,1 ,1

, ,

*Department of Physiology and Pharmacology, University “Sapienza”, Roma, Italy

†I.R.C.C.S. Neuromed, Pozzilli, Italy

‡The Psychiatric Institute, Department of Psychiatry, College of Medicine, The University of Illinois at

Chicago, Chicago, Illinois, USA

§Department of Experimental Medicine, Pharmacology and Toxicology Section, University of Genoa,

Genoa, Italy

AbstractThe a2d subunit of voltage-sensitive calcium channels(VSCCs) is the molecular target of pregabalin and gabapen-tin, two drugs marked for the treatment of focal epilepsy,neuropathic pain, and anxiety disorders. Expression of the a2d

subunit is up-regulated in the dorsal horns of the spinal cord inmodels of neuropathic pain, suggesting that plastic changesin the a2d subunit are associated with pathological states.Here, we examined the expression of the a2d-1 subunit in theamygdala, hippocampus, and frontal cortex in the trimethyl-tiazoline (TMT) mouse model of innate anxiety. TMT is avolatile molecule present in the feces of the rodent predator,red fox. Mice that show a high defensive behavior during TMTexposure developed anxiety-like behavior in the following

72 h, as shown by the light–dark test. Anxiety was associatedwith an increased expression of the a2d-1 subunit of VSCCsin the amygdaloid complex at all times following TMTexposure (4, 24, and 72 h). No changes in the a2d-1 proteinlevels were seen in the hippocampus and frontal cortex ofmice exposed to TMT. Pregabalin (30 mg/kg, i.p.) reducedanxiety-like behavior in TMT-exposed mice, but not in controlmice. These data offer the first demonstration that the a2d-1subunit of VSCCs undergoes plastic changes in a model ofinnate anxiety, and supports the use of pregabalin as adisease-dependent drug in the treatment of anxiety disorders.Keywords: a2d-1 subunit, amygdala, innate anxiety, TMT,voltage-sensitive calcium channels.J. Neurochem. (2013) 125, 649–656.

Voltage-sensitive calcium channels (VSCCs) are formed bythe assembly of different subunits, including the pore-forming a1 subunit (which defines the specific type ofVSCC), acytosolic b subunit, a 4-TM-domain c subunit, andan a2d subunit, in which an extracellular a2 subunit isdisulfide bonded to a transmembrane d subunit (Catterall2000; Arikkath and Campbell 2003; Davies et al. 2007,2010). There are four isoforms of the a2d subunit encoded byfour separate genes with several known splice variants. Thea2d-1 subunit is expressed in the forebrain, spinal cord,skeletal muscle, and cardiac muscle; the a2d-2 subunit isfound in the forebrain and cerebellum; the a2d-3 subunitis exclusively expressed in the brain; and the a2d-4 subunit is

found in the brain, pituitary, adrenal glands, and intestine(Dooley et al. 2007; Taylor and Garrido 2008).If coexpressed with the a1 subunit, the a2d subunit increases

the amplitude of calcium channel currents and influences the

Received May 29, 2012; revised manuscript received July 11, 2012;accepted July 12, 2012.Address correspondence and reprint requests to Ferdinando Nicoletti,

Department of Physiology and Pharmacology, University”Sapienza”,Piazzale Aldo Moro, 5, 00185 Rome, Italy.E-mail: ferdinandonicoletti@hotmail.com1Equally contributed to the work.Abbreviations used: SDS, sodium dodecyl sulfate; TMT, trimethyl-

tiazoline; VSCCs, voltage-sensitive calcium channels.

Journal of Neurochemistry © 2012 International Society for Neurochemistry, J. Neurochem. (2013) 125, 649--656 649© 2012 The Authors

JOURNAL OF NEUROCHEMISTRY | 2013 | 125 | 649–656 doi: 10.1111/j.1471-4159.2012.07895.x

rate of channel activation and inactivation (De Waard andCampbell 1995; Birnbaumer et al. 1998; Jones et al. 1998;Klugbauer et al. 1999; Wakamori et al. 1999; Cantí et al.2005). The amplifying effect of calcium current has beenascribed to an increase trafficking of the VSCC to the plasmamembrane (Cantí et al. 2005; Bernstein and Jones 2007).Interestingly, neuronal a2d-1 subunit binds to the extracellularmatrix proteins trombospondins, thereby promoting theformation of excitatory synapses (Eroglu et al. 2009). Theinterest for the a2d subunit of VSCCs has grown considerablysince the discovery that the a2d-1 and a2d-2 subunits are thepharmacological targets of gabapentin and pregabalin (Geeet al. 1996; Marais et al. 2001; Quin et al. 2002; Field et al.2006; Dooley et al. 2007), two anti-epileptic drugs that arenow gold standard in the treatment of neuropathic pain (Attalet al. 2010).Gabapentin and pregabalin are also effective in thetreatment of generalized anxiety disorder, bipolar disorders,and fibromyalgia (reviewed by Yatham 2004; Keck et al.2006; Bandelow et al. 2007; Owen 2007; Siler et al. 2011;Tzellos et al. 2010; Samuel et al. 2011). Studies carried out inspinal cord slices suggest that gabapentin and pregabalinbehave like ‘disease-dependent’ drugs, i.e. they reduce paintransmission only under pathological conditions (Patel et al.2000; Fehrenbacher et al. 2003). During neuropathic pain, thelevels of the a2d-1 subunit are up-regulated in the dorsal hornsof the spinal cord, and pregabalin prevents the increasedtransport of the a2d-1 subunit from dorsal root ganglia neuronsto the pre-synaptic terminals of primary afferent fibers in thespinal cord (Bauer et al. 2009). So far, expression of the a2dsubunit has only been studied in the dorsal root ganglia/spinalcord under conditions of chronic pain, and how the proteinbehaves in models of anxiety is unknown.Here, we examined the expression of the a2d-1 subunit in

mice exposed to trimethyltiazoline (TMT), a highly volatilesulfur-containing molecule that is found in the feces of the redfox, a natural predator of rodents (Vernet-Maury et al. 1984).Exposure to predator odor in rodents represents a model forinnate anxiety and animal phobias with putative clinicalrelevance (reviewed by Kavaliers and Choleris 2001; Rosenet al. 2008).

Materials and methods

Materials

2,5-Dihydro-2,4,5-TMT was purchased from Phero-Tech (Delta,BC, Canada). Pregabalin [(S)-3-aminomethyl)-5-methylhexanoicacid] was purchased from Tocris Bioscience (Bristol, UK).

Experimental design and TMT exposure

Experiments were carried out according to the European (86/609/EEC) and Italia (D. Lgs 116/92) guidelines of animal care. Allefforts were made to minimize animal suffering and the number ofanimals used. The experimental protocol was approved by theItalian Ministry of Health according to the procedure indicated in the

D. Lgs. 116/92. Male CD1 adult mice (25–30 g, b.w.; HarlanLaboratories, Udine, Italy) were housed with free access to food andwater and maintained on a 12-h light\dark cycle (lights off at 20:00).One week before behavioral testing, mice were individually handleddaily. Handled mice were lifted by the base of the tail and permittedfree exploration of a gloved hand for approximately 1 min. Threedays before behavioral evaluation, all mice were exposed to theexperimental protocol: on each day, they were leave free to explorea plexiglass cage (50 9 50 9 50 cm) containing an odor-free Petridish for 10 min. After that, they were placed back in their homecage. After habituation, mice were randomly assigned to TMT orsaline. Experiments were performed from 10:00 a.m. to 1 p.m. TMT(40 lL), the major component of the anal gland secretions of the redfox, was impregnated on a gauze in a Petri dish that was positionedin the open field. Mice were exposed individually for 10 min toTMT or saline and videotaped for behavioral analysis. Contactfrequency with the odorant pad, defensive burying (movementtoward the odorant cloth while pushing or spraying bedding materialtowards the cloth), freezing (immobility except for movement ofbreathing muscles), and grooming frequencies were scored. Asexpected, mice were not homogenous in displaying defensivebehavior during TMT exposure. Only mice showing a highdefensive response to TMT (i.e. mice displaying > 1-min offreezing during the 10-min exposure; Hebb et al. 2004) wererecruited for biochemical analysis and assessment of anxiety-likebehavior in the light–dark box. Of 72 mice exposed to TMT, 22were ‘high responders’. ‘High responders’ to TMT were dividedinto three groups (n = 6–8); control mice exposed to odor-freegauge (n = 20) were also divided into three groups (n = 6–7).Individual groups of ‘high responders’ and their controls were testedfor anxiety-like behaviors in the light–dark box after 4, 24, or 72 h,and killed 20 min after the end of the light–dark test (at 4, 24, or72 h after exposure to TMT or odor-free Petri dish) for biochemicalanalysis of the a2d-1 subunit.Other independent groups of mice were used to examine the

anxiolytic-like effect of pregabalin after exposure to TMT or an odor-free Petri dish. Again, only mice displaying > 1-min freezing duringTMT exposure were included in the TMT groups. In a firstexperiment, mice exposed to an odor-free Petri dish or to TMT wereused for the assessment of anxiety-like behavior in the light–dark boxat 4 h after exposure. These mice were treated i.p. with pregabalin(30 mg/kg, dissolved into saline) or with an equal volume ofsaline 1 h prior to the light–dark test, i.e. 3 h after exposure to theodor-free gauge or to TMT (n = 7, in the group of odor-free + saline,i.p.; n = 6, in the group of odor-free + pregabalin; n = 8, in the groupof high responder to TMT + saline; n = 8 in the group of highresponders to TMT + pregabalin). In a second experiment, we testedthe anxiolytic-like effect of pregabalin at 24 h after exposure to odor-free gauge or TMT. Pregabalin or saline were injected i.p. 1 h prior tothe light–dark test, i.p. 23 h after the exposure (n = 6, in the group ofodor-free + saline, i.p.; n = 6, in the group of odor-free + pregaba-lin; n = 10, in the group of high responder to TMT + saline; n = 11 inthe group of high responders to TMT + pregabalin).

Light–dark test

The apparatus consisted of a rectangular plexiglass box(20 9 50 9 20 cm) with a black chamber comprising 1\3 of thetotal volume. The two sections were separated by a plexiglass

Journal of Neurochemistry © 2012 International Society for Neurochemistry, J. Neurochem. (2013) 125, 649--656© 2012 The Authors

650 C. Nasca et al.

septum with an open door (12 9 5 cm) that permitted the passagefrom the illuminated chamber to the enclosed dark chamber. Micewere videotaped, and the time spent by each mouse in the twochambers was measured. Mice were considered to have entered achamber when all four paws were positioned within the section.

Immunoblot analysis

Mice were killed by decapitation 20 min after the end of the light–dark session, and the hippocampus, prefrontal cortex and amygda-loid complex were dissected and stored at �80°C. Anatomicaldissection was standardized with a mouse stainless steel coronalbrain matrix with a slice width of 0.5 mm using chilled razor blades.Dissection was performed at 2°C. To dissect the prefrontal cortex,we cut the portions of cerebral hemispheres anterior to a pointroughly corresponding to +2.00 mm (AP) from bregma (accordingto the Franklin and Paxinos mouse brain atlas, 1997) . Both themedial and lateral portions of the prefrontal cortex were dissected.To dissect the amygdaloid complex, we made a coronal slice1.5 mm width with the anterior portion roughly corresponding to�0.5 mm, and the posterior portion to �2.00 mm from bregma. Toobtain the amygdaloid complex, we dissected the ventral portion ofthe slice between the lateral border of the hypothalamus and themedial border of the piriform cortex. The hippocampus wasdissected out from the remaining portion of the brain. For westernblot analysis, tissue was homogenized at 4°C in ice-cold 0.1%sodium dodecyl sulfate (SDS)-lysis buffer containing proteaseinhibitors (1 mM phenylmethylsulfonyl fluoride , 1 lg/mL aproti-nin and 1 lg/mL of leupeptin) and phosphatase inhibitors(1 mMNaF, 1 mM Na3VO4 and 1 mM glycerol-2-phosphate) witha motor-driven Teflon-glass homogenizer (1700 rpm). Homogen-ates were centrifuged at 17 000 g, 4°C, for 20 min and thesupernatant was used for protein determinations. Samples contain-ing 30 lg protein were resuspended in SDS-bromophenol bluereducing buffer containing 40 mM dithiothreitol. Samples wereelectrophoresed on 8% SDS polyacrylamide gels, which were thenelectroblotted on nitrocellulose membranes (Bio-Rad, Hercules, CA,USA). Filters were blocked overnight at 4°C in Tween-tris-bufferedsaline (TTBS) buffer (100 mM Tris–HCl; 0.9% NaCl; 0.1% Tween20; pH 7.4) containing 5% non-fat dry milk and then, respectively,incubated for 2 h at 20°C with 1 lg/mL of a polyclonal antibodythat recognizes the N-terminal region of the a2d-1 subunit of VSCCs(Millipore, Temecula, CA, USA), or with 0.2 lg/mL of a mono-clonal anti-b-actin antibody (Sigma-Aldrich, St. Louis, MO, USA).Blots were washed three times with TTBS buffer and then incubatedfor 1 h with secondary antibodies (peroxidase-coupled anti-rabbit oranti-mouse; Millipore) diluted 1 : 5000 with TTBS. Immunostain-ing was revealed by enhanced chemiluminescence (AmershamBiosciences, Milan, Italy).

Real-time PCR analysis

Total RNA was extracted from the amygdala, hippocampus, orfrontal cortex with Trizol reagent (Invitrogen, Milan, Italy) andsubjected to DNaseI treatment (Promega, Milan, Italy) according tothe manufacturer’s instructions. One microgram of total RNA wasthen employed for cDNA synthesis, using ImProm-II ReverseTrascriptase (Promega) and random hexamer primers according tothe manufacturer’s instructions. One microliter of cDNA wasemployed for amplification. Amplification of Cacna2d1 cDNA was

carried out using the following primers: forward: CAGCAACGCTCAGGATGTAA; reverse: ATCTGTGATCCCCTTTGCTG; b-actin:forward: GTTGACATCCGTAAAGACC; reverse: TGGAAGGTGGACAGTGAG. Real-time quantitative PCR was performedusing a 2X SensiMix SYBR & Fluorescein Kit (Bioline, Rome,Italy) containing the double-stranded DNA-binding fluorescentprobe Syber Green and all necessary components except primers.Quantitative PCR conditions included an initial denaturation step of94°C/10 min followed by 35 cycles of 94°C/30 s and 58°C/30 s.Standards, samples, and negative controls (no template) wereanalyzed in triplicate. Concentrations of mRNA were calculatedfrom serially diluted standard curves simultaneously amplified withthe unknown samples and corrected for b-actin mRNA levels.

Statistical analysis

Statistical analysis was carried out by Student’s t-test (Fig. 1a) or bytwo- or three-way ANOVA followed by Fisher’s LSD MultipleComparison test (Figs 1b, 2, 3, and 4).

Results

About 30% of mice exposed to TMT displayed a strongdefensive behavior characterized by a total duration offreezing > 60 s in the 10-min observation period (t(40) =�38.124, p < 0.05, as compared to mice exposed to odor-free gauge). During exposure to TMT, ‘high responder’ miceshowed reduced contact frequencies with the odorant pad(t(40) = 5.813; p < 0.05), an increased defensive burying(t(40) = �2.675; p < 0.05), and a reduced grooming behavior(t(40) = 3.383; p < 0.05) with respect to control miceexposed to odor-free gauge (Fig. 1a). All these mice weresubdivided into different groups and analyzed for anxiety-like behavior in the light–dark box and for a2d-1 subunitexpression by immunoblot analysis and real-time PCR at 4,24, or 72 h following exposure to TMT or saline. The samemice tested at the light–dark box were killed 20 min later forbiochemical analysis. ‘High responder’ mice spent less timein the light chamber (i.e. they were more ‘anxious’) thanmice exposed to odor-free gauge at 4, 24, and 72 h after odorexposure (group effect – TMT vs. odor-free -,F(1,41) = 75.56; p < 0.05) (Fig. 1b).Immunoblot analysis showed an increased expression of

the a2d-1 subunit of VSCCs in the amygdaloid complex of‘high responder’ mice exposed to TMT as compared tocontrol mice exposed to saline. The increase was alreadysubstantial at 4 h and persisted at 72 h (the last timepoint examined) (group effect – TMT vs. odor-free,F(1,41) = 78.07; p < 0.05) (Fig. 2). No changes in theexpression of the a2d-1 subunit were seen in the hippocam-pus and frontal cortex of mice exposed to TMT (Fig. 2).We also measured the transcript of the a2d-1 subunit in

mice exposed to TMT or saline. Real-time PCR analysisshowed no changes in mRNA levels of a2d-1 subunit in theamygdala, hippocampus or frontal cortex at 4, 24, or 72 hfollowing TMT exposure (Fig. 3).

© 2012 The AuthorsJournal of Neurochemistry © 2012 International Society for Neurochemistry, J. Neurochem. (2013) 125, 649--656

a2d subunit of VSCCs and anxiety 651

In a separate set of experiments, we examined theanxiolytic-like effects of pregabalin in control mice exposedto odor-free gauge and in mice exposed to TMT andclassified as ‘high responders’ (> 1-min freezing duringexposure). Pregabalin (30 mg/kg) or saline were injected i.p.1 h prior the light–dark test either, i.e. 3 or 23 h followingexposure to odor-free gauge or TMT. Different groups ofmice were used for the assessment of anxiety-like behavior at4 or 24 h after exposure to avoid that pregabalin injectedafter 3 h could interfere with measurements at 24 h. At both4 and 24 h, injection of pregabalin did not affect behavior inthe light–dark test in mice exposed to odor-free gauge, butabolished anxiety-like behavior in mice exposed to TMT(Fig. 4a and b). Interestingly, mice exposed to TMT andtreated with pregabalin showed less anxiety-like behaviorwith respect to all other groups of mice at 4 h, but not at24 h (Fig. 4a and b) (group effect – TMT vs. odor-free -,F(1,61) = 26.38; p < 0.05; treatment effect – pregabalin vs.saline -, F(1,61) = 56.66; p < 0.05).

Discussion

Our data offer the first demonstration that expression of thea2d-1 subunit of VSCCs displays plastic changes in responseto a behavioral paradigm that results in anxiety-like behaviorin mice. Here, mice were exposed to the predator odor, TMT,which is known to produce unconditioned fear in rodents,and causes behavioral reactions that recapitulate animalphobias in humans (reviewed by Kavaliers and Choleris2001; Rosen et al. 2008). Lesion studies suggest that a‘medial hypothalamic defensive circuit’ involving the

anterior hypothalamic nucleus, the dorsomedial part of theventromedial hypothalamic nucleus, and the dorsalpremammillary nucleus, is critically involved in the uncon-ditioned fear response to predator odor exposure in rodents(Canteras et al. 2001; Canteras 2002). This hypothalamiccircuit receives major inputs from the medial nucleus of theamygdala and the bed nucleus of the striaterminalis, whichcarry the olfactory information to the hypothalamus (Shipleyet al. 2004). Lesions of the medial amygdala or the bednucleus of the striaterminalis reduce freezing in response topredator odor exposure (Fendt et al. 2003; Li et al. 2004;Müller and Fendt 2006; Rosen et al. 2008). We have foundthat mice characterized by a robust defensive response toTMT exposure developed anxiety-like behavior that was stillvisible after 72 h. Hebb et al. (2004) found an increasedanxiety-like behavior after 30 min, but not after 24, 48, or168 h following TMT exposure by comparing all miceexposed to TMT with mice exposed to saline, or, alterna-tively, comparing ‘high responders’ with ‘low responders’.We compared ‘high responders’ versus mice exposed tosaline, because our aim was to examine the expression of thea2d-1 subunit in groups of mice that were highly divergent interms of anxiety-like behavior. We found that anxiety wasassociated with increases in the a2d-1 protein levels in theamygdaloid complex of mice exposed to TMT. This increase,with the expected amplification of calcium channel currentand neurotransmitter release, might contribute to the induc-tion and maintenance of anxiety in response to unconditionedfear. The dissection procedure we have used did not allow usto determine where precisely the a2d-1 subunit was up-regulated inside the amygdaloid complex. Immunohisto-

Freq

uenc

y of

beh

avio

urs

(num

ber o

f eve

nts/

10 m

in)

Contact Burying Grooming

20

15

10

5

0

Odor-freeTMT (HR)

*

** S

econ

ds o

f fre

ezin

g/10

min

80

60

40

20

0 Cum

ulat

ive

time

in li

ght c

ham

ber

of li

ght d

ark

box

(/600

sec

)

4 h 24 h 72 h

400

300

200

100

0

**

*

* #

Odor-freeTMT (HR)

Odor-freeTMT (HR)

(b)(a)

Fig. 1 Long-lasting anxiety in mice showing a high behavioralresponse to trimethyltiazoline (TMT) exposure. Defensive (contact

frequencies with the pad, burying behavior, freezing) and non-defen-sive (grooming) behavior in control mice exposed to odor-free gaugeand in mice exposed to TMT and classified as ‘high responders’ (HR) is

shown in (a). Behavior was videotaped and recorded for all theduration of TMT exposure (10 min). Anxiety-like behavior in the light-dark box at 4, 24, and 72 h after exposure to saline or TMT is shown in

(b).In (a), values are means ± SEM of 20 mice in the group of ‘odor-free’, and 22 mice in the group of mice exposed to TMT. p < 0.05

(Student’s t test), as compared to the mice exposed to the odor-freegauge. In (b), values are means ± SEM of six to eight determinationsper group. p < 0.05 (Two-way ANOVA + Fisher’s LSD) versus the

corresponding groups of control mice exposed to the odor free gauge(*) or versus mice exposed to the odor-free gauge and examined after72 h (#). Group effect: F(1,41) = 75.56; time effect: F(2,41) = 5.37.

Journal of Neurochemistry © 2012 International Society for Neurochemistry, J. Neurochem. (2013) 125, 649--656© 2012 The Authors

652 C. Nasca et al.

chemical analysis (see Taylor and Garrido 2008) may help tospecifically address this important issue. The associationbetween an increased expression of the a2d-1 subunit in theamygdala and unconditioned fear-induced anxiety wasstrengthened by the lack of changes in the hippocampusand prefrontal cortex, two brain regions that are onlyminimally involved in the behavioral response to predatorodor exposure (Rosen et al. 2008).However, we shouldhighlight that no effort was made in dissecting the subregionsof the prefrontal cortex, and, therefore, we cannot excludethat anatomically restricted changes in the expression of the

a2d-1 subunit occur in the prefrontal cortex in response toTMT.The molecular nature of the increased expression of the

a2d-1 subunit we have found in the amygdaloid complex ofmice exposed to TMT is unknown. The increase was alreadysubstantial at 4 h after TMT exposure, and was notassociated with changes in mRNA levels. Thus, it is unlikelythat TMT exposure changed the de novo synthesis of the a2d-1 subunit. A series of elegant studies have shown thatgabapentin inhibits the Rab11-dependent insertion of thea2d-2 subunit from post-Golgi compartments to the plasma

β-actin >

4 h 24 h 72 h

4 h 24 h 72 h4 h 24 h 72 h

0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

β-actin >

β-actin >

<140 kD

<45 kD

<140 kD

<45 kD

<140 kD

<45 kD

** *

4 h

24 h

72 h

0

0.2

0.4

0.6

0.8

1.0

0

0.2

0.4

0.6

0.8

1.0

1.2

Amygdala

Hippocampus Cortex

Den

sito

met

ric a

naly

isis

of α

δ-1/β-

actin

2

Den

sito

met

ric a

naly

isis

of α

δ-1/β-

actin

2D

ensi

tom

etric

ana

lyis

is o

f αδ-

1/β-

actin

2

α δ-1 >2

α δ-1 >2

α δ-1 >2

Odor-freeTMT (HR)

Odor-freeTMT (HR)

Odor-freeTMT (HR)

Odor-free TMT (HR)

# #

§ §

Fig. 2 Long-lasting increases in the protein levels of the a2d-1 subunitof VSCCs in the amygdala of ‘high responder’ (HR) mice developinganxiety following trimethyltiazoline (TMT) exposure. Densitometric

values are the expressed as the ratio between the a2d-1 subunitbands and the relative b-actin bands and are the means ± SEM of

six to eight determinations. p < 0.05 (Two-way ANOVA + Fisher’s LSD)versus the corresponding values obtained in control mice exposedto odor-free gauge (*), versus TMT values at 4 h (#), or versus ‘odor-

free’ values at 4 h (§). Group effect: F(1,41) = 78.07; time effect:F(2,41) = 12.77.

© 2012 The AuthorsJournal of Neurochemistry © 2012 International Society for Neurochemistry, J. Neurochem. (2013) 125, 649--656

a2d subunit of VSCCs and anxiety 653

membrane (Hendrich et al. 2008; Tran-Van-Minh and Dol-phin 2010). It has been hypothesized that gabapentindisplaces an endogenous ligand that promotes cell-surfaceexpression of the a2d-1 subunit (Hendrich et al. 2008). Wespeculate that unconditioned fear caused by predator odorexposure affects the intracellular trafficking of the a2d-1

subunit in the amygdala, thereby enhancing protein recyclingto the plasma membrane at the expenses of the endosomalpool that is destined to proteasomal degradation. Thishypothesis warrants further investigation.It was important to demonstrate that treatment with

pregabalin, which is one of the two marketed ligands ofthe a2d-1 subunit of VSCCs, was ‘therapeutically’ effectivein the TMT model of innate anxiety. In spite of the wide useof pregabalin in the treatment of anxiety disorders (seeIntroduction and references therein), there are only a fewstudies showing the anxiolytic effect of the drug in animalmodels. Pregabalin has shown anxiolytic effects in conflicttests in rat and mice (Field et al. 2001; Lotarski et al. 2011),and in the elevated X maze in rats (Field et al. 2001). Inaddition, pregabalin was found to reduce anxiety-likebehavior induced by cannabinoid withdrawal in mice(Aracil-Fernández et al. 2011). Of particular relevance toour finding is the evidence that pregabalin was effective in arat model of post-traumatic stress disorder induced by a 10-min exposure to predator urine scent (well-soiled cat litter for10 min). Using this model, pregabalin, at a dose of 30 mg/kg, reduced anxiety in the elevated plus maze and acousticstartle response paradigms at 1 h following predator urinescent exposure (Zohar et al. 2008). Here, pregabalin (30 mg/kg, i.p.) showed a clear-cut anxiolytic effect at both 4 and24 h following TMT exposure, two time points that coincidewith the increased levels of the a2d-1subunit in the amygdalaRemarkably, pregabalin treatment did not affect behavior inthe light–dark test in control mice (i.e. in mice exposed to anodor-free gauge), suggesting that pregabalin behaved as ananxiolytic drug in a context characterized by an up-regulation

0

0.02

0.04

0.06

0.08

0.10

0

0.05

0.10

0.15

0.20

0.25

0

0.05

0.10

0.15

0.20

0.25Amygdala Hippocampus Cortex

4 24 72 h 4 24 72 h 4 24 72 h

mR

NA

Cac

na2δ

1/β -

actin

(ng)

mR

NA

Cac

na2δ

1/β-

actin

(ng)

mR

NA

Cac

na2δ

1/β -

actin

(ng)

Odor-free

TMT (HR)

Odor-free

TMT (HR)

Odor-free

TMT (HR)

Fig. 3 No changes in the transcript of the a2d-1 subunit of VSCCs in

the amygdala, hippocampus, and frontal cortex of mice exposed toTMT and classified as ‘high responders’ (HR). Values aremeans ± SEM of six to eight determinations. Odor-free values were

measure after 4 h of exposure. Additional experiments (not reported)

showed that a2d-1 subunit mRNA levels were stable at 4, 24, and72 h following exposure to odor-free gauge.

Odor-free TMT (HR)

100

200

300

400

Cum

ulat

ive

time

in li

ght c

ham

ber

of li

ght d

ark

box

(/600

s)

0

Saline Pregabalin, 30 mg/kg

Odor-free TMT (HR)

*

*

4 h 24 h

#

§ §

Fig. 4 Pregabalin treatment reduces anxiety-like behavior in the light–dark test in mice exposed to trimethyltiazoline (TMT). Mice exposed to

odor-free gauge or TMT were tested in the light–dark box at 4 and 24 hafter exposure. Pregabalin (30 mg/kg) or saline were injected i.p. onlyonce 1 h prior to the light–dark test (i.e., 3 or 23 h following odor-free

or TMT exposure). Values are means ± SEM of 6–11 mice per group.p < 0.05 (Three-way ANOVA+ Fisher’s LSD) versus TMT-exposed micetreated with saline at both 4 and 24 h (*), versus TMT-exposed micetreated with pregabalin at 24 h (#), or versus all other values (§).Group

effect – TMT versus odor-free -, F(1,61) = 26.38; treatment effect –

pregabalin versus saline - F(1,61) = 56.66; time effect, F(1,61) = 0.01.

Journal of Neurochemistry © 2012 International Society for Neurochemistry, J. Neurochem. (2013) 125, 649--656© 2012 The Authors

654 C. Nasca et al.

of the a2d-1 subunit. We have no explanation for thesubstantial anxiolytic-like effect of pregabalin seen at 4 hfollowing TMT exposure, when TMT-exposed mice treatedwith pregabalin were even less ‘anxious’ than control miceexposed to the odor-free gauge.In conclusion, our data support the hypothesis that a2d

ligands act as ‘disease-dependent’ drugs and raise anumber of interesting questions that need to be addressed,i.e. (i) where precisely the a2d-1 subunit is up-regulatedwithin the amygdaloid complex and perhaps in other brainstructures involved in anxiety; (ii)whether and how thea2d-1 subunit responds to other behavioral paradigms ofanxiety, including fear conditioning; and (iii) how anxietyaffects specific functions related to a2d, including traffick-ing and activity of voltage-sensitive calcium channels orchanges in neuroplasticity resulting from the interactionbetween the a2d subunit and thrombospondins (Erogluet al. 2009).

Acknowledgement

The authors have no conflict of interest to declare.

References

Aracil-Fernández A., Almela P. and Manzanares J. (2011) Pregabalinand topiramate regulate behavioural and brain gene transcriptionchanges induced by spontaneous cannabinoid withdrawal in mice.Addict. Biol. doi: 10.1111/j.1369-1600.2011.00406.x [Epub aheadof print].

Arikkath J. and Campbell K. P. (2003) Auxiliary subunits: essentialcomponents of the voltage- gated calcium channel complex. Curr.Opin. Neurobiol. 13, 298–307.

Attal N., Cruccu G., Baron R., Haanpää M., Hansson P., Jensen T. S.and Nurmikko T. (2010) EFNS guidelines on the pharmacologicaltreatment of neuropathic pain: 2010 revision. Eur. J. Neurol. 17,1113–1188.

Bandelow B., Wedekind D. and Leon T. (2007) Pregabalin for thetreatment of generalized anxiety disorder: a novel pharmacologicintervention. Expert Rev. Neurother. 7, 769–781.

Bauer C. S., Nicto-Rostro M., Rahman W. et al. (2009) The increasedtrafficking of the calcium channel Subunit a2d1 into presynapticterminals in neuropathic pain is inhibited by the a2d ligandpregabalin. J. Neurosci. 13, 4076–4088.

Bernstein G. M. and Jones O. T. (2007) Kinetics of internalization anddegradation of N-type voltage-gated calcium channels: role of thealpha2/delta subunit. Cell Calcium 41, 27–40.

Birnbaumer L., Qin N., Olcese R., Tareilus E., Platano D., Costantin J.and Stefani E. (1998) Structures and functions of calcium channelbeta subunits. J. Bioenerg. Biomembr. 30, 357–375.

Canteras N. S. (2002) The medial hypothalamic defensive system:hodological organization and functional implications. Pharmacol.Biochem. Behav. 71, 481–491.

Canteras N. S., Ribeiro-Barbosa E. R. and ComoliE. (2001) Tracingfrom thedorsal premammillary nucleusprosencephalic systemsinvolved in the organization of innate fear responses. Neurosci.Biobehav. Rev. 25, 661–668.

Cantí C., Nieto-Rostro M., Foucault I. et al. (2005) The metal-ion-dependent adhesion site in the Von Willebrand factor-A domain of

alpha2delta subunits is key to trafficking voltage-gated Ca2+

channels. Proc. Natl Acad. Sci. USA 9, 11230–11235.Catterall W. A. (2000) From ionic currents to molecular mechanisms: the

structure and function of voltage-gated sodium channels. Neuron26, 13–25.

Davies A., Hendrich J., Van Minh A. T., Wratten J., Douglas L. andDolphin A. C. (2007) Functional biology of the alpha(2)deltasubunits of voltage gated calcium channels. Trends Pharmacol.Sci. 28, 220–228.

Davies A., Kadurin I., Alvarez-Laviada A., Douglas L., Nieto-RostroM., Bauer C. S., Pratt W. S. and Dolphin A. C. (2010) The a2dsubunits of voltage gated calcium channel form GPI-ancoredproteins, a posttraslational modification essential for function.Proc. Natl Acad. Sci. USA 107, 1654–1659.

De Waard M. and Campbell K. P. (1995) Subunit regulation of theneuronal alpha 1A Ca2+ channel expressed in Xenopus oocytes.J. Physiol. 15, 619–634.

Dooley D. J., Taylor C. P., Donevan S. and Feltner D. (2007) Ca2+

channel alpha2 delta ligands:novel modulators ofneurotransmission. Trends Pharmacol. Sci. 28, 75–81.

Eroglu C., Allen N. J., Susman M. W. et al. (2009) Gabapentin receptoralpha2 delta-1 is a neural trombospondine responsible forexcitatory CNS synaptogenesis. Cell 139, 380–392.

Fehrenbacher J. C., Taylor C. P. and Vasko M. R. (2003) Pregabalin andgabapentin reduce release of substance P and CGHRP from ratspinal tissue only after infiammation or activation of protein kinaseC. Pain 105, 133–141.

Fendt M., Endres T. and Apfelbach R. (2003) Temporary inactivation ofthe bed nucleus of the striaterminalis but not of the amygdalablocks freezing induced by trimethylthiazoline, a component of foxfeces. J. Neurosci. 1, 23–28.

Field M. J., Oles R. J. and Singh L. (2001) Pregabalin may represent anovel class of anxiolytic agents with a broad spectrum of activity.Br. J. Pharmacol. 132, 1–4.

Field M. J., Cox P. J., Stott E. et al. (2006) Identification of the alpha2-delta-1 subunit of voltage-dependent calcium channels as amolecular target for pain mediating the analgesic actions ofpregabalin. Proc. Natl Acad. Sci. USA 14, 17537–17542.

Franklin K. B. J. and Paxinos G. (1997) The mouse brain in stereotaxiccoordinates. London: Academic.

Gee N. S., Brown J. P., Dissanayake V. U., Offord J., Thurlow R. andWoodruff G. N. (1996) The novel anticonvulsant drug, gabapentin(Neurontin), binds to the alpha2delta subunit of a calcium channel.J. Biol. Chem. 8, 5768–5776.

Hebb A. L., Zacharko R. M., Gauthier M., Trudel F., Laforest S. andDrolet G. (2004) Brief exposure to predator odor and resultantanxiety enhances mesocorticolimbic activity and enkefphalinexpression in CD-1 mice. Eur. J. Neurosci. 20, 2415–2429.

Hendrich J., Van Minh A. T., Heblich F., Nieto-Rostro M., WatschingerK., Striessnig J., Wratten J., Davies A. and Dolphin A. C. (2008)Pharmacological disruption of calcium channel trafficking by thealpha 2 delta ligand gabapentin. Proc. Natl Acad. Sci. USA 105,3628–3633.

Jones L. P., Wei S. K. and Yue D. T. (1998) Mechanism of auxiliarysubunit modulation of neuronal alpha1E calcium channels. J. Gen.Physiol. 112, 125–143.

Kavaliers M. and Choleris E. (2001) Antipredator responses anddefensive behavior: ecological and ethological approaches for theneurosciences. Neurosci. Biobehav. Rev. 25, 577–586.

Keck P. E., Strawn J. R. and McElroy S. L. (2006) Pharmacologictreatment considerations in co- occurring bipolar and anxietydisorders. J. Clin. Psychiatry 1, 8–15.

Klugbauer N., Marais E., Lacinová L. and Hofmann F. (1999) T-typecalcium channel from mouse brain. Pflugers Arch. 437, 710–715.

© 2012 The AuthorsJournal of Neurochemistry © 2012 International Society for Neurochemistry, J. Neurochem. (2013) 125, 649--656

a2d subunit of VSCCs and anxiety 655

Li C. I., Maglinao T. L. and Takahashi L. K. (2004) Medial amygdalamodulation of predator odor- induced unconditioned fear in the rat.Behav. Neurol. 118, 324–332.

Lotarski S. M., Donevan S., El-Kattan A., Osgood S., Poe J., Taylor C.P. and Offord J. (2011) Anxiolytic-like activity of pregabalin in theVogel conflict test in a2d-1 (R217A) and a2d-2 (R279A) mousemutants. J. Pharmacol. Exp. Ther. 338, 615–621.

Marais E., Klugbauer N. and Hofmann F. (2001) Calcium channel alpha(2)delta subunits-structure and Gabapentin binding. Mol.Pharmacol. 59, 1243–1248.

Müller M. and Fendt M. (2006) Temporary inactivation of the medialand basolateral amygdala differentially affects TMT-induced fearbehaviour in rats. Behav. Brain Res. 167, 57–62.

Owen R. T. (2007) Pregabalin: its efficacy, safety and tolerability profilein generalized anxiety. Drugs Today 43, 601–610.

Patel M. K., Gonzalez M. I., Bramwell S., Pinnock R. D. and Lee K.(2000) Gabapentin inhibits excitatory synaptic transmission in thehyperalgesic spinal cord. Br. J. Pharmacol. 130, 1731–1734.

Quin N., Yagel S., Momplasir M. L., Codd E. E. and D’Andrea M.R. (2002) Molecular cloning and characterization of humanvoltage gated calcium channel alpha (2) delta-4 subunit. Mol.Pharm. 62, 485–496.

Rosen J. B., Pagani J. H., Rolla K. L. and Davis C. (2008) Analysis ofbehavioral constraints and the neuroanatomy of fear to the predatorodor trimethylthiazoline: a model for animal phobias. Neurosci.Biobehav. Rev. 32, 1267–1276.

Samuel M., Zimovetz E. A., Gabriel Z. and Beard S. M. (2011) Efficacyand safety of treatments for refractory generalized anxiety disorder:a systematic review. Int. Clin. Psychopharmacol. 26, 63–68.

Shipley M. T., Ennis M. and Puche A. (2004) Olfactory system, in TheRat Nervous System (Paxinos G., ed), pp. 923–964. ElsevierAcademic Press, San Diego.

Siler A. C., Gardner H., Yanit K., Cushman T. and McDonagh M.(2011) Systematic review of the comparative effectiveness ofantiepileptic drugs for fibromyalgia. J. Pain 12, 407–415.

Taylor C. P. and Garrido R. (2008) Immunostaining of rat brain, spinalcord; sensory neurons and skeletal muscle for calcium channelalpha2 delta type 1 protein. Neuroscience 155, 510–521.

Tran-Van-Minh A. and Dolphin A. C. (2010) The alpha2delta ligandgabapentin inhibits the Rab11- dependent recycling of the calciumchannel subunit alpha2delta-2. J. Neurosci. 22, 12856–12867.

Tzellos T. G., Toulis K. A., Goulis D. G., Papazisis G., Zampeli V. A.,Vakfari A. and Kouvelas D. (2010) Gabapentin and pregabalin inthe treatment of fibromyalgia: a systematic review and a meta-analysis. J. Clin. Pharm. Ther. 35, 639–656.

Vernet-Maury E., Polak E. H. and Demael A. (1984) Structure–activityrelationship of stress- inducing odorants in the rat. J. Chem. Ecol.10, 1007–1018.

Wakamori M., Mikala G. and Mori Y. (1999) Auxiliary subunitsoperateas a molecular switch in determining gating behaviour of theunitary N-type Ca2+ channel current in Xenopusoocytes. J. Physiol.15, 659–672.

Yatham L. N. (2004) Newer anticonvulsants in the treatment of bipolardisorder. J. Clin. Psych 65, 28–35.

Zohar J., Matar M. A., Ifergane G., Kaplan Z. and Cohen H. (2008) Briefpost-stressor treatment with pregabalin in an animal model forPTSD: short-term anxiolytic effects without long-term anxiogeniceffect. Eur. Neuropsychopharmacol. 18, 653–666.

Journal of Neurochemistry © 2012 International Society for Neurochemistry, J. Neurochem. (2013) 125, 649--656© 2012 The Authors

656 C. Nasca et al.