NRF2IntensiﬁesHostDefenseSystemstoPrevent Lung ... · length (mm) width (mm) height (mm) 0.5 (22). Quantitative RT-PCR Total RNA was extracted from the tissues using ISOGEN (Nippon

Tumor and Stem Cell Biology

NRF2 Intensifies Host Defense Systems to PreventLung Carcinogenesis, but After Tumor InitiationAccelerates Malignant Cell GrowthHironori Satoh1,2, Takashi Moriguchi1, Daisuke Saigusa3, Liam Baird1, Lei Yu1,Hirofumi Rokutan2, Keiko Igarashi2, Masahito Ebina4, Tatsuhiro Shibata2,and Masayuki Yamamoto1

Abstract

Nrf2 activation promotes resistance to chemical carcinogenesisin animal models, but activating mutations in Nrf2 also confermalignant characters to human cells by activating antioxidative/detoxifying enzymes andmetabolic reprogramming. In this study,we examined how these contradictory activities of Nrf2, cancerchemoprevention and cancer cell growth enhancement, can bereconciled in an established mouse model of urethane-inducedlung carcinogenesis. Using Keap1-knockdown (kd) mice, whichexpress high levels of Nrf2, we found that urethane was rapidlyexcreted into the urine, consistent with an upregulation in theexpression of urethane detoxification genes. Consequently, ure-thane-induced tumorswere significantly smaller and less frequentin Keap1-kd mice than in wild-type mice. In contrast, tumor cells

derived from Keap1-kd mice and transplanted into nude miceexhibited higher tumorigenicity comparedwith cells derived fromwild-type mice. To identify the factors contributing to the tumorgrowth phenotype in the transplantation model, we performed amicroarray analysis and found that many antioxidative stressgenes were upregulated in the Keap1-kd–derived tumors. There-fore, we suggest that Nrf2 activation in cancer cells enhances theirtumorigenicity, but global Nrf2 activation, as in Keap1-kd mice,simultaneously enhances anticancer immunity, thereby suppres-sing the growth potential of Keap1-kd tumors. Our findingsprovide relevant insight into the dual role of Nrf2 in cancer andwarrant further studies of Nrf2 function during different stages ofcarcinogenesis. Cancer Res; 76(10); 3088–96. �2016 AACR.

IntroductionThe transcription factor Nrf2 plays important roles in the

protective response against environmental stresses, particularlyagainst oxidative and electrophilic insults (1, 2). In unstressedconditions, Nrf2 is bound by Keap1 and subjected to degradationthrough the ubiquitin–proteasome pathway. Upon exposure tooxidative or electrophilic stresses, reactive cysteine residues ofKeap1 are chemically modified. Thereafter, the Keap1-mediateddegradation of Nrf2 is eliminated, leading to Nrf2 accumulationin thenucleus. Subsequently,Nrf2dimerizeswithoneof the smallMaf proteins (sMaf) and binds to the specific DNA sequencereferred to as antioxidant/electrophile response element, throughwhich a variety of target genes, such as NAD(P)H quinone oxido-

reductase (Nqo1), heme oxygenase 1 (Ho-1), and glutamate-cysteineligase catalytic subunit (Gclc), are induced. These cytoprotectiveenzymes contribute to the cellular protection against oxidativeand electrophilic insults.

Urethane (ethyl carbamate) is a prototypic carcinogen thatinduces lung adenoma and adenocarcinoma (3). Upon admin-istration of urethane tomice, adenomas oftendevelop in the lung,which later give rise to adenocarcinomas (4). Cytochrome P4502E1 (Cyp2e1)-mediated oxidization converts urethane intovinyl carbamate epoxide (VCE), which serves as a potent carcin-ogen by inducing DNA- and protein–adduct formation (5). VCEis converted into 1, 2-dihydroxyethyl carbamate by microsomalepoxide hydrolase (mEH), and subsequently the product is sub-jected to Gstp1/p2–mediated glutathione conjugation. There-after, the conjugate is excreted into the urine (6). As the mEHand Gstp1/p2 genes are targets of NRF2 (1, 7, 8), the detoxifica-tion pathway of urethane appears to be under the influence ofNrf2 activity. Many studies have demonstrated thatNrf2-deficientmice are susceptible to a variety of carcinogens (9–12). In contrast,Nrf2 activation in cancer cells has also been shown to contributeto the promotion of tumor growth in many forms of cancer(13, 14). These two rather contradictory aspects of Nrf2 functionhave been referred to as the "Double-Edged Sword of Nrf2"(15, 16). We have previously demonstrated that Nrf2 activityexhibits bidirectional stage-specific effects in urethane-inducedlung carcinogenesis (17). Specifically, Nrf2-deficient mice exhib-ited more abundant microtumor nodules than wild-type miceat early stages (4–8 weeks) after urethane administration. Incontrast, in the later stages (16 weeks after urethane treatment),wild-type mice showed large, malignant lung tumors with

1Department of Medical Biochemistry, Graduate School of Medicine,Tohoku University, Sendai, Japan. 2Division of Cancer Genomics,National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan.3Department of Integrative Genomics, Tohoku Medical Megabank,Tohoku University, Aoba-ku, Sendai, Japan. 4Department of Respira-tory Medicine, Pulmonary Center, Tohoku Pharmaceutical UniversityHospital, Miyagino-ku, Sendai, Japan.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Authors: Masayuki Yamamoto, Tohoku University GraduateSchool of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575, Japan. Phone:812-2717-8084; Fax: 812-2717-8090; E-mail: [email protected];and Takashi Moriguchi, [email protected]

doi: 10.1158/0008-5472.CAN-15-1584

�2016 American Association for Cancer Research.

CancerResearch

Cancer Res; 76(10) May 15, 20163088

on April 20, 2020. © 2016 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 28, 2016; DOI: 10.1158/0008-5472.CAN-15-1584

http://cancerres.aacrjournals.org/

increased Nrf2 accumulation, whereas Nrf2-deficient mice rarelydeveloped suchmalignant cancers (17). These results indicate thatNrf2 prevents cancer initiation in the early stages, whereas Nrf2accelerates cancer progression in the advanced stages of urethane-induced lung carcinogenesis.

Given the above results from the Nrf2-deficient mice, wenext wanted to address whether constitutive Nrf2 activationaffects cancer incidence and malignancy. To this end, we explo-ited Keap1-knockdown (Keap1-kd) mice that show constitutiveNrf2 accumulation due to a systemic decrease in Keap1 expres-sion (18). The Keap1-kd mice survive to adulthood and exhibitresistance against oxidative and electrophilic insults (19, 20).Therefore, the Keap1-kd mice serve as an excellent model ofgenetic Nrf2 induction.

Considering that Nrf2-deficient mice show increased suscepti-bility to urethane and develop many micronodules in the earlystage (17), we hypothesized that Keap1-kd mice could be resis-tant against urethane-induced lung carcinogenesis, due to theconstitutive activation of stress-responsive genes. To address thishypothesis, we utilized the urethane carcinogenesis model inKeap1-kd mice. We found that the Keap1-kd mice developed asignificantly lower number of urethane-induced lung tumors thanthewild-typemice. In contrast, when transplanted into nudemice,the Keap1-kd mice–derived tumor cells showed more vigorousgrowth than thewild-typemice–derived tumor cells. These resultsdemonstrate that systemic activation of Nrf2 prevents urethane-induced lung carcinogenesis, whereas Nrf2 activation conferstumorigenicity on the cancer cells.

Materials and MethodsExperimental animals

Keap1-kd mice (5–9 weeks) and age-matched Keap1-wt micewith ICR genetic background were used (18, 21). The mice weremaintained in a facility free of specific pathogens.Nudemice (8–9weeks) were purchased from CLEA Japan. We mainly used malemice in this study to exclude gender biases. All animal experi-ments were performed under the approval of the Tohoku Uni-versity Animal Care Committee.

Transplantation of tumors into nude miceUrethane-induced lung tumors of approximately equal sizes

(f ¼ 0.5–1.5 mm) from Keap1-kd and Keap1-wt mice were trans-planted subcutaneously into the backs of nude mice. The tumordiameters were measured each month using a digital caliper. Thetumor volumes were calculated using the following formula:length (mm) � width (mm) � height (mm) � 0.5 (22).

Quantitative RT-PCRTotal RNA was extracted from the tissues using ISOGEN

(Nippon Gene). First-strand cDNA was synthesized from thetotal RNA using random hexamers and Superscript III Reverse-Transcriptase (Invitrogen). Real-time RT-PCR was performedusing 2X SYBR Green PCR Master Mix (Invitrogen) and the ABIPRISM 7300 sequence detector system (PE-Applied Biosystems).Sequences of primers and TaqMan probes were described pre-viously (17). Following primers were newly prepared; Ppargc1a:forward ACAGCTTTCTGGGTGGATTG, reverse TCTGTGAGAA-CCGCTAGCAA. Catalase: forward GCTTCAAGTTGGTTAATGC-AG, reverse GGCAATTTTTGATGCCCTGG, and TaqMan probeAGAGGCAGTCTATTGCAAG.

Urethane-induced lung carcinogenesis experimentsUrethane (ethyl carbamate; 1 g/kg body weight) was intraper-

itoneally administered. At 8 weeks, 16 weeks, and 8 months afterthe administration, the mice were euthanized. The lungs weredissected and the total number of lung surface tumors wascounted macroscopically. The diameter of the tumors was mea-sured using an electronic caliper.

Gene expression analysisSurface lung tumors were dissected, and surrounding tissues

were carefully removed under a stereoscopic microscope. Tu-mors and nontumor tissues in lungs of urethane-administeredmouse were pooled and subjected to a whole-mouse genomemicroarray analysis (4 � 44 k; Agilent Technologies). Expres-sion array data were analyzed with GeneSpring software (Sil-icon Genetics). Heatmaps were generated utilizing Cluster 3.0(http://bonsai.hgc.jp/~mdehoon/software/cluster/) and JAVATreeview 159 (http://jtreeview.sourceforge.net/). The classifica-tions of the selected genes according to their biologic andtoxicologic functions were performed using Ingenuity PathwayAnalysis (IPA) software (Ingenuity system). P value, representedas the negative log ratio of the IPA results, is calculated by theFisher exact test.

Statistical analysesThe data are described as the mean � SD. The statistical

significance in differences was calculated by the Student t test orthe Mann–Whitney U test. The values for the incidence oflung tumors were analyzed with the Fisher exact probabilitytest. P values < 0.05 were considered significant.

ResultsKeap1-kd mice express Nrf2 and its target genes at high levels

Urethane acquires carcinogenic activity through conversioninto the electrophilic metabolite, vinyl carbamate epoxide(VCE; Fig. 1A). We previously found that intraperitonealinjection of urethane (1 g/kg body weight) increased Nrf2protein level and expression of Nrf2 target genes in the lungof Keap1-wt mice (17). It has previously been shown thatKeap1-kd mice are highly resistant to the damaging effects ofoxidants due to the high expression level of Nrf20s cytopro-tective target genes (19, 20). In this study, we found that anumber of genes that directly participate in the detoxifica-tion of urethane, that is, Cyp2e1, mEH, Gstp1, and Gstp2, wereinduced in the lung of Keap1-kd mice compared with Keap1-wtmice (Fig. 1B). In the liver, mRNA expression of mEH andGstp2 was also higher in Keap1-kd mice when compared withKeap1-wt mice (Supplementary Fig. 1). These results indicatethat the expression of urethane detoxification genes is en-hanced in Keap1-kd mice.

The constitutive activation of the urethane detoxificationsystem in Keap1-kd mice suggests that urethane is efficientlydetoxified in Keap1-kd mice. It has previously been reportedthat urethane metabolites are mainly excreted into the urine(23). Therefore, we examined the concentration of urethaneand its metabolite in plasma and urine of Keap1-kd and Keap1-wtmice after intraperitoneal injection of urethane. We collectedplasma and urine samples one day after the injection ofurethane (1 g/kg body weight) and subjected them to LC/MS-MS analyses. A selected reaction monitoring (SRM)

Genetic Nrf2 Activation in Chemical Lung Carcinogenesis

www.aacrjournals.org Cancer Res; 76(10) May 15, 2016 3089




chromatogram of urethane and its positive control urethane-d5 (deuterium-labeled urethane as an internal standard) inplasma are shown in Fig. 1C and a SRM chromatogram ofVCE and urethane-d5 in urine are shown in Fig. 1D.

The urethane level in the plasma was significantlylower in Keap1-kd mice compared with Keap1-wt mice oneday after the urethane injection (Fig. 1E). Similarly, thelevel of VCE in the urine was also lower in the Keap1-kdmice than in the Keap1-wt mice (Fig. 1F). These resultsindicate that urethane and its metabolite VCE is efficientlydetoxified and excreted by Keap1-kd mice, presumably byvirtue of the enhanced activity of the urethane detoxifi-cation pathway.

Keap1-kd mice are resistant against urethane-inducedtumorigenesis

To address the question of whether the susceptibility to ure-thane is altered in Keap1-kd mice, we applied the urethane-induced carcinogenesis methodology to the Keap1-kd andKeap1-wt mice. We analyzed the effects of urethane treatmentunder four different experimental conditions: short-term obser-vation (8 weeks), mid-term observation (16 weeks), long-termobservation (8 months), and long-term observation (8 months)with multiple administrations of urethane.

We found that in the short-term observation after a singleurethane administration, 100.0% (4/4) of the urethane-treatedKeap1-wt mice developed macroscopic (f > 0.5 mm) lung

Figure 1.Urethane metabolism in Keap1-kd mice. A, bioactivationand detoxification pathway of urethane (ethylcarbamate). B, RT-qPCR analysis of urethanedetoxification enzymes in the lung of Keap1-wt-mice andKeap1-kd-mice. mRNA abundance is normalized withb-actin level. SRM chromatogram of urethane or VCEwithurethane-d5 (deuterium-labeled urethane as an internalstandard) as a control in plasma (C) and urine (D).Quantification of plasma urethane (E) and urinary VCE (F)by LC-/MS-MS in the Keap1-wt-mice and Keap1-kd-miceafter vehicle (V) or urethane (U) treatment is depicted.Plasma urethane level and urinary VCE level are bothlower in the Keap1-kdmice than in the Keap1-wtmice. Thedata are presented as the mean � SD. The significantdifferences determined by Student t test are indicated(� , P < 0.05; �� , P < 0.01; n ¼ 4 in each group).

Satoh et al.

Cancer Res; 76(10) May 15, 2016 Cancer Research3090




surface tumors, compared with only 20% (2/10) of theKeap1-kd mice (f > 0.5 mm; Fig. 2A and B; Table 1A). Thisresult suggests that the induction of Nrf2 in Keap1-kd miceprevents urethane-induced lung tumorigenesis during theearly phase.

We extended the observation time and examined the totalnumber and diameter of lung surface tumors 16 weeks afterurethane administration. The total number of lung surfacetumors (f > 1.0 mm) per mouse was significantly increasedduring this extended period in the Keap1-wt mice (Fig. 2C andD; Table 1B). There also exists the possibility that Keap1-kdtumor cells may grow vigorously during the later stages of theurethane-induced tumorigenesis, as Nrf2 shows potent onco-genic activity in many types of human cancers (13, 22). Toexamine this possibility, we extended the observation term

again and examined the total number and diameter of ure-thane-induced tumors 8 months after a single administrationof urethane. The total number of surface tumors (f > 1.0 mm)per mouse was significantly increased in the Keap1-wt mice at 8months (Fig. 3A and B; Table 1C). In contrast, the numbers ofsurface tumors did not significantly increase in the Keap1-kdmice even at this late time point (Fig. 3A and B; Table 1C). Bydetermining the average diameter of all of the tumors in bothgenotypes, we found that Keap1-kd mice also developed muchsmaller tumors when compared with the Keap1-wt mice(Fig. 3C). These results indicate that constitutive induction ofNrf2 through the knockdown of Keap1 expression stronglyrestricts the growth of urethane-induced lung tumors.

To examine whether an increased amount of urethane and itsmetabolites could increase urethane-mediated tumorigenesisin Keap1-kd mice, we conducted a tumorigenesis experimentusing multiple injections of urethane. Both Keap1-kd and Keap1-wtmice were injected weekly with urethane for four consecutiveweeks, subsequently the mice were examined 8 months afterthe first urethane administration (Fig. 3D). Surprisingly, theinitiation of tumorigenesis was not dramatically enhanced bythis treatment, and the number of surface tumors was stillsignificantly lower in Keap1-kd mice than in Keap1-wt mice(Fig. 3E; Table 1D). Interestingly, using this experimental pro-cedure, the diameter of Keap1-kd tumors became similar to thatof Keap1-wt mice (Fig. 3F). In addition, Keap1-kd tumors con-tained an increased number of Ki67-positive cells comparedwith similar sized Keap1-wt tumors (top panels in the Supple-mentary Fig. S2A), whereas the tumor bearing Keap1-kd lungtissue harbored a higher number of infiltrating inflammatorycells than the Keap1-wt lung (bottom panels in the Supplemen-tary Fig. S2B). These results indicate that the Keap1-kd tumorshave a high tumorigenic potential, but the increased numberof inflammatory cells might attenuate the tumor growth in theKeap1-kd lung tissue.

Cancer-resistant host microenvironment is activated in Keap1-kd mice

We previously found that systemic Nrf2 activation in Keap1-kdmice generates a cancer-resistant host immune environmentby attenuating the activity of myeloid-derived suppressor cells(MDSC), a potent cancer immunosurveillance cell type (24).Intracellular accumulation of reactive oxygen species (ROS)in MDSCs (ROS-in-MDSC) leads to the suppression of CD8þ

T-cell–mediated cancer immunity, hence the ROS levelserves as a good indicator of MDSCs activity (24, 25). There-fore, we hypothesized that an increase in Nrf2 activity willdecrease the ROS-in-MDSCs level in tumor-bearing Keap1-kdmice, thereby attenuating the activity of MDSCs, leading to thegeneration of a cancer-resistant host immune environment inKeap1-kd mice.

To test this hypothesis, we conducted tumor cell transplan-tation studies into immunodeficient nude mice, a gold stan-dard experiment to evaluate the tumorigenicity of cancer cellswithout the influence of host-environment interactions (26).We dissected lung tumors of approximately equal sizes (f ¼0.5–1.5 mm) from the Keap1-wt and Keap1-kd mice 8 monthsafter a single urethane administration, transplanted them intonude mice, and evaluated their tumorigenicity. Notably, duringthe 5-month observation period, tumor cells from Keap1-kdmice grew much more aggressively than tumor cells from

Figure 2.Short-term and mid-term urethane-induced lung carcinogenesis. A,mouse lungs were examined at 8 weeks after urethane administration.Representative gross observations of surface lung tumors in Keap1-wt andKeap1-kd mice (top). Arrowhead, the surface tumor. Scale bar, 5 mm.Representative hematoxylin and eosin–stained sections. Scale bar, 100mm (bottom). B, number of surface lung tumors in Keap1-wt (n ¼ 4) andKeap1-kd (n ¼ 10) mice. Each dot represents total number of macroscopictumors (f > 0.5 mm) in an individual mouse. The color of the dotsindicates the size of the largest tumor in each mouse lung. C,representative hematoxylin and eosin–stained sections in Keap1-wt andKeap1-kd-mice at 16 weeks. Scale bar, 100 mm. D, numbers of surfacetumors (f > 1.0 mm) in Keap1-wt (n ¼ 4) and Keap1-kd (n ¼ 6) mice. Dataare presented as the mean � SD. The significant differences by Studentt test are indicated (�� , P < 0.01).






Keap1-wt mice. Representative tumors taken from the back ofnude mice are shown in Fig. 4A, and the sizes of the tumorsmeasured every month are depicted in Fig. 4B. These resultsindicate that the tumor cells derived from Keap1-kd mice aremore highly proliferative compared with those from the wild-type mice when transplanted into an immunodeficient hostenvironment.

Expression profile of cancer-related genes in Keap1-kd tumorcells

To explore the mechanisms underlying the enhancedgrowth of Keap1-kd cancer cells in nude mice, we conductedexpression microarray analysis and compared the gene expres-sion profile between Keap1-kd and Keap1-wt tumor cells. Forthis purpose, we extracted total RNA from tumors and non-cancerous normal tissue from both Keap1-kd and Keap1-wtmice 8 months after a single administration of urethane. Weselected genes that were induced more than 2-fold in thetumors relative to normal lung tissue in both genotypes ofmice and subjected the expression array data to IPA to identifyenriched gene ontology terms. From this analysis, the gene setannotated as "cancer-related genes" was identified and sepa-rated into three groups depending on whether they werecommonly or differentially expressed between Keap1-kd andKeap1-wt tumors (depicted in the Venn diagram; Fig. 5A). A setof 566 genes were found to be commonly upregulated in boththe Keap1-kd and Keap1-wt cancer tissues, including genes thatregulate lung development, such as Sox9, Id2, and Foxa2 (datanot shown). These three genes have previously been shown toparticipate in lung cancer progression under the regulation ofNrf2 (17).

A distinct set of 489 genes was exclusively upregulated inthe Keap1-kd tumors. Employing IPA analysis, we identified20 downstream genes responsible for the enhanced growthof Keap1-kd tumors and confirmed their differential expres-sion patterns between the Keap1-wt and the Keap1-kd tumors(Fig. 5B). Most of the genes encode antioxidant and detoxi-fication enzymes, which are well-known downstream targetgenes of Nrf2 (Supplementary Table S1; refs. 27–31). Of the20 genes, Glutathione peroxidase 2 (Gpx2), Catalase (Cat),Ppargc1A, Glutathione-S-transferase a4 (Gsta4), and Glutathionereductase (Gsr) were found to be highly expressed in the Keap1-kd cancers in comparison with the Keap1-wt cancers (pink dotsin Fig. 5B), and all five of these genes have been reported tocontribute to cancer cell proliferation through eliminatingcellular ROS level (32–35). We confirmed this change in geneexpression by means of manual quantitative RT-PCR (Fig.5C). In addition, we noticed an increase in Multidrug resistanceprotein 3 (Mrp3) expression, which contributes to cellularmultidrug resistance (36). These results suggest that theKeap1-kd cancer cells retain higher level of drug resistancethan do the Keap1-wt cancer cells.

However, it should be noted that the tumors in Keap1-kdmice were all small, and that the cancer cells from theKeap1-kd mice only proliferated vigorously in the micro-environment of the nude mouse. Therefore, these resultsdemonstrate that, although increased expression of antiox-idant genes contributes to the enhanced proliferation ofKeap1-kd cancer cells, the proliferation of these tumors isseverely repressed by the anticancer immunity mediated bythe global increase in Nrf2 activity in Keap1-kd mice (sum-marized in Fig. 6).

Table 1. Summary of urethane-induced lung carcinogenesis experiments

A. Short-term observation (8 weeks) after single urethane administration in Keap1-wt and Keap1-kd mice

Incidence of lung surface tumorsAverage number of lung surface tumors per

mouseTumor size (mm) f > 0.5 f > 0.5Keap1-wt (n ¼ 4) 4/4 (100.0%) 2.5 � 1.3Keap1-kd (n ¼ 10) 2/10 (20.0%)a 0.2 � 0.4a

B. Mid-term observation (16 weeks) after single urethane treatment in Keap1-wt and Keap1-kd mice


mouseTumor size (mm) f > 1.0 f > 1.0Keap1-wt (n ¼ 4) 4/4 (100.0%) 6.0 � 3.7Keap1-kd (n ¼ 6) 1/6 (16.7%)a 0.2 � 0.4a

C. Long-term observation (8 months) after single urethane treatment in Keap1-wt and Keap1-kd mice


mouseTumor size (mm) f > 1.0 f > 3.0 f > 1.0 f > 3.0Keap1-wt (n ¼ 7) 7/7 (100.0%) 7/7 (100.0%) 12.7 � 6.1 3.1 � 2.4Keap1-kd (n ¼ 8) 7/8 (87.6%) 2/8 (25.0%)a 1.8 � 1.5a 0.4 � 0.7a

D. Long-term observation (8 month) after four times urethane treatment in Keap1-wt and Keap1-kd mice


mouseTumor size (mm) f > 1.0 f > 3.0 f > 1.0 f > 3.0Keap1-wt (n ¼ 3)b 3/3 (100.0%) 3/3 (100.0%) 47.0 � 23.1 9.3 � 9.1Keap1-kd (n ¼ 7) 7/7 (100.0%) 4/7 (57.1%) 10.9 � 4.6a 1.3 � 1.4c

aP < 0.01 compared with wild-type mice.bThree of Keap1-wt mice dropped out during the experimental term.cP < 0.05 compared with wild-type mice.

Satoh et al.





DiscussionIt is widely accepted that Nrf2 attenuates toxicities of many

oncogenic compounds by inducing the expression of a series ofdetoxifying and antioxidative stress enzyme genes (1). Forexample, urethane treatment induces Nrf2 accumulation, andthe subsequent induction of detoxifying and antioxidativestress enzymes alleviates the initiation of lung cancers inwild-type mice (17). In this study, we have demonstrated thatKeap1-kd mice, which express cytoprotective enzymes at a highlevel, are significantly resistant to urethane-induced lung car-cinogenesis, indicating that the cytoprotective enzymes regu-lated by Nrf2 are crucial for the prevention of urethane-inducedcarcinogenesis. Intriguingly, while the number and size ofurethane-induced tumors was significantly decreased in theKeap1-kd mice, tumor cells derived from the Keap1-kd micegrew much more vigorously upon transplantation into nudemice than the wild-type mouse–derived cancer cells. Theseresults demonstrate that, while the Keap1-kd mouse–derivedcancer cells acquire a strong cue for malignant transformation,their proliferation ability is severely repressed by the anticancerimmunity mediated by the global increase in Nrf2 activity in

Figure 3.Long-term urethane-induced lung carcinogenesis. A,experimental protocol for one-shot urethaneadministration. Mouse lungs were examined 8 monthsafter urethane administration. Representative grossobservations of surface lung tumors in Keap1-wt andKeap1-kd-mice are depicted. Arrowheads, the surfacetumors. Scale bar, 10mm. Representative hematoxylin andeosin–stained sections (bottom). Scale bar, 40 mm. B,number of surface lung tumors (f > 1 mm) inKeap1-wt (n¼7) and Keap1-kd (n ¼ 8) mice. The color of the dotsindicates the size of the largest tumor in each individualmouse of both genotypes. Each dot represents the totalnumber of macroscopic tumors (f > 0.5 mm) in anindividualmouse. The color of the dots indicates the size ofthe largest tumor in each mouse lung. C, average tumordiameter in each genotype of mouse. D, experimentalprotocol for the four consecutive urethane administrationexperiment.Mouse lungs are examined8months after fourconsecutive administrations of urethane. Representativegross observations of surface lung tumors in Keap1-wt andKeap1-kd-mice. Arrowheads, the surface tumor. Scale bar,10 mm. Representative hematoxylin and eosin–stainedsections (bottom). Scale bar, 40 mm. E, number of surfacelung tumors (f > 1mm) in inKeap1-wt (n¼ 3) andKeap1-kd(n¼ 7) mice. The color of dots indicates size of the largesttumor in each individual mouse of both genotypes. Eachdot represents total number ofmacroscopic tumors (f>1.0mm) in individualmouse. The color of dots indicates size ofthe largest tumor in each mouse lung. F, average tumordiameter in each genotype of mouse. The data arepresented as themean� SD. The significant differences byStudent t test are indicated (� , P < 0.05; �� , P < 0.01).

Figure 4.Keap1-kd mice tumors transplanted into nude mice grow larger than thatof Keap1-wt mice. A, gross observations of tumors transplanted innude mice. Scale bar, 0.5 mm. Representative hematoxylin andeosin–stained sections (bottom). Scale bar, 20 mm. B, growth curve ofKeap1-wt and Keap1-kd tumors transplanted in nude mice. The dataare presented as the mean � SEM. The statistically significant differencesby Mann–Whitney unpaired U test are depicted (�, P < 0.05; n ¼ 6–8in each group).






Keap1-kd mice. Consequently, the size of the tumors is keptsmall in the Keap1-kd mice.

It has been shown that the immunosuppressive activity byMDSCs is primarily regulated by the intracellular ROS level(37) and that the Nrf2-mediated antioxidant system appears toplay a crucial role for the reduction of immunosuppressiveactivity in MDSCs (24, 38). Recently, ex vivo experiment ofbone marrow–derived macrophage using Nrf2-deficient miceshowed that Nrf2 contributes to CD8þ T-cell function byregulating g-GCS and xCT (39). We recently reported that theimmune microenvironment of Keap1-kd mice leads to resis-tance against metastasis of lung cancer cells and that activationof Nrf2 by chemical inducers reduces ROS levels in MDSCs,which in turn strengthens host immunity against metastaticcancer cells (38). We found that when Keap1-kd tumors weretransplanted into T-cell–deficient nude mice, they proliferatedvigorously, supporting the notion that Nrf2-mediatedenhancement of anticancer immunity is critically importantto regulate the cancer-resistant host microenvironment. Wewould postulate that, the genetic induction of Nrf2 by knock-down of the Keap1 gene results in reduced MDSCs activity, and

consequently a reduction in both tumor number and size inresponse to urethane-induced carcinogenesis (summarizedin Fig. 6).

To clarify the mechanisms underlying the strong proliferativeactivity of the transplanted Keap1-kd cells, we examined the geneexpression signature of the Keap1-kd tumors. Our microarrayanalysis revealed that a battery of Nrf2 downstream genes ishighly expressed in the Keap1-kd tumors. Particularly, expressionsof Gpx2, Gsr, Cat, Mrp3, Gsta2, and Ppargc1A genes, all of whichhave been reported to be regulated by Nrf2, are increased (27–31,36, 40, 41). Of these antioxidant proteins, Catalase encoded byCat is known to play a crucial role in the ROS-scavenging systemby converting hydrogen peroxide to water (31). A recent studyrevealed the contribution of Catalase to the enhancement of lungcancer malignancy by reducing ROS level (32). PPAR gammacoactivator-1a (Pgc1a), a transcriptional coactivator encoded byPpargc1A, also plays important roles in cellular protection againstROS by increasing the expression of antioxidant enzymes (27). Inaddition, Pgc1a has also been shown to be highly expressed inseveral types of epithelial cancer where it contributes to ROSscavenging (34). Given these previous reports, our current resultsindicate that constitutively activated Nrf2 in the Keap1-kd tumorcells contributes tomalignant progression by reducing ROS levelsthrough inducing the expression of multiple antioxidant genes.Similarly, treatment of tumor-bearing mice with antioxidants,such as N-acetylcysteine (NAC) and vitamin E, have been shownto reduce intracellular ROS levels and promote cancer progression

Figure 5.Identification of the gene expression signature in the Keap1-kd andKeap1-wt tumors. A, Venn diagram depicting the numbers of genesinduced more than 2-fold in tumors over nontumor lung tissues ofKeap1-wt and Keap1-kd mice. B, heat map comparisons of differentiallyexpressed genes in the lung tumors of Keap1-wt and Keap1-kd mice.Pink dots, Nrf2 target genes that contribute to cancer cell malignancy.C, qRT-PCR analyses of Nrf2 target genes. Statistical significance indifferences by Student t test is indicated (�� , P < 0.01).

Figure 6.High-level Nrf2 expression in the Keap1-kd lung cancer cells enhances thetumorigenicity through activating antioxidative stress system. Meanwhile,increased level of Nrf2 intensifies carcinogen detoxifying system andanticancer immunity in the host environment (depicted in the "HostDefense"). Balance between these two aspects of Nrf2 function is a criticaldeterminant for tumor growth. In the Keap1-kd mice, the tumor-resistantenvironment dominates the tumorigenicity of the cells, thereby diminishingtumor growth.

Satoh et al.





in experimental carcinogenesis in multiple tissues (42). Thesewide-ranging observations suggest that antioxidants may exertaccelerating effects on cancer progression at the late stages ofcarcinogenesis.

Constitutive activation of Nrf2 in Keap1-kd mice producesthe same positive effect on the proliferation of tumor cells,but as Nrf2 concomitantly activates anticancer immunity, itdoes not promote unrestricted tumor growth. Thus, ourresults show that the systemic activation of Nrf2 prior to theadministration of carcinogens prevents urethane-inducedlung carcinogenesis.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: H. Satoh, T. Moriguchi, M. YamamotoDevelopment of methodology: H. Satoh, D. SaigusaAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): H. Satoh, T. Moriguchi, D. Saigusa, L. Baird, L. Yu,T. ShibataAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): H. Satoh, T. Moriguchi, D. Saigusa, L. Baird, L. Yu,T. Shibata, M. YamamotoWriting, review, and/or revision of the manuscript: H. Satoh, T. Moriguchi,D. Saigusa, L. Baird, T. Shibata, M. Yamamoto

Administrative, technical, or material support (i.e., reporting or organiz-ing data, constructing databases): H. Satoh, L. Yu, H. Rokutan, K. Igarashi,M. Ebina, M. YamamotoStudy supervision: M. Yamamoto

AcknowledgmentsThe authors thank Dr. Yasuhito Arai, Dr. Takanori Hidaka, and Mr. Kohei

Tsuchida for the insightful advice and helpful discussions. The authors alsothank the Biomedical Research Core of Tohoku University Graduate School ofMedicine for its technical support.

Grant SupportThisworkwas supported in part byGrants-in-Aid for Scientific Research from

the Ministry of Education, Culture, Sports, Science, and Technology and theJapan Society for Promotion of Science (T. Moriguchi and M. Yamamoto),Scientific Research on Priority Areas (M. Yamamoto) and Specially PromotedResearch (M. Yamamoto). H. Satoh was supported by Research Fellowships ofJapan Society for the Promotion of Science for Young Scientists. This study wasalso supported in part by MEXT/JSPS KAKENHI (24249015 and 26111002to M. Yamamoto; 24590371 to T. Moriguchi; 25870071 and 25870071and 268771 to H. Satoh), AMED-CREST, AMED (chronic inflammation;M. Yamamoto), P-DIRECT, AMED (M. Yamamoto), and Takeda Science Foun-dation (M. Yamamoto).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received June 15, 2015; revised February 10, 2016; accepted February 26,2016; published OnlineFirst March 28, 2016.

References1. ItohK,Mimura J, YamamotoM.Discoveryof thenegative regulator ofNrf2,

Keap1: a historical overview. Antioxid Redox Signal 2010;13:1665–78.2. ItohK,Chiba T, Takahashi S, Ishii T, IgarashiK,KatohY, et al. AnNrf2/small

Maf heterodimer mediates the induction of phase II detoxifying enzymegenes through antioxidant response elements. Biochem Biophys ResCommun 1997;236:313–22.

3. Anderson N, Paul SH, Henry M. Induction of pulmonary tumors in micewith ethyl carbamate (Urethane). J Natl Cancer Inst 1943;4:309–19.

4. Horio Y, Chen A, Rice P, Roth JA, Malkinson AM, Schrump DS. Ki-ras andp53 mutations are early and late events, respectively, in urethane-inducedpulmonary carcinogenesis in A/J mice. Mol Carcinog 1996;17:217–23.

5. Ghanayem BI, Hoffler U. Investigation of xenobiotics metabolism, geno-toxicity, and carcinogenicity using Cyp2e1(-/-) mice. Curr Drug Metab2007;8:728–49.

6. Kemper RA, Myers SR, Hurst HE. Detoxification of vinyl carbamateepoxide by glutathione: evidence for participation of glutathione S-transferases in metabolism of ethyl carbamate. Toxicol Appl Pharmacol1995;135:110–8.

7. Su S, YangX,Omiecinski CJ. IntronicDNAelements regulateNrf2 chemicalresponsiveness of the human microsomal epoxide hydrolase gene(EPHX1) through a far upstream alternative promoter. Biochim BiophysActa 2014;1839:493–505.

8. Hu R, Xu C, Shen G, Jain MR, Khor TO, Gopalkrishnan A, et al. Geneexpression profiles induced by cancer chemopreventive isothiocyanatesulforaphane in the liver of C57BL/6J mice and C57BL/6J/Nrf2 (-/-) mice.Cancer Lett 2006;243:170–92.

9. Xu C, HuangMT, ShenG, Yuan X, LinW, Khor TO, et al. Inhibition of 7,12-dimethylbenz(a)anthracene-induced skin tumorigenesis in C57BL/6 miceby sulforaphane is mediated by nuclear factor E2-related factor 2. CancerRes 2006;66:8293–6.

10. Ramos-Gomez M, Kwak MK, Dolan PM, Itoh K, Yamamoto M, Talalay P,et al. Sensitivity to carcinogenesis is increased and chemoprotectiveefficacy of enzyme inducers is lost in nrf2 transcription factor-deficientmice. Proc Natl Acad Sci U S A 2001;98:3410–5.

11. Osburn WO, Karim B, Dolan PM, Liu G, Yamamoto M, Huso DL, et al.Increased colonic inflammatory injury and formation of aberrant crypt foci

in Nrf2-deficient mice upon dextran sulfate treatment. Int J Cancer 2007;121:1883–91.

12. Iida K, Itoh K, Kumagai Y, Oyasu R, Hattori K, Kawai K, et al. Nrf2 isessential for the chemopreventive efficacy of oltipraz against urinarybladder carcinogenesis. Cancer Res 2004;64:6424–31.

13. Shibata T, Ohta T, Tong KI, Kokubu A, Odogawa R, Tsuta K, et al. Cancerrelated mutations in NRF2 impair its recognition by Keap1-Cul3 E3ligase and promote malignancy. Proc Natl Acad Sci U S A 2008;105:13568–73.

14. Shibata T, Kokubu A, Gotoh M, Ojima H, Ohta T, Yamamoto M, et al.Genetic alteration of Keap1 confers constitutive Nrf2 activation andresistance to chemotherapy in gallbladder cancer. Gastroenterology 2008;135:1358–68.

15. Hayes JD, McMahon M. The double-edged sword of Nrf2: subversion ofredox homeostasis during the evolution of cancer. Mol Cell 2006;21:732–4.

16. Ma Q.Role of nrf2 in oxidative stress and toxicity. Annu Rev PharmacolToxicol 2013;53:401–26.

17. Satoh H, Moriguchi T, Takai J, Ebina M, Yamamoto M. Nrf2 preventsinitiation but accelerates progression through the Kras signaling pathwayduring lung carcinogenesis. Cancer Res 2013;73:4158–68.

18. Taguchi K, Maher JM, Suzuki T, Kawatani Y, Motohashi H, Yamamoto M.Genetic analysis of cytoprotective functions supported by graded expres-sion of Keap1. Mol Cell Biol 2010;30:3016–26.

19. Reisman SA, Csanaky IL, Aleksunes LM, Klaassen CD. Altered dispositionof acetaminophen in Nrf2-null and Keap1-knockdown mice. Toxicol Sci2009;109:31–40.

20. Wu KC, Liu JJ, Klaassen CD. Nrf2 activation prevents cadmium-inducedacute liver injury. Toxicol Appl Pharmacol 2012;263:14–20.

21. Uruno A, Furusawa Y, Yagishita Y, Fukutomi T, Muramatsu H, Negishi T,et al. The Keap1-Nrf2 system prevents onset of diabetes mellitus. Mol CellBiol 2013;33:2996–3010.

22. Singh A, Boldin-Adamsky S, Thimmulappa RK, Rath SK, AshushH, CoulterJ, et al. RNAi-mediated silencing of nuclear factor erythroid-2-related factor2 gene expression in non-small cell lung cancer inhibits tumor growth andincreases efficacy of chemotherapy. Cancer Res 2008;68:7975–84.






23. Hoffler U, Ghanayem BI. Increased bioaccumulation of urethane inCYP2E1-/- versus CYP2E1þ/þ mice. Drug Metab Dispos 2005;33:1144–50.

24. Satoh H, Moriguchi T, Taguchi K, Takai J, Maher JM, Suzuki T, et al. Nrf2-deficiency creates a responsive microenvironment for metastasis to thelung. Carcinogenesis 2010;31:1833–43.

25. Nagaraj S, Gabrilovich DI. Tumor escape mechanism governed by mye-loid-derived suppressor cells. Cancer Res 2008;68:2561–3.

26. Cardoso CC, Bornstein SR, Hornsby PJ. New methods for investigatingexperimental human adrenal tumorigenesis. Mol Cell Endocrinol 2009;300:175–9.

27. Baldelli S, Aquilano K, Ciriolo MR. Punctum on two different tran-scription factors regulated by PGC-1alpha: nuclear factor erythroid-derived 2-like 2 and nuclear respiratory factor 2. Biochim Biophys Acta2013;1830:4137–46.

28. Harvey CJ, Thimmulappa RK, Singh A, Blake DJ, Ling G, Wakabayashi N,et al. Nrf2-regulated glutathione recycling independent of biosynthesis iscritical for cell survival during oxidative stress. Free Radic Biol Med 2009;46:443–53.

29. Malhotra D, Portales-Casamar E, Singh A, Srivastava S, Arenillas D, HappelC, et al. Global mapping of binding sites for Nrf2 identifies novel targets incell survival response through ChIP-Seq profiling and network analysis.Nucleic Acids Res 2010;38:5718–34.

30. Singh A, Rangasamy T, Thimmulappa RK, Lee H, Osburn WO, Brigelius-Floh�e R, et al. Glutathione peroxidase 2, the major cigarette smoke-inducible isoform of GPX in lungs, is regulated by Nrf2. Am J Respir CellMol Biol 2006;35:639–50.

31. Vaziri ND. Protective effect of Nrf2 and catalase in maternal diabetes-induced perinatal hypertension and kidney disease. Diabetes 2012;61:2400–2.

32. Kinnula VL, Paakko P, Soini Y. Antioxidant enzymes and redox regulatingthiol proteins in malignancies of human lung. FEBS Lett 2004;569:1–6.

33. Naiki T, Naiki-Ito A, Asamoto M, Kawai N, Tozawa K, Etani T, et al. GPX2overexpression is involved in cell proliferation and prognosis of castration-resistant prostate cancer. Carcinogenesis 2014;35:1962–7.

34. Salem AF, Whitaker-Menezes D, Howell A, Sotgia F, Lisanti MP. Mitochon-drial biogenesis in epithelial cancer cells promotes breast cancer tumorgrowth and confers autophagy resistance. Cell Cycle 2012;11:4174–80.

35. Singh S.Cytoprotective and regulatory functions of glutathione S-trans-ferases in cancer cell proliferation and cell death. Cancer ChemotherPharmacol 2015;75:1–15.

36. Maher JM, Dieter MZ, Aleksunes LM, Slitt AL, Guo G, Tanaka Y, et al.Oxidative and electrophilic stress induces multidrug resistance-associatedprotein transporters via the nuclear factor-E2-related factor-2 transcrip-tional pathway. Hepatology 2007;46:1597–610.

37. Nagaraj S, Gupta K, Pisarev V, Kinarsky L, Sherman S, Kang L, et al. Alteredrecognition of antigen is a mechanism of CD8þ T cell tolerance in cancer.Nat Med 2007;13:828–35.

38. Hiramoto K, Satoh H, Suzuki T, Moriguchi T, Pi J, Shimosegawa T, et al.Myeloid lineage-specific deletion of antioxidant system enhances tumormetastasis. Cancer Prev Res 2014;7:835–44.

39. Sha LK, Sha W, Kuchler L, Daiber A, Giegerich AK, Weigert A, et al. Loss ofNrf2 in bone marrow-derived macrophages impairs antigen-driven CD8(þ) T cell function by limiting GSH and Cys availability. Free Radic BiolMed 2015;83:77–88.

40. Jung KA, Kwak MK. The Nrf2 system as a potential target for the develop-ment of indirect antioxidants. Molecules 2010;15:7266–91.

41. Zahlten J, Kim YJ, Doehn JM, Pribyl T, Hocke AC, García P, et al. Strep-tococcus pneumoniae-induced oxidative stress in lung epithelial cellsdepends on pneumococcal autolysis and is reversible by resveratrol.J Infect Dis 2015;211:1822–30.

42. Sayin VI, Ibrahim MX, Larsson E, Nilsson JA, Lindahl P, Bergo MO.Antioxidants accelerate lung cancer progression in mice. Sci Transl Med2014;6:221ra15.


Satoh et al.




2016;76:3088-3096. Published OnlineFirst March 28, 2016.Cancer Res Hironori Satoh, Takashi Moriguchi, Daisuke Saigusa, et al. Cell GrowthCarcinogenesis, but After Tumor Initiation Accelerates Malignant NRF2 Intensifies Host Defense Systems to Prevent Lung

Updated version

10.1158/0008-5472.CAN-15-1584doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2016/03/26/0008-5472.CAN-15-1584.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/76/10/3088.full#ref-list-1

This article cites 42 articles, 13 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/76/10/3088.full#related-urls

This article has been cited by 5 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/76/10/3088To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-15-1584

http://cancerres.aacrjournals.org/content/suppl/2016/03/26/0008-5472.CAN-15-1584.DC1

http://cancerres.aacrjournals.org/content/76/10/3088.full#ref-list-1

http://cancerres.aacrjournals.org/content/76/10/3088.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/76/10/3088


Documents

NRF2IntensiﬁesHostDefenseSystemstoPrevent Lung ... · length (mm) width (mm) height (mm) 0.5 (22). Quantitative RT-PCR Total RNA was extracted from the tissues using ISOGEN (Nippon