Pigment Epithelium-Derived FactorInduces Pro-inflammatory Genesin Neonatal Astrocytes ThroughActivation of NF-kB and CREBTAKESHI YABE,1,2,4*y TOMOMI SANAGI,1,2y JOAN P. SCHWARTZ,3

AND HARUKI YAMADA1,2,4

1Kitasato Institute for Life Sciences, Kitasato University, Tokyo, Japan2Graduate School of Infection Control Sciences, Kitasato University, Tokyo, Japan

3Neurotrophic Factors Section, National Institute of Neurological Disorders and Stroke(NINDS), National Institutes of Health, Bethesda, Maryland

4Oriental Medicine Research Center, Kitasato Institute, Tokyo, Japan

KEY WORDS cytokines; glial cells; chemokines; inflammation

ABSTRACT Pigment epithelium-derived factor (PEDF) is a potent and broadlyacting neurotrophic factor that protects neurons in various types of cultured neuronsagainst glutamate excitotoxicity and induced-apoptosis. Some of the effects of PEDFreflect specific changes in gene expression, mediated via activation of the transcrip-tion factor NF-kB in neurons. To investigate whether PEDF also modulates geneexpression in astrocytes, we employed the use of RT-PCR to analyze the gene expres-sion of certain pro-inflammatory genes and found that genes such as IL-1b, IL-6,TNF-a, MIP1a, and MIP3a were induced in PEDF-treated cultured neonatal astro-cytes, but not in adult astrocytes. Electrophoresis mobility shift assay (EMSA)revealed that a time- and dose-dependent increase of NF-kB- and AP-1-DNA bindingactivity was observed in PEDF-treated neonatal astrocytes. Furthermore, rapid phos-phorylation of CREB protein had occurred in PEDF-treated neonatal astrocytes.Upregulation of pro-inflammatory and AP-1-related genes by PEDF was blocked byoverexpression of dominant negative CREB or a mutated form of IkBa. These resultssuggest that the induction of pro-inflammatory genes is mediated via activation ofNF-kB, AP-1, and CREB in neonatal astrocytes. Taken together, these results demon-strate that PEDF is a multipotent factor, capable of affecting not only neurons, butalso neonatal astrocytes, and suggests that it may act as a neuroimmune modulatorin the developmental brain. VVC 2005 Wiley-Liss, Inc.

*Correspondence to: Takeshi Yabe, Kitasato Institute for Life Sciences,Kitasato University, 5-9-1, Shirokane, Minato-ku, Tokyo, 108-8641, Japan.E-mail: tyabe@lisci.kitasato-u.ac.jp

yT. Yabe and T. Sanagi contributed equally to this work.

Received 8 August 2004; Accepted 10 November 2004

DOI 10.1002/glia.20171

Published online 28 February 2005 in Wiley InterScience (www.interscience.wiley.com).

Abbreviations used: PEDF, pigment epithelium-derived factor; CGCs, cere-bellar granule cells; DIV, days in vitro; TNF, tumor necrosis factor; IL-1, inter-leukin-1; IL-6, interleukin-6; MIP1, macrophage inflammatory protein 1;MIP3, macrophage inflammatory protein 3; CRE, cAMP-response element; RT-PCR, reverse transcriptase polymerase chain reaction; NF-kB, nuclear factorkB; CREB, cAMP-responsive element binding protein; ERK, extracellular sig-nal-regulated kinase; MAPK, mitogen-activated protein kinase; JNK, c-JunNH2-terminal kinase; SERPIN, serine protease inhibitor; MOI, multiplicity ofinfection; CNS, central nervous system; AP-1, activator protein 1; EMSA, elec-trophoresis mobility shift assay.

Grant sponsor: Uehara Memorial Foundation; Grant sponsor: TakedaResearch Foundation; Grant sponsor: Kitasato University (Research Grant forYoung Researchers); Grant sponsor: Ministry of Education, Culture, Sports,Science and Technology (MEXT; 21st Century COE Program); Grant sponsor:Tsumura & Co., Tokyo.

VVC 2005 Wiley-Liss, Inc.

GLIA 50:223–234 (2005)

INTRODUCTION

Pigment epithelium-derived factor (PEDF) is a 50-kDa glycoprotein and is a member of the serine pro-tease inhibitor (SERPIN) gene family (Tombran-Tinket al., 1991). It was first isolated from medium condi-tioned by human fetal retinal pigment epithelial (RPE)cells. Expression of PEDF mRNA was detected in abroad range of human fetal and adult tissues, includ-ing almost all brain areas (Tombran-Tink et al., 1996).Later studies demonstrated that PEDF promotes thesurvival of cerebellar granule cell neurons (CGCs) inculture (Taniwaki et al., 1995), and that it can protectthem against glutamate toxicity (Taniwaki et al., 1997)and induced apoptosis (Araki et al., 1998). It is alsoneurotrophic and protective for neurons cultured fromthe hippocampus (DeCoster et al., 1999), spinal cord(motor neurons) (Bilak et al., 1999; Houenou et al.,1999), and retina (Cao et al., 1999). Thus, PEDF mayplay important roles in the survival and maintenanceof various kinds of neurons. Although the precisemechanism by which PEDF protects against neuronalapoptosis is still unclear, we have demonstrated pre-viously that treatment with PEDF activates transcrip-tion factor NF-kB and induces anti-apoptotic relatedgenes in cultured cerebellar granule cell neurons (Yabeet al., 2001), suggesting that some of the effects ofPEDF may reflect specific changes in gene expression,mediated via activation of transcription factors.

Astrocytes play an important role in maintaining nor-mal homeostasis, as well as regulating inflammatoryresponses in the central nervous system (CNS) (Muckeand Eddleston, 1993; Zhao and Schwartz, 1998). Astro-cytes secrete pro-inflammatory mediators such as tumornecrosis factor-a (TNF-a), interleukin-1b (IL-1b), inter-leukin-6 (IL-6), and chemokines in response to variousstimuli such as ischemia, viral infection, or cytokinesproduced by inflammatory cells and activated microglialcells. Although astrocytes constitute approximately 50%of the total cell number within the CNS, a point thathas not been fully addressed is whether PEDF acts onastrocytes. Analysis of the effects of PEDF on astroglialfunction is indispensable for an understanding of therole of PEDF in the CNS. The only effect of PEDFshown so far on astrocytes is that PEDF had no directeffect on metabolic activity or proliferation, butblocked astrocyte proliferation in an astrocyte-micro-glia co-culture (Sugita et al., 1997). To investigatewhether PEDF acts not only on neuronal cells butalso glial cells, we analyzed the effects of recombinanthuman PEDF (rhPEDF) on cytokine mRNA levels,transcription factors, and signal transduction path-ways in cultured astrocytes.

MATERIALS AND METHODS

Antibodies were obtained from the followingsources: anti-phospho-specific CREB and CREB anti-bodies from Upstate Biotechnology (Lake Placid, NY);

anti-phospho-specific p38 MAPK, anti-p38 MAPK, anti-phospho-specific JNK/SAPK, anti-JNK/SAPK anti-phos-pho-specific Erk1/2, and anti-Erk1/2 antibodies fromCell Signaling Technology (Beverly MA); and anti-GFAPmonoclonal antibody from Sigma (St. Louis, MO). Allculture reagents were obtained from the same source(Sigma). The ViraPower2 Adenoviral Expression Sys-tem was obtained from Invitrogen (Carlsbad, CA).

Recombinant human PEDF (rhPEDF)

The PEDF used in this study was prepared as pre-viously described (Becerra et al., 1993). Briefly, a trun-cated recombinant expression construct (Asp44-Pro418) derived from human PEDF cDNA wasexpressed in Escherichia coli, purified from the bacter-ial inclusion bodies, and stored in a urea buffer (50 mMNa phosphate, 150 mM NaCl, pH 6.5, and containing 4M urea). An equivalent volume of urea buffer wasadded to all control/untreated samples. The urea bufferitself (at a final concentration 0.1–20 mM) did notaffect any of the assays (data not shown). Analysis ofrhPEDF in terms of endotoxin lipopolysaccharide(LPS) content demonstrated undetectable levels (<0.05endotoxin units/ml at the lowest dilution of rhPEDFused in assays) using the Limulus amebocyte lysatemethod (Associates of Cape Cod, Falmouth, MA).

Astrocyte Cultures

Astrocytes were prepared from cortex of a litter ofpostnatal day 2 rat pups or three to four adult Wistarrats (250–300 g), and cultured as previously described(Schwartz and Wilson, 1992) in Dulbecco’s modifiedEagle’s medium (DMEM; high glucose) containing10% fetal bovine serum, 1 mM pyruvate, 2 mM gluta-mine, and 25 mg/ml gentamycin in a humidified atmo-sphere of 90% air/10% CO2. When cultures becameconfluent, the flasks were shaken at 225 rpm over-night, and the medium was changed the next morning.Following the third overnight shake, the cells weretrypsinized and cultured for 24 h in 10 mM cytosinearabinoside. When flasks became confluent again, theywere subcultured for experiments. All experimentswere carried out when the cultures had become conflu-ent. The astrocyte cultures consisted of >99% astro-cytes (stained with anti-GFAP antibody), 0% neurons(stained with anti-NeuN antibody), and <1% microglia(stained with anti-OX42 antibody).

RT-PCR

Total RNA was extracted from cultured astrocytes,according to the manufacturer’s instructions for theTRIZOL Reagent (Invitrogen). In this study, 1 mg oftotal RNA was converted to first-strand cDNA, usingthe first-strand cDNA synthesis kit (Amersham Phar-macia Biotech, Piscataway, NJ). The resulting cDNA

224 YABE ET AL.

was subjected to polymerase chain reaction (PCR)analysis. The PCR amplification mixture in a finalvolume of 25 ml consisted of 1 � Taq DNA polymerasebuffer, 0.2 mM dNTPs, 1.5 mM MgCl2, 0.5 mM of eachspecific primer, and 2.5 U Taq DNA polymerase (Invi-trogen), in accordance with the manufacturer’sinstructions. Cycle number was chosen such thatamplification of the products was linear with respectto the amount of input RNA. Each cycle consisted of30 s at 948C for denaturation, 30 s at 608C for anneal-ing, and 60 s at 728C for extension. The PCR productswere stained with ethidium bromide after agarose gelelectrophoresis and photographed using Polaroid filmtype 667. The actual sequences of specific primers aresummarized in Table 1.

Nuclear Extract Preparation andElectrophoresis Mobility Shift Assay

Nuclear extracts for electrophoresis mobility shiftassay (EMSA) were prepared by a mini-extraction pro-tocol (Schreiber et al., 1989). EMSA was performedwith a commercial kit (Promega, Madison, WI) accord-ing to the manufacturer’s instructions. Two mg ofnuclear extract was incubated with a 32P-labeled DNAsequence containing the NF-kB or AP-1 binding site.The DNA-protein complexes were separated fromunbound oligonucleotides by electrophoresis throughnative 6% polyacrylamide gels using a 0.5� TBE buf-fer. Following electrophoresis, the gels were dried andanalyzed by autoradiography. Competition experi-ments were performed by co-incubation with a 100-foldexcess of unlabeled double-stranded oligonucleotides inthe DNA-protein binding reaction. Polyclonal antibo-dies against p65 (RelA), RelB, c-Rel, p50, and p52, usedfor the supershift experiments, were purchased fromSanta Cruz Biotechnology (Santa Cruz, CA). For super-shift analysis, 2 mg of antibody was preincubated for30 min at 48C before the binding reaction.

Immunocytochemistry for RelA

Following experimental treatments, astrocytes werewashed three times with phosphate-buffered saline(PBS) and fixed by incubating in 4% paraformalde-hyde for 30 min. Cells were then incubated in per-meabilization buffer (3% H2O2 in 80% MeOH) for2 min on ice. To block nonspecific antibody binding,

cells were incubated in a blocking solution containing1% bovine serum albumin (BSA) and 0.3% Triton X-100 for 2 h. Following incubation with primary anti-bodies overnight, cells were then incubated in anAlexa Fluor 488-labeled goat anti-rabbit IgG second-ary antibody and an Alexa Fluor 594-labeled goatanti-mouse IgG secondary antibody. Images were col-lected using a fluorescent microscope with a CCDcamera. The 488- and 568-nm lines of a krypton/argon laser were used for fluorescence excitation.

Western Blotting

For immunoblotting, astrocytes treated withrhPEDF were washed with cold PBS, solubilized withsodium dodecyl sulfate (SDS) sample buffer, and thensonicated for 10 s. The lysates were boiled for 5 minand centrifuged for 15 min. The supernatants weresubjected to sodium dodecyl sulfate-polyacrylamidegel electrophoresis (SDS-PAGE). Equal amounts oflysate protein were run on a 10% SDS polyacrylamidegel and transferred to nitrocellulose membranes.Nitrocellulose blots were blocked with 3% bovineserum albumin (BSA) in Tris-buffered saline contain-ing 0.1% Triton X-100 (TBST), and then incubatedwith primary antibodies [anti-IkBa (Cell Signaling,1:2,000), anti-IkBb (Cell Signaling, 1:2000), anti-phos-pho-CREB (Upstate Biotechnology, 1:2,000), anti-CREB (Cell Signaling, 1:2000), anti-phospho-ERK1/2(Cell Signaling, 1:2, 000), anti-ERK1/2 (Cell Signal-ing, 1:2,000), b-actin (Sigma, 1:5,000), anti-phospho-SAPK/JNK (Cell Signaling, 1:2,000), and anti-phos-pho-p38(Cell Signaling, 1:2,000)] in TBST containing3% BSA or 5% skim milk (Meiji Dairies, Tokyo). Afterwashing, the blots were incubated for 1 h with horse-radish peroxidase (HRP)-conjugated anti-rabbit IgGor anti-mouse IgG at a dilution of 1:5,000. Immuno-reactive IKBd, IKBb phospho-CREB, CREB?? phos-pho-AKT, AKT, phospho-ERK1/2, ERK1/2, b-actin,phospho-SAPK/JNK, and phospho-p38 were detectedwith the enhanced chemiluminescence (ECL) protocol(Amersham).

Adenovirus Constructs and Transfection

Replication-defective adenovirus vectors expressinga mutated nondegradable IkBa, with serines 32 and

TABLE 1. Primers Employed in RT-PCR Analysis

Gene Sense Primer Antisense Primer

IL-1b TGTCTGAAGCAGCTATGGCAA TCTCCACAGCCACAATGAGTGAIL-6 AGCCAGAGTCATTCAGAGCAATACTG CACTAGGTTTGCCGAGTAGACCTCTNFa CCAGAACTCCAGGCGGTGTCTGTG GTGGTTTGCTACGACGTGGGCTACMIP1a CACCGCTGCCCTTGCTGTTCTTC AGGCATTTAGTTCCAGCTCAGTGATGMIP3a AGCAAGCAACTTTGACTGCTGCCTC CGGCTGTGTCCAATTCCATCCCAGIkBaM CACTCCATCCTGAAGGCTACCAAC CACACTTCAACAGGAGTGACACCAGdnCREB CCCGATTTACCAAACTAGCAGTGGG GAGGACGCCATAACAACTCCAGGGLacZ CGGCGGGCCATTACCAGGCC AAGTCGCCGCGCGCCACTGGTGcyclophilin AGGATGATTGCTGATGTGGATAC CACAAAGATGGTCACTGTCTGC

225PEDF INDUCES PRO-INFLAMMATORY GENES IN ASTROCYTES

36 mutated to alanines (Adeno-IkBaM) under the con-trol of the cytomegalovirus (CMV) promoter, wereconstructed using the ViraPower2 Adenoviral Expres-sion System (Invitrogen). In brief, an IkBaM frag-ment from a pCMV.IkBaM plasmid (Clontech) wasinserted into the multicloning site of a pENTR2Bentry vector (Invitrogen). IkBaM in pENTR2B wasthen transferred into the pAd/CMV/V5-DEST plasmidusing a Gateway system (Invitrogen). pAd/CMV/IkBaM was digested by PacI to expose the ITRs, andthe digested plasmid was then transfected into 293Acells. A recombinant adenovirus vector expressing a

mutant of CREB (Adeno-CREB133), in which thephosphorylation site at Ser133 was changed to ala-nine, was constructed using the same protocol. Ade-noviral vectors were amplified in 293A cells andpurified by ultracentrifugation through a CsCl gradi-ent. Astrocytes were infected for 72 h with adenovirusvectors, using a multiplicity of infection of 15, achiev-ing a 90% transduction efficiency (data not shown).Experiments using recombinant adenoviruses wereapproved by the Recombinant DNA Committee of theKitasato University and performed according to insti-tutional guidelines.

Fig. 1. RT-PCR analysis for inflammatory-related genes in cul-tured astrocytes. A: Cortical astrocytes from neonatal brain wastreated with 5 nM recombinant human pigment epithelium-derived factor (rhPEDF) for indicated times. Total RNA wasextracted and reverse-transcribed, followed by PCR with specificprimers. Cyclophilin served as the unchanging control mRNA.Relative quantitation values of these mRNA levels were normal-ized with respect to cyclophilin gene expression, and the resultsof three independent experiments are summarized as a bar

graph. Data are expressed as mean �SEM (n ¼ 3). B: Corticalastrocytes from neonatal brain or adult brain were treated withrhPEDF (5 nM) for the indicated times. Total RNA was extractedand reverse-transcribed, followed by PCR with specific primers.Cyclophilin served as the unchanging control mRNA. Relativequantitation values of these mRNA levels were normalized withrespect to cyclophilin gene expression, and the results of threeindependent experiments are summarized as a bar graph. Dataare expressed as mean �SEM (n ¼ 3).

226 YABE ET AL.

RESULTSrhPEDF Induces Expression of

Pro-inflammatory Cytokines and Chemokinesin a Time-Dependent Manner

Astrocytes express inflammatory-related genes inresponse to various stimuli (Zhao and Schwartz, 1998).We therefore examined the effect of rhPEDF on expres-sion of mRNAs for IL-1b, IL-6, TNF-a, macrophageinflammatory protein 1a (MIP1a), and macrophageinflammatory protein 3a (MIP3a) in cultured astro-cytes using RT-PCR analysis. As shown in Figure 1,the level of expression of these genes was small orundetectable in untreated astrocytes. When rhPEDFwas added at 5 nM, a concentration previouslyreported to prevent the death of cultured cerebellargranule cell neurons after exposure to low Kþ/serum-free medium or glutamate (Yabe et al., 2001), rhPEDFmarkedly induced mRNA expression of IL-1b, IL-6,TNF-a, MIP1a, and MIP3a in cultured neonatal astro-cytes (Fig. 1A). This induction was observed within 3 hand persisted for at least 24 h after rhPEDF treatment.Interestingly, rhPEDF had little effect on expression ofpro-inflammatory genes in cultured astrocytes, whichare prepared from adult rat brain (Fig. 1B). These find-ings are similar to in vivo results, in which overexpres-sion of human PEDF by adenoviral gene transfer doesnot induce inflammation in adult rat brain (our unpub-lished observation).

Because there is low-level contamination of astrocytecultures with microglia (<1% of total cells), and micro-glia are potent producers of cytokines and chemokinesand are known to respond to PEDF treatment (Sugitaet al., 1997; Yabe et al., 2004), the possibility was exam-ined that microglia in the cultures were responsible forrhPEDF-induced pro-inflammatory gene expression.To remove the microglia, astrocyte cultures were trea-ted with 50 mM L-leucine methyl ester (LME), a com-pound that kills microglia. Despite the removal of themicroglia by LME treatment, rhPEDF remained ableto induce or enhance expression of mRNA for IL-1b, IL-6, TNF-a MIP 1a, and MIP 3a, demonstrating that theastrocytes themselves were capable of synthesizingthese factors (data not shown).

Effect of rhPEDF on NF-kB Binding Activity

Several cytokines and growth factors induce geneexpression via activation of several well-known tran-scription factors. Among these are the nuclear factor-kB(NF-kB) and activator protein-1 (AP-1) family of tran-scription factors, which are also known to be importantin the induction of pro-inflammatory genes. To deter-mine whether rhPEDF affects NF-kB transcription fac-tor activity, the level of NF-kB binding to DNA wasanalyzed using EMSA in neonatal astrocytes treatedwith or without rhPEDF. A time course study revealedthat NF-kB binding activity was increased within 1 h,

with this effect persisting for at least 6 h after rhPEDFtreatment (Fig. 2A). Figure 2B indicates that therhPEDF increased NF-kB binding activity in a dose-dependent manner. The addition of a 100-fold excess ofunlabeled NF-kB oligonucleotide, but not AP-1, CRE, orOCT-1 oligonucleotides, displaced the binding (Fig. 2C).Antibody supershift analysis was performed to elucidatethe nature of the NF-kB complex activated by rhPEDF.As shown in Figure 2D, each of the two putative NF-kBDNA complexes was supershifted by the p50-specificantibody, whereas the larger complex (upper band) wasalso supershifted by anti-RelA. In contrast, antibodiesagainst RelB, c-Rel, or p52 did not cross-react with theNF-kB-DNA complex. These analyses suggest that therhPEDF-treated astrocytes contain nuclear NF-kB-Relcomplexes composed predominantly of p50/p50 homodi-mer and ReA/p50 heterodimer.

IkB Degradation by ProteasomesIs Required for rhPEDF-Induced IL-1b

and TNF-a mRNA Expression

NF-kB is normally sequestered in the cytoplasm by amember of the IkB family of inhibitory proteins. Whencells are exposed to activators of NF-kB, these IkB pro-teins undergo sequential phosphorylation, ubiquitina-tion and proteasomal degradation, thereby allowingthe translocation of dimeric complexes of NF-kB to thenucleus. To examine whether activation of NF-kBrequires IkB degradation by proteasomes, we analyzedthe expression level of IkB proteins in rhPEDF-treatedastrocytes using Western blot analysis. As shown inFigure 3A, a decreased level of IkBa protein wasobserved at 60 and 120 min after rhPEDF treatment incultured neonatal astrocytes, whereas IkBb levels weredecreased at 120 min after rhPEDF treatment.Furthermore, pretreatment with proteasome inhibitorMG-132 at 10 mM inhibited the ability of rhPEDF toinduce IL-1b and TNF-amRNA (Fig. 3B). These resultssuggest that rhPEDF-induced gene expressionrequires IkB degradation via the proteasomes. Tofurther demonstrate activation of NF-kB protein,immunohistochemistry was used to investigate nucleartranslocation (Fig. 4). Untreated or rhPEDF-treatedastrocytes were fixed and stained with antibody toRelA. Under basal conditions, no nuclear staining forRelA was observed. However, 4 h after rhPEDF expo-sure, nuclei was strongly labeled with the RelA anti-body. In addition, RT-PCR analysis revealed thatrhPEDF induces expression of IkBa mRNA in astro-cytes (data not shown), a process regulated by NF-kB(Le Bail et al., 1993).

Effect of rhPEDF on AP-1- DNABinding Activity

The AP-1 family of transcription factors consistsof Jun (c-Jun, JunD, JunB) and Fos (c-fos, Fra-1,

227PEDF INDUCES PRO-INFLAMMATORY GENES IN ASTROCYTES

Fra-2, FosB) proteins and functions through bindingto the regulatory regions of numerous genes (Curranand Franza, 1988; Angel and Karin, 1991). To deter-mine whether rhPEDF affects AP-1 transcriptionfactor activity, the level of AP-1 binding to DNAwas analyzed using EMSA in astrocytes treatedwith or without rhPEDF. Time-course analysisrevealed that induction of AP-1 binding activity wasobserved at 4 h and 6 h after rhPEDF treatmentin astrocytes (Fig. 5A). rhPEDF treatment inducedAP-1-DNA binding in a dose-dependent manner(Fig. 5B). Furthermore, RT-PCR analysis showedthat mRNA levels of fra-1, fra-2, junB, and junDincreased in rhPEDF-treated astrocytes, whilerhPEDF had little effect on levels of c-fos and c-junmRNA (Fig. 5C).

rhPEDF induces phosphorylation of CREBin neonatal astrocytes

In an effort to determine whether signal transductionpathways play a role in the upregulation of pro-inflam-matory and chemokine genes by rhPEDF, the phosphor-ylation of cyclic AMP responsive element bindingprotein (CREB), extracellular-signal regulated proteinkinase (Erk½), p38 mitogen-activated protein kinase(MAPK), and c-Jun NH2-terminal kinase (JNK) wereevaluated following rhPEDF treatment. A time-depen-dent increase in the phosphorylation of CREB wasobserved in rhPEDF-treated neonatal astrocytes whencompared with untreated cells (Fig. 6A). In contrast,phosphorylation of Erk1/2, p38MAPK, and JNKremained unchanged after rhPEDF treatment (Fig. 6B).

Fig. 2. Effect of recombinanthuman pigment epithelium-derived factor (rhPEDF) on NF-kB-DNA binding activity in cul-tured neonatal astrocytes. A:Cultured astrocytes treated with5 nM rhPEDF for the indicatedtime periods were analyzed byelectrophoresis mobility shiftassay (EMSA). EMSA was per-formed with labeled oligonucleo-tides containing the NF-kB DNAbinding site. B: Cultured astro-cytes were treated with the indi-cated concentrations of rhPEDFfor 4 h or with TNF-a (25 ng/ml)for 1 h. Nuclear extracts wereprepared and analyzed byEMSA. The data are compatiblewith those in three similarexperiments. C: Specific inhibi-tion of DNA-protein complex for-mation by NF-kB sequence motif.Astrocytes were treated withrhPEDF (5 nM) for 4 h, afterwhich nuclear extracts were pre-pared and assayed for NF-kBDNA-protein complex formationin the presence or absence ofunlabeled oligonucleotides (�100-fold molar excess) containing theNF-kB, AP-1, CRE, or OCT-1consensus sequences as describedunder Materials and Methods. D:Identification of NF-kB bindingprotein in nuclei of astrocytestreated with rhPEDF. Astrocyteswere treated with rhPEDF (5nM) for 2 h. Nuclear extractswere prepared and incubated for1 h with antibodies to the indi-cated NF-kB/Rel proteins. Bind-ing to the NF-kB probe was thenassessed by EMSA.

228 YABE ET AL.

Effect of Overexpression of IkBaMon rhPEDF-Induced Gene Expression

As shown in Figure 3B, proteasome inhibitor MG-132 inhibited rhPEDF-induced expression of IL-1band TNF-a mRNA levels. The proteasome is a multi-catalytic proteinase complex responsible for thedegradation of most intracellular proteins, includingproteins crucial to apoptosis (Voorhees et al., 2003).Thus, we could not exclude the possibility that degra-dation of intermediates besides IkB protein wasinvolved in MG-132 inhibition of the upregulation ofpro-inflammatory genes by rhPEDF. In order to pro-vide further evidence that NF-kB activation is crucialfor the upregulation of cytokines and chemokinesmRNA by rhPEDF, neonatal astrocytes were infectedwith either an adenovirus vector expressing amutated nondegradable IkBa (IkBaM) or a controlvirus (Adeno–LacZ), and treated with rhPEDF. Neo-natal astrocytes infected with Adeno-IkBaM stronglyexpressed IkBaM mRNA, while those infected withAdeno–LacZ expressed LacZ mRNA (Figs. 7 and 8).The expression of IkBaM strongly abolished theinduction of IL-1b, IL-6, TNF-a, MIP1a, and MIP3amRNA levels following rhPEDF treatment of neo-natal astrocytes (Fig. 7). Furthermore, rhPEDF-

induced fra-1 and junB mRNA expression was inhib-ited by overexpression of IkBaM in neonatal astro-cytes (Fig. 8).

Effect of Dominant Negative CREBon rhPEDF-induced Gene Expression

In an effort to ascertain the functional significanceof rhPEDF-induced activation of CREB in neonatalastrocytes, cells were infected with either an adeno-virus expressing a dominant negative mutant ofCREB with a phosphorylation site at Ser133 (Adeno-CREB133) or a control virus (Adeno-LacZ), and subse-quently treated with rhPEDF. Astrocytes infected

Fig. 3. IkB degradation by proteasome is required for recombi-nant human pigment epithelium-derived factor (rhPEDF)-inducedinflammatory-related genes in neonatal astrocytes. A: Astrocyteswere treated with 5 nM rhPEDF for the indicated times. Cytoplas-mic extracts were prepared, and equal amounts of protein were ana-lyzed by Western blotting for the presence of IkB proteins. B: Effectof proteasome inhibitor, MG-132, on rhPEDF-induced IL-1b andTNF-a mRNA levels in glial cells. Astrocytes were treated withrhPEDF (5 nM) in the presence or absence of MG132 (1 or 10 mM)for 6 h. Total RNA was extracted and reverse-transcribed, followedby PCR with specific primers. Cyclophilin served as the unchangingcontrol mRNA.

Fig. 4. Nuclear accumulation of RelA protein in recombinanthuman pigment epithelium-derived factor (rhPEDF)-treated neona-tal astrocytes. Micrographs showing immunofluorescent analysis ofastrocytes either untreated or treated with 5 nM rhPEDF for 4 h,then immunostained with either a rabbit anti RelA antibody(A,C,D,F) or a mouse anti-GFAP antibody (B,C,E,F), followed by anAlexa Fluor 488-labeled anti rabbit IgG secondary antibody and anAlexa Fluor 594-labeled anti–mouse IgG secondary antibody. RelAare shown in green and the GFAP signal in red.

229PEDF INDUCES PRO-INFLAMMATORY GENES IN ASTROCYTES

with Adeno–CREB133 strongly expressed dominantnegative CREB mRNA, while those infected withAdeno–LacZ expressed LacZ mRNA (Figs. 7 and 8).Overexpression of dominant negative CREB stronglyinhibited the induction of TNF-a by rhPEDF, while ithad little effect on levels of IL-1b, IL-6, MIP1a, andMIP3a (Fig. 7). Furthermore, rhPEDF-induced fra-2,junB and junD mRNA expression was strongly inhib-ited by Adeno-CREB133 (Fig. 8).

DISCUSSION

Astrocytes are the most abundant glial cell type inthe mammalian brain. They play key roles in CNSdevelopment, inflammation and repair by producing awide variety of cytokines, chemokines, and growthfactors (Dong and Benveniste, 2001). Within the CNS,inflammatory responses rapidly induce marked astro-cytic changes referred to as reactive gliosis. Gliosiscan be viewed as a beneficial event for promotingneuronal survival by producing growth factors andneurotrophins that support neuronal growth, or itmay be deemed detrimental for neuronal function byforming glial scars or producing neurotoxic mediators,such as pro-inflammatory cytokines (Zhao andSchwarz, 1998). The understanding of the function ofastrocytes is very important not only for the fullunderstanding of brain function, but also for thedevelopment of new therapeutic agents. In this paper,we demonstrated that rhPEDF induced pro-inflamma-tory genes such as IL-1b, IL-6, TNF-a, MIP1a, andMIP3a in cultured neonatal astrocytes. These obser-vations suggest that PEDF is a multipotent factor,capable of affecting not only neurons, but also neona-

tal astrocytes. In contrast to neonatal astrocytes,rhPEDF had little effect on the expression of pro-inflammatory genes in adult astrocytes. Nakagawaand Schwartz (2004) reported that cultured neonatalastrocytes express many genes at a two-fold orgreater level than their expression in cultured adultastrocytes, including genes in the adhesion, cytoskele-ton, and extracellular matrix family, those involved insignal transduction, and genes related to apoptosis,DNA-binding, and cell cycle regulation. Wyss-Corayet al. (2003) reported that b amyloid protein stimu-lates MCP-1 production from cultured neonatal astro-cytes, but not from cultured adult astrocytes. Theseobservations raise the possibility that cultured neona-tal astrocytes are more ‘‘activated’’ than culturedadult cells. Moreover, PEDF has differential effectson CGCs, protecting immature (days in vitro [DIV] 2)but not mature (DIV6) cells against low Kþ/serum-free-induced apoptosis (Araki et al., 1998) while pro-tecting mature CGCs (DIV8) against glutamate-induced toxicity (Taniwaki et al., 1997). Although dif-ferences in characterization between neonatal astro-cytes and adult astrocytes are still unclear, theseobservations suggest that the responses of neuronand astrocytes to PEDF may vary as cell maturationproceeds, possibly because of changes in signal trans-duction pathways or gene expression as a function ofcell maturity.

NF-kB is composed of homo- and heterodimers ofmembers of the Rel family of related transcriptionfactors that control the expression of numerous genes.In general, NF-kB exists as a heterodimer comprisinga 50-kDa (p50) and a 65-kDa (p65) subunit, and issequestered in the cytoplasm by an inhibitory proteinof the IkB family. Immunological activators of NF-kB

Fig. 5. Effect of recombinant human pigment epithelium-derivedfactor (rhPEDF) on AP-1 -DNA binding activity in cultured neonatalastrocytes. A: Cultured neonatal astrocytes treated with 5 nMrhPEDF for the indicated time periods were analyzed by electro-phoresis mobility shift assay (EMSA). EMSA was performed withlabeled oligonucleotides containing the AP-1 DNA binding site.B: Cultured neonatal astrocytes were treated with the indicated

concentrations of rhPEDF for 4 h or with TNF-a (25 ng/ml) for 1 h.Nuclear extracts were prepared and analyzed by EMSA. C: RT-PCRanalysis for AP-1 related genes in neonatal astrocytes. Astrocytesfrom neonatal cortex were treated with rhPEDF (5 nM) for the indi-cated times. Total RNA was extracted and reverse-transcribed, fol-lowed by PCR with specific primers. Cyclophilin served as theunchanging control mRNA.

230 YABE ET AL.

such as TNF-a or IL-1b facilitate the phosphorylationand degradation of the IkB inhibitory protein by pro-teasomes, thus allowing free NF-kB to enter thenucleus, bind to its cognate DNA sequences, andinduce target gene transcription. NF-kB is a key tran-scription factor required for the expression of manyinflammatory genes, including IL-1b, TNF-a, IL-6,MIP1a, and MIP3a. Potential NF-kB binding siteshave been identified in the 50-flanking region of allthe aforementioned genes (Collart et al., 1990; Shi-mizu et al., 1990; Grove and Plumb, 1993; Cogswellet al., 1994; Sugita et al., 2002). In this study, wedemonstrated that treatment with rhPEDF inducedNF-kB-DNA binding activity in neonatal astrocytes.rhPEDF induced decreased levels of IkB proteins andtranslocation of p65 (RelA) to the nucleus. We alsodemonstrated that the adenoviral gene transfer of amutated form of IkBa protein (IkBaM) and protea-some inhibitor MG-132 inhibited rhPEDF-inducedexpression of pro-inflammatory genes, suggesting thatrhPEDF upregulates pro-inflammatory genes throughproteasome-dependent NF-kB activation.

AP-1 family members are immediate-early genesthat belong to the basic leucine zipper family of tran-scription factors. Members of the AP-1 family (c-Jun,JunB, JunD, c-Fos, Fra-1, Fra-2, and FosB) bind tothe AP-1 site (TGAG/CTCA) as either homodimers ofJun family proteins or heterodimers of Fos and Junfamily proteins, but not as homodimers of Fos familyproteins (Karin et al., 1997). Potential AP-1 bindingsites have been identified in the 50 flanking region ofIL-1b, IL-6, TNF-a, MIP1a, and MIP3a (Ray et al.,1989; Leitman et al., 1991; Hurme and Matikainen,1993; Harant et al., 2001; Fernandez et al., 2002). Inthe present work, we demonstrated that AP-1-DNAbinding activity increased in a dose and time-depen-dent manner in rhPEDF-treated neonatal astrocytes.Furthermore, rhPEDF treatment also resulted in atemporal increase in fra-1, fra-2, junB, and junDmRNA levels in neonatal astrocytes, whereas mRNAlevels of c-fos, c-jun, and fosB remained unchanged.Interestingly, rhPEDF-induced expression of fra-1and junB was almost completely inhibited by theadenoviral gene transfer of IkBaM. Functional bind-ing sites for NF-kB have been identified in the

Fig. 6. Increased phosphorylation of CREB in recombinanthuman pigment epithelium-derived factor (rhPEDF)-treated neona-tal astrocytes. Cultured astrocytes were treated with 5 nM rhPEDFfor the indicated times. Astrocyte lysates were analyzed by Westernblotting with (A) anti-phospho-CREB or anti-CREB, (B) anti-phos-pho-ERK1/2, anti-phospho-SAPK/JNK, anti-phospho-p38 antibodies,anti-ERK1/2, and b-actin.

Fig. 7. Effects of IkBa super-repressor protein and dominantnegative CREB on recombinant human pigment epithelium-derivedfactor (rhPEDF)-induced inflammatory-related genes. Astrocyteswere infected with recombinant adenoviruses expressing LacZ(Adeno-LacZ, multiplicity of infection [MOI] 15), IkBa super-repres-sor protein (Adeno-IkBaM, MOI 15), dominant negative CREB(Adeno-CREB133, MOI 15), or left uninfected. At 48 h after infec-tion, cells were exposed to 5 nM rhPEDF for 6 h. Total RNA wasextracted and reverse-transcribed, followed by PCR with specific pri-mers. Cyclophilin served as the unchanging control mRNA.

231PEDF INDUCES PRO-INFLAMMATORY GENES IN ASTROCYTES

promoter region of junB, but not fra-1. However, ourresults raise the possibility that NF-kB activation isinvolved in the regulation of fra-1 genes in astro-cytes. Further studies will be required to estimatethe functional significance of the induction of AP-1-DNA binding activity and AP-1-related genes byPEDF.

The cyclic AMP response element (CRE) has beenimplicated in the regulation of the expression of manygenes and cellular processes important in brain func-tion (Lonze and Ginty, 2002). CRE sites exist in thepromoter regions of several pro-inflammatory genes,such as IL-1, IL-6, and TNF-a (Krueger et al., 1991;Gray et al., 1993; Newell et al., 1994). Members ofCREB/ATF (activation of transcription factor) bind toCREs within promoter and enhancer sequences ofmany genes and are activated by phosphorylation onspecific serine residues. CREB is a 43-kDa nucleartranscription factor that was originally found to beactivated by cAMP-dependent protein kinase. Recentstudies demonstrated that phosphorylation of CREBis also mediated by Erk, p38 MAPK, calcium-calmo-dulin kinase (CaMK), and the Akt protein kinasepathway (Lonze and Ginty, 2002). A constitutive bind-ing of CREB to CRE consensus sequences in theabsence of a stimulus has been reported (Quinn andGranner, 1990), where phosphorylation of CREB

results in the enhancement of transcriptional activa-tion by the recruitment of additional coactivators(Chrivia et al., 1993; Quinn, 1993). Alternatively,phosphorylation of CREB might promote binding tothe CRE (Yamamoto et al., 1988; Nichols et al., 1992).In this report, we demonstrated that rhPEDF inducedthe phosphorylation of CREB in neonatal astrocytes.Furthermore, the overexpression of dominant nega-tive CREB inhibited the expression of TNF-a inducedby rhPEDF. Although both CRE and NF-kB consen-sus sequences exist in the promoter region of IL-1band IL-6, rhPEDF-induced mRNA levels of these cyto-kines were inhibited by overexpression of mutatedIkBa protein, but not dominant negative CREB.These observations suggest that the induction of IL-6and IL-1b is principally due to the NF-kB-dependentpathway, but not the CRE-dependent pathway, in neo-natal astrocytes. Further analysis will be required todetermine whether the function of other CREB/ATFfamily members and the interaction between NF-kBand CREB are involved in the upregulation of pro-inflammatory genes by PEDF.

The signal transduction pathway(s) through whichPEDF activate NF-kB, CREB, and AP-1 remainunclear. There are three major groups of MAP kinasein mammalian cells: Erk, p38 MAPK, and JNK. Sinceall three MAPK signaling pathways have been impli-cated in the activation of NF-kB, AP-1 and CREB(Frost et al., 1994; Whitmarsh et al., 1996; Schulze-Osthoff et al., 1997; Nakano et al., 1998; Lonze andGinty, 2002; Zhang et al., 2004), we sought to investi-gate whether rhPEDF influences MAPK signaling.However, we could not show any activation of MAPKby rhPEDF treatment in astrocytes. These resultssuggest that the activation of NF-kB, CREB, and AP-1 by rhPEDF is independent of the MAPKs signalingcascade in rat neonatal astrocytes. Further studieswill be needed to identify the crucial pathway(s) ofPEDF signaling.

In conclusion, we report that rhPEDF induces pro-inflammatory and immediate-early genes through theactivation of NF-kB or CREB in neonatal astrocytes.Although the precise mechanism by which PEDF acti-vates NF-kB, CREB and AP-1 remains unclear, theability to regulate these transcription factors wouldaccount for the induction of pro-inflammatory genesby rhPEDF. Taken together, these results demon-strate that PEDF is a multipotent factor, capable ofaffecting not only neurons, but also neonatal astro-cytes, and suggests that it may act as a neuro-immune modulator in the developmental brain. SincePEDF has both neurotrophic and antiangiogeniceffects, PEDF is currently being tested for the treat-ment of retinal disease, via gene therapy, as wellas cancer and brain ischemia (Mori et al., 2002;Mahtabifard et al., 2003; Miyazaki et al., 2003; Takitaet al., 2003; Wang et al., 2003). However, our presentresults raise the possibility that treatment withPEDF might cause an inflammatory state throughthe induction of pro-inflammatory genes in the neona-

Fig. 8. Effects of IkBa super-repressor protein and dominantnegative CREB on recombinant human pigment epithelium-derivedfactor (rhPEDF)-induced AP-1-related genes. Astrocytes wereinfected with recombinant adenoviruses expressing LacZ (Adeno-LacZ, multiplicity of infection [MOI] 15), IkBa super-repressor pro-tein (Adeno-IkBaM, MOI 15), dominant negative CREB (Adeno-CREB133, MOI 15), or left uninfected. At 48 h after infection, cellswere exposed to 5 nM rhPEDF for 3 h. Total RNA was extractedand reverse-transcribed, followed by PCR with specific primers.Cyclophilin served as the unchanging control mRNA.

232 YABE ET AL.

tal brain. Although further work is required to deline-ate the precise role of PEDF, understanding the effectof PEDF on glial cells would help to evaluate the useof PEDF as a potential therapeutic tool for neurode-generative disorders of the CNS.

ACKNOWLEDGMENTS

The authors thank Dr. S. Patricia Becerra (NEI,NIH) for the gift of recombinant human PEDF.

REFERENCES

Angel P, Karin M. 1991. The role of Jun, Fos and the AP-1 complexin cell-proliferation and transformation. Biochim Biophys Acta1072:129–157.

Araki T, Taniwaki T, Becerra SP, Chader GJ, Schwartz JP. 1998.Pigment epithelium-derived factor (PEDF) differentially protectsimmature but not mature cerebellar granule cells against apopto-tic cell death. J Neurosci Res 53:7–15.

Becerra SP, Palmer I, Kumar A, Steele F, Shiloach J, Notario V,Chader GJ. 1993. Overexpression of fetal human pigment epithe-lium-derived factor in Escherichia coli. A functionally active neu-rotrophic factor. J Biol Chem 268:23148–23156.

Bilak MM, Corse AM, Bilak SR, Lehar M, Tombran-Tink J, KunclRW. 1999. Pigment epithelium-derived factor (PEDF) protectsmotor neurons from chronic glutamate-mediated neurodegenera-tion. J Neuropathol Exp Neurol 58:719–728.

Cao W, Tombran-Tink J, Chen W, Mrazek D, Elias R, McGinnis JF.1999. Pigment epithelium-derived factor protects cultured retinalneurons against hydrogen peroxide-induced cell death. J NeurosciRes 57:789–800.

Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy MR, Good-man RH. 1993. Phosphorylated CREB binds specifically to thenuclear protein CBP. Nature 365:855–859.

Cogswell JP, Godlevski MM, Wisely GB, Clay WC, Leesnitzer LM,Ways JP, Gray JG. 1994. NF-kappa B regulates IL-1 beta tran-scription through a consensus NF-kappa B binding site and anonconsensus CRE-like site. J Immunol 153:712–723.

Collart MA, Baeuerle P, Vassalli P. 1990. Regulation of tumor necro-sis factor alpha transcription in macrophages: involvement of fourkappa B-like motifs and of constitutive and inducible forms ofNF-kappa B. Mol Cell Biol 10:1498–1506.

Curran T, Franza BR Jr. 1988. Fos and Jun: the AP-1 connection.Cell 55:395–397.

DeCoster MA, Schabelman E, Tombran-Tink J, Bazan NG. 1999.Neuroprotection by pigment epithelial-derived factor against glu-tamate toxicity in developing primary hippocampal neurons. JNeurosci Res 56:604–610.

Dong Y, Benveniste EN. 2001. Immune function of astrocytes. Glia36:180–190.

Fernandez N, Renedo M, Garcia-Rodriguez C, Sanchez Crespo M.2002. Activation of monocytic cells through Fc gamma receptorsinduces the expression of macrophage-inflammatory protein (MIP)-1 alpha, MIP-1 beta, and RANTES. J Immunol 169:3321–3328.

Frost JA, Geppert TD, Cobb MH, Feramisco JR. 1994. A require-ment for extracellular signal-regulated kinase (ERK) function inthe activation of AP-1 by Ha-Ras, phorbol 12-myristate 13-acet-ate, and serum. Proc Natl Acad Sci USA 91:3844–3848.

Gray JG, Chandra G, Clay WC, Stinnett SW, Haneline SA, LorenzJJ, Patel IR, Wisely GB, Furdon PJ, Taylor JD, Cost TA. 1993. ACRE/ATF-like site in the upstream regulatory sequence of thehuman interleukin 1 beta gene is necessary for induction in U937and THP-1 monocytic cell lines. Mol Cell Biol 13:6678–6689.

Grove M, Plumb M. 1993. C/EBP, NF-kappa B, and c-Ets familymembers and transcriptional regulation of the cell-specific andinducible macrophage inflammatory protein 1 alpha immediate-early gene. Mol Cell Biol 13:5276–5289.

Harant H, Eldershaw SA, Lindley IJ. 2001. Human macrophageinflammatory protein-3alpha/CCL20/LARC/Exodus/SCYA20 istranscriptionally upregulated by tumor necrosis factor-alpha via anon-standard NF-kappaB site. FEBS Lett 509:439–445.

Houenou LJ, D’Costa AP, Li L, Turgeon VL, Enyadike C, Alberdi E,Becerra SP. 1999. Pigment epithelium-derived factor promotes the

survival and differentiation of developing spinal motor neurons. JComp Neurol 412:506–514.

Hurme M, Matikainen S. 1993. Okadaic acid, a phosphatase inhibitor,enhances the phorbol ester-induced interleukin-1 beta expression viaan AP-1-mediated mechanism. Scand J Immunol 38:570–574.

Karin M, Liu Z, Zandi E. 1997. AP-1 function and regulation. CurrOpin Cell Biol 9:240–246.

Krueger J, Ray A, Tamm I, Sehgal PB. 1991. Expression and func-tion of interleukin-6 in epithelial cells. J Cell Biochem 45:327–334.

Le Bail O, Schmidt-Ullrich R, Israel A. 1993. Promoter analysis ofthe gene encoding the I kappa B-alpha/MAD3 inhibitor of NF-kappa B: positive regulation by members of the rel/NF-kappa Bfamily. EMBO J 12:5043–5049.

Leitman DC, Ribeiro RC, Mackow ER, Baxter JD, West BL. 1991.Identification of a tumor necrosis factor-responsive element inthe tumor necrosis factor alpha gene. J Biol Chem 266:9343–9346.

Lonze BE, Ginty DD. 2002. Function and regulation of CREBfamily transcription factors in the nervous system. Neuron 35:605–623.

Mahtabifard A, Merritt RE, Yamada RE, Crystal RG, Korst RJ.2003. In vivo gene transfer of pigment epithelium-derived factorinhibits tumor growth in syngeneic murine models of thoracicmalignancies. J Thorac Cardiovasc Surg 126:28–38.

Miyazaki M, Ikeda Y, Yonemitsu Y, Goto Y, Sakamoto T, Tabata T,Ueda Y, Hasegawa M, Tobimatsu S, Ishibashi T, Sueishi K. 2003.Simian lentiviral vector-mediated retinal gene transfer of pigmentepithelium-derived factor protects retinal degeneration and elec-trical defect in Royal College of Surgeons rats. Gene Ther10:1503–1511.

Mori K, Gehlbach P, Yamamoto S, Duh E, Zack DJ, Li Q, Berns KI,Raisler BJ, Hauswirth WW, Campochiaro PA. 2002. AAV-mediated gene transfer of pigment epithelium-derived factor inhi-bits choroidal neovascularization. Invest Ophthalmol Vis Sci 43:1994–2000.

Mucke L, Eddleston M. 1993. Astrocytes in infectious and immune-mediated diseases of the central nervous system. FASEB J7:1226–1232.

Nakagawa T, Schwartz JP. 2004. Gene expression patterns in invivo normal adult astrocytes compared with cultured neonataland normal adult astrocytes. Neurochem Int 45:203–242.

Nakano H, Shindo M, Sakon S, Nishinaka S, Mihara M, Yagita H,Okumura K. 1998. Differential regulation of IkappaB kinasealpha and beta by two upstream kinases, NF-kappaB-inducingkinase and mitogen-activated protein kinase/ERK kinase kinase-1. Proc Natl Acad Sci USA 95:3537–3542.

Newell CL, Deisseroth AB, Lopez-Berestein G. 1994. Interaction ofnuclear proteins with an AP-1/CRE-like promoter sequence in thehuman TNF-alpha gene. J Leukoc Biol 56:27–35.

Nichols M, Weih F, Schmid W, DeVack C, Kowenz-Leutz E, LuckowB, Boshart M, Schutz G. 1992. Phosphorylation of CREB affectsits binding to high and low affinity sites: implications for cAMPinduced gene transcription. EMBO J 11:3337–3346.

Quinn PG, Granner DK. 1990. Cyclic AMP-dependent proteinkinase regulates transcription of the phosphoenolpyruvate carbox-ykinase gene but not binding of nuclear factors to the cyclic AMPregulatory element. Mol Cell Biol 10:3357–3364.

Quinn PG. 1993. Distinct activation domains within cAMP responseelement-binding protein (CREB) mediate basal and cAMP-stimu-lated transcription. J Biol Chem 268:16999–17009.

Ray A, Sassone-Corsi P, Sehgal PB. 1989. A multiple cytokine- andsecond messenger-responsive element in the enhancer of thehuman interleukin-6 gene: similarities with c-fos gene regulation.Mol Cell Biol 9:5537–5547.

Schreiber E, Matthias P, Muller MM, Schaffner W. 1989. Rapiddetection of octamer binding proteins with ‘‘mini-extracts,’’ pre-pared from a small number of cells. Nucleic Acids Res 17:6419.

Schulze-Osthoff K, Ferrari D, Riehemann K, Wesselborg S. 1997.Regulation of NF-kappa B activation by MAP kinase cascades.Immunobiology 198:35–49.

Schwartz JP, Wilson DJ. 1992. Preparation and characterization oftype 1 astrocytes cultured from adult rat cortex, cerebellum, andstriatum. Glia 5:75–80.

Shimizu H, Mitomo K, Watanabe T, Okamoto S, Yamamoto K. 1990.Involvement of a NF-kappa B-like transcription factor in the acti-vation of the interleukin-6 gene by inflammatory lymphokines.Mol Cell Biol 10:561–568.

Sugita S, Kohno T, Yamamoto K, Imaizumi Y, Nakajima H, Ishi-maru T, Matsuyama T. 2002. Induction of macrophage-inflamma-tory protein-3alpha gene expression by TNF-dependent NF-kappaB activation. J Immunol 168:5621–5628.

233PEDF INDUCES PRO-INFLAMMATORY GENES IN ASTROCYTES

Sugita Y, Becerra SP, Chader GJ, Schwartz JP. 1997. Pigmentepithelium-derived factor (PEDF) has direct effects on the meta-bolism and proliferation of microglia and indirect effects on astro-cytes. J Neurosci Res 49:710–718.

Takita H, Yoneya S, Gehlbach PL, Duh EJ, Wei LL, Mori K. 2003.Retinal neuroprotection against ischemic injury mediated byintraocular gene transfer of pigment epithelium-derived factor.Invest Ophthalmol Vis Sci 44:4497–4504.

Taniwaki T, Becerra SP, Chader GJ, Schwartz JP. 1995. Pigmentepithelium-derived factor is a survival factor for cerebellar gran-ule cells in culture. J Neurochem 64:2509–2517.

Taniwaki T, Hirashima N, Becerra SP, Chader GJ, EtcheberrigarayR, Schwartz JP. 1997. Pigment epithelium-derived factor protectscultured cerebellar granule cells against glutamate-induced neu-rotoxicity. J Neurochem 68:26–32.

Tombran-Tink J, Chader GG, Johnson LV. 1991. PEDF: a pigmentepithelium-derived factor with potent neuronal differentiativeactivity. Exp Eye Res 53:411–414.

Tombran-Tink J, Mazuruk K, Rodriguez IR, Chung D, Linker T,Englander E, Chader GJ. 1996. Organization, evolutionary conser-vation, expression and unusual Alu density of the human gene forpigment epithelium-derived factor, a unique neurotrophic serpin.Mol Vis 2:11.

Voorhees PM, Dees EC, O’Neil B, Orlowski RZ. 2003. The protea-some as a target for cancer therapy. Clin Cancer Res 15:6316–6325.

Wang L, Schmitz V, Perez-Mediavilla A, Izal I, Prieto J, Qian C.2003. Suppression of angiogenesis and tumor growth by adeno-

viral-mediated gene transfer of pigment epithelium-derived factor.Mol Ther 8:72–79.

Whitmarsh AJ, Davis RJ. 1996. Transcription factor AP-1 regulationby mitogen-activated protein kinase signal transduction path-ways. J Mol Med 74:589–607.

Wyss-Coray T, Loike JD, Brionne TC, Lu E, Anankov R, Yan F,Silverstein SC, Husemann J. 2003. Adult mouse astrocytesdegrade amyloid-beta in vitro and in situ. Nat Med 9:453–457.

Yabe T, Wilson D, Schwartz JP. 2001. NFkappaB activation isrequired for the neuroprotective effects of pigment epithelium-derived factor (PEDF) on cerebellar granule neurons. J Biol Chem276:43313–43319.

Yabe T, Herbert JT, Takanohashi A, Schwartz JP. 2004. Treatmentof cerebellar granule cell neurons with the neurotrophic factorpigment epithelium-derived factor in vitro enhances expression ofother neurotrophic factors as well as cytokines and chemokines. JNeurosci Res 77:642–652.

Yamamoto KK, Gonzalez GA, Biggs WH III, Montminy MR. 1988.Phosphorylation-induced binding and transcriptional efficacy ofnuclear factor CREB. Nature 334:494–498.

Zhang B, Liu S, Perpetua MD, Walker WH, Harbrecht BG. 2004.Cytokines increase CRE binding but decrease CRE-mediatedreporter activity in rat hepatocytes by increasing c-Jun. Hepatol-ogy 39:1343–1352.

Zhao B, Schwartz JP. 1998. Involvement of cytokines in normalCNS development and neurological diseases: recent progress andperspectives. J Neurosci Res 52:7–16.

234 YABE ET AL.