Upload
ian-martin
View
625
Download
4
Embed Size (px)
Citation preview
Undergraduate Thesis
Name: Ian Martin
Programme: Genetics & Cell Biology GCB4
Student Number: 11532343
Supervisor: Dr. Brendan O’Connor
Combined Literature Survey & Final Year Research Project
Literature Survey
Simply Better Glycoproteins : A Bittersweet Relationship
Between Glycosylation and Recombinant Therapeutics
Final Year Research Project
Assessing the Sweet Tooth of Fungal Lectin AAL-2:
Characterizing AAL-2 binding with N-aceylglucosamine
Appendix A
DCU University’s Declaration on Plagiarism
Assignment Submission Form
This form must be filled in and completed by the student submitting an assignment.
Assignments submitted without the completed form will not be accepted.
Name:
Programme:
Module Code:
Assignment Title:
Submission Date:
I declare that this material, which I now submit for assessment, is entirely my own
work and has not been taken from the work of others, save and to the extent that such
work has been cited and acknowledged within the text of my work. I understand that
plagiarism, collusion, and copying are grave and serious offences in the university and
accept the penalties that would be imposed should I engage in plagiarism, collusion or
copying. I have read and understood the Assignment Regulations set out in the
module documentation. I have identified and included the source of all facts, ideas,
opinions, and viewpoints of others in the assignment references. Direct quotations
from books, journal articles, internet sources, module text, or any other source
whatsoever are acknowledged and the source cited are identified in the assignment
references. This assignment, or any part of it, has not been previously submitted by
me or any other person for assessment on this or any other course of study.
I have read and understood the referencing guidelines found at
http://www.library.dcu.ie/citing&refguide08.pdf and/or recommended in the
assignment guidelines.
Name: ________________________________ Date: _________________
Simply Better Glycoproteins
“A Bittersweet Relationship Between Glycosylation
and Recombinant Therapeutics”
Name: Ian Martin
Student Number: 11532343
Supervisor: Brendan O’ Connor
Programme: Genetics and Cell Biology (GCB4)
Abstract
Glycosylation is a ubiquitous post translational modification found in all domains of life
that involves the sequential addition of sugars to biomolecules. The attachment of specific
glycans to therapeutic glycoproteins imparts extensive functional information that extends
beyond the genome code and plays an important role in dictating a biologic’s pharmacological
efficiency, structure and immunogenicity. Several industrial cell lines are subject to a spectrum
of inventive glycoengineering strategies to produce high amounts of desired homogenous
therapeutic glycoproteins that are both fit for purpose and safe for patient consumption. This
review summarises the salient features of N- and O-linked protein glycosylation, details the
significance of glycosylation in relation protein therapeutics and explores glycoengineering
techniques used to obtain optimal biologics from mammalian, bacteria and plant cell lines.
Contents Introduction ............................................................................................................................................... 1
What Is Glycosylation? ............................................................................................................................ 1
N-Glycosylation ........................................................................................................................................ 2
O-linked Glycosylation ............................................................................................................................. 4
Glycoprotein heterogeneity ....................................................................................................................... 5
Properties of Therapeutic Glycoproteins .................................................................................................. 5
Controlling Glycosylation ......................................................................................................................... 7
Mammalian Cell Lines .............................................................................................................................. 9
Precision Genome Editing Strategies in CHO cells ................................................................................ 11
Bacteria Cell Lines .................................................................................................................................. 14
E.coli Vaccine Production ...................................................................................................................... 16
Plant Cell Lines ....................................................................................................................................... 18
Glycoengineering The First Plant FDA Approved Biologic .................................................................. 22
Future Perspectives ................................................................................................................................. 23
Conclusion .............................................................................................................................................. 24
References ............................................................................................................................................... 24
1
Introduction
Traditional small molecule drugs synthesised from reproducible chemical reactions are
steadily being replaced by large molecule recombinant proteins, known as biologics, which are
derived from genetically modified industrial cell lines(Walsh 2009; Walsh 2010; Lepenies &
Seeberger 2014). This molecular transition in therapeutic drug production has fuelled the
emergence of the biopharmaceutical industry over the last 30 years and today it is approximated
that there are over 4000 biotech companies worldwide (Walsh 2009; Walsh 2010). The
properties of a biologic are governed by several variables including post translational
modifications (PTM) and the biopharmaceutical industry are recognizing that 40% of
recombinant proteins are subject to glycosylation(Declerck 2012). Such a PTM can produce
thousands of variations of an approved recombinant drug which is a concern to drug authorities
because glycosylation has such an extensive impact on the biological and physical characteristics
of given recombinant therapeutic(Spiro 2002(Walsh 2010)). By characterising pivotal glycan
motifs that dictate pharmacological activity and harnessing industrial cell glycosylation in
controlled manner, glycoproteins can be optimised for efficiency and safe patient
consumption(Griebenow & Sola 2010). The purpose of this literature review is to examine the
prominent features of glycosylation as well as detailing the latest possible glycoengineering
strategies being pursued in regards mammalian and non-mammalian cells in order to produce
high quality drug products(Lepenies & Seeberger 2014).
What Is Glycosylation?
Glycosylation is a universal post-translational modification present in eukarya,
prokaryotes and archaea which facilitates the addition of oligosaccharides to lipids or proteins in
order to form glycoproteins and glycolipids respectively(Lowe & Marth 2003). A cell’s glycome
is the collective term given to all the free glycans that are transported into cells by integral
membrane transporters , sugars produced via de novo pathways and oligosaccharide bearing
biomolecules(Marth & Grewal 2008) . Different domains of life exhibit show glycomes and in
eukaryotic cells 10 monosaccharides predominant the composition of a given glycan
biomolecules. They are as follows; fucose (Fuc), galactose (Gal), glucose (Glc),
2
N‑acetylgalactosamine (GalNAc), N‑acetylglucosamine (GlcNAc), glucuronic acid (GlcA),
iduronic acid (IdoA), mannose (Man), sialic acid (SA) and xylose (Xyl)(Moremen et al. 2012).
Studies have indicated that most secreted molecules in cells are enzymatically modified
using the activated form of the above sugars as they travel through the Endo Reticulum (ER)
and Golgi Apparatus pathway (Freeze et al. 2009).It is suggested that there is nearly 700 proteins
work in symphony to orchestrate the production of an estimated 7,000 mammalian glycan
structures in the ER-Gogi pathway. (E.Taylor 2003)Glycosylation predominantly relies on
integral membrane known as glucosytransferases and glycosidases proteins within this system to
synthesise glycan structures onto biomolecules.
35 % of glycosylation enzymes found in eukarya cells are categorized as
glycosyltransferases which catalyse glycosidic alpha and beta bonds between activated
monosaccharides and add oligosaccharide chains to proteins directly. (Paulson et al. 2006;
Gloster 2014). Glycotranferases are specific for the monosaccharide donor substrates they act
upon and their anabolic action promotes the elongation of glycan motifs. Glycosidases on the
other hand cleave monosaccharides off oligosaccharides by disrupting glycosidic bonds within
an polysaccharide chain. The complimentary action of glycosyltransferases and glycosylsidases
carry out different types glycosylation which categorised by the identity of the atom contained
in the amino acid in which a carbohydrate chain is attached.(Ohtsubo & Marth 2006) For the
purposes of this review only N- and O-linked glycosylation will be examined as these are
predominant glycosylation products in a given cell.
N-Glycosylation
N-Linked Glycosylation is the most abundant form of glycosylation across all domains of
life as approximately 90-95 % of glycoproteins contain N-glycan structures. N-glycosylation
assembly is depicted in Figure 1 (Sneider,J n.d) and begins with the fabrication of a lipid
precursor known as lipid dolichol phosphate (Dol-P) made up of 14 monosaccharides (Costa et
al. 2014).This lipoglycan structure is constructed on the cytosolic side of the ER membrane with
GlcNac and Man residues before being translocated into the lumen of ER via a bilayer flippase
(Costa et al. 2014).Situated in the ER lumen four Man and three Glc residues are attached to the
lipoglycan completing the synthesis of the dolichol glycan precursor Glc3Man9GlcNAc2.
3
]he crucial step of N-glysoylation is the attachment of Glc3Man9GlcNAc2 to an
emerging protein being translated from a ribosome. This event is a co-translational and en bloc
transfer of the lipid-glycan is mediated by an oligosaccharyltransferase (OST) emedded in the
bilayer to an exposed Asn residue (Dell et al. 2010). Typically a predicted consequence Asn-X-
Thr/Ser motif sequence whereby X can be any amino acid except proline is used for N-
glycosylaion. (Spiro 2002). One should also acknowledge that proteins emerging from a
ribosome are not in a folded state thus facilitate access to an asn sites. Once a
Glc3Man9GlcNAc2 motif is attached a series of successive trimming steps ensue in the lumen of
the ER by glucosidases to yield Man8GlcNAc2. This is the core structure for any N-glycan
before diversification in the Golgi apparatus(Wang & Amin 2014).
Figure 1 N-glycan Construction.Lipid precursor is synthesised in the cytosol and
translocated into the ER via a flippase. An oligosaccharide transferase attaches the
precursor lipoglycan structure to an Asn residue of growing nascent protein
The Golgi Apparatus is composed of a series of cisternae stacks known as the cis,
medial and trans cisternae respectively. Vesicle transport allows secretory proteins to be shipped
from the ER to the Golgi complex and between these cisternse compartments. N-glycans are
initially transported to the cis cistarnae where 3 mannose residues are cleaved by mannosidase
before being transported to the medial Golgi. Within the medial-Golgi further mannose cleavage
ensues before GlcNac and fucose residues are attached. Processing of a glycoprotein is
completed in the Golgi when finally galactose residues and sialic are added. These reactions
allows variable amounts of GlcNAc, galactose, fucose, and sialic acid to be given glycoprotein in
4
variety of different linkage patterns before processed glycoproteins are transferred to many intra
and extracellular destinations (Freeze et al. 2014).
Ultimately, a N-Glycan with core Man3GlcNa2 can exhibit one of 3 types of sugar
structures as depicted in Figure 2 (Hossler 2009 ,pg 939, fig 01) (1) High mannose (5 -9
mannose residues linked to core Man3GlcNa2). (2) Complex (No mannose attached but Gal and
siaic acid residues are attached in branched structures). (3) Hybrid (High mannose content and
complex antenne which can be biantennary, triantennary and tetra-antennary)
O-linked Glycosylation
O-Glycosylation is the second most predominant form of glycosylation found in all
domains of life. It is characterised by the addition of oligosaccharides to serine and threonine
acceptor amino sites however unlike N-glycosylation does not harbour a specific amino acid
acceptor sequence(Ohtsubo & Marth 2006). Contrary also to N-glycans which decorate a given
protein at between 1 -10 sites, O-gylcans are more universally expressed along the polypeptide
backbone of glycoprotein(E.Taylor 2003). For example mucins and proteoglycans O-glycans
produce large sugar motifs that make up to 75% of the final mass of a given glycoprotein. The
Figure 2 N-Glycan and O glycan structures Structures (A) N-glycosylation can result in 3
possible structures: (1)High Mannose structure (2)Hybrid structure (3) Complex (B) O-
glycans cosist one of 8 core glycan structures.
5
exact mechanics of O-glycosylation are less characterised than that of N-glycosylation but it
widely accepted they principally take place in the Golgi complex. O-glycans exhibit simple sugar
motifs with one of 8 core structures depicted in figure 2.(Ohtsubo & Marth 2006; Hossler et al.
2009) While O- glycosylation produces a wide diversity of O-glycan structures, the purpose of
such modifications are not as well-known as N-glycosylation.For this reason the remainder of the
review will concentrate on primarily on N-glycosylation.
Glycoprotein heterogeneity
A given protein encoded from a single gene sequence can exist in several different
glycosylated states , known as a glycoforms, due to different sugar being attached to the same
protein.(Griebenow & Sola 2010). Unlike protein sequences which are derived from gene order,
glycan structures are indirectly coded from the genome because they are created from gene
encoded glycosytransferases and glycosidases. It should be emphasized each golgi cisternae
apparatus harbours different glycosylation enzymes that contend with other each other to modify
glycan motifs. (Lowe & Marth 2003) For example the competitive between glycosyltransferses
to act on glycan sugar substrate may be decided by monosaccharide availability in a cell.
Therefore if a particular sugar is more readily obtainable at a given time it will be added to a
glycan motif structure first. This is important because the product of each enzymatic reaction
provides the substrate for the next step thus the addition of one monosaccharide over another
may switch the faith of a glycan motif (Ohtsubo & Marth 2006). Variation in the activity of
glycosynthetic enzymes along other variables such as the speed in which glycosylation takes
place in the ER-Golgi pathway and remodelling of a glycoprotein when it is discharged from the
golgi apparatus result in glycan micro and macro heterogeneity being displayed on the surface of
a glycoprotein. (Ohtsubo & Marth 2006; Lowe & Marth 2003) This glycan deviation is best
exemplified by an IgG which can hold one of 32 unique oligosaccharides motifs on each of its
heavy chains. Due to the bisymmetrical nature of IgG therefore there are in total 500
glycoforms that could materialise due to variations in the glycosylation pathway (Uçaktürk 2012;
Jefferis 2009).
Properties of Therapeutic Glycoproteins
The above concept of glycosylation heterogeneity plays an instrumental role in dictating
the properties of proteins because glycan motifs convey supplementary information that
6
overrides DNA transcription, supersedes translation and ultimately dictates the properties of a
protein(Hossler et al. 2009a). As will be now discussed this is extremely relevant in regards
recombinant therapeutics because studies have shown that the presence and absence of sugar
contribute significantly the solubility, stability and half-life of a given biologic (Kamionka 2011;
Griebenow & Sola 2010)
Solubility
Solubility plays an instrumental role in attaining the desired therapeutic concentration of
a drug in systemic blood and hence promotes a correct pharmacological response in a patient.
One example whereby the solubility properties of a biologic is governed by glycosylation is
Fabrazyme which is a-galactosidase used to treat Fabrys disease.(Walsh 2009) Studies have
showed that if N-glycosylation does not occur at asn184 of its polypeptide chain unfavourable
aggregation and precipitation of the drug can transpire in vivo. It is suggested that N-
glycosylation increases solubility because hydrophilic sugar molecules such as sialic acid
shielding hydrophobic residues interacting with blood plasa. (Walsh 2009)
Stability
The systemic expression of proteases blood circulation can result in unwanted proteolytic
degradation of a given biologic and reduced bioavailability. It has been suggested that
glycosylation can mechanically disrupt protease catalysis by steric hindering or cleaving the
active site of a proteases. In addition the branching, length and overall charge of glycan
structures also repel proteolysis. (Golledge et al. 2007; Russell et al. 2009).
Half Life
It has been indicated that N- and O- glycan structures dramatically impact the circulatory
half-life of therapeutic glycoproteins. It is widely accepted that the presence of terminal sialic
acids is proportional to the lifespan of a glycoprotein in blood. Sialic residues are hypnotised to
shield galactose or mannose terminating glycoproteins by blocking asialoglycoprotein
receptor-mediated endocytosis in liver cells. (Hossler et al. 2009b)One recombinant protein
which expresses high sensitivity towards N-terminal sialylation is Erythropoietin (EPO). This
hormonal drug plays in an imperative role in the regulation of red blood cell homeostasis in
7
anaemic patients .Studies performed have shown that when human recombinant was injected
intravenously into rodents the half-life of the drug was between 5 to 6 hours while desialylated
EPO remained lasted under 2 minutes.(Hossler et al. 2009)
Immunogenicity
The capacity of a given compound to elicit an immune response is defined as its
immunogenicity. An unwanted immune reaction can be triggered by a glycoprotein because the
body’s immune system recognises a biologic as a non-self molecule. (van Beers & Bardor
2012)Over the last ten years several sugar epitopes have been identified to stimulate an
immunological response. For example 50 % of blood donors contain antibodies against β1,2-
xylose core-xylose, which is a characteristic of plant glycosylation. The potential stimulation of
the immune response because of the presence of these anti-β1,2-xylose core-xylose
immunoglobulins has pressed industry to regulate glycosylation pathways in cells.(van Beers &
Bardor 2012)
Controlling Glycosylation
As previously discussed above the unpredictability glycoform generation is a distinctive
hallmark of glycosylation. Drug authorities are becoming increasing concerned about variable
glycan composition because glycosylation can significantly affect the pharmacological
characteristics of a biologic(Jenkins et al. 2008). This capacity to modify proteins noticeably
means that control of glycosylation mechanism in industrial cell lines is of upmost priority in
relation to therapeutic protein manufactory (Walsh & Jefferis 2006) Drug authorities are exerting
mounting pressure of biotech companies to the regulate underlying glycosylation mechanisms,
characterise optimal glycoprofiles and enrich for such biologics in accordance with defined
acceptance limits stipulated by international drug protocols.(Hossler et al. 2009b). These limits
are set in place to ensure that drugs are fit purpose and not dangerous for patient consumption.
However ever since the first glycoprotein there has been ongoing debate regarding what
glycoforms comprise the identity, purity and potency of a drug product without revaluating a as a
new biopharmaceutical.(Schiestl et al. 2011) In a study published in Nature in 2011 Martin
Schiestl et el highlights the prevalence of glycoform variation in respect to 3 biologics Enbrel,
Aranesp and Rituxan when compared to their original approved glycoform. (Schiestl et al. 2011)
8
All three molecules exhibited subtle changes in their glycosylation status from 2007 to 2010
which were properly the resultant of alterations in bioprocessing. While the study acknowledges
that such implemented changes had to be proven they were beneficial in respective to their
pharmacological performance it comments that the control of constant glycoform during biologic
manufacturing is a considerable challenge due to variables introduced during the culturing and
the innate mechanics of glycosylation itself. (Schiestl et al. 2011) These are issues now being
circumvented by glycoengineering which is the controlled manipulation of a protein’s glycan
composition using in vitro and in vivo techniques.
Examples of glycongineering methods include modifying directly the amino acid content
of ta biologic such as introducing new N-glycosylation sites into its amino acid backbone. This
tactic is exemplified by Aranespap which is an EPO derivative Configured to contain 5 N-
glycosylation sites rather its wild type’s 3. It was shown that the addition of N-glycans in these
the new regions increased the half-life of the drug due to increased sialic acid conten(Zhong &
Wright 2013). As hinted at before altering culturing parameters can modify glycanprofiles and
one such glycoengineering strategy being used is the reduction the culturing temperatures to
yield homogenous glycoprofiles. The theory underpinning this culturing technique is that lower
temperatures promote cell survival and decrease glycosidases being emitted into culture from
cell apoptosis.(Hossler et al. 2009a).
A modern initiative to glycoengineering involves concentrating on the innate
glycosylation characteristics of the cell line it was generated from. Industrial cells lines display
unique glycosylation glycoprofiles as shown in Figure 3 (D.Ghaderi et al 2010,pg 149,fig 01)
because different cells lines do not use the same glycosylation pathway, contain the same
enzymes or harness the same monosaccharides. (Lowe & Marth 2003)For this reason there are a
spectrum of cells used in industry today ranging from mammalian to non-mammalian cells that
offer their own distinct advantages and disadvantages when producing recombinant
glycoproteins(Hossler et al. 2009a). Cell specific glycoengineering is transforming the
manufactory of these biologics because it regulates precisely the construction of glycoproteins.
The following section will examine mammalian, bacteria and plant cell lines and detail how
initiative glycoengineering techniques are revolutionising their use in biotechnology.
9
Figure 3 Glycoprofiles displayed in yeast, insect, animal and plants in comparison to Human
glycan structure.
Mammalian Cell Lines
Since the origin of animal derived recombinants up to 2011, 96 recombinant protein
therapeutics stemming from mammalian host cells have been approved by international drug
authorities and currently these cells generate 2 thirds of total biopharmaceutical revenues each
year (Lai et al. 2013). There are a variety of mammalian systems used in industry including
rodent cells lines Baby Hamster Kidney (BHK) cells and mouse myeloma (NS0) cells as well as
human cell lines such as Human Embryonic Kidney cells(HEK- 293)(Qiu et al. 2014; Hossler et
al. 2009a). For the purposes of this review hinase Hamster ovaries (CHO) cells will be the
mammalian culturing system of focus because they are most common cell host for commercial
bioprocessing. It is estimated that up to 70 % of current biologics are being produced using CHO
cells. These cells are useful for bioprocessing because of several reasons including low viral
transmission, tolerance to environmental factors (Temperature, pressure pH and oxygen) and
substantial yields of desired therapeutic proteins. (Butler & Spearman 2014; Durocher & Butler
2009; Lai et al. 2013) In addition CHO cells can adjust to growing in bioreactor suspension
cultures and in the presence of serum-free and chemically defined media to enhance
reproducibility between batches. From the perspective of this essay mammalian cell lines such as
CHO cells have the intrinsic ability to perform PTMs such as glycosylation in a manner which is
10
comparable to humans .However while the early events of glycosylation are conserved between
the two species evolutionary divergences have resulted immunogenic alpha-Gal and Neu5Gc
being added to the N-terminus during CHO glycosylation processes.
Alpha-Gal
The first dissimilarity between human and CHO glycosylation is that humans cannot cap
N-glycan structures with alpha-gal structures. Humans lost their ability to synthesise these motifs
structures 20 -30 million years ago and have developed antibody resistance during the same
period.(Xu et al. 2011) All humans have IgA, IgM, and IgG against alpha-Gal motifs and
collectively these antibodies account for 1% of all immunoglobulins in the bloodstream. It is still
unclear what exact levels of α-Gal is needed to stimulate anaphylaxis or immunogenic responses
in patients however the presence of high levels of anti-α-Gal antibodies suggests curtailing a-gal
exposure mitigates the risk of any potential reation (Bosques et al. 2010; Butler & Spearman
2014; Ghaderi et al. 2010).
It is well documented that the adverse effects associated with the anticancer drug Erbitux,
produced in myeloma cells, is attributed to the both the intravenous delivery method and the
presence of alpha Gal terminal moieties. Until recently it was believed that CHO cells lack the
machinery to synthesise such an immunogenic epitope and was a possible expression system
option to replace myeloma expression for Erbitux.(Ghaderi et al. 2010) However it has been
controversially reported that CHO cells contains the necessary N-acetyllactosaminide 3-α-
galactosyltransferase-1 which facilities the addition of a-gal to N-terminals of glycans(Bosques
et al. 2010). New Studies conducted on Abatacept produced in CHO cells now suggest low
occurrence of unwanted α-Gal epitopes in some of the glycoforms it generates.(Bosques et al.
2010).
Neu5Gc
Another difference between human and CHO cell glycosylation is that humans only
produce sialic acid N-acetylneuraminic acid (Neu5Ac ) and contrary to mammalian cell lines
including CHO cells human cannot synthesise N-acetylglycolneuraminic acid Neu5Gc .Recent
studies have shown that non-human Neu5Gc sialic acid is evident in various FDA approved
glycoprotein drugs(Ghaderi et al. 2010).Work by Ghaderi et al established that humans contain
11
variable levels anti-Neu5Gc antibodies and in some cases patients have shown to demonstrate
elevated levels of this immunglobulin in their blood serum which accounted for 0.1–0.2% of
circulating IgG. It is now suggested that injectable glycoproteins contaminated with Neu5Gc can
elicit the production of undesirable immune complexes that can trigger the complement system
and heighten the risk cancer and cardiovascular disease in patients(Ghaderi et al. 2012; van
Beers & Bardor 2012). To eradicate these undesirable immunogenic reactions several in vivo and
in vitro glycoengineering approaches have been employed including manipulation cell cultures
and anti-sense RNA strategies.
When CHO cells are grown in suspension medium they inherit extracellular Neu5G from
animal derived materials and metabolically incorporate them into their own glycan profile. By
growing CHO cells in medium that doesn’t contain Neu5G or supplementing human Neu5Ac in
order to compete with endogenous Neu5G the generation of glycoform containing Neu5Gc
residues can be eradicated (Ghaderi et al. 2012) .A more invasive in vivo approach was
employed by Stephane Chenu et al who used antisense RNA fragments designed from
homologous hamster and mice nucleotide sequences to inhibit the CMP-Neu5Ac hydroxylase.
(Chenu et al. 2003). Blocking of CMP-Neu5Ac hydroxylase translation and subsequent transfer
was achieved s by two mechanisms 1) steric hindrance of the ribosome binding and 2) removal
of antisense RNA-mRNA duplexes by Rnases. Overall this method achieved an 80% reduction
in the levels of Neu5Gc in the CHO-AsUH2 cell relative to the untreated parental cell. This
method produced a stable cell line that could passaged up to 30 times displaying low levels of
Neu5Gc content (Chenu et al. 2003).
Precision Genome Editing Strategies in CHO cells The arrival of new accurate gene manipulation technologies holds much promise in
yielding homogenous glycoforms that are produced via genetically tailored glycosylation
pathways in CHO cells. Techniques such as Zinc Finger Nucleases (ZFN), transcription
activator-like effector endonucleases and RNA-guided clustered regularly interspaced short
palindromic nuclease systems have already revolutionised a number of fields in biology and an
exemplary example of ZFN was used improve antibody-dependent cellular cytotoxicity in Cho
cell derived IgG. (Urnov et al. 2010; Steentoft et al. 2014; Durocher & Butler 2009).
12
Previously studies conducted by Clynes et al examined the effects of a range of
recombinant antibodies, including anti-cancer drugs trastuzumab and rituximab, in relation to
their modulation of immune effector cells(Shields et al. 2002).It was found that the Fc regions of
these biomolecules as shown in Figure 05 (Yamane-Ohnuki 2014,pg 232,fig 01) stimulated
enhanced ADCC activity if they interacted with Fcγ activation receptors on neutral killer cells.
While some Fc regions of other antibodies acted on inhibitory Fcγ receptors which exhibited
reduced ADCC action. (Shields et al. 2002)Follow up studies by Shields et al discovered the
absence of fucose residues attached at as297 in trastzumab dicated this reaction and facilitated a
43% increase of ADCC potency against breast cancer comprised cells in vitro. Similar
experiments using non fucosylated antibodies also demonstrated a high degree of potency
because of ADCC against viral diseases such as and including Ebola and respiratory syncytial
viruses which will discussed in detail later(Hiatt et al. 2014).
IgG is glycosylated at Asn297 of the heavy chain of the molecule is glycosylated tri-
mannosyl core structure,terminal galactose (Gal) ,bisect N-acetylglucosamine (GlcNAc) and a
fucose residue.. X. (Yamane-Ohnuki & Satoh 2014).Electron microscope examination of the
crystalized structure of non –fucoylated IgG revealed that increased binding and activation of
ADCC was attributed slight configuration changes in a small region of the IgG-Fc. It was
Figure 4 Deferential ADCC response displayed by Non fucosylated and fucosylated
anobodies.Non-fucosylated antibodies demonstrate an increased binding affinity for
FcγRIIIa compared to fucosylated IgGs. This enhanced binding in turn activates natural
killers cells and a heightened ADCC response.
13
revealed that high affinity of of non-fucosylated antibodies for FcγRIII is facilitated by
interactions between Asn-162 which is only exposed without fucose residues impeding it.
Ultimately the advantage of non-fucoyslated antibodies is that a therapeutic efficiency can
achieved at a lower dosage while maintaining cellular cytotoxicity against target cells.(Yamane-
Ohnuki & Satoh 2014) .FUT8 is a gene found CHO cells that is responsible for encoding α1,6-
fucosyltransferase which mediates fucose transfer to IgG molecule. Recently Malphettes, L. et al
used zinc finger nucleases to generate FUT8 deficient CHO cell lines and optimal non-
fucosylated antibodies.(Steentoft et al. 2014)
Figure 5 Zinc Finger nuclease editing of FUT8 exon (A) Molecular structure of Fut8
protein with highlighted cleavage motif to be target by ZFN treatment.(B)Nucleotide and
amino sequence to be targetdby ZFN.(C)Results of Surveyor nuclease activity shown
amplification of cleaved FUT8 locus.
Zinc finger nucleases are artificial synthetic endonucleases which permit efficient
genomic editing of DNA by introducing double strand breaks at specific sites.(Urnov et al.
2010). The knockout system used by Malphettes, L. et al entailed of 12 zinc finger proteins
adhering to the supercoiled state of DNA on both the template and non-template coding strands
of FUT8 as illustrated in figure 06 (Laetitia Malphettes et al 2010,pg 776 ,fig 01) .The Fokl
subunits as shown dimerze with each other to form a functional endonuclease and introduce
14
defined a double stranded break into the DNA sequence(Malphettes et al. 2010). PCR
amplification of the FUT8 in ZFN modified CHO compared to CHO showed that FUT8 had
been cleaved in 2.This indicates that a bialleic gene deletion of FUC8 event ensued because of
ambiguous non-homologous end joining repair. This gene removal specifically targeted the
removal 2 lysine amino acids that were deemed to be fundamental in the proper function of the
active site of fucosyltransferase (Malphettes et al. 2010).
Bacteria Cell Lines The capacity to carry out post-translational modifications is a defining characteristic that
differentiates eukaryotic and prokaryotic expression platforms in the biopharma industry.(Dell et
al. 2010; Jenkins et al. 2008) Until recently it was widely accepted that bacterial expression
systems were not capable of synthesising glycoproteins because they lacked the machinery to
carry out such a post translational modifcaton. However the substantial yields generated, low
running costs and simplicity of growing bacteria offers supreme benefits over any other existing
expression used in biopharming.(Berlec & Strukelj 2013; Chen 2012; Kamionka 2011) Recent
promising advances in glycoengineering have allowed certain strains of E.coli to be genetically
manipulated in a manner that facilities production of glycoproteins. (Ihssen et al. 2010; Garcia-
Quintanilla et al. 2014)
Glycoengineering E.coli
E.coli is perhaps the most investigated and thoroughly characterised bacterial
organism on this planet. Science’s detailed understanding of its physiology and protein
production makes it an ideal candidate to be exploited for expression of recombinant drugs. It is
simplest and cheapest expression system used in biopharming today and is regularly used for the
production of non-glycosylated proteins such as lispro produced by Eli Lilly(Wildt & Gerngross
2005; Chen 2012). While E.coli expression is inexpensive, well characterised and high yielding
there are number disadvantages to using such a system including deficient post-translational
modification capabilities such as glycosylation and limited capacity to perform adequate protein
folding. However in 2002 Wacker et al published a landmark paper that noted that N-linked
glycosylation present gam negative bacterium Campylobacter jejuni could be transferred to
E.coli.(Wacker et al. 2002)C. jejuni was the first bacterium to exhibit a N-glycosylation pathway
15
to be discovered in prokaryotes and bioinformatics has revealed that genes required for N-
glycosylation were existent among all C.jeuni species.(Tytgat & Lebeer 2014)
Figure 6 (A) 17 KB Gene Cluster composing of 13 genes required Pgl N-glycosylation (B)
Transformation of gene cluster encoding N-glycosylation into plasmid. (C) N-glycans
displayed on E.coli following N-glycosylation.
It has been shown that this system can modify more than 65 C.jejuni proteins. As shown
in figure 6 (Baker et al 2013,pg 314 Fig1) The system itself is a primate form N-glycosylation
and begins with a lipid linked heptasaccharide being assembled in the cytoplasm. GlaNac is
attached to phospholipid ,undeca prenyl phosphate (Und-P) using a oligotransferase protein
called WecA. This lipid-linked oligosaccharide lipoglycan is translocated to periplasm via a ATP
depedent flippase enzyme PgIK. Once situated in the periplasm PgIb ,aoligosaccharytransferase,
recognises the LLO and adds it to target protein Acra at consensus sequence asparagine
consensus Asp/Glu-X1 -Asn-X2 -Ser/Thr. (X1 and X2 signify any amino acid except
Proline)(Pandhal et al. 2012)
In 2002 Wacker et al successfully introduced this N-glycosylation system into by E.coli
by as depicted in figure 07 the ligating a17-kb pgl gene cluster containing all the necessary
glycosylation proteins needed into a pACYC plasmid and transforming the construct into the
target bacterium. Remarkably expression of the pathway decorated of simple N-glycans on lipid
16
bilayer of the bacterium(Baker et al. 2013). Since this accomplishment the system has been
utilised for production of recombinant vaccines.
E.coli Vaccine Production Conjugate vaccines consist of bacteria endotoxins chemically adhered to carrier proteins
and have been highly effective in eradicating viral infections such as Haemophilus influenza.
(Ihssen et al. 2010; Baker et al. 2013)The standard method for congregate vaccine manufactory
firstly involves cultivating large quantities of pathogenic bacteria producing O-antigens and
separately growing carrier proteins using another recombinant system as shown in Figure 07
(Ihssen et al 2010,pg 2 Fig 01),Subsequent purification of the lipopolysaccharide and carrier
proteins respectively is often difficult and significant losses of the therapeutic product occurs.In
addition due to the chemically imprecise nature of combining of lipopolysaccharide and carrier
often leads to unfavourable large heterogeneous congregates which exhibit decreased protection
against a given pathogen(Ihssen et al. 2010). This process is time consuming, and costly which
are the reasons why in vivo synthesis using E.coli harnessing glycosylation are being explored as
an alternate approach to produce congregate vaccines. The relaxed substrate specificity of PgIb
not only allows substrates found in Campylobacter jeunui to be added to carrier protein AcrA but
endotoxins found in pathogenic Gram-negative bacteria(Feldman et al. 2005).
In 2010 Julian Ihssen et al designed vaccine glycogregates for Shigellosis, which is a
disease that kills up to 1 million people annually, using a reproducible large scale fed batch
system and in vivo E.coli N-glycosylation(Ihssen et al. 2010). Shigellosisis is attributed to 4 key
species of Shigella , S. dysenteriae, S. flexneri, S. boydii and S. sonnei, however this approach
produced congregate vaccines against specifically against S. dysenteriae because it demonstrates
a higher mortality rate than the other species. It was identified that rfp and rfb gene clusters
produce glycosyltransferases and polymerases needed for the production of undecaprenyl-
pyrophosphate-linked Shigella O1 polysaccharides and these were expressed on a pGVXN64
plasmid(Ihssen et al. 2010). Subsequent rounds of transfection using the pGVXN64 plasmid
along with plasmids harnessing PgI modification yield novel vacglycoproteins. Notable features
of the work include the use of alternate immunogenic carrier of P. aeruginosa exotoxoid A (EPA)
when expressed in the periplasm of the E.coli. Furthermore (Ihssen et al. 2010)
17
Fatima Garcia-Quintanilla el al employed the same in vivo synthesis technique of
congregate vaccine against Burkholderia pseudomallei, a Gram-negative saprophyte which is
responsible for melioidosi and considered a potential class B bioterrorism weapon if aerosolized.
It was stablished that two distinct O-polysaccharides governed the virulence of B. pseudomallei
and as depicted 15 gene cluster required for the biosynthesis of B. pseudomalle OPS II was
inserted into an E.coli harnessing N-glycosylation via plasmid transformation. (Garcia-
Quintanilla et al. 2014) One notable improvement employed by Fatima Garcia-Quintanilla was
the use of E.coli Waal- and WecA- mutant strain because it was hypnotised that these genes
reduce efficiency of protein glycosylation of OPS II. WecA adds on unwanted GlcNAc residues
not found in the case of OPS II while Waal ligase can disrupt OPS polysaccharide synthesis.
(Garcia-Quintanilla et al. 2014) Preliminary tests using mice test models injected with this novel
vaccine glycoprotein developed a long lasting IgG adaptive immune response when
compromised with B. pseudomallei when compared to controls.(Garcia-Quintanilla et al. 2014)
Figure 7 Comparison between in vitro method and in vivo biosynthesis of congregate
vaccines.
Optimisation of E.coli N-glycosylation
Most notably from a biopharmaceutical perspective N-glycans produced from bacteria
are differ in composition to any other eukaryotic glycan. This variance is attributed to a several
18
factors including the location assembly glycosylation pathway in the periplasm , the restricted
repertoire of glycosylation enzymes in the cytoplasm and the limited availability of
oligosaccharide residues contained in the bacterium (Baker et al. 2013). An additional important
to highlight note is timing of the PTM whereby E.coli glycosylates a given protein post
transitionally in its folded form which in turn reduces the addition of glycans to asn sites. Other
evident differences include an extended asn consensus sequence for n-glycosylation and absence
of a golgi apparatus in E.coli does not the replicate the extensive glycan remodeling
demonstrated in Eurkaryotic cells. The (Dell et al. 2010). While much progress has been
generating glycans in E.coli tthe sialylated terminal structures common to all human
glycanprofiles is ultimately the end goal(Baker et al. 2013). Strategies being currently examined
to enhance E.coli N-glycosylation include the use different E.coli operons to increase glycan
homogeneity and upregulatimg the expression some of the E.coli’s own e innate enzyme to
produce higher yields of glycosylated proteins.(Srichaisupakit et al. 2014; Pandhal et al. 2012)
However a more direct method being explored is the direct introduction of eukaryotic
glycosylation pathways into E.coli in an attempt to efficiently mimic complex extended human
glycan profiles. Valderrama-Rincon et al N-a successfully a engineered saccharomyces
cerevisiae gene cluster coding glycosylation proteinsALG13, ALG14, ALG1 and ALG2 into
E.coli strain. This was promising step for N-glycosylation because this gene cluster codes for a
range provided a platform for the first time precision directed synthesis of complex N-glycan
structures.(Dell et al. 2010; Valderrama-Rincon et al. 2012)
Plant Cell Lines
In recent times plant expression systems have become increasingly viable option to
synthesize recombinant antibodies because of their scalability, low-cost, high yields , lack of
human pathogen transmission and a capacity to produce complex N-glycans. While controlled
plant glycosylation is still its infancy because of issues relating protein heterogeneity, non –
human glycan epitopes and a lack of diverse glycofroms, breakthroughs in the last 10 years and
lately plant derived Ebola vaccines has propelled in planta glycoengineering to the forefront of
large molecule therapeutics(Strasser et al. 2014; Saint-Jore-Dupas et al. 2007).
Antibodies synthesised in plants display both exhibit high mannose and biantennary
complex type N-glycan structures as shown in Figure 08 (Veronique Gomord 2005,pg 560,fig
19
01). While the core precursor Man3GlcNAc2 is conserved between human and plants there are
extensive differences due to remodelling in the Golgi apparatus. (Saint-Jore-Dupas et al. 2007;
Baker et al. 2013)Typically mammalian systems modify core Man3GlcNAc2 with galactose and
terminal sialic acid residues while plants produce N-glycans with without b1,2-xylose and a1,3-
fucose residues . These structural differences between plants and animals form the basis of why
plant N-linked glycans are immunogenic to a range of lab mammals and elicit defined IgE
responses in humans when administered parentally (Giritch et al. 2006; Baker et al.
2013).Despite these pitfall humans are continuously exposed to plant glycoproteins in their diet
and oral administration poses perhaps an acceptable route for plant-made pharmaceuticals in the
future. (Gomord et al. 2005)To harness the full therapeutic potential of glycoproteins produced
from plants several different gene knock in and knock out avenues have been explored in order
to ultimately attain ‘humanized’ non-immunogenic N-glycan therapeutics.
Figure 8 Comparison between mammalian and plant N-glycan structures. Notably N-glycan
structures of mammals are capped with NeuAc and while plants exhibit B 1,3 Gal capping.In
addition plants contain B 1 2 Xyl residues which are absence from mammals.
Knock out Strategies
The most fast and flexible methods of in planta glycoengineering is the use of multiple
gene vectors to integrate cDNA into a given plant’s genome. This transfection process uses
recombinant plasmids carrying tailored genes that are injected into plants leaves and
incorporated into a plant’s genome via horizontal gene transfer instigated by typically
agrobacterium (Gleba et al. 2014). Normally the plant expression system used for such a
20
transfection process is Nicotiana benthamiana because of two reasons; (1) It is susceptible to a
wide variety of plant-pathogenic bacteria and viruses that can infiltrate its genome. (2) It displays
high regeneration efficiency and growth in greenhouses. (Strasser et al. 2008)
The use of a customised plasmid cDNA in conjunction with Nicotiana benthamiana is
best exemplified by one of the first in planta knock out strategies that pursued the removal
xylosyltransferases and core a1,3-fucosyltransferase from a given N-glycan. RNAi genes that
downregulated the expression of FucT and XylT were incorporated into pGA643 and
agrofiltrated into Nicotiana benthamiana. (Strasser et al. 2014) After a series of rounds selection
plants complex N-glycans made up of the GnGn oligosaccharide without the presence of
unwanted immunogenic N-glycan residues resulted. This success was a defining moment for
glycoengineering in plants for several reasons: (1) It was established that plants are able endure
extensive manipulation of their N-glycosylation pathway without disturbing adversely their
phenotype. (2) The efficient production of precursor GnGN oliggoshaccaride enabled further
glycan addition. (3) It permitted increased glycan homogeneity(Castilho et al. 2010). A subtle
variant of the above method is the use of viral vectors to insert glycan genes into the genome.
The advantages of such expression include the hijacking of innate host cell RNA mechanisms to
predominately amplify viral RNA over existing innate cell mRNA in order to generate high
qualities of recombinant protein in the process. As one writes this review the above viral
expression in conjunction with tobacco plants is being trailed for the production an Ebola
biologic known as Zmapp.
Glycoengineering Ebola
Ebola is ralovirus which poses serious detrimental health risk to humans and is
characterised by nose bleeding, nausea and vomiting. In the spring of 2014, a new strain ebola
emerged in the West Africa which has been reported to have claimed 7,000 people according the
World Health Organisation(Murin et al. 2014; WHO 2014). Currently there are several Ebola
drug products being assessed as possible treatment options including vaccines, small molecule
inhibitors, and siRNA-based drugs however studies have shown the passive injection of
antibodies due their long treatment offer the best cure for Ebola (Qiu et al. 2014).
21
Recently rodent models treated with 3 antibodies exhibited synergy between the
molecules and resulted in enhanced protection against Ebola. The key constituents of the most
effective antibody cocktails were isolated including MB-003 which is made up 3 antibodies to
form a novel composite antibody known as Zmapp. Interesting from the perspective of this essay
Gene Garrard Olinger explored if tobacco plants could be a cost saving, rapid and high yield
platform to manufacture MB-003.(Murin et al. 2014) The approach Gene el al utilised was a
transient viral expression system whereby two noncompeting vobacco mosaic virus and potato
viruses were systematically delivered into mature tobacco plants by Agrobacterium infiltration.
The use of two viruses was to ensure the heterooligomeric antibody structure of MB-003 was
efficiently expressed as previous work showed viral vectors containing both the large and small
chains of an antobody in the one plamid diminishes replication performance. The design of this
viral vector used a RNA interference system (RNAi) to down regulate α1,3 fucosyltransferase
and β1,2 xylosyltransferase(Olinger et al. 2012).
Interestingly when the therapeutic efficiency of plant derived MB-003 was compared to
its CHO produced counterpart, the plant derivative exhibited a greater potency because of
increased ADCC. This heightened level of ADCC activity was attributed to production non-
fucosylated plant antibodies and their increased affinity for neutral killer cell receptor
activation.(Olinger et al. 2012) However the most advantageous and important aspect of MB-003
is not directly the production of non-fucosylated antibodies but the efficiency it achieved this
task. While as previously discussed, glycoengineered knock out CHO cells could theoretically
generate non fucosylated antibodies these approaches thus far have only generated small yields
desired recombinant proteins(Yamane-Ohnuki & Satoh 2014). In contrast tobacco plant derived
cell antibodies exhibits elevated homogeneity within its produced glycoprofile and high yields at
the same time. Thus this expression reduces downstream processes, speeds up the production and
lowers the cost of the potential Zmapp drug. These are beneficial attributes given the speed in
which Ebola is aggressing in west Africa and the financial state of third world countries(Quick
2003)
Knock In Strategies
The first success to humanize plant glycosylation by introducing mammalian
glycosyltransferases was reported by Palacpac et al who produced b1,4-galactosylated glycans
22
in tobacco plants. This success only paved future to augment a plant’s repertoire of mammalian
enzymes further and allowed N-glycosyation siaylation to be performed.(Saint-Jore-Dupas et al.
2007) Sialylation was particularly arduous to glycoengineer into plants because of the absence
of several key requirements including : (1) An inability to biosynthesise sialic acid Neu5Ac (2)
No transmembrane receptor to import sialic acid into the Golgi apparatus (3) The absence of
sialictransferase to add a sialic acid to a protein. Thus the lack of prerequisites for siaylation
obligated the incorporation of 6 genes in a multigene vector to facilitate transfer of a mammalian
glycosylation pathway. When the experiment was analysed sialylation was reported in the
subsequent generated IgG glycoproteins(Castilho et al. 2010). Remarkably increased sialylation
of IgGs has is favourable for the production of potent autoimmune autoimmune drugs.Ultimately
the success of glycoengineering sialylation and galactosylases into plants has allowed the
production EPO in Nicotiana benthamiana.
Glycoengineering The First Plant FDA Approved Biologic A unique glycoprotein approach being incorporated into the production plant
pharmaceuticals is the use of C-terminal KDEL or HDEL retention s proteins signals in the
lumen of the ER to yield high non immunogenic mannose glycoproteins(Gomord et al. 2005). A
prime example of this method is the first FDA and EU approved plant biodrug Taliglucerase alfa
, which is a recombinant glucocerebrosidase used to treat Gaucher’s disease.(Shaaltiel et al.
2007) The role glucocerebrosidase is to catalyse the hydrolysis of glucosylceramide however an
deficiency of the enzyme leads to the build-up of the glycolipid and unwanted accumulation
foam cells. This collection of gaucher cells can cause anemia, bone irregularities and
cardiovascular problems however Taliglucerase alfa glucocerebrosidase can be used an enzyme
replacement therapy to eradicate such issues.
Recombinant glucocerebrosidase is made up of 497 amino acids and exhibits 5 N-glycosylation
sites that must be occupied with high Nmannose structures to promote maximum pharmaco
effects via activation macrophage internalization. Prior to Taliglucerase alfa approval in 2012
CHO cell derived recombinant glucocerebrosidase such as imiglucerase and velaglucerase were
used as Gaucher’s disease treatments. The manufactory of these CHO cell and human cell
derived glucocerebrosidase were costly and laborious as in vitro glycoengineering techniques
were required to deglycosylate sialic and galactose residues to expose preferable mannose
23
residues.(Zimran et al. 2014; Saint-Jore-Dupas et al. 2007) In contrast to carrot derived
glucocerebrosidase yielded high mannose n-glycans because HDE Lgene sequences were
incorporated into viral vectors and expressed signal motifs in the c-terminus of the
protein(Tekoah et al. 2013). This c terminal motif retards the transit of the glycoprotein through
the ER because it attaches to a HDEL receptor of retrograde vesicles. Notably in study
evaluating the glycoform profiles of Taliglucerase alfa, imiglucerase and velaglucerase, it was
shown by mass spectrometry that Taliglucerase alfa produced a 100% homogeneous glycan
profile of high mannose sugars and the other tested biologics demonstrated variable glycan
profiles a such as Velaglucerase alfa which showed that 50% of its produced glycoproteins were
inadequate as high mannose glycoproteins. (Zimran et al. 2014)
Future Perspectives While the review describes some of the seminal highlights achieved thus far for
glycobiology and recombinant therapeutics, many challenges still remain to be negotiated to
usher in a new era of optimised glycoprotein biologics The most formidable obstacle perhaps is
deciphering non-template driven glycan synthesis and enhancing complimentary in vitro
purification techniques(Walsh 2010; E.Taylor 2003). With the arrival of bioinformatics in the
last 20 years filling the information gap between glycan synthesis and gene expression has
become much more attainable. Inroads have already been made in cracking such a biological
enigma and recently statistical computer algorithms have been used to show what sites of
glycoproteins are favourable for glycosylation. In addition novel microarray technologies that
analyse the transcription levels of glycosidase and glycotransferases will also provide additional
information regarding glycan expression and regulation patterns. (Ohtsubo & Marth 2006)
Although the glycoengineering techniques discussed above increase the expression of
homogenous glycoproteins, the rate in which this is achieved is still relatively low. Therefore
glycoengineering will never total subside the need of downstream processing totally .Thus
advancing glycoproteins characterising technologies such mass spectrometry and enrichment
strategies such lectin affinity chromatography will only compliment glycoengineered cell
lines(Kaji et al. 2006).
24
Conclusion The advent of novel biologics coupled with the rapid expansion of the biopharmaceutical
industry marks a new era in modern medicine.(Press 2011) As shown therapeutic functionality of
recombinant therapeutics are dictated by PTMs such as glycosylation which decorates biologics
with a spectrum of heterogeneous N- and O-linked glycans as a result of the synchronized
activity displayed by 250 enzymes during the ER-Golgi pathway. In this light the regulation of
glycosylation is now essential in biopharmaceutical manufacturing and glycoengineering
industrial cell lines is quickly becoming widely used to produce recombinant pharmaceuticals
with optimised efficient and safe glycoprofiles.(Hossler et al. 2009) In conclusion controlled
glycosylation patterns within industrial expression systems and the subsequent attainment of an
optimal therapeutic glycoprotein’s sweet spot is the desired goal for any glycosylated
therapeutic. By utilizing some the approaches described above and answering some the questions
that lie ahead the generation of “Simply Better Glycoproteins” will save millions of lives in the
future(Lepenies & Seeberger 2014).
References
Baker, J.L., Çelik, E. & DeLisa, M.P., 2013. Expanding the glycoengineering toolbox:
the rise of bacterial N-linked protein glycosylation. Trends in biotechnology, 31(5),
pp.313–23.
Van Beers, M.M.C. & Bardor, M., 2012. Minimizing immunogenicity of
biopharmaceuticals by controlling critical quality attributes of proteins.
Biotechnology journal, 7(12), pp.1473–84.
Berlec, A. & Strukelj, B., 2013. Current state and recent advances in biopharmaceutical
production in Escherichia coli, yeasts and mammalian cells. Journal of industrial
microbiology & biotechnology, 40(3-4), pp.257–74.
Bosques, C.J. et al., 2010. Chinese hamster ovary cells can produce galactose-[alpha]-
1,3-galactose antigens on proteins. Nat Biotech, 28(11), pp.1153–1156.
Butler, M. & Spearman, M., 2014. The choice of mammalian cell host and possibilities
for glycosylation engineering. Current opinion in biotechnology, 30C, pp.107–112.
25
Castilho, A. et al., 2010. In planta protein sialylation through overexpression of the
respective mammalian pathway. The Journal of biological chemistry, 285(21),
pp.15923–30.
Chen, R., 2012. Bacterial expression systems for recombinant protein production: E. coli
and beyond. Biotechnology advances, 30(5), pp.1102–7.
Chenu, S. et al., 2003. Reduction of CMP-N-acetylneuraminic acid hydroxylase activity
in engineered Chinese hamster ovary cells using an antisense-RNA strategy.
Biochimica et Biophysica Acta (BBA) - General Subjects, 1622(2), pp.133–144.
Costa, A.R. et al., 2014. Glycosylation: impact, control and improvement during
therapeutic protein production. Critical reviews in biotechnology, 34(4), pp.281–99.
Declerck, P.J., 2012. Biologicals and biosimilars: a review of the science and its
implications. Generics and Biosimilars Initiative Journal, 1(1), pp.13–16.
Dell, A. et al., 2010. Similarities and differences in the glycosylation mechanisms in
prokaryotes and eukaryotes. International journal of microbiology, 2010, p.148178.
Durocher, Y. & Butler, M., 2009. Expression systems for therapeutic glycoprotein
production. Current opinion in biotechnology, 20(6), pp.700–7.
E.Taylor, M., 2003. Introduction to Glycobiolgy 2nd Edtion., Oxford University Press.
Feldman, M.F. et al., 2005. Engineering N-linked protein glycosylation with diverse O
antigen lipopolysaccharide structures in Escherichia coli. , 19.
Freeze, H.H. et al., 2014. Solving glycosylation disorders: fundamental approaches reveal
complicated pathways. American journal of human genetics, 94(2), pp.161–75.
Garcia-Quintanilla, F. et al., 2014. Production of a recombinant vaccine candidate against
Burkholderia pseudomallei exploiting the bacterial N-glycosylation machinery.
Frontiers in microbiology, 5(July), p.381.
Ghaderi, D. et al., 2010. Implications of the presence of N-glycolylneuraminic acid in
recombinant therapeutic glycoproteins. Nature biotechnology, 28(8), pp.863–7.
26
Ghaderi, D. et al., 2012. Production platforms for biotherapeutic glycoproteins.
Occurrence, impact, and challenges of non-human sialylation. Biotechnology and
Genetic Engineering Reviews, 28(1), pp.147–176.
Giritch, A. et al., 2006. Rapid high-yield expression of full-size IgG antibodies in plants
coinfected with noncompeting viral vectors. Proceedings of the National Academy of
Sciences of the United States of America, 103(40), pp.14701–6.
Gleba, Y.Y., Tusé, D. & Giritch, A., 2014. Plant Viral Vectors for Delivery by
Agrobacterium. , (August 2013), pp.155–192.
Gloster, T.M., 2014. Advances in understanding glycosyltransferases from a structural
perspective. Current opinion in structural biology, 28C, pp.131–141.
Golledge, J. et al., 2007. Bone marrow-derived cells and arterial disease. Journal of
vascular surgery, 46(3), pp.590–600.
Gomord, V. et al., 2005. Biopharmaceutical production in plants: problems, solutions and
opportunities. Trends in biotechnology, 23(11), pp.559–65.
Griebenow, K. & Sola, R.J., 2010. Glycosylation of Therapeutic Proteins An Effective
Strategy to Optimize Efficacy. , 24(1), pp.9–21.
Hiatt, A. et al., 2014. Glycan variants of a respiratory syncytial virus antibody with
enhanced effector function and in vivo efficacy. Proceedings of the National
Academy of Sciences of the United States of America, 111(16), pp.5992–7.
Hossler, P., Khattak, S.F. & Li, Z.J., 2009a. Optimal and consistent protein glycosylation
in mammalian cell culture. Glycobiology, 19(9), pp.936–49.
Hossler, P., Khattak, S.F. & Li, Z.J., 2009b. Optimal and consistent protein glycosylation
in mammalian cell culture. Glycobiology, 19(9), pp.936–49.
Ihssen, J. et al., 2010. Production of glycoprotein vaccines in Escherichia coli. Microbial
cell factories, 9, p.61
Jefferis, R., 2009. Glycosylation as a strategy to improve antibody-based therapeutics.
Nature reviews. Drug discovery, 8(3), pp.226–34.
27
Jenkins, N., Murphy, L. & Tyther, R., 2008. Post-translational modifications of
recombinant proteins: significance for biopharmaceuticals. Molecular biotechnology,
39(2), pp.113–8.
Kaji, H. et al., 2006. Mass spectrometric identification of N-linked glycopeptides using
lectin-mediated affinity capture and glycosylation site-specific stable isotope
tagging. Nature protocols, 1(6), pp.3019–27.
Kamionka, M., 2011. Engineering of Therapeutic Proteins Production in Escherichia coli.
Current Pharmaceutical Biotechnology, 12(2), pp.268–274.
Lai, T., Yang, Y. & Ng, S.K., 2013. Advances in Mammalian cell line development
technologies for recombinant protein production. Pharmaceuticals (Basel,
Switzerland), 6(5), pp.579–603.
Lepenies, B. & Seeberger, P.H., 2014. Simply better glycoproteins. Nat Biotech, 32(5),
pp.443–445. Available at: http://dx.doi.org/10.1038/nbt.2893.
Lowe, J.B. & Marth, J.D., 2003. A genetic approach to Mammalian glycan function.
Annual review of biochemistry, 72(1), pp.643–91.
Malphettes, L. et al., 2010. Highly efficient deletion of FUT8 in CHO cell lines using
zinc-finger nucleases yields cells that produce completely nonfucosylated antibodies.
Biotechnology and bioengineering, 106(5), pp.774–83.
Marth, J.D. & Grewal, P.K., 2008. Mammalian glycosylation in immunity. Nature
reviews. Immunology, 8(11), pp.874–87.
Moremen, K.W., Tiemeyer, M. & Nairn, A. V, 2012. Vertebrate protein glycosylation:
diversity, synthesis and function. Nature reviews. Molecular cell biology, 13(7),
pp.448–62.
Murin, C.D. et al., 2014. Structures of protective antibodies reveal sites of vulnerability
on Ebola virus. Proceedings of the National Academy of Sciences of the United
States of America.
Ohtsubo, K. & Marth, J.D., 2006. Glycosylation in cellular mechanisms of health and
disease. Cell, 126(5), pp.855–67.
28
Olinger, G.G. et al., 2012. Delayed treatment of Ebola virus infection with plant-derived
monoclonal antibodies provides protection in rhesus macaques. Proceedings of the
National Academy of Sciences of the United States of America, 109(44), pp.18030–5.
Pandhal, J. et al., 2012. Systematic metabolic engineering for improvement of
glycosylation efficiency in Escherichia coli. Biochemical and biophysical research
communications, 419(3), pp.472–6.
Paulson, J.C., Blixt, O. & Collins, B.E., 2006. Sweet spots in functional glycomics.
Nature chemical biology, 2(5), pp.238–48.
Qiu, X. et al., 2014. Reversion of advanced Ebola virus disease in nonhuman primates
with ZMapp. Nature, 514(7520), pp.47–53.
Quick, J.D., 2003. Ensuring access to essential medicines in the developing countries: A
framework for action[ast]. Clin Pharmacol Ther, 73(4), pp.279–283. Available at:
http://dx.doi.org/10.1016/S0009-9236(03)00002-X.
Russell, D., Oldham, N.J. & Davis, B.G., 2009. Site-selective chemical protein
glycosylation protects from autolysis and proteolytic degradation. Carbohydrate
research, 344(12), pp.1508–14.
Saint-Jore-Dupas, C., Faye, L. & Gomord, V., 2007. From planta to pharma with
glycosylation in the toolbox. Trends in biotechnology, 25(7), pp.317–23.
Schiestl, M. et al., 2011. Acceptable changes in quality attributes of glycosylated
biopharmaceuticals. Nat Biotech, 29(4), pp.310–312.
Shaaltiel, Y. et al., 2007. Production of glucocerebrosidase with terminal mannose
glycans for enzyme replacement therapy of Gaucher’s disease using a plant cell
system. Plant biotechnology journal, 5(5), pp.579–90.
Shields, R.L. et al., 2002. Lack of fucose on human IgG1 N-linked oligosaccharide
improves binding to human Fcgamma RIII and antibody-dependent cellular toxicity.
The Journal of biological chemistry, 277(30), pp.26733–40.
Spiro, R.G., 2002. Protein glycosylation: nature, distribution, enzymatic formation, and
disease implications of glycopeptide bonds. Glycobiology, 12(4), p.43R–56R.
29
Srichaisupakit, A., Ohashi, T. & Fujiyama, K., 2014. Identification of a protein
glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous
expression in Escherichia coli. Journal of bioscience and bioengineering, 118(3),
pp.256–62.
Steentoft, C. et al., 2014. Precision genome editing: a small revolution for glycobiology.
Glycobiology, 24(8), pp.663–80.
Strasser, R. et al., 2008. Generation of glyco-engineered Nicotiana benthamiana for the
production of monoclonal antibodies with a homogeneous human-like N-glycan
structure. Plant biotechnology journal, 6(4), pp.392–402.
Strasser, R., Altmann, F. & Steinkellner, H., 2014. Controlled glycosylation of plant-
produced recombinant proteins. Current opinion in biotechnology, 30C, pp.95–100.
Tekoah, Y. et al., 2013. Glycosylation and functionality of recombinant β-
glucocerebrosidase from various production systems. Bioscience reports, 33(5).
Tytgat, H.L.P. & Lebeer, S., 2014. The sweet tooth of bacteria: common themes in
bacterial glycoconjugates. Microbiology and molecular biology reviews : MMBR,
78(3), pp.372–417.
Uçaktürk, E., 2012. Analysis of glycoforms on the glycosylation site and the glycans in
monoclonal antibody biopharmaceuticals. Journal of separation science, 35(3),
pp.341–50.
Urnov, F.D. et al., 2010. Genome editing with engineered zinc finger nucleases. Nature
reviews. Genetics, 11(9), pp.636–46.
Valderrama-Rincon, J.D. et al., 2012. An engineered eukaryotic protein glycosylation
pathway in Escherichia coli. Nat Chem Biol, 8(5), pp.434–436. Available at:
http://dx.doi.org/10.1038/nchembio.921.
Wacker, M. et al., 2002. N-linked glycosylation in Campylobacter jejuni and its
functional transfer into E. coli. Science (New York, N.Y.), 298(5599), pp.1790–3.
Walsh, G., 2009. Post-Translational Modifications in the Context of Therapeutic
Proteins : An Introductory Overview,
30
Walsh, G., 2010. Post-translational modifications of protein biopharmaceuticals. Drug
discovery today, 15(17-18), pp.773–80.
Walsh, G. & Jefferis, R., 2006. Post-translational modifications in the context of
therapeutic proteins. Nature biotechnology, 24(10), pp.1241–52.
Wang, L.-X. & Amin, M.N., 2014. Chemical and chemoenzymatic synthesis of
glycoproteins for deciphering functions. Chemistry & biology, 21(1), pp.51–66.
WHO, 2014. EBOLA RESPONSE ROADMAP SITUATION REPORT, Available at:
http://www.who.int/csr/disease/ebola/situation-reports/en/.
Wildt, S. & Gerngross, T.U., 2005. The humanization of N-glycosylation pathways in
yeast. Nature reviews. Microbiology, 3(2), pp.119–28.
Xu, X. et al., 2011. The genomic sequence of the Chinese hamster ovary (CHO)-K1 cell
line. Nature biotechnology, 29(8), pp.735–41.
Yamane-Ohnuki, N. & Satoh, M., 2014. Production of therapeutic antibodies with
controlled fucosylation. mAbs, 1(3), pp.230–236.
Zhong, X. & Wright, J.F., 2013. Biological Insights into Therapeutic Protein
Modifications throughout Trafficking and Their Biopharmaceutical Applications.
International journal of cell biology, 2013, p.273086.
Zimran, A. et al., 2014. Pivotal trial with plant cell – expressed recombinant
glucocerebrosidase , taliglucerase alfa , a novel enzyme replacement therapy for
Gaucher disease. , 118(22), pp.5767–5774.
Illustration References
Figure 1:Snider, J. (n.d.). N-glycan assembly and attachment. [image] Available at:
http://www.piercenet.com/method/protein-glycosylation [Accessed 12 Nov. 2014].
Figure 2:Hossler 2009 Optimal and consistent protein glycosylation in mammalian cell culture
Glycobiology Review
Figure 3:D.Ghaderi 2010 Production platforms for biotherapeutic glycoproteins. Occurrence,
impact, and challenges of non-human sialylation: Nature Biotechnology and Genetic
Engineering Reviews
31
Figure : Naoko Yamane-Ohnuki 2014. Production of therapeutic antibodies with controlled
fucosylation. Landes Bioscience Review
Figure 5 :Laetitia Malphettes et al 2010 Highly Efficient Deletion of FUT8 in CHO Cell Lines
Using Zinc-Finger Nucleases Yields Cells That Produce Completely Nonfucosylated
Antibodies. BioTechnology and Engineeering
Figure 6 :Jenny L. Baker1et al 2013 .Expanding the glycoengineering toolbox: the rise of
bacterial N-linked protein glycosylation Trends in Biotechnology.
Figure 7:Julian Ihssen et al 2010. Production of glycoprotein vaccines in Escherichia coli.
Microbial Cell Factories 2010
Figure 8;Veronique Gomord et al 2005.Biopharmaceutical production in plants: problems,
solutions and opportunities Trends in Biotechnology
Name: Ian Martin
Programme: GCB4
Student Number: 11532343
Supervisor: Dr.Brendan O’Connor
Final Year Research Project Title
“Assessing the Sweet Tooth of Fungal Lectin AAL-2:
Characterizing AAL-2 binding with N-acetyl-D-glucosamine”
Abstract
Glycosylation is widely considered the most biologically significant Post Translational
Modification (PTM) and involves the addition of oligosaccharide moieties to proteins.
Lectins are Carbohydrate Binding Proteins (CBP) that bind reversible to specific glycan
motifs and have become important components of glycoanalytic tools such as Enzyme-
Linked Lectin assays (ELLA). AAL-2 is a fungal lectin derived from the mushroom plant
Agrocybe Aegerita and has previously demonstrated high binding selectivity towards
terminal non-reducing N-acetyl-glucosamine (GlcNAc) residues. This lectin carbohydrate
interaction remained unspecified until BLAST analysis identified conserved sequence motifs
associated with GlcNAc residue binding between AAL-2 and another lectin Psathyrella
Velutina Lectin (PVL). In the present study AAL-2 was subjected to sited directed
mutagenesis in two sites to reduce binding efficiency and demonstrate that these are
implicated in GlcNAc binding. This research also presents a protocol to express AAL-2 using
E.coli strains KRX and JM109, purification strategy using IMAC chromatography and future
perspectives for GlcNAc and AAL-2 characterization.
Appendix A
DCU University’s Declaration on Plagiarism
Assignment Submission Form
This form must be filled in and completed by the student submitting an assignment.
Assignments submitted without the completed form will not be accepted.
Name:
Programme:
Module Code:
Assignment Title:
Submission Date:
I declare that this material, which I now submit for assessment, is entirely my own
work and has not been taken from the work of others, save and to the extent that such
work has been cited and acknowledged within the text of my work. I understand that
plagiarism, collusion, and copying are grave and serious offences in the university and
accept the penalties that would be imposed should I engage in plagiarism, collusion or
copying. I have read and understood the Assignment Regulations set out in the
module documentation. I have identified and included the source of all facts, ideas,
opinions, and viewpoints of others in the assignment references. Direct quotations
from books, journal articles, internet sources, module text, or any other source
whatsoever are acknowledged and the source cited are identified in the assignment
references. This assignment, or any part of it, has not been previously submitted by
me or any other person for assessment on this or any other course of study.
I have read and understood the referencing guidelines found at
http://www.library.dcu.ie/citing&refguide08.pdf and/or recommended in the
assignment guidelines.
Name: ________________________________ Date: _________________
Abbreviations
BLAST Basic Local Alignment Search Tool
CBP Carbohydrate-binding protein
dH2O Distilled water
ELLA Enzyme Linked Lectin Assay
GFP Green Fluorescent protein
GSL-II Griffonia simplicifolia lectin-II
GlcNAc N-acetyl-glucosamine HRP Horse Radish Peroxidase
IPTG Isopropyl-β-D-thiogalactopyranoside
LB Luria Bertani Broth
MW Molecular weight
PAGE Poly-acrylamide gel electrophoresis
PCR Polymerase Chain Reaction
PVL Psathyrella Velutina Lectin PTM Post Translational Modification
SDS Sodium Dodecyl Sulphate
TEMED Tetramethylethylenediamine TB TB Terrific Broth
WGA WGA Wheat germ agglutinin
Contents
1. Introduction 1
1.1 Glycosylation 1
1.2 Lectins 1
1.3Glycoanalysis 1
1.4 O-GlyNAcylation 2
1.5 AAL-2 2
1.6 Experimental Hypothesis 3
1.7 Experimental Approach 4
1.8 Aims and Objectives 4
2.0 Methods and Materials 5
2.1 Bacterial Strains 5
2.2 Primers 5
2.3 Plasmid 6
2.4 Equipment 6
2.5 Reagents 7
2.6 Microbial Media 7
2.7 Buffers and Solutions 7
2.8 Enzyme Reactions 10
2.8.1 Polymerase Chain Reaction (PCR) 10
2.8.2 Restriction Digest 11
2.8.3 Ligation Reaction 11
2.9 Plasmid DNA Isolation Sigma GenElute Plasmid Miniprep Kit 11
3.0 Purification of DNA Mixture using GE Healthcare GFX Kit 12
3.1 Purification of DNA from agarose gels using GE Healthcare GFX Kit 12
3.2 Agarose Gels 12
3.3 Competent cells 13
3.4 Transformation of Competent cells. 13
3.5 Bacterial Stock Solutions and Culturing 14
3.6 Screening for Protein Expression 14
3.7 SDS-PAGE Analysis 14
3.8 Sample Preparation for SDS-PAGE 15
4.0 Protein Expression 15
4.1 Protein Purification 15
4.2 Stripping and Recharging the IMAC Resin 16
4.3 DNA Sequencing 16
5.0 Results & Discussion 16
5.1 Isolation of pQE-30 Plasmid 16
5.2 1st Round of Site Directed Mutagenesis 18
5.3 Plasmid Digestion and Ligation of PCR Products 19
5.4 Transformation with JM109 cells using RF method 20
5.5 Sequence Check of Transformants 21
5.6 Second Round Site Directed Mutagenesis 22
5.7 Plasmid Isolation from JM109 and KRX transformants 22
5.8 PCR Products of Site Directed Mutagensis 23
5.9 Digestion and Ligation of JM109 PCR Products 24
6.0 2nd
Round of Transformation 25
6.1 Sequence Verification using XX of mutated AAL-2 Protein 25
6.2 Protein Expression Check using 15 % SDS-PAGE Analysis 26
6.3 IMAC Chromatography 27
6.4 Troubleshooting IMAC Purification 27
6.5 Troubleshooting Transfromation with KRX and JM109 30
6.6 Protein Expression Check of KRX and JM109 new transformants 30
6.7 IMAC Purification of KRX Clone 31
7.0 Future Perspectives 32
8.0 Conclusion 33
9.0 Acknowledgements 33
9.0 References 34
10.0 Appendix 36
1
1. Introduction
1.1 Glycosylation
Glycosylation is a post translational modification (PTM) which involves the
addition of oligosaccharides to proteins to form glycoproteins .The heterogeneity of
glycoproteins is attributed to the non-template-driven process of glycosylation. The
unpredictable nature of the PTM produces a diverse range of complex glycans which
differ in variety of ways include monosaccharide sequence, chain length, anomery and
branching points.(Ohtsubo & Marth 2006) This abundant protein PTM facilitates a
number of biological functions that reach beyond the genome including efficient
folding, enhanced trafficking and increased stability of proteins. (Moremen et al. 2012)
1.2 Lectins
Lectins are classified as Carbohydrate Binding Proteins (CBP) that can
recognize particular glycans and bind to them in a reversible non-catalytic
manner(Varrot et al. 2013). They facilitate a range biological functions including bio
recognition and cell proliferation, cell communication and migration, activation of
immunological responses, cell death and interactions with a variety of pathogens
including prions, viruses and microorganisms.(Ambrosi et al. 2005; Thompson et al.
2011).
1.3Glycoanalysis
A growing number of lectins derived from plant, animals and bacteria are now
being incorporated into glycoanalytic tools because of their ability to distinguish
between different glycan molecules. Lectin microarrays are steadily becoming the
method of choice for glycomic based research and the most conventional glycoanalytic
device is known as an Enzyme-Linked Lectin Assay (ELLA)(Thompson et al. 2011).
The basic format of an ELLA as shown in (Figure 1) involves firstly the
immobilization glycoconjugates onto the surface of an ELISA plate, blocking of the
plate surface and then probing the glycan molecules with lectins. By using predefined
arrangements of glycans with characterized glycan binding specificities one can infer
glycosylation pattern of a given glycoprotein or glycoconjugate using lectins.
(Thompson et al. 2011).
2
Figure 1 Enzyme-Linked Lectin Assay (ELLA). Glycoproteins are immobilized onto
the wells of an ELISA plate. Surfaces of plates are blocked with a blocking agent. A
labelled or tagged Lectin is applied to ELLA. Binding is characterized using a labelled
or antibody against the labelled lectin or tag. The antibody used can be conjugated with
Horse Radish Peroxidase (HRP(Thompson et al. 2011)).
1.4 O-GlyNAcylation
Lectin microarrays are now being utilized as diagnostic tool for establishing the
glycosylation status of diseased cells. It has suggested that O-glynacylation is involved
in the pathogenesis of diabetes and neurology disorders including Alzheimer’s
disease(Ren et al. 2013). Until now the most extensively method for the detection of
O-GlyNAcylation was the use is N-acetyl- glucosamine (GlcNAc) specific commercial
lectins including wheat germ agglutinin (WGA) and lectin GSL-II (Griffonia
simplicifolia lectin-II). However the inadequate specificity and low affinity of these
CBPs toward O-GlcNAc has thus far delayed research on O-GlyNAcylation
diseases(Ren et al. 2013). In addition these plant derived lectins are subjected to costly
purification strategies which is not preferable.
1.5 AAL-2
Fungi derived lectins have become a major source of novel CBP with 82%
originating from mushrooms. These CBP are preferential for glycomic studies because
they have been showed to bind with high specificity to a human glycoconjugates such
as GlcNAc. The fungal lectin AAL-2 isolated from Agrocybe aegerita mushrooms has
exhibited a concentration-dependent binding and a precise specificity for non-reducing
terminal GlcNAc moieties(Jiang et al. 2012). AAL-2 is 1224 bp and has a molecular
3
weight of 43kDa.AAL-2 displays a greater affinity for GlcNac than both WGA and
GSL-II and its enhanced bio-recognition of GlcNAc has already been used in studies
concerning O-linked proteins.
1.6 Experimental Hypothesis
The advantage of having the ability express AAL-2 via a recombinant
expression system such as E.coli means it demonstrates minor batch to batch variations
when it is produced and it can subjected to mutagenesis strategies that can produce a
novel protein with enhanced bio recognition. While AAL-2 demonstrates a high
affinity towards GlcNac the exact mechanism whereby it interacts with this glycan
remains undefined. In order to elucidate this interaction an amino acid sequence-
homology BLAST search was performed and identified that Psathyrella velutina Lectin
(PVL) was 60% identical (Ren et al. 2013). As shown in the (Figure2a) PVL is a 401
amino acid lectin that exhibits a seven bladed b-propeller fold structure and has six
glycan binding pockets found sandwiched between 2 consecutive blades(Cioci et al.
2006). The amino acid sequences of each of the binding sites are highly conserved and
it is understood that 5 hydrogen bonds be facilitate glycan binding (see Figure 2b). By
analyzing sequence homology of PVL and AAL-2 it was hypnotized that certain amino
motifs identified in PVL also play an active role in GlcNac binding in AAL-2. By
characterizing these amino acids recombinant AAL-2may feature in diagnostic devices
for diseases associated with O-linked proteins.
A B
Figure 2 (a) Crystal structure of PVL indicating 6 binding sites for GlcNac.
(b)PVL hydrogen binding for sites 5-6 and 1-2.Note bulky tryptophan
molecule(Cioci et al. 2006)..
4
Figure 1 PVL amino acid sequence with 7 amino acids indicated in blue
implicated with glycan binding amino acids. The amino acids indicated in yellow are
associated with calcium binding(Cioci et al. 2006).
1.7 Experimental Approach
AAL-2 contains 5 suggested glycan binding sites as indicated in (Figure 2b). In order
to significantly alter lectin-glycan interactions the two binding sites with the most
homologous sequences with PVL were selected for alanine mapping which is a
common technique used to establish the influence of specific amino residues in relation
to a protein’s function. Alanine is utilized for amino acid knock out because of small
size, non-reactivity and ability to replicate the secondary structure of a protein. The
introduction of multiple alanines at both targeted glycan binding will in theory disrupt
the affinity of AAL-2 towards GlcNac it because replaces bulky amino acids such as
tryptophan illustrated in (Figure2b) .Removing a bulky amino will drastically alter the
binding pocket of AAL-2 and thus will stop binding with GlcNac. This reduced
binding can be characterized using an ELLA.
1.8 Aims and Objectives
Determine the binding specificity of AAL-2 for non-reducing terminal GlcNac
by site directed mutagenesis of sites associated with binding motifs as indicated
with BLAST analysis.
Develop an efficient E.coli expresser strain (JM109 and KRX) which produces
mutated AAL-2 at high levels.
Efficiently selectively purify mutated AAL-2 with the use of IMAC
chromatography.
Evaluate the binding effects of the mutated AAL-2 protein compared to wild
type AAl-2 with the use of ELLA characterization.
5
2.0 Methods and Materials
2.1 Bacterial Strains
Table 1 Information on Bacterial Strains Used
Type:
JM109
Genotype: e14–,(McrA–) recA1,
endA1, gyrA96, thi-1, hsdR17,
(rK–mK+), supE44, relA1, Δ(lac-
proAB),[F´ traD36 ,proAB
,lacIqZΔM15.
Comments: JM109 cells are
deficient endonuclease (endA),
which enhances quality of DNA
preps and lacks ecombination
(recA) lacking thus plasmid
stability.
Origin
Strategene
Type:
KRX
Genotype: [F´, traD36, ΔompP,
proA+B+, lacIq , Δ(lacZ)M15]
ΔompT, endA1, recA1, gyrA96
(Nalr ), thi-1, hsdR17 (rK –, mK
+), e14– (McrA–), relA1, supE44,
Δ(lac-proAB), Δ(rhaBAD)::T7
RNA polymerase
Comments: The ompT– and
ompP– mutations eliminate one
source of proteolysis of
overexpressed protein in E. coli.
Origin:
Promega
2.2 Primers
Site Directed Mutagenesis Primer Set 1:
Forward: 5’- GCGCTGACCACCAAACACGTTCGTCTGATCGC - 3’
Reverse: 5’- AGCAGCAGCGTTCTGAGCGAAGTTTTTAACAGCC- 3’
Site Directed Mutagenesis Primer Set 2:
Forward: 5’-GCTGCTGCTAAAATCGGTGACCACCCGCGTTTCGTTGC-3’
Reverse: 5’-AGCGTCAATGCAGAAGTTGTCGATAACAGATTTAGCCG-3’
6
2.3 Plasmid
Figure 04. Qiagen vector
pQE-30 plasmid generated
using Snapgene. Vector
contains AAl-2 sequence
under the control of T5
promoter and Lac
operator.Origin of replication
(Ori) ampicillin resistance
(AmpR) are also present.
Bam H1 and HindII restriction
sites also displayed. Primer
2.4 Equipment
Small Centrifuge Labnet spectrafuge
Large Centrifuge Sorvall RC 5B plus
Plasmid extraction kit Sigma GenElute plasmid miniprep kit.
Blue transilluminator Clare chemical research dark reader transilluminator
Cell disrupter Constant cell disruption systems
Incubator Sanyo orbital incubator
Spectrophotometer Shimadzu - UV Mni – 1240 UV-Vis spectrophotometer
Heating block Labnet accublock digital dry bath
Stirrer AGB 1000 hotplate and stirrer
Agarose Gel Rig BioRad Horizontal Gel apparatus
SDS-PAGE Rig ATTO vertical mini electrophoresis system
Power Pack Powerplex 3000
Gel purification kit GE Healthcare GFX PCR DNA and gel band purification kit
7
2.5 Reagents
All reagents used during experimentation were of ACS grade quality and originated
from Sigma-Aldrich unless stated otherwise. All microbial media prior to use was
autoclaved at 121oc for 60 minutes. Milli-Q system Academic supplied distilled water
(dH2O) for analysis in the lab.
2.6 Microbial Media
Table 2 Reagent table Luria Bertani Broth (LB)
Broth Type Composition Concentration
Luria Bertani Broth (LB)
Tryptone 10 g/L
NaCl 10 g/L
Yeast Extract 10 g/L
Comment: Using dropwise addition of NaOH pH was adjusted to pH 7.0 and dH20
was added to bring to volume. Solid agar plates were prepared by adding 15g/L of
agar before autoclaving.
Table 3 Reagent Table Terrific Broth (TB)
Broth Type Composition Concentration
Terrific Broth (TB)
Tryptone 12 g/L
Yeast Extract 24 g/L
Glycerol 4 mL/L
Comment: After sterilization dH20 was added to TB to bring solution to 900ml and
pH was adjusted to 7.4 using 100ml of phosphate buffer after adequate time for
cooling. All media manipulation was conducted in an aseptic environment
.
Ampicillin and IPTG
Ampicillin (Amp) and isopropyl β-D-1-thiogalactopyranoside (IPTG) were prepared at
100 mg/L concentration. Stocks were added to media after autoclaving in order to
attain 100μg/mL broth concentration.
2.7 Buffers and Solutions
8
Table 4 Reagent Table for 1M Potassium Phosphate Buffer
Buffer Type Composition Mass (g/l)
1M Potassium Phosphate Buffer KH2PO4
K2HPO4
23.1 g/L
125.4 g/L
Comment: Potassium Phosphate Buffer was brought to 1 L with dH2O and
autoclaved. pH needed to be adjusted to pH 7.4.
Table 5 Reagent Table for TB Buffer
Buffer Type Composition Concentration
TB Buffer
PIPES 10 mM
CaCl2 10 mM
KCl 250 mM
Comment: KOH and MnCl2 were used in conjunction with each other to adjust the
final pH 7.0. A sterile syringe with 0.22 μm filter membrane decontaminated
the solution. Stored at 4°C if needed at a later time.
Table 6 Reagent Table for TAE Buffer (50X)
Reagent Type Composition Volume
TAE Buffer (50X)
Tris 242 g/L
Glacial acetic acid 57.1 mL/L
EDTA 50 mM
Comment: 1X solution of TAE buffer was achieved by adding 20ml of 50X TAE
Buffer to 500ml dH2O. pH 8.0 was assumed for solution used.
Table 7 Reagent Table for TAE Buffer
Buffer Type Composition Volume
TAE Buffer (50X)
Tris 242 g/L
Glacial acetic acid 57.1 mL/L
EDTA 50 mM
Table 8 Reagent Table for Gel Loading Dye
Type Composition Concentration
Xylene Cyanol 0.25% (w/v)
9
Table 9 Reagent Table for SDS-PAGE Buffer (5X)
Type Composition Concentration
SDS-PAGE Buffer (5X) Tris-HCl 15 g/L
Glycine 72 g/L
SDS 5 g/L
: This was diluted toa 1X running buffer solution dH20. pH 8.3 assumed.
Table 10 Reagent Table for SDS-PAGE Sample Buffer (10X)
Type Composition Concentration
SDS-PAGE Sample Buffer (10X)
SDS 3.2 ml 10
2-Mercaptoethanol 0.8Ml
Tris-HCl 2.0ml 0.5M Stock
Bromophenol Blue (0.5 w/v)
dH2O 0.4ml
Table 11 Reagent Table for Coomassie blue stain solution
Type Composition Concentration
Coomassie blue stain solution
dH2O 50% (v/v)
Methanol 40% (v/v)
Acetic Acid 10% (v/v)
Coomassie blue 10% (v/v)
Table 12 Reagent Table for Coomassie blue stain solution
Type Composition Concentration
Coomassie blue stain solution
dH2O 50% (v/v)
Methanol 40% (v/v)
Acetic Acid 10% (v/v)
Table 13 Reagent Table for Coomassie Blue De-stain solution
Type Composition Concentration
Coomassie Blue De-stain solution dH2O 45% (v/v)
Methanol 45% (v/v)
Gel loading Dye Ficoll (Type 400) 15% (w/v)
10
Acetic Acid 10% (v/v)
Table 14 Reagent Table for Ethidium Bromide Solution
Type Composition Concentration
Ethidium Bromide Solution
dH2O 1 L
EB Stock 100 μL of 10mg/ml
solution
Table 15 Reagent Table for Lysis
Type Composition Concentration
Lysis Buffer NaH2PO4 50 mM
NaCl 0.5 M
Imidazole 20-250 mM
2.8 Enzyme Reactions
2.8.1 Polymerase Chain Reaction (PCR)
PCR reactions were executed in a Veriti 96 well Thermal Cycler (Applied
Biosciences).
Table 16
PCR reagent Volume (ul)
Template DNA 1μl
dNTP’s (10 μM) 1μL
Primers (10 μM) 1μL of each Primer Type
Buffer (5X) 10μL QF Phusion
dH2O 35 μL
Phusion DNA polymerase 1μL
DNA polymerase was added last immediately before PCR cycle initiation.
PCR Programme utilised for all Site Directed Mutagenesis reactions.
Stage 1.0 -Denaturation Step: 95°C for 10 minutes
Stage 2.1 - Denaturation Step: 95°C for 30 seconds
Stage 2.2 - Annealing for 30 seconds. (Temperatures used 55, 60, 65, 70°C)
Stage 2.3 - Extension at 72°C for 3 minutes.
11
Stage 3.0 - Extension at 72°C for 10 min
Stage 4.0 - Samples refrigerated at 4°C
NOTE : Stage 2.1 , 2.2 and 2.3 were repeated for 30 cycles in total
2.8.2 Restriction Digest
Table 17 Restriction Digest Quantities
Digestion Reagent Volume μL
Buffer (10X) 5 μL
Purified Plasmid 30 μL
Enzyme (DpnI) 1.5 μL
dH2O 13.5 μL
Reactions were incubated at 37°C for 2 hours. Before the digested DNA could be used
additional applications purification was carried out as detailed below with a GE
Healthcare GFX Kit.
2.8.3 Ligation Reaction
Table 18 Ligation Reaction Quantities
Ligation Reagent Volume (μL)
Purified plasmid 40 μL
Buffer (10X) 5 μL
T4 Ligase 2 μL
dH2O 3 μL
Ligation reactions were incubated at ambient room temperature for 3 hours or
overnight at 4oC. The ligated plasmid can then be introduced into competent cells.
2.9 Plasmid DNA Isolation Sigma GenElute Plasmid Miniprep Kit
1.5ml of overnight bacterial culture was centrifuged at 13,000 rpm for 2 minutes to
form a cell pellet. The supernatant was pipetted off and pellet was suspended in 200ul
of chilled suspension solution containing RNase A. Lysis solution was added to
Eppendorf tube, inverted allowed to rest at room temperature for approximately 5
minutes. 350 μL of Neutralisation solution was supplemented to the tube and mixed by
inversion in order remove cell debris, lipids, proteins and chromosomal
DNA.Neutralization mixture was allowed to settle for 10 minutes. Precipitate was
12
gathered by centrifugation at 13,000 rpm for 5 minutes. During this period a spin
column was prepared by adding 500 μL of column preparation solution to spin column
surface. The spin column was then centrifuged at 13,000 rpm for 1 minute. The
supernatant was then added to the conditioned spin column and centrifuged at 13,000
rpm in order to bind the plasmid DNA. The flow through was removed 750 μL of
wash solution was added to spin column. The column was centrifuged at 13,000 rpm
for 30 sec to remove remaining contaminants. The flow through was thrown away and
the matrix was dried further by centrifuging at 13,000rpm for 2 minutes. Spin column
was added to Eppendorf tube and centrifuged at 13,000 rpm elute plasmid DNA.
3.0 Purification of DNA Mixture using GE Healthcare GFX Kit
Purification of DNA from PCR mixtures involved adding 500 μL of capture buffer
type 3 to 100 μL of a PCR mixture. The solution should turn a pale yellow. The sample
was added to a spin column and centrifuged at 13,000 rpm for 30 seconds before flow
through was removed .40ul of elution buffer was added to the middle of the spin
column matrix and allowed to rest at room temperature for 2 minutes. The column was
then centrifuged at 13,000 rpm for 30 seconds to allow elution of the DNA
3.1 Purification of DNA from agarose gels using GE Healthcare GFX
Kit
Under blue light DNA bands were purified from the agarose using a scapal.DNA bands
were cut out and 500ul of capture buffer type was added to the sample and vortex in
Eppendorf tube. The tube was incubated at 60°C for 15- 20 minutes until the agarose
was dissolved. The tube was inverted every 3 minutes to progress the dissolving
process.Purification was then in the same manner of DNA mixture purification
3.2 Agarose Gels
DNA samples were examined using electrophoresis through in a BioRad Horizontal
Gel apparatus. Agarose was added to TAE buffer to make 0.7% w/v concentration.
Agarose solutions were stored at 60°C to avert unwanted solidification. When needed
the heated agarose was poured into a BioRad horizontal gel apparatus and allowed set
with a plastic comb inserted in order to form wells. The gel was allowed to air dry for
20 minutes before being placed in the fridge at -40C for 5 minutes. The comb was
13
removed and 1.0 μL of gel loading dye was mixed with 4 μL of sample to help the
sample settle in the well and to give indication of migration distance during
electrophoresis.1X TAE buffer was used as the running buffer. A 1kb ladder was used
to identity DNA fragments. The gels were run for 25 minutes at 120 volts and
subsequently stained carefully with ethidium bromide staining solution for 15 minutes.
The gels were then visualized using a UV transilluminator. SYBR gels were prepared
by combining 3 μL of SYBR Safe stain with 30 mL of 0.7% agarose before being
added to a BioRad horizontal gel apparatus.(Larragy 2011) SYBR gel was visualized
under blue light.
3.3 Competent cells
5ml of LB broth containing ampicillin was inoculated with 1 colony of JM109 E.coli
from a plate stock and cultured overnight at 37oC. A 1L flask with 200ml of LB was
inoculated with 2ml of the LB overnight culture and incubated at 37oc shaking at 180-
220rpm. When OD 600 reached approximately 0.5 the flask was chilled on ice in the
cold room. The overnight culture was placed into a sterile centrifuge tube .The cells
were centrifuged at 3000 rpm at 5 minutes. The supernatant was removed and cells
were gradually suspended in 60ml of cold RP1 buffer. The suspension was allowed to
rest on ice for 90minutes .The cells were subjected to centrifugation at 3000 rpm for 5
minutes. The supernatant was removed and the cells were placed in 8ml of RP2 buffer.
Aliquots of 400ml of JM109 competent cells were flashed frozen using a metal steel
block and stored in 1.5ml microfuge tubes at -80oc.(Larragy 2011)
3.4 Transformation of Competent cells.
Aliquots of containing competent cells and plasmid DNA were allowed thaw
completely on ice. 5ul of plasmid DNA and 200ul of competent cells were softly
mixed in an Eppendorf tube. The tube was placed on ice for 30 minutes to allow the
plasmid and the cells to bind together. Cells were heat-shocked at 42°C for 30 seconds
and placed back on ice for 2 minutes.800ul of LB broth was supplemented to the cells
and they were incubated in a water bath for an hour at 37°.A neat suspension if cells
was prepared by adding 200ul onto a LB ampicillin plate and was incubated overnight.
The leftover 800ul was subjected to centrifugation at 5,000 rpm for 1 minute. 600ul of
the supernatant was removed and the remainder of the solution was used or suspension
14
of the pellet. This remainder was added to the ampicillin plate and incubated at 37oc
3.5 Bacterial Stock Solutions and Culturing
Both JM109 and KRX were stored as glycerol stock solutions. These stocks were
stored at -800c and made from 1 ml LB cultures with 50% glycerol. Ampicillin
was also added to maintain of E.coli of interest. Overnight E. col cultures were
prepared by inoculating a single colony from LB agar pate or a loopful glycerol
stock with 5ml of media culture(TB or LB).2ml of this overnight was then
subsequently used to inoculate 200 mL of broth which was shaken at 37°C for 2-
4 hours.
3.6 Screening for Protein Expression
Transformants were streaked in order to isolate a single transformant on individual LB
ampicillin plates. These colonies were inoculated in separate 8ml of TB, ampicillin and
IPTG (50 μg/mL) cultures. Expression cultures were grown overnight at 370C. After
overnight incubation the cultures were allowed to cool to arrest growth. The samples
were analyzed by spectrometer at OD600 to calculate the volume needed for harvested.
Samples were normalized using the equation:
The volume obtained using the equation is subjected to centrifugation at 13,300 rpm
for 1 min and pellet is combined with 50 μL of 1X SDS-PAGE sample buffer. The
samples are evaluated using 15% SDS-PAGE gel.
3.7 SDS-PAGE Analysis
Table 19 Regents for SDS-PAGE
Reagents 15% resolving gel 4% stacking gel
30% Acrylamide (mL) 3.75 0.325
dH2O (mL) 1.75875 1.54
1.5M Tris-HCl pH 8.8 (mL) 1.875 -
0.5M Tris-HCl pH 6.8 (mL) - 0.625
10% APS (μL) 37.5 12.5
10% SDS (μL) 75 25
Temed (μL) 3.5 2.5
15
.
Preparation of 15% resolving and 4% stacking polyacrylamide are detailed as per table
19.Gels were casted in an ATTO vertical mini electrophoresis system and TEMED was
always added last to initiate the setting process. After the addition of TEMED to the
resolving gel it was immediately covered with IMS. A comb was placed into the top of
the gel to form loading well .If the gels were not used straight away, they were placed
in the fridge at 4°C wrapped in soaked tissue.
3.8 Sample Preparation for SDS-PAGE
18 μL of protein sample and 2 μL of 10X gel loading dye was combined in a
microfuge tube and heated for 5 minutes at 100°C. 5 μL of this mixture was then
injected into a well. A broad range protein marker was used 2-212kDa in order to
gauge protein size. Prior to loading the samples gels were pre-run for 30 minutes at a
constant voltage of 30 mA. When gels were electrophoresed the constant fluctuated
between 30-70 mA and lasted as long as 90-120 minutes. When run was completed
gels were cleaned with dH20 and stained with Comassie blue overnight. The following
day gels were treated with Comassie destain solution to visualize protein bands.
4.0 Protein Expression
The highest expresser clone identified during screening was grown in 200ml TB
ampicillin culture. The culture was grown at 370C until it reached OD600 of 0.4-0.6
.When OD reached this range IPTG 100ug/ml was added and the culture was
transferred to a 30°C incubator for 16 hours. The culture was subjected to
centrifugation at 5,000 rpm for 10 min at 4°C using sterile centrifuge bottles.
Supernatant was disposed of and obtained pellet was suspended in in 100 mL of lysis
buffer (20 mM imidazole) with 0.01% anti-foam. Cell lysis was performed using a cell
disruptor, Constant Systems Ltd., at 15kPSi twice. The cell lysate was collected in high
speed centrifuge tubes and spun at 13,000 rpm for 40 min at 4°C. The resulting late is
filtered using Whitman filter into a sterile duran.
4.1 Protein Purification
Immobilized Metal Affinity Chromatography (IMAC) was used to purify recombinant
16
AAL-2 with terminal (His) 6 tag. Table 20 shows the steps needed for a standard
elution Column used was BioRad Proafinity Column with a Column volume (CV) of
20ml.
Table 20 IMAC Purification Washes
Step Added Fraction Collected
Rinse 10 CV dH2O -
Equilibrate 10 CV LB (20 mM) -
Lysate Filtered Lysate Unbound Lysate
Wash 10 CV LB (20 mM) 20 mM wash
10 CV LB (50 mM) 50mM wash
10 CV LB (80 mM) 80 mM wash
Elution 5 CV LB (250 mM) 10 x 1 mL
Rinse 10 CV dH2O -
Storage In 20% IMS -
4.2 Stripping and Recharging the IMAC Resin
IMAC resin was stripped and recharged after purification. The column was initially
washed with 20 ml of dH2O followed by 20ml of 20% IMS. Metals were removed by
washing with 20ml of 100 mM EDTA.The resin was then washed with 10 CV of
dH2O and recharged with ½ a CV of 100 mM NiSO4. The column was again washed
with 10 CV of dH2O and stored in 20% ethanol.
4.3 DNA Sequencing
Possible Mutants are screened using agarose gel electrophoresis and a potential mutant
is then identified using DNA sequencing. The sent plasmid sent for sequencing is
purified and eluted into dH20. The obtained plasmid is then delivered to Eurofins
MWG Operon .Sequences for both forward and reverse reads are retrieved by logging
into Eurofins website(Larragy 2011).
5.0 Results & Discussion
5.1 Isolation of pQE-30 Plasmid
Plasmid isolation was carried out as detailed using a Sigma GenElute Plasmid
Miniprep Kit and gel electrophoresis confirmed the presence of a pQE-30 isolated
plasmid. (Figure5a) illustrates a 0.7% agarose gel stained with ethidium bromide
showing a band in lane 6. As can be seen that smearing was observed all lanes loaded
17
with DNA including PQE30 plasmid AAL-2 in lane 6. While a DNA band did appear
in lane 6 it was difficult to establish its molecular weight due to unfavorable resolution
of the ladders in lanes 1 and 5. The banding at the bottom of the gel was the result of
short fragments of DNA. One reason the gel showed inconclusive results was that the
agarose used was expired and the gel therefore did not polymerize correctly. As shown
in (Figure4b) SYBR staining and new fresh agarose were used for enhanced
visualization of gel analysis. As shown in (Figure5b) a faint band of approximately
4Kb materialized in lane 7 which confirmed the presence of the pQE-30. The faint
suggests that a low amount of DNA plasmid was extracted from the JM109 E.coli.
Figure 5 Plasmid Isolation Agarose Gel Analysis (a) 0.7 % agarose gel stained with
ethidium bromide containing isolated plasmid pin lane 6.(B)0.7% agarose Gel stained
with SYBR containing DNA prep in lane 7. Faint band is observed in lane 7
corresponding to molecular weight of plasmid DNA. Molecular Ladder used Thermo
Scientific Gene Ruler 1Kb Plus DNA Ladder.
One should note there were several problems associated with imaging and preparation
of agarose gels throughout analysis. Agarose gels were fragile and would often
disintegrate when manipulated during the process. Often fragmentation of the gel
occurred where the electrophoresis comb was inserted. Amendments introduced to
rectify this included a longer period to allow the gel to set after agarose pouring, a 5
minute freezing step in -4o fridge and reduction in comb size to ensure gel was
structurally intact.
18
5.2 1st Round of Site Directed Mutagenesis
Figure 06 Agarose gels with PCR Products (a) 0.7% agarose stained with ethidium
bromide loaded with site directed mutagenesis PCR products in lanes (6-9) .Molecular
Ladders loaded in lanes 1 and 5. (b) 0.7 % agarose SYBR stained gel with site directed
mutagenesis PCR products in lanes 2-5. Molecular ladder loaded in lanes 1 and 6.
Molecular Ladder used for both gels Thermo Scientific Gene Ruler 1Kb Plus DNA
Ladder.
Site directed mutagenesis was the method used to alter the binding pockets of each
motif indicated in (Figure 18) of the appendix. The first round of mutagenesis used
mutagenic primers indicated in Methods and Materials 2.2 and intended to introduce
mutations N51A, N53A W54A. By amplifying the whole plasmid these desired
mutations could be integrated into the newly synthesized pQE-30 plasmid and
subsequently checked by gel electrophoresis to establish if the PCR reaction had
worked. In addition one could also establish which annealing temperature was optimal
for the production of the mutated plasmid.
(Figure 6a) displays a 0.7 % agarose gel stained with ethidium bromide loaded with
PCR products in lanes 6-9 .One can see that 4 PCR products were obtained for all
temperatures and it is evident from the intensity of the bands that annealing
temperatures 600c and 65
0c produced the greatest amount of PCR product. While PCR
products were attained one could not infer if the PCR was the correct molecular weight
due to the wavy appearance of the gel and resolution of the molecular ladder.
Possibilities for these unwanted characteristics include forceful removal of the gel
19
comb prior gel electrophoresis and incorrect positioning of the gel in electrophoresis
rig.
In order to validate the result categorically a SYPR gel was loaded with samples and
the results are shown in (Figure 6b). As depicted 4 of the 4 PCR products ran
effectively on the gel and their banding correlated with molecular weight of the
mutated plasmid 4.6kba. In order to obtain the maximum amount of mutated PCR
product the 60oC and 70
0C products were combined. Smearing observed in lanes
loaded may have be the result loading too much PCR product. Banding at the bottom
of gel indicate primer dimer formation.
5.3 Plasmid Digestion and Ligation of PCR Products
Before transformation could commence the original template pQE-30 plasmid had to
be removed from the PCR products in order to prevent a non-mutated plasmid being
transformed into a competent JM109 cell. This was achieved by subjecting the PCR
products to a DpnI restriction digestion. Dpn1 cuts at recognition sites GATC of
template plasmid only because adenosine residues of template plasmid are methylated.
The first digestion was unsuccessful as shown in (Figure 7a) as the gel was severely
warped. This distorted shape was caused by not allowing the gel set adequately. The
second attempt to examine the Digestion products as shown in (Figure 7b) was
ineffective as the loaded samples got caught in the loading well. One cause for this
result is protein contamination which limits mobility of the DNA through the agarose.
(Figure 7c) shows the digestion had worked properly as two thick bands of plasmid
DNA were obtained in lanes 3 and 5 corresponding to the molecular weight of the
plasmid. The residual smearing at the bottom of the gel is most likely caused lingering
cleaved DNA fragments.
20
Figure7 (a) 0.7% Agarose ethidium bromide stained gel loaded with digested
DNA Lanes 5 & 6: DNA digest. (b)Failed 0.7 % SYBR agarose with digested DNA
samples retained in loading wells 6 and 6. (c) Successful 0.7 % SYBR agarose with
digested plasmid DNA in lanes 3 and 5. Molecular ladder used Thermo Scientific Gene
Ruler 1Kb Plus DNA Ladder.
Digested PCR was purified from TAE agarose gel using a GE Healthcare purification
kit as detailed in the protocol. After obtaining purified DNA ligation of linearized PCR
products was initiated by T4 ligase in order to promote self ligation. This ligation step
was used to promote DNA uptake during transformation.
5.4 Transformation with JM109 cells using RF method
The purpose of the transformation was to introduce one’s mutated pQE-30 plasmid
into a competent cell in order to replicate and store plasmid indefinitely. Competent
JM109 E.coli cells were cultured in 5ml LB with 100ug/ml ampicillin overnight before
upscaling to a 200ml LB. The JM109 LB was allowed to grow for approximately 90
minutes until its 0D600 was determined to be 485nm. This indicated that the cells had
reached mid exponential phase and were ready for resuspension using RFP buffer.
Transformation was carried out using a heat shock method with prepared competent
JM109 using RF method. Selection of the JM109 transformants involved streaking
transformed cells onto LB amp+ agar plates. Only JM109 E.coli with the pQE-30 of
interest would grow due to the presence of amp gene located in the vector shown in
(Figure 4). As shown in figure transformants colonies were obtained on both neat and
21
concentrated plates streaked with JM109. No colonies materialised on the control plate
which indicated no contamination was present. All transformants displayed similar
morphology as they were circular, smooth, off white and shiny in appearance. Single
transformants were picked off from the neat and concentrated plates and streaked onto
new LB amp + plates to create a bank of single colony transformants.
As shown in (Figure8c) the streaking technique used was not efficient in
isolating singular colonies as an incorrect streak technique was applied. In addition the
plates had grown new colonies that differed in morphology compared to the original
transformants obtained. As shown the contaminants were identifiable due to their
larger circular morphology. New plates were streaked as shown desired single colonies
were obtained for further experimentation.
Figure 8 LB amp+ agar plates with JM109 transformed colonies. (a) Control plate
containing no transformants (b) Concentrated JM109 transformant LB agar plate
whereby 9 transformants were exhibited. (C) Streak plate of one of the JM109
transformants. Single colonies were obtained despite unfavourable streaking technique.
Transformation was also carried successfully with previously generated KRX
competent cells as well. The success of transformation was not as effective as JM109
competent cells as only 2 transformants materialised. Competent cells ability to obtain
plasmid DNA reduces overtime. Transformation was performed KRX as a backup if
the new the JM109 competent cells were not successful.
5.5 Sequence Check of Transformants
22
In order to validate if site directed mutagenesis had integrated the correct mutations
into the predicted binding pocket of AAL-2 and transformants contained pQE-30 a
sequence check was required. Only the reverse read of the DNA product was obtained
and it was converted into its reverse complement using the reverse complement tool
available from (http://www.bioinformatics.org/sms/rev_comp.html). This reversed
sequence was then converted from its nucleotide sequence to amino acid sequence
using the ExPasy translate tool (http://web.expasy.org/translate/). Figure 19 of the
appendix shows that BLAST analysis of the mutated plasmid confirming the presence
of AAL-2 in the transformant. As can be seen the sequences were 100% identical
however this result did not verify if the mutation had been introduced successfully into
the recombinant AAL-2 as the reverse read stopped 45 amino acids upstream from the
wanted mutation site. Given time constraints and cost it was decided to continue
despite no confirmation of the desired mutation.
5.6 Second Round Site Directed Mutagenesis
The aim of the second of round of mutagenesis was to introduce silent mutation at
another site implicated GlcNac binding as shown Figure 18 of the appendix. The
following mutations G221A G222A W223A would be introduced into the second
glycan binding site.
5.7 Plasmid Isolation from JM109 and KRX transformants
Plasmid isolation was performed as before using a Sigma GenElute Plasmid Miniprep
Kit and (Figure 9) shows the CYBR gel confirming the presence of isolated pQE-30
plasmid. Two types of competent cells were used for this experiment freshly produced
JM109 competent cells in lane 2 and older KRX competent cells in lane 5. As
indicated by the band intensity more plasmid DNA was extracted in the newer JM109
competent cells. Interestingly along with the low amount of DNA extracted from KRX
a faint band in lane 7 can be seen higher up the gel in lane. The positioning band is
unusually as it is higher than would be inspected for circular DNA. Two possibilities
for this outcome is that the plasmid DNA got caught in the gel loading channel and did
not resolve correctly as a result. The second more unlikely possibility is that same
plasmid was contaminated with chromosomal DNA which explains it high molecular
weight.
23
Figure 09 0.7 % agarose SYBR stained gel
showing isolated plasmid from JM109 and
KRX E.coli strains. DNA preparations of
JM109 (Lane 2) and KRX plasmid (Lane3).
Band displayed in lane 2 is 1.4kb which
corresponds to pQE30 plasmid size. .Molecular
ladder used New England BioLabs N3232S
DNA Ladder 1 kb.
5.8 PCR Products of Site Directed Mutagensis
The purpose of the PCR gel illustrated in (Figure 10) was to determine what
annealing temperatures produced the optimal amount of product for further DNA
manipulation. Only PCR reactions derived from fresh competent JM109 DNA were
successfully as PCR products were seen in 3 of the 4 loaded this sample while no PCR
products were seen in the older KRX cells. This compliments the previous isolation gel
above as it was seen that low quality plasmid template DNA was extracted from the
older competent cells. This lower quantity of DNA thus facilitated an unsuccessful
PCR reaction. As shown in figure 10 temperatures 550C
and 70
oC demonstrated the
best bands and were combined to ensure an adequate mutated plasmid could be
retrieved. As shown smearing was apparent in lanes 2-5 were PCR product was
obtained and this could be attributed to a number of factors.1) The gel was not
prepared properly and therefore solidified unevenly. 2) Wells were overloaded with
PCR product. 3) The DNA was contaminated with proteins. 4) DNA was degraded by
nuclease activity.
24
Figure 10 0.7 % TAE agarose gel stained SYBR displaying PCR products
obtained during second round of site directed mutagensis. Lanes 2-5 were loaded
with PCR products from JM109 template plasmid . Lanes 7-10 show PCR products
from KRX derived plasmid DNA. As shown annealing temparatures 550C and 70
0C
created the most PCR product.Molecular ladder used New England BioLabs N3232S
DNA Ladder 1 kb.
5.9 Digestion and Ligation of JM109 PCR Products
Digestion was peformed with Dpn1 to remove nonmethylated DNA template. The
result of the restriction is shown in (Figure 11) and as shown two distinct bands of
AAL-2 plasmid materialised at 4.6Kb mark on the gel. The smearing apparent in both
lanes loaded with sample is indicative that DNA was degraded during the incubation
time of the digestion. Another possiblity for the smearing is that the restriction enyzme
used became bound to the template DNA it was cuting and didn’t allow the DNA
fragments to resolve adequently on the gel. Digested Dna was excised from the gel ,
purfied and subjected to ligation reaction as detailed above to promote transformataion
efficency.
Figure 11 0.7 % TAE agarose gel stained with
SYBR displaying digested PCR products PCR
products loaded lanes in 3 and 5. DNA Bands
relating to th molecular weight of pQE-30 plasmid
materialise in both lanes loaded with 20 ul of
digested sample. Smearing apparent in both lanes
loaded. Molecular ladder used New England
BioLabs N3232S DNA Ladder 1 kb.
25
6.0 2nd
Round of Transformation
The first attempt at transforming competent JM109 with mutated plasmid was
unsucessful. This can be inferred as no colonies were found on any of the agar amp+
plates treated with JM109 cells . This outcome was likely attributed to experiemental
error as competent cells were allowed to thaw on ice for an excessively long period.
This prolonged thawing may have caused the cells to undergo lysis. Another possiblity
which caused this unfavourable result may have caused by ineffective ligation. The
ligation was allowed to proceed for 3 days during which some the plasmid may have
become linearised. Linearised DNA does not transform as efficently as circular
plasmid. A second attempt at transformation was performed adheing to protocol more
stringently and applying a concentrated cell samples to LB amp + plates. These
obtained transformants were streaked onto additional plates to establish e.coli bank to
work from,
6.1 Sequence Verification using XX of mutated AAL-2 Protein
Figure 12. Amino acid sequence of mutated AAL-2. As indicated by the red arrow
in the diagram 3 alanines were introduced as a result of the first round of mutagensis.
As shown by the blue arrow 3 alanines were created as result second round of
mutatgenesis.
In order to validate if the transformation had incoporated the correct mutated pQE-30
plasmid the next step invloved sequence verification. Both Transformanants were
seperately cultured overnight in 5ml LB and their respective plasmids were isolated
using Sigma GenElute plasmid miniprep kit. The isolated plasmids were purfied using
a GE Healthcare GFX PCR DNA purification kit before being sent for sequencing.
Full sequence retrival was gathered for plamsid and it was established that intended
point mutations had been successful integrated during both rounds of mutagensis. As
26
shown Figure 12 new NAAL and DAAA sequences had been established in the
plasmid.
6.2 Protein Expression Check using 15 % SDS-PAGE Analysis
The purpsose of the evalauting the expresson levels of each of the transformants by
SDS-Page gel electrophoresis was to establish which clone produced the maximum
amount of AAL-2 protein. 2 transformatants were used inoculate inoculate two
separate overnigh 5 mL TB ampicillin and IPTG (50 μg/mL) cultures.When the
overnight cultures were evaulated the following day no growth had occurred in any
cultures. This result was attributed to experimental error during the inoculation
procedure whereby the loop used was not allowed to cool efficently when obtaining
bacteria from stocks.The second possibly for no growth was that the TB used
supplemented with too high a concentration of amplicin thus killing the transformant
ecoli in the process. The second attempt to produce overnights was sucessful and OD
values were obtained for both transfomant cultures as shown in Table 21 of the
Appendix. These OD figures were substitued into the equation 1 to determine the
amount of cell culture to be loaded onto subsequent 15% SDS-PAGE gels.
Figure 13. 15 % SDS Agarose Protein
Expression gel showing the expression of
two transformants. Protein samples loaded
in lanes 13 and 13. Ladder used was New
England Biolab Unstained Protein Marker,
Broad Range (2-212 kDa) AAL-2 reference
sample loaded in lane 11.
The 15 % SDS agarose gel shown in figure 10 was inconclusive in determining which
of the 2 transformant loading in lanes 12 and 13 expressed the most AAL-2. While the
two JM109 samples loaded produced a mileau of proteins as indicated by the multiple
blue bands observed because the reference AAL-2 protein loaded in lane 9 did not
maternalise and the 25 Kb molecular weight ladder did not migrate properly one could
not ascertain if AAL-2 had been produced. The absence of the AAL-2 reference band
27
in lane 11 could have been attributed too low amount of protein being loaded intially
onto the gel. The improper ladder patterning may have been attributed contaminatation
of of the running buffer. Due to time restrictions transformant 2 was picked as the
clone to continue experimental analysis.
6.3 IMAC Chromatography
After selecting a JM109 expressor the aim of using IMAC chromatography during this
stage of the analysis was to selectively purify AAL-2 by allowing its engineered His-
tag to complex with a Biorad Proaffinity Column . JM109 transformant 2 was upscaled
from an 5 ml to 200ml TB culture before being induced with 100 ug/ml IPTG at an OD
600 value of 0.500. (Figure 12) shows the 15% SDS-PAGE gel of IMAC purfied lysate
and indicates that no protein was selectively fractionated in any of the collected
250mM fractions. This can be deduced as no bands corresponding to AAL-2 were
present in any of elutions. In additon no reference AAL-2 protein maternalised on the
SDS-PAGE gel. A Red Run Expeon Protein ladder was used and it migrated
unfavourable down the gel.
Figure 12 15 % SDS Gel
containing IMAC purified AAL-
2 products. 14ul of purified
IMAC product was loaded in lanes
2 – 10. Ladder used was a
RunBlue Expeodeon prestained
7.6Kda - 195Kda Ladder.
6.4 Troubleshooting IMAC Purification
In order to establish if any proteins, including AAL-2, were produced by
JM109 transformant selected during the upscaling process a 15% SDS-PAGE gel
loaded with JM109 filtered lysate was analyzed. As can be seen in Figure 13 multiple
bands materialized in lane 9 indicating overall JM109 protein expression was efficient
28
however it difficult to establish if the AAL-2 was expressed adequately due to other
proteins masking it. This is a noteworthy observation because it suggests that the
JM109 clone selected perhaps was not an optimal expresser of AAL-2. If a JM109
clone selected had been an efficient expresser of AAL-2 it would have displayed an
intense 42Kda band which would not have been masked by other contaminant proteins
As a result of the previous 15% SDS-Page gel it was decided reevaluate the 250mM
collections along with the unbound and elution washes to conclusively ascertain were
AAL-2 had been fractionated during the purification process.
Figure 13 15% SDS-Page Gel
evaluating the filter Lysate of
JM109 clone. Lane 5 loaded with
AAL-2 reference sample. Lane 9
contains filtered lysate sample.
Lane 2 contains a RunBlue
Expeodeon prestained 7.6Kda -
195Kda Ladder.
Figure 14 15% SDS Page
Comassie Blue stained gel
containing filtrate unbound and
wash steps. Unbound (Lane 13),
imidazole washes steps (Lanes1, 2
and 14) and elution fractions
(Lanes 2-11). Ladder used was a
RunBlue Expeodeon prestained
7.6Kda - 195Kda Ladder.
Figure 14 displays the second
troubleshooting 15 % SDS-PAGE gel produced with all fractions loaded in lanes (2-
11), excluding lane 10. No AAL-2 was detected in any of 250mM washes as inferred
by the absence of band of 42Kda. Lane 13 containing unbound wash shows the
collection of proteins that did not complex with the nickel column. There is a low
intensity band corresponding to 42Kda present in unbound wash suggests the JM109
29
clone is producing AAL-2 however it is not interacting with column efficiently.
Possibilities which may have contributed to include
1. Proteolytic cleavage of the histag during fermentation or purification.
2. The target protein could be found in inclusion bodies which didn’t permit
complexation with IMAC column.
3. Air bubbles within the column impeded gravity flow of the fractions and
washes limited the contact of the proteins with column.
4. The proteins were folded state which did not allow the AAL-2 to interact with
the column.
As shown in gel on the 20mM elution was the only step which showed any indication
of the presence of protein. This was as expected as the purpose of imidazole wash
gradient wash was to elute any unwanted histine rich contaminating proteins from the
IMAC column. Overall the low intensity of bands found in wash and elution steps
suggest low protein expression was demonstrated by the JM109 clone. The cause for
the absence of protein could be attributed to transformant chosen not being an efficent
expressor of protein. In hindsight more colonies should been selected after
transformation process to increase the chances of obtaining a robust expressor of AAL-
2.
Another cause for the above 15% SDS gel could be attributed to applying an incorrect
temperature during 16 hour incubation period. The temperature used was 22o
c which
was not conducive in maximasing protein output. The protocol stipulates that a 30oC
incubation should have been performed as this maintains the bacteria in healthy
phsyiological whereby protein production is optimised while at the same time the
culture does not overgrow.
While the gel was electrophoresed it was observed the 30 amps being subjected gel
steadily increased. This surge in amps levels may have contributed to the
instatisfactory resolution of this molecular ladder in this gel and previous gels.
30
6.5 Troubleshooting Transfromation with KRX and JM109
In attempt to improve the likelihood of attaining AAL-2 for purification both KRX and
JM109 were transformed again in order to obtain an efficient expresser of AAL-2.
Plasmid isolation was carried out as detailed using a Sigma GenElute Plasmid
Miniprep Kit and a low amount of plasmid DNA was obtained. As a result 20ul of
plasmid DNA was used in the transformation reaction instead of 5ul as stipulated in the
protocol to enhance the chances of effective transformation. Transformation was
successfully carried in both competent KRX and JM109 strains as 3 colonies for KRX
and 5 colonies for JM109 were selected on amp positive agar plates.
6.6 Protein Expression Check of KRX and JM109 new transformants
Figure 15 15% SDS gel showing expression levels of new transforannts lanes.
JM109 (Lanes1-5), KRX transformants (Lanes 6-8) and old JM109 transformants
(Lanes 9-10). From the SDS gel KRX transformant in lane 6 was identified as the most
efficient expresser of AAL-2 as it produced the most intense band corresponding to the
MW of AAL-2. RunBlue Expeodeon prestained 7.6Kda - 195Kda Ladder loaded in
lane 5 and 12.
Each of the transformants were streaked onto separate LB agar plates before being
grown overnight at 37oc in 8ml TB. 5 transformants of new JM109, 3 transformants
from KRX and the two previously transformed JM109 strains were tested for protein
expression. The OD600 values are shown in Appendix table 23 and the samples were
normalised (Appendix Table 24) prior to loading onto SDS. The SDS-gel was
31
optimised by using making fresh preparations of 10% APS and TRIS buffers. In
addition 140 volts were applied to the gel. This reduced voltage meant the gel ran
considerably slowly and took 3 hours for the run to be completed. These changes gave
fruitful results and as shown in Figure 16 KRX clone in lane 6 displayed the greatest
levels of AAL-2 expression as indicated by in band at 42kb molecular marker.
However due to experimental error no IPTG was added to TB prior to protein
expression check therefore the production exhibited may not have been representative
of which clone was the best expresser. Instead results obtained shows which clone has
exhibits leakiest T5 promoter and highest basal expression of AAL-2. Another reason
that KRX may have produced more AAL-2 is that it could displays reduced Condon
bias.
The experiment was rerun with the addition of IPTG using 3 clones that displayed high
levels basal AAL-2 expression however the subsequent 15 % SDS gel analysis, not
shown, produced a gel which was inclusive due to unfavourable protein migration. Due
to time constraints the KRX clone which showed high expression of AAL-2 despite not
being induced by IPTG was selected for upscale culturing and IMAC purification.
6.7 IMAC Purification of KRX Clone
The 15% SDS gel shown in Figure 16 performed after IMAC purification of
KRX shows no bands corresponding to AAL-2 in any of the 250 Mm eluted fractions.
Overall the gel did not perform efficiently as shown by the poor resolution of the
molecular ladder loaded in land 6.Visualisation of bands was difficult and the only
bands that did materialise were faint high molecular weight proteins bands found in the
filtrate and unbound loaded lanes of 1 and 2. This SDS gel performance mimicked the
gel failure obtained during previous protein expression checks of KRX and JM109
transformants. A possible source of error was that the pH gradient between the
stacking and resolving gels was not maintained due to incorrect TRIS buffer
preparation. Another error that could have caused this result was that the OD600 of
KRX was 0.389 when induced with IPTG which is not optimal and therefore did not
express sufficient amounts of the protein of interest. Due to time limitations IMAC
purification was not repeated and no AAL-2 protein collected for further ELLA
characterisation.
32
Figure 16 Failed 15% SDS-PAGE gel contain KRX derived IMAC purified
protein samples. Filtered lysate (Lane 2) unbound fraction (Lane 3), Imidazole
Washes 20-80 Mm (Lanes 4-6) and eluted fraction Lanes (8-13). MW is in (Lane 7)
Ladder used was a RunBlue Expeodeon prestained 7.6Kda - 195Kda Ladder.
7.0 Future Perspectives
The first recommendation one could explore is the use of precast SDS-PAGE gels to
firmly confirm that the lack of AAL-2 production was attributed to the identification of
a poor AAL-2 expresser rather than gel failure(Schagger 2006). Other techniques that
could identify AAL-2 more proficiently include using SDS-PAGE in conjunction with
silver staining and western blotting analysis. Silver staining is a more sensitive staining
while Anti-HisTag antibodies could be used to recognize AAL-2 from a protein lysate
for western blot analysis.(Mahmood & Yang 2012). One could use a gene reporter
such as Green Fluorescent Protein (GFP) to track the location of AAL-2 during a
purification process. The pQE-30 vector harbouring AAL-2 could be reengineered to
have AAL-2 expression under the control of a T7 promoter Bacteriophage. Both
JM109 and KRX contain T7 RNA polymerase in their respective genotypes and this
could enhance protein production of AAL-2. Additionally same E.coli strain which
Jang et al used as also processes a T7 promoter. The use of multiple chromatography
steps such as ion exchange and affinity chromatography prior to IMAC
chromatography could fractionate the protein lysate further and yield purer AAL-
2(Anon 2006; Durham 2005). The final avenue
33
8.0 Conclusion
In this study one successfully introduced two mutations by site directed
mutagenesis into two hypnotised carbohydrate binding sites of AAL-2 for GlcNac. It
was envisioned that alanine mapping would reduce the binding of AAL-2 to GlcNac
thus proving that that specific amino acids are implicated in the interaction between
AAL-2 and N-GlcNac residues. While one did effectively identify clones with
sufficient levels of basal AAL-2 expression, the identification of clone with adequate
IPTG protein expression were not attained. This failure to obtain an expresser of AAL-
2 coupled with issues with SDS gel analysis did not facilitate IMAC chromatography
purification. Ultimately no protein could be fractionated and therefore characterisation
using ELLA analysis of the binding of mutated AAL-2 with GlcNac was not
performed. In conclusion this project has identified several issues with AAL-2 protein
expression and purification, solved problems associated DNA visualisation using
agarose gel electrophoresis and has provided some suggests which can enhance the
experimental process. Ultimately the outcome of this project can be deemed
bittersweet while the evaluation of AAL-2 binding with GlcNac was achieved overall
this FYP has been personally awarding experience and was provides a solid foundation
for the characterisation AAL-2 in the future.
9.0 Acknowledgements
I would like to sincerely thank my supervisor Dr. Brendan O’Connor for all his
help, support and patience throughout my final year project. I would also like to thank
PhDs students John Cawley and Donal Monaghan for their daily guidance in the lab
and showing me that maintaining a positive attitude in a research environment is a
valuable skill.
34
9.0 References
Ambrosi, M., Cameron, N.R. & Davis, B.G., 2005. Lectins: tools for the molecular
understanding of the glycocode. Organic & biomolecular chemistry, 3(9),
pp.1593–608. Available at: http://www.ncbi.nlm.nih.gov/pubmed/15858635.
Anon, 2006. Gel-filtration chromatography. Nat Meth, 3(5), pp.411–412. Available at:
http://dx.doi.org/10.1038/nmeth0506-411.
Cioci, G. et al., 2006. Beta-propeller crystal structure of Psathyrella velutina lectin: an
integrin-like fungal protein interacting with monosaccharides and calcium.
Journal of molecular biology, 357(5), pp.1575–91. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/16497330 [Accessed April 23, 2015].
Durham, D., 2005. Isolation by Ion-Exchange Methods. In S. Sarker, Z. Latif, & A.
Gray, eds. Natural Products Isolation SE - 6. Methods in Biotechnology.
Humana Press, pp. 159–183. Available at: http://dx.doi.org/10.1385/1-59259-955-
9:159.
Jiang, S. et al., 2012. A novel lectin from Agrocybe aegerita shows high binding
selectivity for terminal N-acetylglucosamine. The Biochemical journal, 443(2),
pp.369–78. Available at:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3316157&tool=pmce
ntrez&rendertype=abstract [Accessed April 20, 2015].
Larragy, R., 2011. The cloning, expression and characterisation of bacterial chitin-
binding proteins from Pseudomonas aeruginosa, Serratia marcescens,
Photorhabdus luminescens and Photorhabdus asymbiotica. DCU.
Mahmood, T. & Yang, P.-C., 2012. Western Blot: Technique, Theory, and Trouble
Shooting. North American Journal of Medical Sciences, 4(9), pp.429–434.
Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3456489/.
Moremen, K.W., Tiemeyer, M. & Nairn, A. V, 2012. Vertebrate protein glycosylation:
diversity, synthesis and function. Nature reviews. Molecular cell biology, 13(7),
pp.448–62. Available at:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3934011&tool=pmce
ntrez&rendertype=abstract [Accessed July 11, 2014].
Ohtsubo, K. & Marth, J.D., 2006. Glycosylation in cellular mechanisms of health and
disease. Cell, 126(5), pp.855–67. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/16959566 [Accessed July 10, 2014].
Ren, X. et al., 2013. Crystallization and preliminary crystallographic studies of AAL-2,
a novel lectin from Agrocybe aegerita that binds nonreducing terminal N-
acetylglucosamine. Acta crystallographica. Section F, Structural biology and
35
crystallization communications, 69(Pt 6), pp.650–2. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/23722844 [Accessed April 23, 2015].
Schagger, H., 2006. Tricine-SDS-PAGE. Nat. Protocols, 1(1), pp.16–22. Available at:
http://dx.doi.org/10.1038/nprot.2006.4.
Thompson, R. et al., 2011. Optimization of the enzyme-linked lectin assay for
enhanced glycoprotein and glycoconjugate analysis. Analytical biochemistry,
413(2), pp.114–22. Available at: http://www.ncbi.nlm.nih.gov/pubmed/21320462
[Accessed April 23, 2015].
Varrot, A., Basheer, S.M. & Imberty, A., 2013. Fungal lectins: structure, function and
potential applications. Current opinion in structural biology, 23(5), pp.678–85.
Available at: http://www.ncbi.nlm.nih.gov/pubmed/23920351 [Accessed April 20,
2015].
36
10.0 Appendix
(Figure 17)
Selected Features of Quiagen pqE30
ATG - Protein Translation Start Site
CAT CAC CAT CAC CAT CAC - His BamH1Tag Methionine
GGA TCC - BamH1 Restriction Site
TAA- Methionine Stop Condon
AAG CTT – HindIII Restriction Site
GCT GGT GGT - Mutation Site One
GGT GGT TGG – Mutation Site Two
AAL-2 IN PLASMID PQE30
CTC GAG AAA TCA TAA AAA ATT TAT TTG CTT TGT GAG CGG ATA ACA ATT
ATA ATA GAT TCA ATT GTG AGC GGA TAA CAA TTT CAC ACA GAA TTC ATT
AAA GAG GAG AAA TTA ACT ATG AGA GGA TCG CAT CAC CAT CAC CAT CAC
GGA TCC ATG ACC TCT AAC GTT ATC ACC CAG GAC CTG CCG ATC CCG GTT GCT TCT CGT GGT TTC GCT GAC ATC GTT GGT TTC GGT CTG GAC GGT GTT
GTT ATC GGT CGT AAC GCT GTT AAC CTG CAG CCG TTC CTG GCT GTT AAA
AAC TTC GCT CAG AAC GCT GGT GGT TGG CTG ACC ACC AAA CAC GTT CGT
CTG ATC GCT GAC ACC ACC GGT ACC GGT AAA GGT GAC ATC GTT GGT TTC
GGT AAC GCT GGT GTT TAC GTT TCT GTT AAC AAC GGT AAA AAC ACC TTC
GCT GAC CCG CCG AAA ATG GTT ATC GCT AAC TTC GGT TAC GAC GCT GGT
GGT TGG CGT GTT GAA AAA CAC CTG CGT TAC CTG GCT GAC ATC CGT AAA
ATC GGT CGT GCT GAC ATC ATC GGT TTC GGT GAA AAA GGT GTT CTG GTT
TCT CGT AAC AAC GGT GGT CTG AAC TTC GGT CCG GCT ACC CTG GTT CTG
AAA GAC TTC GGT TAC GAC GCT GGT GGT TGG CGT CTG GAC CGT CAC CTG
CGT TTC CTG GCT GAC GTT ACC GGT AAC GGT CAC CTG GAC ATC GTT GGT
TTC GGT GAC AAA CAC GTT TTC ATC TCT CGT AAC AAC GGT GAC GGT ACC
TTC GCT CCG GCT AAA TCT GTT ATC GAC AAC TTC TGC ATC GAC GCT GGT
GGT TGG AAA ATC GGT GAC CAC CCG CGT TTC GTT GCT GAC CTG ACC GGT
GAC GGT ACC GCT GAC ATC ATC GGT TGC GGT AAA GCT GGT TGC TGG GTT
GCT CTG AAC AAC GGT GGT GGT GTT TTC GGT CAG GTT AAA CTG GTT ATC
AAC GAC TTC GGT ACC GAC AAA GGT TGG CAG GCT GCT AAA CAC CCG CGT
TTC ATC GCT GAC CTG ACC GGT AAC GGT CGT GGT GAC GTT GTT GGT TTC
GGT AAC GCT GGT GTT TAC GTT GCT CTG AAC AAC GGT GAC GGT ACC TTC
CAG TCT GCT AAA CTG GTT CTG AAA GAC TTC GGT GTT CAG CAG GGT TGG
ACC GTT TCT AAA CAC CGT CGT TTC GTT GTT GAC CTG ACC GGT GAC GGT
TGC GCT GAC ATC ATC GGT TTC GGT GAA AAA GAA ACC CTG GTT TCT TAC
AAC GAC GGT AAA GGT AAC TTC GGT CCG GTT AAA GCT CTG ACC AAC GAC
TTC TCT TTC TCT GGT GGT AAA TGG GCT CCG GAA ACC ACC GTT TGC TGG
ATG GCT AAC CTG GAC TCT TCT CGT CAC TAA AAG CTT AAT TAG CTG AGC
TTG GAC TCC TGT TGA TAG ATC CAG TAA TGA CCT CAG AAC TCC ATC TGG
ATT TGT TCA GAA CGC TCG GTT GCC GCC GGG CGT TTT TTA TTG GTG AGA
ATC CAA GCT AGC TTG GCG AGA TTT TCA GGA GCT AAG GAA GCT AAA ATG
GAG AAA AAA ATC ACT GGA TAT ACC ACC GTT GAT ATA TCC CAA TGG CAT
CGT AAA GAA CAT TTT GAG GCA TTT CAG TCA GTT GCT CAA TGT ACC TAT
37
AAC CAG ACC GTT CAG CTG GAT ATT ACG GCC TTT TTA AAG ACC GTA AAG
AAA AAT AAG CAC AAG TTT TAT CCG GCC TT
Figure 18 Blast sequence alignment of amino acid sequence of AAL-2 and PVL.
As indicated the sequences are 60 % identical. The boxed regions indicate the N-
GlcNac binding motifs of the proteins. The Red boxes are the sites that were targeted
for site directed mutagenesis First Red box mutation Site1.Second red box mutation
site 2
Figure 19 Blast alignment of pQE-30 translated reverse read and AAL-2. This
alignment confirmed the presence of PQE30 in a JM109 transformant. No mutation
indicated as sequence read of AAL-2 stopped 45 amino acids from mutation site.
Calculations for Protein Expression analysis Table 21 Sample Preparation for Transformants JM109 and KRX
Clone OD (600nm) D.Factor (1:5) Sample (ul) dH20
JM109 0.548 2.74 76 4
KRX 0.521 2.605 80 0
38
Table 22 Calculations Normalization of Loaded JM109 and KRX
Table 23 Sample Preparation for Troubleshoot JM109 and KRX Transformants
Clone Type OD (660nm) D. Factor (1:5) Sample (ul) dH20 (ul)
JM109 0.602 3.01 70 10
JM109 0.538 2.69 78 2
JM109 0.524 2.62 80 0
JM109 0.566 2.83 74 6
KRX 1 0.655 3.275 64 16
KRX 2 0.544 2.72 77 3
JM109 0.7 3.5 60 20
JM109 0.65 3.25 64 16
KRX 3 0.621 3.105 67 13
Table 24 Normalization of Loaded Troubleshoot JM109 and KRX samples
Table 25 Sample Preparation for induced JM109 and KRX Troubleshoot Transformants
Transformant OD Value Dilution Factor (1:5) Sample Volume (ul) dH20 (ul)
JM109 3 0.501 2.505 84 21
JM109 4 0.405 2.025 104 1
KRX 6 0.399 1.995 105 0
Table 26Normalisation JM109 and KRX Troubleshoot IPTG induced samples
Sample Normalization Calculations
Steps KRX 6 JM109 Trans 4
Dilution Factor (0.399) X 5 =1.995 (0.501 X 5 =2.50
Formula (0.7/2.0) X 300 (0.7 /2.50) X 300
Sample (ul) 105 ul 104 ul
Water (ul) 105 ul - 105 ul = 0 ul 105 -104 = 1 ul
Total Volume (ul) 105 ul + 0 ul = 105 ul 104 ul + 1ul = 105 ul
Clone JM109 Tranformant 3 JM109 Tranformant 2
Dilution Factor (0.524) X 5 = 2.62 (0.538) X 5 =2.69
Formula (0.7/2.62) X 300 (0.7 /2.69) X 300
Sample ul 80.15ul Sample Loaded 78.06 Sample Loaded
Water ul 80.15 -80.15 = 0 ul 80.15- 78.06 = 2.08 ul
Total Volume ul 80.15ul + 0 ul = 80.15ul 78.06 + 2.08 ul = 80.15ul
Clone JM109 Tranformant 3 JM109 Tranformant 2
Dilution Factor (0.524) X 5 = 2.62 (0.538) X 5 =2.69
Formula (0.7/2.62) X 300 (0.7 /2.69) X 300
Sample ul 80.15ul Sample Loaded 78.06 Sample Loaded
Water ul 80.15 -80.15 = 0 ul 80.15- 78.06 = 2.08 ul
Total Volume ul 80.15ul + 0 ul = 80.15ul 78.06 + 2.08 ul = 80.15ul