European Journal of Pharmacology...2015/04/21 · Molecular and cellular pharmacology Protective effects of dendrosomal curcumin on an animal metastatic breast tumor Baharak Farhangia,

Molecular and cellular pharmacology

Protective effects of dendrosomal curcumin on an animal metastaticbreast tumor

Baharak Farhangi a, Ali Mohammad Alizadeh a,n, Hamid Khodayari b, Saeed Khodayari b,Mohammad Javad Dehghan c, Vahid Khori d, Alemeh Heidarzadeh c, Mahmood Khaniki e,Majid Sadeghizade c,nn, Farhood Najafi f

Q1

a Cancer Research Center, Tehran University of Medical Sciences, Tehran, Iranb Cancer Model Research Center, Tehran University of Medical Sciences, Tehran, Iranc Department of Genetics, School of Biological Sciences, Tarbiat Modares University, Tehran, Irand Ischemic Disorders Research Center, Golestan University of Medical Sciences, Gorgan, Irane Pathology Department, Faculty of Medicine, Tehran University of Medical Sciences, Tehran, Iranf Department of Resin and Additives, Institute for Color Science and Technology, Tehran, Iran

a r t i c l e i n f o

Article history:Received 23 October 2014Received in revised form21 March 2015Accepted 25 March 2015

Keywords:Dendrosomal curcuminMetastasisBreast cancer

a b s t r a c t

Curcumin has been shown to inhibit migration and invasion of cancer angiogenesis via interacting withkey regulatory molecules like NF-κB. Rapidly metabolized and conjugated in the liver, curcumin has thelimited systemic bioavailability. Previous results have shown a new light of potential biocompatibility,biodegradability, as well as anti-cancer effects of dendrosomal curcumin (DNC) in biological systems.The present study aims to deliberate the protective effects of DNC on metastatic breast tumor in vitro andin vivo. After the dosing procedure, twenty-seven female mice were divided into 40 and 80 mg/kg groupsof DNC, along with a control group to investigate the anti-metastatic effects of DNC on mammary tumor-bearing mice. In vitro results showed that the different concentrations of DNC reduced the migration andthe adhesion of 4T1 cells after 24 h (Po0.05). Under the dosing procedure, DNC was safe at 80 mg/kgand lower doses. The treated DNC animals had a higher survival rate and lower metastatic signs (14%)compared to control (100%) (Po0.05). The metastatic tumors were more common in control mice thanthe treated groups in the lung, the liver and the sternum tissues. Animals treated with DNC had smallertumor volume in comparison with control group (Po0.05). Final mean tumor volume reached toapproximately 1.11, 0.31 and 0.27 cm3 in the control, and 40 and 80 mg/kg DNC groups, respectively(Po0.05). Furthermore, suppression of NF-κB expression by DNC led to down-regulation of VEGF, COX-2,and MMP-9 expressions in the breast tumor, the lung, the brain, the spleen and the liver tissues(Po0.05). These outcomes indicate that dendrosomal curcumin has a chemoprotective effect on thebreast cancer metastasis through suppression of NF-κB and its regulated gene products.

& 2015 Elsevier B.V. All rights reserved.

1. Introduction

Metastasis is a multi-step process involving complex interactionsbetween the disseminating cancer cells, and their microenvironment(Alizadeh et al., 2014). Cancer metastasis is the cause of 90% of alldeaths from cancer and exhibits an outstandingly different situationof clinical characteristics (Khan and Mukhtar, 2010), therefore, agentsthat inhibit metastasis provide a major advantage in treating cancers.Most tumors activate the transcription factor nuclear factor-kB (NF-kB), whereas natural chemopreventive agents suppress it, indicating

a strong link between the tumor biology and the anti-cancer effectsof various natural compounds (Luo et al., 2005). Experimentalevidence has suggested that NF-κB has an important role not onlyin cancer initiation but also in cancer progression and metastasis(Huber et al., 2004). NF-κB regulates the genes expression involvedin cancer metastasis such as MMPs, VEGF and COX-2 (Xie et al.,2010). NF-κB has also been described as a major culprit in cancerbecause it is constitutively activated in most human cancers,especially in the poorly differentiated cancers like those pertainingto the breasts (Bharti and Aggarwal, 2002). Several studies haveshown that curcumin inhibits cancer angiogenesis, specificallymigration and invasion through interacting with the key regulatorymolecules like NF-κB (Himelstein et al., 1993).

Curcumin is a lipid-soluble compound extracted from the plantCurcuma Longa, and can potentially prevent cancer development

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

6768697071727374757677787980818283848586

Contents lists available at ScienceDirect

journal homepage: www.elsevier.com/locate/ejphar

European Journal of Pharmacology

http://dx.doi.org/10.1016/j.ejphar.2015.03.0760014-2999/& 2015 Elsevier B.V. All rights reserved.

n Corresponding author. Tel./fax: þ98 21 61192501; mobile: þ98 912 5790941.nn Corresponding author. Tel.: þ98 21 82884409; fax: þ98 21 82884484.E-mail addresses: [email protected],

[email protected] (A.M. Alizadeh).

Please cite this article as: Farhangi, B., et al., Protective effects of dendrosomal curcumin on an animal metastatic breast tumor. Eur JPharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.03.076i

European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

www.sciencedirect.com/science/journal/00142999

www.elsevier.com/locate/ejphar

http://dx.doi.org/10.1016/j.ejphar.2015.03.076



mailto:[email protected]

mailto:[email protected]





with no discernible toxicity (Kelloff et al., 2000; Aggarwal et al.,2007). It is cost-effective, and has been used for centuries withoutknown side-effects (Shishodia et al., 2005). However, absorption,distribution, metabolism and excretory studies of curcumin inrecent years focused on its low bioavailability in systemic circula-tion (Ghalandarlaki et al., 2014). Subsequently, many methodswere tested to overcome this defect like the use of the dendroso-mal curcumin (DNC) (Sarbolouki et al., 2000; Alizadeh et al., 2012).Our previous results shed a new light on the potential biocompat-ibility, the biodegradability and the anticancer effects of DNC inthe biological systems (Alizadeh et al., 2012; Babaei et al., 2012;Sarbolouki et al., 2012; Khaniki et al., 2013; Alizadeh et al., 2015;Mirgani et al., 2014). Accordingly, the present study has beendesigned to investigate the protective effects of DNC on themetastatic breast cancer cell line, and the model metastatic ofmouse mammary tumor-bearing.

2. Materials and methods

2.1. Materials

Curcumin was purchased from Merck KGaA (Darmstadt, Ger-many) with a purity of 95%. The polymeric nanocarrier was locallyproduced in our lab (Patent Number: 71753). Methylthiazol tetra-zolium (MTT), phosphate-buffered saline (PBS) solution, Ketamineand Xylazine were purchased from Sigma-Aldrich Co. (St Louis,MO, USA). Dulbecco's modified Eagle's medium (DMEM), fetalbovine serum (FBS), penicillin, streptomycin were from LifeTechnologies.

2.2. Dendrosomal curcumin preparation

For DNC preparation, the optimized protocol was used aspreviously described (Mirgani et al., 2014). Briefly, different w/wratios of DNC ranging from 50:1 to 1:1 were examined beforesettling a suitable ratio of 7:1. Curcumin was dissolved in variousamounts of dendrosome, and checked for absorbance spectra by UVspectrophotometery (TECAN, Switzerland). Appropriate mixture ofdendrosome and curcumin were evaluated for the excitation/emis-sion values in comparison with curcumin dissolved in PBS and 1%methanol as control. Briefly, curcumin and dendrosome were co-dissolved in 5 ml of acetone. The solution was then added into 5 mlof PBS and stirred. To evaporate acetone, the solution was finally leftin a rotary evaporator. The dendrosome/curcumin micelle solutionwas sterilized using a 0.22 mm syringe filter (Millex-LG, Millipore Co.USA). Prepared DNC was stored in 4 1C in a light protected conditionuntil used.

2.3. The study design

The present study was conducted in two series of experimentsin order to obtain the protective effects of DNC (i) on themetastatic breast cancer cell line, and (ii) on the metastatic mousemammary tumor-bearing.

2.4. Cell lines and their culture condition

The metastatic breast cancer cell line (4T1) and the normalmouse embryonic fibroblastic cells were procured from the nationalcell bank of Pasteur Institute, Tehran, Iran. The cells were cultured inGibcos high glucose Dulbecco's Modified Eagle Medium. They weresupplemented with 10% fetal bovine serum, 100 U/ml penicillin, and100 mg/ml streptomycin. All cells were grown at 37 1C in a humidifiedatmosphere of 5% carbon dioxide.

2.5. Cell viability assay

Cell viability assessed with methylthiazol tetrazolium (MTT) assay(Sigma-Aldrich) according to the manufacturer's instruction. Briefly,the cells were plated onto 96-well plates and incubated for 24, 48,and 72 h in the presence or absence of the different concentrationsof DNC. Dendrosome alone was used to test the nanocarriers'cytotoxicity. Doxorubicin and void curcumin were used to evaluatethe comparative toxicity of DNC on both cancerous and normal celllines. Media containing the treatment agents were carefully removedafterwards, and the cells were washed twice with PBS. Having keptat 37 1C for 4 h, the medium was totally removed, and 200 μldimethyl sulfoxide solution was added to each well. Absorbancewhich is directly proportional to the cell viability was subsequentlymeasured at 570 nm in each well, and presented as the percentage ofcell viability of treated cells against control cells using an enzyme-linked immunosorbent assay plate reader.

2.6. Scratch assay

Migration of 4T1 cells was measured by the scratch assay aspreviously described with some modifications (Oudhoff et al.,2008). The cells were cultured in 24-well plates and DMEMcontaining 10% FBS to nearly confluent cell monolayer, and ascratch wound was then created on the cell surface using amicropipette tip. The monolayer was once washed with PBS toremove debris or the detached cells from the monolayer. The cellswere incubated at different concentrations (0, 5, 10, 15, and 20 mM)of DNC and void curcumin. The cultures were then incubated at37 1C, subsequently photographed with microscope at 0 and 24 h.For each time point, four measurements per scratch were carriedout. For the quantification and statistical analysis, the individualscratch width (micrometer, mean and standard deviation) wasmeasured using the Image J software. The scratch area closed ratewas measured for the different concentrations of DNC at 24 hpost-treatment (the scratch width at 0 h was supposed 1 mm), andwas calculated according to the following equation:

The percentage of the scratch area closed¼(scratch width at0 h�the remaining scratch width at 24 h)/scratch width in0 h�100%. The scratch area closed rate at 0 h in each group wastreated as 0%. Experiments were performed in triplicate (Oudhoffet al., 2008).

2.7. Adhesion assay

To measure the relative attachment of 4T1 cells to immobilizedfibronectin, 96-well plates were coated with 100 μl of 2.5 mg/mlfibronectin (Sigma, USA), and incubated overnight at 4 1C. Plateswere then blocked with 100 μl PBS containing 3% (w/v) bovineserum albumin (BSA) for 30 min at 37 1C. To measure baselinenonspecific binding, other wells were coated with 1 mg/ml BSA.Following pretreatment of the cells with the different concentrationsof DNC and void curcumin for 24 h, the cells were resuspended inserum-free DMEM and BSA (1:1) and incubated at 37 1C for 90minto allow recovery of cell surface receptors and alleviate the effect oftrypsin on the cells. Approximately 5�105 cells in 100 μl of DMEM-BSA were seeded in quadruplicates into each fibronectin-coated well,and incubated at 37 1C for 90 min. Nonadherent cells were removedby washing with PBS twice, and the adherent cells were fixed inethanol for 10 min. After 5 min of crystal violet staining [0.1% (w/v)in 25% (v/v) methanol] at room temperature, the cells were gentlyrinsed with water five times to remove unbound stain and allowedto air-dry at room temperature. Fixed cells were lysed by 0.2% TritonX-100, and the absorbance was measured at 550 nm as follows: %Adhesion to matrix in 0 mM of DNC as 100 (Dastpeyman et al., 2012).

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

B. Farhangi et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎2





2.8. Animals

Animal studies have been conducted according to relevantnational and international guidelines of the Weatherall report,and Institutional Animal Care and Use Committee (IACUC) ofTehran University of Medical Sciences. Animals were housed inpens exceeding the stipulated size requirements. All inbred femaleBALB/c mice (6–8 weeks old, purchased from Iran Pasteur Insti-tute) were maintained in large group houses under 12-h dark andlight cycles and were given access to food and water ad libitum.

2.9. Dosing procedure

Twenty-seven BALB/c mice were equally divided to study thetoxicity of DNC with doses of 320, 160, 80, 40, 20 and 10 mg/kg (B.W, i.p) for 7 consecutive days together control group. The dosewith no adverse reactions during 24 h was assigned as a survivaldose. Survived animals weighed on a daily basis and euthanizedone week later. Abnormal hematological/blood chemical indices,and the body weight changes were amongst the toxicity signs.

2.10. Hematology and blood chemistry tests

Animals decapitated under general anesthesia to evaluate thehematology and the clinical chemistry parameters. Blood sampleswere taken and added into the ethylene-diamine-tetra-acetic-acid(EDTA)-coated tubes for hematology and heparin-coated tubes forthe clinical chemistry tests. Total leukocyte count (WBC), erythrocytecount (RBC), platelets (Plt), hemoglobin (Hgb), and hematocrit (Hct)were measured by using an animal blood counter (Celltac; NihonKohden, Tokyo, Japan). Blood urea nitrogen (BUN), creatine (Cr) andglucose (Glu) were determined by using CCX System (CCX WB; NovaBiomedical, USA). Plasma alkaline phosphatase (ALP), albumin (ALB),alanine transaminase (ALT) and aspartate transaminase (AST) werealso measured (Autoanalyser Model Biotecnica, BT 3500, Rome, Italy).

2.11. Tumorgenicity

4T1 cells were trypsinized and re-suspended in 10-fold excessculture medium. After centrifugation, cells were re-suspended inPBS, and 1�106 cells were injected (0.1 ml, s.c) using a 21-gaugeneedle in the left flank of BALB/c mice under Ketamine and Xylazine(10 mg/kg, i.p) anesthesia. The tumors were seen about two weeksafter cells injection.

2.12. Evaluation of DNC protective effects on metastatic mice breasttumor

According dosing procedure, twenty-seven mice were equallydivided into three groups of 40 and 80 mg/kg doses of DNC, andcontrol (saline) groups. DNC was given for 35 days after tumorinjection from day 3 up to day 38. All animals euthanatized at day42 post-cells injection. Tumor volume was measured on a weekly

basis by a digital vernier caliper (Mitutoyo, Japan) and calculatedusing the following formula (Mohsenikia et al., 2013).

V ¼ 1=6 πLWDð Þ;where L¼ length; W ¼width; and D¼ depth:

2.13. Depiction of tumors and metastases

Animals were closely monitored for general health during thestudy period. Mice were weekly weighed, and observed forevidence of complicacy and death. Moribund animals were killed.The rest were also euthanatized at the end of the 6th week. Athorough necropsy was then made, and vital organs including theliver, the spleen, the lung, the brain and the bone were examinedfor lesions and metastatic deposits. At the end of the 6th week, allanimals underwent routine surgery and euthanasia. Weight,number, size and location of the tumors were recorded.

2.14. Histological assay

The internal organs comprised of the liver, the spleen, thebrain, the lung, the bone and the breast tumor were fixed in 10%formaldehyde, passaged and embedded in paraffin. Paraffin blockswere then sectioned into 3–5 μm thickness for hematoxylin andeosin (H & E) staining. The slides were studied by OLYMPUS-BX51microscope (Alizadeh et al., 2012). Digital photos were taken withOLYMPUS-DP12 camera and graded by the Scharff–Bloom–

Richardson Scale (Mohsenikia et al., 2013).

2.15. RNA extraction and real-time polymerase chain reaction (PCR)

Total RNA was extracted from five different organs including thespleen, the liver, the brain, the lung and the tumor tissues usingTRIzols reagent (Life Technologies) followed by DNase I digestion(Thermo Fisher Scientific, Waltham, MA, USA). Complementary DNAwas synthesized by PrimeScript™ RT reagent kit (Fermentas, Ger-many). The list of primers for specific genes including NF-κB p105,VEGF, COX-2, MMP-9 and housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) indicated in Table 1. Real-timePCR was performed using the SYBRs Premix Ex Taq™ II (Takara).Relative gene expression was calculated as 2�ΔΔCt.

2.16. Statistical analysis

Statistics were presented in Prisms 6.1 software (GraphPadSoftware, Inc, La Jolla, CA, USA), and analyzed using one-wayanalysis of variance followed by Newman–Keuls multiple compar-ison test or two tailed student's t-test. Incidences of tumors werecompared by fisher exact test. All data were expressed asmean7S.D. Differences among groups were stated to be statisti-cally significant when Po0.05.

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

Table 1Nucleotide sequences ofQ6 the primers used for real-time RT-PCR.

Gene Forward primer (5ʹ–3ʹ) Reverse primer (5ʹ–3ʹ) Size (bp)

GAPDH CAGCAAGGACACTGAGCAAG TGATGGTATTCAAGAGAGTAGGGA 139MMP9 TTCCAGTACCAAGACAAAGCC CACGGTTGAAGCAAAGAAGG 176VEGFA TGAACTTTCTGCTCTCTTGGG GCTTCGCTGGTAGACATCC 146COX-2 TGAAGAACTTACAGGAGAGAAGG AGTATTGAGGAGAACAGATGGG 200NFκB(p105) TCTTACACTTAGCCATCATCCAC CCAACCCTCAGCAAATCCTCT 178

B. Farhangi et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎ 3





3. Results

3.1. DNC effects on cell viability

As shown in fig. 1, DNC significantly suppressed the viability of4T1 cell induced in a time- and dose dependent manner. Half-maximal inhibitory concentration (IC50) of DNC for 4T1 cells was32.5 and 25 μM after 24 h (Fig. 1A) and 48 h (Fig. 1B) respectively,which was declined to 17.5 μM at 72 h (Fig. 1C) (Po0.001). However,the viability of 4T1 cells was affected by free curcumin only at 72 h(Fig. 1C). Curcumin and DNC had slight effects at higher concentra-tions on normal mouse embryonic fibroblast cells (Fig. 1D). Noinhibitory effect was observed for void dendrosome.

3.2. Inhibitory effects of free curcumin and DNC on 4T1 cellsmigration

Free curcumin and DNC were able to significantly inhibit themigration of 4T1 cells in a dose dependent-manner after 24 h(Fig. 2). Compared to control, the migration of 4T1 cells wasreduced by 5, 10, 15, and 20 mM free curcumin to 30% (Po0.05),

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

Fig. 1. Cytotoxic effects of the dendrosomal curcumin on mouse mammary (4T1) carcinoma cell line. The 4T1 cells were grown in Dulbecco's modified Eagle's mediumcontaining 10% fetal bovine serum at a 37 1C temperature in a humid atmosphere of 5% CO2. The 4T1 cells treated with various concentrations of the dendrosomal curcumin,Doxorubicin (Dox), curcumin, nanocarrier and normal saline for 24 h (A), 48 h (B) and 72 h (C). Afterwards, 20 μl of MTT (5 mg/ml) added to each well and incubated for anadditional 4 h followed by adding 200 μl of dimethyl sulfoxide. The cell viability measured by MTT assay. Relative cell viability determined by using a 96-well plate reader at540 nm. Curcumin and DNC had slight effects at higher concentrations on normal mouse embryonic fibroblast cells (D). Data reported are mean7S.D; *Po0.05 compared tocurcumin; DNC¼dendrosomal curcumin; DEN¼dendrosome; DOX¼doxorubicin.

Fig. 2. Inhibitory effects of free curcumin and DNC on the migration of 4T1 cells.Evaluating by the scratch assay showed that the confluent monolayers of 4T1 cellswere scarred, and the repair was monitored microscopically after 24 h of treatmentwith free curcumin and DNC (5–30 mM). For quantification analysis, the individualscratch width (micrometer) was measured using the Image J software. The cellmigration rate was measured for 0, 5, 10, 15 and 20 mM of free curcumin and DNC at24 h post-treatment (the scratch width at 0 h was supposed 1 mm) and wascalculated according to the equation: the percentage of the scratch area closed¼(scratch width at 0 h�the remaining scratch width at 24 h)/scratch width in0 h�100%. The scratch area closed rate at 0 h in each group was treated as 0%. Dataare presented as mean7S.D, *Po0.05 compared to control (dose 0), #Po0.05compared to free curcumin, DNC¼dendrosomal curcumin.






38.5% (Po0.05), 55.5% (Po0.05) and 57.5% (Po0.05), respectively,and by 5, 10, 15, and 20 mM DNC to 41% (Po0.05), 63% (Po0.05),74% (Po0.05), and 78% (Po0.05), respectively. Furthermore, thisreduction was significant by DNC in comparison with free curcu-min at 10, 15 and 20 mM concentrations (Fig. 2).

3.3. Inhibitory effects of free curcumin and DNC on 4T1 cellsadhesion

Free curcumin and DNC were able to significantly inhibit theadhesion of 4T1 cells to fibronectin in a dose dependent-mannerafter 24 h (Fig. 3). In comparison with control, the adhesion of 4T1cells to matrix was reduced by 5, 10, 15, and 20 mM free curcumin to35.5% (Po0.05), 42% (Po0.05), 46% (Po0.05) and 71% (Po0.05),respectively, and by 5, 10, 15, and 20 mM DNC to 42% (Po0.05), 55%(Po0.05), 65.5% (Po0.05), and 78.5% (Po0.05), respectively. More-over, this reduction was significant by DNC in comparison with freecurcumin at 15 and 20 mM concentrations (Fig. 3).

3.4. The DNC toxicity in mice

The main toxicity signs to DNC in various doses summarized inTable 2. The doses of 320 and 160 mg/kg of DNC associated withmild poisoning symptoms of hematological, hepatocellular andrenal tissues, and DNC showed the remarkable safety rate up to

80 mg/kg (Table 2). Hematological markers were measured by acomplete blood count analysis. No inflammatory responses wereseen in treated groups since the total leukocyte counts remainedwithin normal range (Table 2). A significant decrease in WBC wasseen at 160 and 320 mg/kg DNC compared to control animals(Po0.05) (Table 2).

BUN and Cr levels were measured for kidney function assess-ment, while ALP, ALB, ALT, and AST were done for liver functionevaluation. BUN and Cr were significantly higher in animals of 160and 320 mg/kg DNC compared to control animals (Po0.05)(Table 2). Furthermore, the liver function tests showed the drasticincrease in ALT and AST levels, and the decrease in ALB level in 160and 320 mg/kg DNC compared to control mice (Po0.05) (Table 2).It seems that the liver and the kidney were the target organs forDNC toxicity in the high doses.

3.5. Protective effects of DNC on metastatic mice breast tumor

3.5.1. General observationsAnimals' weight in the control and DNC treated groups slightly

increased. Body weight rose steadily to reach a plateau after about3 weeks in all animals, but showed a slight fall in the control groupin the last few weeks as tumors developed (Fig. 4). Eight of thetwenty-seven mice died 3–7 weeks after tumor injection in thecontrol (n¼5), 40 mg/kg DNC (n¼2) and 80 mg/kg DNC groups

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

Fig. 3. Inhibitory effects of free curcumin and DNC on the adhesion of 4T1 cells.After pretreatment of the cells with free curcumin and DNC concentrations (5–30 mM) for 24 h, cells were harvested and used for adhesion assay. Free curcuminand DNC inhibited adhesion of 4T1 cells to matrix. Data are presented as mean7S.D. *Po0.05 compared to control (dose 0), #Po0.05 compared to free curcumin,DNC¼dendrosomal curcumin.

Table 2

Parameters Groups

Control DNC 10 DNC 20 DNC 40 DNC 80 DNC 160 DNC 320 ED50 mg/kg

Animal weight (g) 24.472.3 2373.2 25.572.4 23.272.5 23.672.7 21.172.6 22.472.7 –

RBC (Millin/mm3) 7.870.5 6.570.8 7.270.7 8.170.9 7.870.5 7.570.8 7.270.6 –

HCT (%) 45.374.1 42.773.2 42.572.5 45.572.9 43.973 43.673 42.472 –

Hgb (g/dl) 1471.6 13.572.8 13.772.3 14.871.9 14.171.2 14.371.8 13.371.6 –

Plt (1000/mm3) 567760 5877 91 550745 570739 540748 510766 530756 –

WBC (1000/mm3) 9.270.9 8.772 8.8 71.5 8.172.3 8.372.2 a,6.571.5 a,4.571.2 173.5Glu (mg/dl) 194719 214758 192733 196728 186729 185735 200725 –

BUN (mg/dl) 33.576.1 35716 46715 43717 45720 a,63715 a,83712 174.2Cr (mg/dl) 0.570.1 0.570.08 0.670.07 0.670.1 0.770.1 a,0.970.2 a,1.970.3 417000AST (U/l) 456746 538795 455781 4807152 4947103 558761 a,789756 207ALT (U/l) 208728 178747 186721 198786 238766 378740 a,396766 100.8ALP (U/l) 760757 794767 835730 787791 777762 7337102 740736 –

ALB (mg/dl) 370.3 3.270.2 3.470.2 3.170.6 2.970.4 3.870.5 a,4.870.6 162.2

Values are mean7S.E.M. DNC¼dendrosomal curcumin, EC50¼half-maximal effective concentration, RBC¼ red blood cell, HCT¼hematocrit, Hgb¼hemoglobin,WBC¼white blood cells, Plt¼platelets, Cr¼creatinine, BUN¼blood urea nitrogen, Glu¼glucose, AST¼aspartate transaminase, ALT¼alanine transaminase, ALP¼alkalinephosphatase, ALB¼albumin.

a Po0.05 compared to control.

Fig. 4. A plot of dendrosomal curcumin effects on mice weight. Mice weight wasmeasured weekly. Mice in treated groups (40 and 80 mg/kg of DNC) gained weightnormally, however, the control animals were observed to lose weight due to tumorburden. DNC¼dendrosomal curcumin.






(n¼1). DNC treated animals had higher survival rates compared tothe control (Fig. 5). Except for a slight fall in food intake (g/day) inthe control group, there were no significant differences in terms ofthe intake in control and treatment groups. No behavioral changeswere observed in the animals during the course of administration,or in the ensuing follow up period.

3.6. Tumor type

Tumor cells developed with sarcomatoid-type areas showingmorphological signs of epithelial differentiation into surroundingtissues. Tumor cell infiltration observed in the surrounding tissuesand nests of carcinoma cells with grade II/III based on Scharff–Bloom–Richardson scale (Fig. 6).

3.7. Tumor incidence and size

At the end of the second week, the tumor take rate was 100% incontrol and treated groups. However, at the end of the study, mice incontrol group had higher tumor induction in comparison to thetreated groups. Additionally, mice treated with DNC had smallertumor volume (cm3) in comparison with control (Fig. 7A). Theaverage tumor volume was significantly less in DNC groups than incontrol groups at 21, 28, 35 and 42 days after tumor cells injection(Po0.05). The mean final tumor volume reached to approximately

1.11, 0.31 and 0.27 cm3 in the control, 40 and 80 mg/kg DNC groups,respectively (Fig. 7A). Moreover, the average final tumor weightreached to approximately 1400, 550 and 500 mg in the control, 40and 80 mg/kg DNC groups, respectively (Fig. 7B).

3.8. Tumor metastases

At the end of the study, a thorough necropsy was made, and thevital organs including the liver, the spleen, the lung, the brain andthe bone were examined for lesions and metastatic deposits. Theywere fixed in 10% formaldehyde, passaged and embedded in paraffin,and were then sectioned into 3–5 μm thickness for H & E staining.The slides were read by two evaluators using an OLYMPUS-BX51microscope. Results showed that the incidence of the breast tumormetastases was about 89% in the control animals (n¼8) in compar-ison with about 11% in both 40 mg/kg (n¼1) and 80 mg/kg (n¼1) ofDNC doses. Among the treatment groups, reduction in the tumorincidence in 40 and 80 mg/kg DNC ranged equally to 87.6% comparedto control (Po0.001). Furthermore, the number of metastases permouse in the metastatic mice varied from one to three. The tumorswere scattered in the different parts of the body. Metastatic tumorswere more common in the lung (Fig. 8A), the liver (Fig. 8B) and thesternum tissue (Fig. 8C).

3.9. Analysis of gene expression by real-time PCR

NF-ƙB p105 mRNA expression was significantly down-regulatedin 40 and 80 mg/kg of DNC compared to control in the breast tumor,the lung, the brain, the liver and the spleen tissues (P˂0.05).

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

Fig. 5. Dendrosomal curcumin effects on animals survival rate after tumor cellsinjection a typical animal model of breast cancer. DNC (40 and 80 mg/kg) was givenfor 32 days, from 3–35 days after tumor cells injection. DNC-treated animals had agreater survival rate compared to the control. DNC¼dendrosomal curcumin.

Fig. 6. The histopathological features of mouse mammary tumor. Breast tumorsamples fixed and preserved in 4% buffered formaldehyde for at least 24 h. Paraffinblocks then sectioned by 3–5 μm thickness for hematoxylin and eosin staining.Slides studied by OLYMPUS-BX51 microscope. Tumor cell infiltration observed inthe surrounding tissues and nests of carcinoma cells with grade II/III based onScharff–Bloom–Richardson Scale (H & E, 40� ).

Fig. 7. Dendrosomal curcumin effects on (A) tumor size (cm3) and (B) tumorweight (mg) in an animal model of breast cancer. DNC (40 and 80 mg/kg) was givenfor 32 days from 3–35 days after tumor cells injection. Tumor volume weeklymeasured by a digital vernier caliper and by using the following formula: V¼1/6(πLWD), where L¼ length, W¼width and D¼depth. The average tumor volume wassignificantly less than control group in the second and third weeks after DNCtreatment. Data reported are mean7S.D; *Po0.05 compared to control;DNC¼dendrosomal curcumin.






Furthermore, this effect was higher in 80 mg/kg DNC (breast tumor0.17, lung 0.13, brain 0.21, liver 0.23 and spleen 0.65 fold) than in40 mg/kg DNC (breast tumor 0.17, lung 0.13, brain 0.21, liver 0.23 andspleen 0.65 fold) (P˂0.05) (Fig. 9A).

MMP-9 mRNA expression was decreased in 40 and 80 mg/kg ofDNC groups (P˂0.05). This decrease was significantly more in80 mg/kg of DNC (breast tumor 0.39, lung 0.02, brain 0.11, liver0.10 and spleen 0.08 fold) than in 40 mg/kg of DNC group (breasttumor 0.53, lung 0.42, brain 0.82, liver 0.67 and spleen 0.41 fold)(P˂0.05) (Fig. 9B).

VEGF mRNA expression was reduced in 40 and 80 mg/kg of DNCgroups (P˂0.05). This reduction was significantly more in 80 mg/kg ofDNC (breast tumor 0.17, lung 0.14, brain 0.29, liver 0.41 and spleen0.17 fold) than in 40 mg/kg of DNC (breast tumor 0.34, lung 0.22,brain, 0.78, liver 0.64 and spleen 0.61 fold (P˂0.05)) (Fig. 9C).

COX-2 mRNA expression was significantly declined in 80 mg/kgof DNC (breast tumor 0.90, lung 0.49, brain 0.57, liver 0.20 andspleen 0.31 fold) (P˂0.05). However, unlike the liver tissue, in therest of the tissues it was not significant (breast tumor 0.95, lung0.59, brain 0.93, liver 0.47 and spleen 0.39 fold) in 40 mg/kg ofDNC (P˂0.05) (Fig. 9D).

4. Discussion

The major objective and purpose of our study was to assess theanti-metastatic effects of dendrosomal curcumin in a mouse breast

tumor cell line and a typical animal model of metastatic breastcancer. The in vitro results indicated that DNC inhibited the migrationand the adhesion of 4T1 cells. The in vivo analyses demonstrated asignificant DNC-mediated reduction in the incidence, the size andthe weight of tumors. The metastatic tumors were more common inthe control than the treated groups in the lung, the liver and thesternum tissue. This was accompanied by suppression of theexpression of NF-κB p105 and its downstream genes including VEGF,COX-2, and MMP9 in the breast tumor and in the lung, the brain, thespleen and the liver tissue. These findings imply the fact that DNCcan act as an anti-metastatic agent.

The present study aimed the role of dendrosomal curcumin as anagent anti-metastasis, on the cell viability, the migration and theadhesion of 4T1 cells, which is the metastatic cancer cell line bothin vitro and in vivo. The scratch and the adhesion assays arecommonly used method to study the migratory and the adhesivebehavior of cells that are fundamental to diverse biologic processessuch as tumor metastasis. The effects of DNC on the migration abilityand the adhesion of 4T1 cells to matrix were performed at theconcentration range 15 mM, and determined by the scratch and theadhesion assays which its concentration was 1/2 concentrationobtained from 24 h MTT assay. The concentration and time depen-dent inhibition of the cell viability, the migration and the adhesionby DNC can show its central role in the process of cancer metastasis.

In the dosing procedure, high doses of DNC (160 and 250 mg/kg) brought the poisoning symptoms of hematological, hepatocel-lular and renal tissues. WBC was drastically decreased at the highdoses compared to the control. Higher Cr and Bun levels may bereleased from damaged muscular cells. Significant decrease inalbumin level, together with increased ALT and AST in DNC-treatedanimals points to the hepatic effects of the high doses that mayinduce by nanocarrier metabolism. We are not sure about thereversibility of DNC toxicity since it is beyond the scope of thepresent study.

Metastatic process is often associated with up-regulated MMPs,loosened extracellular matrix for cancer cells evasion. MMPsespecially MMP-9, is known to be involved in tumor angiogenesis;mainly through its matrix-degrading capacity (Kiuchi et al., 1993).Previous reports have indicated that MMP-9 expression is tran-scriptionally regulated through NF-κB elements within MMP-9gene (Farina et al., 1999). Aggarwal (2004) also showed that NF-κBactivation is an absolute requirement in MMP-9 up-regulation(Aggarwal, 2004). Results showed that treatment with curcumin isassociated with a decrease in NF-κB and MMP-9 expression levels(Hong et al., 2006; Bachmeier et al., 2007; Killian et al., 2012). Ithas also been found that curcumin inhibits the migratory activity,the proliferative rate, the adhesion, and the invasion of breastcancer cells through down-regulating NF-κB p65 expression (Chiuand Su, 2009; Kang et al., 2009). Therefore, our results are inagreement with previous reports showing that dendrosomalcurcumin can inhibit MMP-9 expression in the breast tumor, thelung, the brain, the spleen and the liver tissue.

In another portion of the present study, we showed that DNCdown-regulated VEGF expression in the breast tumor, the lung, thebrain, the spleen and the liver tissue. VEGF plays a key role in cancerbiology and being involved in tumor neovascularization in responseto increased demand of tumor cells for obtaining a variety ofnutrients as well as oxygen (Ferrara, 1999). It has also been suggestedthat VEGF induction is interceded by NF-κB intracellular signalingpathway. Consequently, VEGF down-regulation – as shown here –

can explain the anti-metastatic activities of DNC (Gasparini et al.,2005). Furthermore, it is well established that VEGF and MMPs arethe essential factors in angiogenesis and cancer cells invasion(Himelstein et al., 1993; Carmeliet, 2004), and curcumin can inhibitthe tumor growth and suppress the angiogenesis through inhibitionof MMP-9 and neovascularization (Perry et al., 2010).

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

Fig. 8. The histopathological features of mammary tumor metastases to differenttissues. The vital organs including the liver, the spleen, the lung, the brain and thebone were fixed in 10% formaldehyde, passaged and embedded in paraffin, and werethen sectioned into 3–5 μm thickness for hematoxylin and eosin staining. The slideswere read by two evaluators using OLYMPUS-BX51 microscope and the digital photoswere taken with OLYMPUS-DP12 camera. Metastatic tumors were more common inthe lung (A, 20� ), the liver (B, 40� ) and the sternum tissue (C, 20� ).






COX-2 has been implicated in carcinogenic processes (Kardehet al., 2014). Malignant cells induced COX-2 over-expression has beenshown to enhance the cellular invasion, the angiogenesis andregulate the anti-apoptotic defensive activities of the cells (Shiragaet al., 2002). These effects have shown to be reversed by the anti-inflammatory agents for example; curcumin (Huei-Chen et al., 1992;Khaniki et al., 2013). Additionally, the several lines of evidenceindicated the critical role of COX-2 in carcinogenesis (Koide et al.,1999; Gómez-Hernández et al., 2006) which is mediated by NF-κBintracellular signaling pathway (Wang et al., 2008). Correspondingly,curcumin appears to exert its anti-angiogenic effect through inhibi-tion of COX-2 expression (Khaniki et al., 2013). Furthermore, pre-clinical studies have shown that curcumin suppressed COX-2 activitythrough NF-kB kinase enzymes suppression (Plummer et al., 1999).Moreover, curcumin administration noticeably decreased metastasisto the lung tissue, and suppressed COX-2 expression in a humanxenograft model of breast cancer (Aggarwal et al., 2005). In thisregard, our results are in agreement with the previous reports inwhich curcumin inhibited NF-κB regulated COX-2 and MMP-9expression (Kitamura et al., 1996; Plummer et al., 1999).

Animal and clinical trials have shown that curcumin and itsanalogs may be target critical genes associated with the tumorangiogenesis and metastasis (Im Kim et al., 2008; Kronski et al.,2014). Curcumin has been shown to decrease the ability ofpaclitaxel-resistant breast cancer cells to form the lung metastasesvia suppression of NF-κB, COX2 and MMP-9 expression (Aggarwal etal., 2005). In addition, a 78% reduction in the tumor metastasis wasobserved in nude mice receiving both curcumin (100 mg/kg) andpaclitaxel (7 mg/kg) compared to control group in a xenograft modelof mice breast cancer (Kang et al., 2009). The first clinical trial ofcurcumin investigated the feasibility and tolerability of docetaxel andcurcumin combination in patients with the advanced and metastaticbreast cancer (Bayet-Robert et al., 2010). Based on the results fromthe previous studies, phase I/II/III clinical trials of curcumin alone or

in combination with other chemotherapeutic agents are currentlyongoing in patients with different types of cancer including breastcancer (Gupta et al., 2013).

Taken together, the results of the current study reveal that DNC iseffective in suppressing the metastatic tumor growth both in vitroand in vivo. As well, DNC exerted its chemoprotective anti-metastaticeffects through suppression of NF-κB and its regulated gene pro-ducts. It seems that dendrosomal curcumin may provide a clinicallyuseful tool for abolishing the activity of VEGF, MMP-9 and COX-2 intumor cells.

Declaration of interest

The authors reported no conflicts of interest. The authors aloneare responsible for the content of the paper.

Acknowledgments

This study was Q2supported by a grant of Tehran University ofMedical Sciences.

References

Aggarwal, B.B., 2004. Nuclear factor-kappaB: the enemy within. Cancer Cell 6 (3),203–208.

Aggarwal, B.B., Shishodia, S., Takada, Y., Banerjee, S., Newman, R.A., Bueso-Ramos, C.E., Price, J.E., 2005. Curcumin suppresses the paclitaxel-induced nuclear factor-κB pathway in breast cancer cells and inhibits lung metastasis of human breastcancer in nude mice. Clin. Cancer Res. 11 (20), 7490–7498.

Aggarwal, B.B., Surh, Y.-J., Shishodia, S., 2007. The Molecular Targets Q3and Ther-apeutic Uses of Curcumin in Health and Disease. Springer Science & BusinessMedia.

Alizadeh, A.M., Khaniki, M., Azizian, S., Mohaghgheghi, M.A., Sadeghizadeh, M.,Najafi, F., 2012. Chemoprevention of azoxymethane-initiated colon cancer in rat

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960616263646566

676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130131132

Fig. 9. Effects of dendrosomal curcumin on suppressing the genes expression of NF-κB (A), MMP-9 (B), VEGF (C), and COX-2 (D) in various tissues in an animal model ofbreast cancer. Data reported are mean7S.D; *Po0.05 compared to control; #Po0.05 compared to 40 mg/kg DNC, DNC¼dendrosomal curcumin.






by using a novel polymeric nanocarrier–curcumin. Eur. J. Pharmacol. 689 (1),226–232.

Alizadeh, A.M., Sadeghizadeh, M., Najafi, F., Ardestani, S.K., Erfani-Moghadam, V.,Khaniki, M., Rezaei, A., Zamani, M., Khodayari, S., Khodayari, H., 2015. Encap-sulation of curcumin in diblock copolymer micellesQ4 for cancer therapy. BioMedRes. Int..

Alizadeh, A.M., Shiri, S., Farsinejad, S., 2014. Metastasis review: from bench tobedside. Tumor Biol. 35 (9), 8483–8523.

Babaei, E., Sadeghizadeh, M., Hassan, Z.M., Feizi, M.A.H., Najafi, F., Hashemi, S.M.,2012. Dendrosomal curcumin significantly suppresses cancer cell proliferationin vitro and in vivo. Int. Immunopharmacol. 12 (1), 226–234.

Bachmeier, B.E., Nerlich, A.G., Iancu, C.M., Cilli, M., Schleicher, E., Vene, R., Dell’Eva,R., Jochum, M., Albini, A., Pfeffer, U., 2007. The chemopreventive polyphenolcurcumin prevents hematogenous breast cancer metastases in immunodefi-cient mice. Cell. Physiol. Biochem. 19 (1–4), 137–152.

Bayet-Robert, M., Kwiatowski, F., Leheurteur, M., Gachon, F., Planchat, E., Abrial, C.,Mouret-Reynier, M.-A., Durando, X., Barthomeuf, C., Chollet, P., 2010. Phase Idose escalation trial of docetaxel plus curcumin in patients with advanced andmetastatic breast cancer. Cancer Biol. Ther. 9 (1), 8–14.

Bharti, A.C., Aggarwal, B.B., 2002. Nuclear factor-kappa B and cancer: its role inprevention and therapy. Bioch. Pharmacol. 64 (5), 883–888.

Carmeliet, P., 2004. VEGF as a key mediator of angiogenesis in cancer. Oncology 69,4–10.

Chiu, T.-L., Su, C.-C., 2009. Curcumin inhibits proliferation and migration byincreasing the Bax to Bcl-2 ratio and decreasing NF-κBp65 expression in breastcancer MDA-MB-231 cells. Int. J. Mol. Med. 23 (4), 469–475.

Dastpeyman, M., Motamed, N., Azadmanesh, K., Mostafavi, E., Kia, V., Jahanian-Najafabadi, A., Shokrgozar, M.A., 2012. Inhibition of silibinin on migration andadhesion capacity of human highly metastatic breast cancer cell line, MDA-MB-231, by evaluation of β1-integrin and downstream molecules, Cdc42, Raf-1 andD4GDI. Med. Oncol. 29 (4), 2512–2518.

Farina, A.R., Tacconelli, A., Vacca, A., Maroder, M., Gulino, A., Mackay, A.R., 1999.Transcriptional up-regulation of matrix metalloproteinase-9 expression duringspontaneous epithelial to neuroblast phenotype conversion by SK-N-SH neuro-blastoma cells, involved in enhanced invasivity, depends upon GT-box andnuclear factor kappaB elements. Cell Growth Differ. 10, 353–367.

Ferrara, N., 1999. Molecular and biological properties of vascular endothelialgrowth factor. J. Mol. Med. 77 (7), 527–543.

Gasparini, G., Longo, R., Toi, M., Ferrara, N., 2005. Angiogenic inhibitors: a newtherapeutic strategy in oncology. Nat. Clin. Pract. Oncol. 2 (11), 562–577.

Ghalandarlaki, N., Alizadeh, A.M., Ashkani-Esfahani, S., 2014. Nanotechnology-applied curcumin for different diseases therapy. BioMed Res. Int..

Gómez-Hernández, A., Martín-Ventura, J.L., Sánchez-Galán, E., Vidal, C., Ortego, M.,Blanco-Colio, L.M., Ortega, L., Tuñón, J., Egido, J., 2006. Overexpression of COX-2,prostaglandin E synthase-1 and prostaglandin E receptors in blood mono-nuclear cells and plaque of patients with carotid atherosclerosis: regulation bynuclear factor-κB. Atherosclerosis 187 (1), 139–149.

Gupta, S.C., Patchva, S., Aggarwal, B.B., 2013. Therapeutic roles of curcumin: lessonslearned from clinical trials. AAPS J. 15 (1), 195–218.

Himelstein, B., Canete-Soler, R., Bernhard, E., Dilks, D., Muschel, R., 1993. Metallo-proteinases in tumor progression: the contribution of MMP-9. Invasion Metas-tasis 14 (1–6), 246–258.

Hong, J., Sang, S., Park, H.-J., Kwon, S.J., Suh, N., Huang, M.-T., Ho, C.-T., Yang, C.S.,2006. Modulation of arachidonic acid metabolism and nitric oxide synthesis bygarcinol and its derivatives. Carcinogenesis 27 (2), 278–286.

Huber, M.A., Azoitei, N., Baumann, B., Grünert, S., Sommer, A., Pehamberger, H.,Kraut, N., Beug, H., Wirth, T., 2004. NF-κB is essential for epithelial-mesenchymal transition and metastasis in a model of breast cancer progres-sion. J. Clin. Investig. 114 (4), 569.

Huei-Chen, H., Tong-Rong, J., Sheau-Farn, Y., 1992. Inhibitory effect of curcumin, ananti-inflammatory agent, on vascular smooth muscle cell proliferation. Eur. J.Pharmacol. 221 (2), 381–384.

Im Kim, H., Huang, H., Cheepala, S., Huang, S., Chung, J., 2008. Curcumin inhibitionof integrin (α6β4)-dependent breast cancer cell motility and invasion. CancerPrev. Res. 1 (5), 385–391.

Kang, H.J., Lee, S.H., Price, J.E., Kim, L.S., 2009. Curcumin suppresses the paclitaxel-induced nuclear factor-κb in breast cancer cells and potentiates the growthinhibitory effect of paclitaxel in a breast cancer nude mice model. Breast J. 15(3), 223–229.

Kardeh, S., Ashkani-Esfahani, S., Alizadeh, A.M., 2014. Paradoxical action of reactiveoxygen species in creation and therapy of cancer. Eur. J. Pharmacol. 735,150–168.

Kelloff, G.J., Crowell, J.A., Steele, V.E., Lubet, R.A., Malone, W.A., Boone, C.W.,Kopelovich, L., Hawk, E.T., Lieberman, R., Lawrence, J.A., 2000. Progress incancer chemoprevention: development of diet-derived chemopreventiveagents. J. Nutr. 130 (2), 467S–471S.

Khan, N., Mukhtar, H., 2010. Cancer and metastasis: prevention and treatment bygreen tea. Cancer Metastasis Rev. 29 (3), 435–445.

Khaniki, M., Azizian, S., Alizadeh, A.M., Hemmati, H., Emamipour, N., Mohagheghi,M.A., 2013. The antiproliferative and anticancerogenic effects of nano-curcuminin rat colon cancer. Tehran Univ. Med. J. 71 (5), 277–284.

Killian, P.H., Kronski, E., Michalik, K.M., Barbieri, O., Astigiano, S., Sommerhoff, C.P.,Pfeffer, U., Nerlich, A.G., Bachmeier, B.E., 2012. Curcumin inhibits prostatecancer metastasis in vivo by targeting the inflammatory cytokines CXCL1 and-2.Carcinogenesis, bgs312.

Kitamura, M., Sütö, T., Yokoo, T., Shimizu, F., Fine, L.G., 1996. Transforming growthfactor-beta 1 is the predominant paracrine inhibitor of macrophage cytokinesynthesis produced by glomerular mesangial cells. J. Immunol. 156 (8),2964–2971.

Kiuchi, F., Goto, Y., Sugimoto, N., Akao, N., Kondo, K., Tsuda, Y., 1993. Nematocidalactivity of turmeric: synergistic action of curcuminoids. Chem. Pharm. Bull. 41(9), 1640.

Koide, M., Murase, Y., Yamato, K., Noguchi, T., Okahashi, N., Nishihara, T., 1999. Bonemorphogenetic protein-2 enhances osteoclast formation mediated byinterleukin-1α through upregulation of osteoclast differentiation factor andcyclooxygenase-2. Biochem. Biophys. Res. Commun. 259 (1), 97–102.

Kronski, E., Fiori, M.E., Barbieri, O., Astigiano, S., Mirisola, V., Killian, P.H., Bruno, A.,Pagani, A., Rovera, F., Pfeffer, U., 2014. miR181b is induced by the chemopre-ventive polyphenol curcumin and inhibits breast cancer metastasis via down-regulation of the inflammatory cytokines CXCL1 and-2. Mol. Oncol. 8 (3),581–595.

Luo, J.-L., Kamata, H., Karin, M., 2005. IKK/NF-κB signaling: balancing life anddeath–a new approach to cancer therapy. J. Clin. Investig. 115 (10), 2625.

Mirgani, M.T., Isacchi, B., Sadeghizadeh, M., Marra, F., Bilia, A.R., Mowla, S.J., Najafi,F., Babaei, E., 2014. Dendrosomal curcumin nanoformulation downregulatespluripotency genes via miR-145 activation in U87MG glioblastoma cells. Int. J.Nanomed. 9, 403.

Mohsenikia, M., Alizadeh, A.M., Khodayari, S., Khodayari, H., Karimi, A., Zamani, M.,Azizian, S., Mohagheghi, M.A., 2013. The protective and therapeutic effects ofalpha-solanine on mice breast cancer. Eur. J. Pharmacol. 718 (1), 1–9.

Oudhoff, M.J., Bolscher, J.G., Nazmi, K., Kalay, H., van’t Hof, W., Amerongen, A.V.N.,Veerman, E.C., 2008. Histatins are the major wound-closure stimulating factorsin human saliva as identified in a cell culture assay. FASEB J. 22 (11),3805–3812.

Perry, M.C., Demeule, M., Régina, A., Moumdjian, R., Béliveau, R., 2010. Curcumininhibits tumor growth and angiogenesis in glioblastoma xenografts. Mol. Nutr.Food Res. 54 (8), 1192–1201.

Plummer, S.M., Holloway, K.A., Manson, M.M., Munks, R.J., Kaptein, A., Farrow, S.,Howells, L., 1999. Inhibition of cyclo-oxygenase 2 expression in colon cells bythe chemopreventive agent curcumin involves inhibition of NF-kB activationvia the NIK/IKK signalling complex. Oncogene 18 (44), 6013–6020.

Sarbolouki, M.N., Alizadeh, A.M., Khaniki, M., Azizian, S., Mohaghgheghi, M.A., 2012.Protective effect of dendrosomal Q5curcumin combination on colon cancer in rat.Tehran Univ. Med. Sci. 69 (11).

Sarbolouki, M.N., Sadeghizadeh, M., Yaghoobi, M.M., Karami, A., Lohrasbi, T., 2000.Dendrosomes: a novel family of vehicles for transfection and therapy. J. Chem.Technol. Biotechnol. 75 (10), 919–922.

Shiraga, M., Yano, S., Yamamoto, A., Ogawa, H., Goto, H., Miki, T., Miki, K., Zhang, H.,Sone, S., 2002. Organ heterogeneity of host-derived matrix metalloproteinaseexpression and its involvement in multiple-organ metastasis by lung cancercell lines. Cancer Res. 62 (20), 5967–5973.

Shishodia, S., Amin, H.M., Lai, R., Aggarwal, B.B., 2005. Curcumin (diferuloyl-methane) inhibits constitutive NF-κB activation, induces G1/S arrest, sup-presses proliferation, and induces apoptosis in mantle cell lymphoma.Biochem. Pharmacol. 70 (5), 700–713.

Wang, D., Veena, M.S., Stevenson, K., Tang, C., Ho, B., Suh, J.D., Duarte, V.M., Faull, K.F., Mehta, K., Srivatsan, E.S., 2008. Liposome-encapsulated curcumin suppressesgrowth of head and neck squamous cell carcinoma in vitro and in xenograftsthrough the inhibition of nuclear factor κB by an AKT-independent pathway.Clin. Cancer Res. 14 (19), 6228–6236.

Xie, T.-X., Xia, Z., Zhang, N., Gong, W., Huang, S., 2010. Constitutive NF-κB activityregulates the expression of VEGF and IL-8 and tumor angiogenesis of humanglioblastoma. Oncol. Rep. 23 (3), 725–732.

123456789

101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657

585960616263646566676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113






Documents

European Journal of Pharmacology...2015/04/21 · Molecular and cellular pharmacology Protective effects of dendrosomal curcumin on an animal metastatic breast tumor Baharak Farhangia,