinations of regulatory elements assumeunique properties in different cell types. For example,the SRIFCRE/SRIF promoter combination is active inislet cells but inactive in JEG-3 cells. Nevertheless,either SRIF element can be made functional in JEG-3cells by pairing it with the appropriate a-gene element.These findings emphasize the importance of interac-tions between apparently distinct regulatory domainsand support a model in which expression of a selectedsubset of genes in a given cell type depends uponunique combinations of DNA regulatory elements todictate cell-specific expression.

MATERIALS AND METHODS

Plasmid Constructions

Synthetic sequences, regulatory DNA elements, and relevantpromoter sequences used to prepare CAT expression vectorsare illustrated schematically in Fig. 1. The structures of severalof the derivatives of aCAT fusion genes have been describedpreviously (7, 10). Briefly, -846 aCAT contains the human «-gene 5'-flanking sequence between -846 and +44 bp linkedto the coding sequence of the CAT gene. Deletion mutants of



the 5'-flanking sequence were prepared from this parent vec-tor using unique restriction enzyme sites (10). The plasmida1 OOCAT has a Bgl II site introduced at position -100 in thea-gene 5'-flanking sequence to allow insertion of syntheticDNA sequences containing cohesive GATC 5'-ends (7). Plas-mids containing single (-128/-111 «1 OOCAT) or repeated(-146/-111 «CAT) copies of an a-gene 18 bp CRE havebeen described (7). Using a similar cloning strategy, additionalpairs of synthetic oligonucleotides were inserted into a1 OOCATto form -186/-151 «1 OOCAT or into —146/—111 a1 OOCATto form —186/—111 a1 OOCAT (10). A synthetic copy of theSRIF 5'-flanking sequence (-56 to -33 bp) containing its CREwas used to prepare -56 / -33 SRIFCREal OOCAT.

-900 SRIFCAT contains the rat SRIF gene 5'-flankingsequence between -900 and +54 linked to the CAT codingsequence. Deletion mutants of the 5'-flanking sequence of-900 SRIFCAT were prepared using unique restriction en-zyme sites or by digestion with Bal 31 nuclease. -65 SRIFCATcontains the SRIFCRE, TGACGTCA, between -48 to -41 bp(Fig. 1) (13). In -42 SRIFCAT, six of eight bases of theSRIFCRE have been deleted. BamHI sites at the 5'-bordersof each of these constructions allow insertion of various a-gene sequences using a cloning strategy analogous to thatused for the a-gene promoter.

-1100 GlucCAT contains approximately 1100 bp of 5'-flanking sequence and 54 bp of the untranslated sequencelinked to CAT (25). A 5'-deletion mutant to position -168 bphas reduced basal activity in the absence of upstream Gluegene elements (25). A BamHI site at the 5'-end of -168GlucCAT was used to insert various a-gene regulatory ele-ments.

The plasmid pAIOCAT is a derivative of pSV2CAT in whichthe SV40 enhancers were deleted, but the basal promoterelements and 21 bp repeated sequences were retained (26).The a-gene Bg/ll/BamHI fragment between -846 and + 44was inserted in both orientations into the unique BglW siteupstream from the SV40 promoter. Additional regulatory ele-ments were inserted into pA1 OCAT as described above. Theconstruction of plasmids containing a-gene regulatory ele-ments upstream of the CG/3-subunit gene promoter have beendescribed elsewhere (14).

Cell Culture

JEG-3 (HTB 36), CV-1 (CCL 70), Y-1 (CCL 79), and BHK (CCL10) cells were obtained from American Type Culture Collection.INR1-G9 cells, a Glue-producing rat islet cell line, were ob-tained from R. Takaki, Medical College of Oita, (Oita, Japan).GH4 rat pituitary cells were provided by Henry Kronenberg(Massachusetts General Hospital, Boston, MA). RIN1027-B2cells, a SRIF-producing rat islet cell line, were cloned from aradiation-induced rat islet cell tumor (27). JEG-3, CV-1, Y-1,and BHK cells were grown in Dulbecco's modified Eagle'smedium containing 5% fetal calf serum, 5% calf serum, peni-cillin (100 U/ml), and streptomycin (100 ng/m\). INR1-G9 andRIN1027-B2 cells were grown in RPMI media containing 10%fetal calf serum and antibiotics.

Transient Expression and CAT Assays

INR1-G9 cells were transfected in suspension using a dieth-ylaminoethyl (DEAE)-dextran mediated transfection procedure(25, 28). Cells were exposed to 5 ^g DNA and DEAE-dextran(300 nQlm\) for 15 min at room temperature, washed two timeswith Dulbecco's modified Eagle's medium containing 10% calfserum, and cultured for 48 h before lysis for CAT assays. GH4cells were transfected as monolayer cultures using DEAE-dextran (28). JEG-3, BHK, CV-1, and Y-1 cells were trans-fected by a calcium phosphate precipitation procedure using10 /xg DNA as described previously (8, 29). RIN1027-B2 cellswere transfected with 40 ^g of DNA by electroporation (330V; 960 jiFd) using a Bio-Rad Genepulsar apparatus (Bio-Rad,Richmond, CA). Plasmid DNAs were purified by two cycles of

CsCI density gradient centrifugation. DNA concentration wasdetermined by absorbance at 260 nm. DNA concentration andsupercoiled structures were confirmed by examining the DNAin ethidium bromide-stained agarose gels. In experiments inwhich 8-bromo-cAMP was added, cells were incubated for 28h after transfection and then exposed to 1 mM 8-bromo-cAMPfor 20 h before preparation of extracts for CAT assays. In theabsence of cAMP treatment, cell extracts were prepared 48 hafter transfection. CAT enzyme activities were determined bymeasuring the rate of acetylation of [14C]chloramphenicol (8,30). Cell extracts were diluted to allow measurements wihinthe linear range of the enzyme assay. A minimum of sixtransfections were performed for each experimental value.The CAT activity of replicate transfections varied by less than20%.

Cellular Protein Extract Preparations and DNase IProtection Assays

Nuclear protein extracts were prepared as described by Dig-nam et al. (31) except that Trasylol (Sigma) (100 U/ml) andphenylmethylsulfonylfluoride (0.5 ITIM) were added to each ofthe buffers. Nuclear proteins were fractionated further usingammonium sulfate precipitation (53% saturation) and DNase Iprotection assays were performed as described previously(10).

Acknowledgments

The authors are grateful to Paul Deutsch, Jacques Phillipe,and Daniel Drucker for providing plasmid constructions. Wethank Chris Albanese and Kathy Wright for assistance withnuclear extract preparations and Rose Mooradian for typingthe manuscript.

Received January 16, 1989. Accepted February 14, 1989.Address requests for reprints to: J. Larry Jameson, Thyroid

Unit, Bulfinch Basement, Massachusetts General Hospital,Boston, Massachusetts 02114.

This work was supported by PHS grants HD-23262, HD-23519 (J.L.J.), DK-25532, and DK-30457 (J.F.H.).

* Supported by Chugai and Upjohn Scholar Awards.t Supported by the Juvenile Diabetes Foundation and the

American Diabetes Association. Current address: EndocrineDivision, Vanderbilt University, Nashville, Tennessee 37232.

REFERENCES

1. Pierce JG, Parsons TF 1981 Glycoprotein hormones:structure and function. Annu Rev Biochem 50:465-495

2. Fiddes JC, Goodman HM 1981 The gene encoding thecommon alpha subunit of the four human glycoproteinhormones. J Mol Appl Genet 1:3-18

3. Chin WW 1985 Organization and expression of the gly-coprotein hormone genes. In: H Imura (ed) The PituitaryGland. Raven Press, New York, pp 103-126

4. Braunstein GD, Vaitukaitis JL, Carbone PP, Ross GT1973Ectopic production of human chorionic gonadotrophin byneoplasms. Ann Intern Med 78:39-45

5. Vaitukaitis JL 1979 Human chorionic gonadotropin—ahormone secreted for many reasons. N Engl J Med301:324-326

6. Silver BJ, Bokar JA, Virgin JB, Vallen EA, Milsted A, NilsonJH 1987 Cyclic AMP regulation of the human glycoproteinhormone a-subunit gene is mediated by an 18-base-pairelement. Proc Natl Acad Sci USA 84:2198-2202

7. Deutsch PJ, Jameson JL, Habener JF 1987 Cyclic AMPresponsiveness of human gonadotropin-a gene transcrip-


MOL ENDO-1989772

Vol 3 No. 5

tion is directed by a repeated 18-base pair enhancer, a-promoter receptivity to the enhancer confers cell-prefer-ential expression. J Biol Chem 262:12169-12174

8. Jameson JL, Deutsch PF, Gallagher GD, Jaffe RC, Ha-bener JF 1987 Trans-acting factors interact with a cyclicAMP response element to modulate expression of thehuman gonadotropin «-gene. Mol Cell Biol 7:3032-3040

9. Delegeane AM, Ferland LH, Mellon PL 1987 Tissue-spe-cific enhancer of the human glycoprotein hormone «-subunit gene: dependence on cyclic AMP-inducible ele-ments. Mol Cell Biol 7:3994-4002

10. Jameson JL, Jaffe RC, Deutsch PJ, Albanese C, HabenerJF 1988 The gonadotropin a-gene contains multiple pro-tein binding domains that interact to modulate basal andcAMP-responsive transcription. J Biol Chem 263:9879-9886

11. Deutsch PJ, Hoeffler JP, Jameson JL, Habener JF 1988Structural determinants for transcriptional activation bycAMP-responsive DNA elements. J. Biol Chem263:18466-18472

12. Montminy MR, Bilezikjian LM 1987 Binding of a nuclearprotein to the cyclic AMP response element of the so-matostatin gene. Nature 333:175-178

13. Montminy MR, Sevarino KA, Wagner JA, Mandel G, Good-man RH 1986 Identification of a cyclic-AMP-responsiveelement within the rat somatostatin gene. Proc Natl AcadSci USA 83:6682-6686

14. Jameson JL, Lindell CM 1988 Isolation and characteriza-tion of the human chorionic gonadotropin (CG) /8-subunitgene cluster: regulation of a transcriptionally active CG/3gene by cAMP. Mol Cell Biol 8:5100-5107

15. Garcia JV, Bich-Thuy L, Stafford J, Queen C 1986 Syn-ergism between immunoglobulin enhancers and pro-moters. Nature 322:383-385

16. Grosschedl R, Baltimore D 1985 Cell-type specificity ofimmunoglobulin gene expression is regulated by at leastthree DNA sequence elements. Cell 41:885-897

17. Edlund T, Walker MD, Barr PJ, Rutter WJ 1985 Cell-specific expression of the rat insulin gene: evidence forrole of two distinct 5'-flanking elements. Science230:912-916

18. Jeannote L, Trifiro MA, Plante RK, Chamberland M, DrouinJ1987 Tissue-specific activity of the pro-opiomelanocortingene promoter. Mol Cell Biol 7:4058-4064

19. Chepelinsky AB, Sommer B, Piatigorsky J 1987 Interac-tion between two different regulatory elements activates

the murine a A-crystallin gene promoter in explanted lensepithelia. Mol Cell Biol 7:1807-1814

20. Grayson DR, Costa RH, Xanthopoulos KG, Darnell JR1988 A cell-specific enhancer of the mouse a 1 -antitrypsingene has multiple functional regions and correspondingprotein-binding sites. Mol Cell Biol 8:1055-1066

21. Godbout R, Ingram RS, Tilghman SM 1988 Fine-structuremapping of three mouse a-fetoprotein gene enhancers.Mol Cell Biol 8:1169-1178

22. Ondek B, Gloss L, Herr W 1988 The SV40 enhancercontains two distinct levels of organization. Nature333:40-45

23. Maniatis T, Goodbourn S, Fischer JA 1987 Regulation ofinducible and tissue-specific gene expression. Science236:1237-1245

24. Hoeffler JP, Meyer TE, Yun Y, Jameson JL, Habener JF1988 Cyclic AMP-responsive DNA-binding protein: Struc-ture determined from a cloned placental cDNA. Science242:1430-1433

25. Drucker DJ, Philippe J, Jepeal L, Habener JF 1987 Glu-cagon gene 5'-flanking sequences promote islet cell-specific gene transcription. J Biol Chem 262:15659-15665

26. Laimins LA, Khoury G, Gorman C, Howard B, Gruss P1982 Host-specific activation of transcription by tandemrepeats from simian virus 40 and Moloney murine sarcomavirus. Proc Natl Acad Sci USA 79:6453-6457

27. Philippe J, Chick WL, Habener JF 1987 Multipotentialphenotypic expression of genes encoding peptide hor-mones in rat insulinoma cell lines. J Clin Invest 79:351-358

28. Lopata MA, Cleveland DW, Sollner-Webb B 1984 Highlevel transient expression of a chloramphenicol acetyltransferase gene by DEAE-dextran mediated DNA trans-fection coupled with dimethyl sulfoxide or glycerol shocktreatment. Nucleic Acids Res 12:5707-5717

29. Graham F, van der Eb A 1973 A new technique for theassay of infectivity of human adenovirus 5 DNA. Virology52:456-457

30. Gorman CM, Moffat LF, Howard BH 1982 Recombinantgenomes which express chloramphenicol acetyltransfer-ase in mammalian cells. Mol Cell Biol 2:1044-1051

31. Dignam JD, Lebovitz RM, Roeder RG 1983 Accuratetranscription initiation by RNA polymerase II in a solubleextract from isolated mammalian nuclei. Nucleic AcidsRes 11:1475-1489


Documents

Enhancer and Promoter Element Interactions Dictate Cyclic Adenosine Monophosphate Mediated and Cell-Specific Expression of the Glycoprotein Hormone α-Gene